Title: Screening of phage-displayed random peptide library for binding peptide of NF-κB(p65)
Abstract: Objective:To screen the p65 subunit of NF-κB binding peptides by phage-display technique.Methods:The p65 subunit of NF-κB was targeted for screening of a random bacteriophage 12-mers peptide library,and the positive clones were identified with ELISA.Results: After three rounds of screening,6 of 15 phage clones were identified as positive by sandwish ELISA.All of these 6 clones had same DNA sequences: CGTCAGCCTCGGCGAATAAGTATCCGAAGGAGTAAA,and their corresponding peptide sequences were FTPSDTYSPRLT.Such positive clone could bind well to p65 subunit of NF-κB,and competitive phage ELISA showed the inhibition with dose-dependent relationship.Conclusion:The clone from phage-display peptide library could bind to p65 subunit of NF-κB specifically,and its sequence is recognized.
Publication Year: 2005
Publication Date: 2005-01-01
Language: en
Type: article
Access and Citation
AI Researcher Chatbot
Get quick answers to your questions about the article from our AI researcher chatbot