Publication Information

{'id': 'https://openalex.org/W1970947265', 'doi': 'https://doi.org/10.4103/0256-4947.62826', 'title': 'Analysis of gene mutations involved in chloroquine resistance in<i>Plasmodium falciparum</i>parasites isolated from patients in the southwest of Saudi Arabia', 'display_name': 'Analysis of gene mutations involved in chloroquine resistance in<i>Plasmodium falciparum</i>parasites isolated from patients in the southwest of Saudi Arabia', 'publication_year': 2010, 'publication_date': '2010-05-01', 'ids': {'openalex': 'https://openalex.org/W1970947265', 'doi': 'https://doi.org/10.4103/0256-4947.62826', 'mag': '1970947265', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/20427933', 'pmcid': 'https://www.ncbi.nlm.nih.gov/pmc/articles/2886867'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.4103/0256-4947.62826', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S61805644', 'display_name': 'Annals of Saudi Medicine', 'issn_l': '0256-4947', 'issn': ['0256-4947', '0975-4466'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310319312', 'host_organization_name': 'King Faisal Specialist Hospital and Research Centre', 'host_organization_lineage': ['https://openalex.org/P4310319312'], 'host_organization_lineage_names': ['King Faisal Specialist Hospital and Research Centre'], 'type': 'journal'}, 'license': 'cc-by-nc-nd', 'license_id': 'https://openalex.org/licenses/cc-by-nc-nd', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'diamond', 'oa_url': 'https://doi.org/10.4103/0256-4947.62826', 'any_repository_has_fulltext': True}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5081125169', 'display_name': 'Saad M. Bin Dajem', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I2800965796', 'display_name': 'King Faisal Specialist Hospital & Research Centre', 'ror': 'https://ror.org/05n0wgt02', 'country_code': 'SA', 'type': 'healthcare', 'lineage': ['https://openalex.org/I2800965796']}], 'countries': ['SA'], 'is_corresponding': False, 'raw_author_name': 'Saad M. Bin Dajem', 'raw_affiliation_strings': ['Biological and Medical Research, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabia.'], 'affiliations': [{'raw_affiliation_string': 'Biological and Medical Research, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabia.', 'institution_ids': ['https://openalex.org/I2800965796']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5076853480', 'display_name': 'Ahmed A. Al‐Qahtani', 'orcid': 'https://orcid.org/0000-0003-4584-5739'}, 'institutions': [{'id': 'https://openalex.org/I2800965796', 'display_name': 'King Faisal Specialist Hospital & Research Centre', 'ror': 'https://ror.org/05n0wgt02', 'country_code': 'SA', 'type': 'healthcare', 'lineage': ['https://openalex.org/I2800965796']}], 'countries': ['SA'], 'is_corresponding': False, 'raw_author_name': 'Ahmed Al-Qahtani', 'raw_affiliation_strings': ['From the Biological and Medical Research, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabia'], 'affiliations': [{'raw_affiliation_string': 'From the Biological and Medical Research, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabia', 'institution_ids': ['https://openalex.org/I2800965796']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 0, 'currency': 'USD', 'value_usd': 0, 'provenance': 'doaj'}, 'apc_paid': None, 'fwci': 2.151, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 20, 'citation_normalized_percentile': {'value': 0.878734, 'is_in_top_1_percent': False, 'is_in_top_10_percent': False}, 'cited_by_percentile_year': {'min': 89, 'max': 90}, 'biblio': {'volume': '30', 'issue': '3', 'first_page': '187', 'last_page': '192'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10091', 'display_name': 'Malaria Research and Control', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2739', 'display_name': 'Public Health, Environmental and Occupational Health'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10091', 'display_name': 'Malaria Research and Control', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2739', 'display_name': 'Public Health, Environmental and Occupational Health'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T11465', 'display_name': 'Drug-Induced Hepatotoxicity and Protection', 'score': 0.9837, 'subfield': {'id': 'https://openalex.org/subfields/3004', 'display_name': 'Pharmacology'}, 'field': {'id': 'https://openalex.org/fields/30', 'display_name': 'Pharmacology, Toxicology and Pharmaceutics'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10166', 'display_name': 'Mosquito-borne diseases and control', 'score': 0.9678, 'subfield': {'id': 'https://openalex.org/subfields/2739', 'display_name': 'Public Health, Environmental and Occupational Health'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/plasmodium', 'display_name': 'Plasmodium (life cycle)', 'score': 0.43029067}], 'concepts': [{'id': 'https://openalex.org/C2778371730', 'wikidata': 'https://www.wikidata.org/wiki/Q311383', 'display_name': 'Plasmodium falciparum', 'level': 3, 'score': 0.9133096}, {'id': 'https://openalex.org/C2777425658', 'wikidata': 'https://www.wikidata.org/wiki/Q422438', 'display_name': 'Chloroquine', 'level': 3, 'score': 0.8872508}, {'id': 'https://openalex.org/C159047783', 'wikidata': 'https://www.wikidata.org/wiki/Q7215', 'display_name': 'Virology', 'level': 1, 'score': 0.57217914}, {'id': 'https://openalex.org/C2778048844', 'wikidata': 'https://www.wikidata.org/wiki/Q12156', 'display_name': 'Malaria', 'level': 2, 'score': 0.56194764}, {'id': 'https://openalex.org/C114851261', 'wikidata': 'https://www.wikidata.org/wiki/Q12147416', 'display_name': 'Drug resistance', 'level': 2, 'score': 0.54671735}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.5418559}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.50640047}, {'id': 'https://openalex.org/C2778675580', 'wikidata': 'https://www.wikidata.org/wiki/Q614956', 'display_name': 'Plasmodium (life cycle)', 'level': 3, 'score': 0.43029067}, {'id': 'https://openalex.org/C501734568', 'wikidata': 'https://www.wikidata.org/wiki/Q42918', 'display_name': 'Mutation', 'level': 3, 'score': 0.41806245}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.36922312}, {'id': 'https://openalex.org/C71928629', 'wikidata': 'https://www.wikidata.org/wiki/Q804206', 'display_name': 'Parasite hosting', 'level': 2, 'score': 0.36525548}, {'id': 'https://openalex.org/C203014093', 'wikidata': 'https://www.wikidata.org/wiki/Q101929', 'display_name': 'Immunology', 'level': 1, 'score': 0.22574133}, {'id': 'https://openalex.org/C136764020', 'wikidata': 'https://www.wikidata.org/wiki/Q466', 'display_name': 'World Wide Web', 'level': 1, 'score': 0.0}, {'id': 'https://openalex.org/C41008148', 'wikidata': 'https://www.wikidata.org/wiki/Q21198', 'display_name': 'Computer science', 'level': 0, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D000962', 'descriptor_name': 'Antimalarials', 'qualifier_ui': 'Q000627', 'qualifier_name': 'therapeutic use', 'is_major_topic': True}, {'descriptor_ui': 'D002738', 'descriptor_name': 'Chloroquine', 'qualifier_ui': 'Q000627', 'qualifier_name': 'therapeutic use', 'is_major_topic': True}, {'descriptor_ui': 'D018432', 'descriptor_name': 'Drug Resistance, Multiple', 'qualifier_ui': 'Q000187', 'qualifier_name': 'drug effects', 'is_major_topic': True}, {'descriptor_ui': 'D016778', 'descriptor_name': 'Malaria, Falciparum', 'qualifier_ui': 'Q000188', 'qualifier_name': 'drug therapy', 'is_major_topic': True}, {'descriptor_ui': 'D009154', 'descriptor_name': 'Mutation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D010963', 'descriptor_name': 'Plasmodium falciparum', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000962', 'descriptor_name': 'Antimalarials', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000962', 'descriptor_name': 'Antimalarials', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D002738', 'descriptor_name': 'Chloroquine', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002738', 'descriptor_name': 'Chloroquine', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D018432', 'descriptor_name': 'Drug Resistance, Multiple', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005784', 'descriptor_name': 'Gene Amplification', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014644', 'descriptor_name': 'Genetic Variation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016778', 'descriptor_name': 'Malaria, Falciparum', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016778', 'descriptor_name': 'Malaria, Falciparum', 'qualifier_ui': 'Q000453', 'qualifier_name': 'epidemiology', 'is_major_topic': False}, {'descriptor_ui': 'D026901', 'descriptor_name': 'Membrane Transport Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D026901', 'descriptor_name': 'Membrane Transport Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D027425', 'descriptor_name': 'Multidrug Resistance-Associated Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D027425', 'descriptor_name': 'Multidrug Resistance-Associated Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D010963', 'descriptor_name': 'Plasmodium falciparum', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010963', 'descriptor_name': 'Plasmodium falciparum', 'qualifier_ui': 'Q000187', 'qualifier_name': 'drug effects', 'is_major_topic': False}, {'descriptor_ui': 'D010963', 'descriptor_name': 'Plasmodium falciparum', 'qualifier_ui': 'Q000302', 'qualifier_name': 'isolation & purification', 'is_major_topic': False}, {'descriptor_ui': 'D015800', 'descriptor_name': 'Protozoan Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015800', 'descriptor_name': 'Protozoan Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D012529', 'descriptor_name': 'Saudi Arabia', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012529', 'descriptor_name': 'Saudi Arabia', 'qualifier_ui': 'Q000453', 'qualifier_name': 'epidemiology', 'is_major_topic': False}], 'locations_count': 4, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.4103/0256-4947.62826', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S61805644', 'display_name': 'Annals of Saudi Medicine', 'issn_l': '0256-4947', 'issn': ['0256-4947', '0975-4466'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310319312', 'host_organization_name': 'King Faisal Specialist Hospital and Research Centre', 'host_organization_lineage': ['https://openalex.org/P4310319312'], 'host_organization_lineage_names': ['King Faisal Specialist Hospital and Research Centre'], 'type': 'journal'}, 'license': 'cc-by-nc-nd', 'license_id': 'https://openalex.org/licenses/cc-by-nc-nd', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': True, 'landing_page_url': 'https://europepmc.org/articles/pmc2886867', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306400806', 'display_name': 'Europe PMC (PubMed Central)', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1303153112', 'host_organization_name': 'European Bioinformatics Institute', 'host_organization_lineage': ['https://openalex.org/I1303153112'], 'host_organization_lineage_names': ['European Bioinformatics Institute'], 'type': 'repository'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': True, 'landing_page_url': 'https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2886867', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S2764455111', 'display_name': 'PubMed Central', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/20427933', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.4103/0256-4947.62826', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S61805644', 'display_name': 'Annals of Saudi Medicine', 'issn_l': '0256-4947', 'issn': ['0256-4947', '0975-4466'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310319312', 'host_organization_name': 'King Faisal Specialist Hospital and Research Centre', 'host_organization_lineage': ['https://openalex.org/P4310319312'], 'host_organization_lineage_names': ['King Faisal Specialist Hospital and Research Centre'], 'type': 'journal'}, 'license': 'cc-by-nc-nd', 'license_id': 'https://openalex.org/licenses/cc-by-nc-nd', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'id': 'https://metadata.un.org/sdg/3', 'display_name': 'Good health and well-being', 'score': 0.84}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 42, 'referenced_works': ['https://openalex.org/W1582828758', 'https://openalex.org/W1835840082', 'https://openalex.org/W1966069891', 'https://openalex.org/W1979124585', 'https://openalex.org/W1986794325', 'https://openalex.org/W1990102080', 'https://openalex.org/W1992733039', 'https://openalex.org/W1994981343', 'https://openalex.org/W1999751517', 'https://openalex.org/W2006760300', 'https://openalex.org/W2020897015', 'https://openalex.org/W2025943007', 'https://openalex.org/W2027284203', 'https://openalex.org/W2031180216', 'https://openalex.org/W2033314986', 'https://openalex.org/W2035877468', 'https://openalex.org/W2062575853', 'https://openalex.org/W2062820605', 'https://openalex.org/W2065887258', 'https://openalex.org/W2083522771', 'https://openalex.org/W2089006774', 'https://openalex.org/W2089486160', 'https://openalex.org/W2090523205', 'https://openalex.org/W2095034330', 'https://openalex.org/W2098413127', 'https://openalex.org/W2105761183', 'https://openalex.org/W2107678864', 'https://openalex.org/W2116928607', 'https://openalex.org/W2124883243', 'https://openalex.org/W2129965217', 'https://openalex.org/W2132923209', 'https://openalex.org/W2137189778', 'https://openalex.org/W2141153530', 'https://openalex.org/W2152072567', 'https://openalex.org/W2157826103', 'https://openalex.org/W2158788393', 'https://openalex.org/W2165454717', 'https://openalex.org/W2167153421', 'https://openalex.org/W2217354070', 'https://openalex.org/W2333050857', 'https://openalex.org/W2401334464', 'https://openalex.org/W2417823775'], 'related_works': ['https://openalex.org/W47752255', 'https://openalex.org/W2465887096', 'https://openalex.org/W2414493761', 'https://openalex.org/W2401334429', 'https://openalex.org/W2166046803', 'https://openalex.org/W2144038468', 'https://openalex.org/W2113822524', 'https://openalex.org/W2077097901', 'https://openalex.org/W1996808398', 'https://openalex.org/W1141749753'], 'abstract_inverted_index': {'original': [0, 3963], 'articleAnalysis': [1], 'of': [2, 19, 38, 85, 90, 102, 113, 186, 202, 224, 227, 244, 268, 279, 285, 302, 319, 380, 395, 402, 454, 459, 492, 500, 503, 526, 532, 537, 544, 561, 598, 630, 637, 645, 696, 714, 720, 736, 784, 801, 807, 837, 846, 857, 876, 890, 991, 1024, 1080, 1090, 1103, 1117, 1128, 1180, 1221, 1279, 1307, 1321, 1335, 1338, 1349, 1353, 1368, 1373, 1388, 1402, 1407, 1412, 1427, 1454, 1482, 1494, 1514, 1563, 1594, 1618, 1663, 1668, 1673, 1688, 1715, 1723, 1738, 1778, 1798, 1821, 1829, 1837, 1859, 1871, 1887, 1899, 1902, 1993, 2002, 2039, 2066, 2080, 2102, 2123, 2136, 2150, 2157, 2174, 2183, 2210, 2217, 2312, 2355, 2376, 2384, 2391, 2419, 2463, 2473, 2480, 2483, 2558, 2584, 2612, 2622, 2636, 2655, 2702, 2728, 2734, 2768, 2842, 2955, 2985, 3019, 3027, 3062, 3099, 3144, 3213, 3221, 3241, 3376, 3439, 3473, 3479, 3511, 3550, 3618, 3702, 3707, 3802, 3844, 3853, 3917, 3934, 3945], 'gene': [3, 308, 708, 755, 771, 816, 1832, 1985, 2984, 3220, 3244, 3282, 3626, 3706, 3735, 3814, 3819], 'mutations': [4, 122, 767, 811, 861, 1825, 1846, 1920, 2153, 2301, 2930, 3405, 3476, 3513, 3808], 'involved': [5, 2988, 2995], 'in': [6, 9, 16, 123, 220, 283, 305, 309, 327, 365, 389, 400, 405, 414, 443, 450, 479, 506, 581, 620, 666, 685, 741, 746, 761, 768, 793, 798, 813, 825, 862, 883, 898, 913, 945, 957, 1043, 1069, 1111, 1148, 1230, 1381, 1491, 1541, 1801, 1808, 1826, 1853, 1865, 1907, 1924, 1971, 1979, 1997, 2019, 2047, 2071, 2075, 2100, 2121, 2144, 2159, 2227, 2230, 2234, 2244, 2257, 2281, 2303, 2314, 2353, 2358, 2372, 2398, 2402, 2407, 2417, 2434, 2455, 2460, 2502, 2513, 2519, 2530, 2586, 2614, 2618, 2639, 2643, 2676, 2709, 2800, 2827, 2850, 2884, 2898, 2931, 2958, 2979, 2989, 2996, 3024, 3056, 3068, 3071, 3217, 3227, 3315, 3333, 3346, 3369, 3379, 3406, 3410, 3442, 3445, 3482, 3517, 3553, 3560, 3629, 3633, 3665, 3733, 3736, 3772, 3799, 3809, 3847, 3850, 3857, 3958], 'chloroquine': [7, 103, 562, 567, 599, 655, 1343, 1380, 1880, 1894, 2085, 2703, 2769, 2847, 2899, 3179, 3225, 3275, 3313, 3345, 3400, 3440, 3480, 3515, 3562, 3587, 3622, 3663, 3711, 3797, 3811], 'resistance': [8, 104, 600, 762, 1344, 1378, 1807, 1878, 1910, 1923, 2059, 2313, 2844, 2957, 2991, 3070, 3147, 3188, 3276, 3281, 3314, 3366, 3401, 3441, 3481, 3516, 3588, 3623, 3798, 3812, 3818], 'Plasmodium': [10, 106, 348, 2823, 2933, 2986, 3028, 3063, 3100, 3184, 3222, 3316, 3411, 3443, 3483, 3518, 3554, 3585, 3620, 3708, 3738, 3803, 3848], 'falciparum': [11, 107, 363, 466, 651, 704, 753, 869, 1383, 1803, 1904, 2161, 2205, 2317, 2707, 2824, 2887, 2934, 2987, 3029, 3064, 3101, 3126, 3185, 3223, 3336, 3378, 3412, 3444, 3484, 3519, 3555, 3586, 3621, 3631, 3709, 3739, 3804, 3849], 'parasites': [12, 341, 570, 722, 870, 1804], 'isolated': [13, 871, 2269], 'from': [14, 109, 148, 698, 803, 872, 928, 982, 1093, 1385, 1415, 1444, 1469, 1676, 1705, 1762, 1855, 2092, 2112, 2166, 2188, 2200, 2207, 2241, 2252, 2270, 2343, 2380, 2422, 2936, 2993, 3030, 3104, 3414, 3486, 3524, 3896], 'patients': [15, 954], 'the': [17, 34, 50, 83, 88, 99, 110, 118, 124, 149, 167, 187, 191, 200, 203, 207, 225, 228, 242, 245, 261, 271, 286, 294, 300, 303, 306, 310, 317, 339, 344, 378, 387, 396, 420, 444, 451, 455, 460, 471, 507, 524, 527, 530, 535, 555, 592, 612, 623, 628, 646, 657, 661, 686, 699, 716, 718, 725, 732, 769, 782, 789, 808, 814, 835, 842, 847, 855, 873, 895, 951, 965, 970, 983, 989, 1088, 1106, 1129, 1139, 1153, 1171, 1177, 1198, 1209, 1224, 1280, 1284, 1294, 1305, 1322, 1333, 1336, 1350, 1357, 1361, 1408, 1413, 1424, 1455, 1480, 1485, 1495, 1499, 1512, 1528, 1538, 1574, 1592, 1595, 1600, 1616, 1619, 1629, 1643, 1649, 1669, 1674, 1685, 1716, 1724, 1747, 1776, 1784, 1796, 1819, 1830, 1838, 1856, 1860, 1866, 1869, 1897, 1900, 1944, 1983, 1991, 1994, 2011, 2027, 2040, 2067, 2078, 2103, 2114, 2124, 2134, 2137, 2155, 2172, 2175, 2184, 2201, 2211, 2215, 2218, 2261, 2266, 2274, 2278, 2288, 2310, 2322, 2335, 2356, 2359, 2364, 2385, 2389, 2392, 2420, 2447, 2456, 2474, 2484, 2587, 2619, 2672, 2731, 2760, 2766, 2801, 2885, 2937, 2980, 3057, 3214, 3218, 3242, 3274, 3334, 3370, 3584, 3619, 3699, 3703, 3810, 3918, 3943, 3946, 3962], 'southwest': [18, 452], 'Saudi': [20, 44, 63, 114, 328, 429, 480, 512, 610, 624, 641, 671, 877, 978, 1389, 1809, 2282, 2590, 2594, 2623, 2626, 2644, 2647, 2678, 2681, 2711, 2853, 3935], 'Arabia': [21, 45, 64, 115, 430, 481, 513, 642, 2283, 2854], 'Saad': [22, 29], 'M.': [23, 30, 2821, 3301], 'Bin': [24, 31], 'Dajem': [25, 32], 'and': [26, 46, 52, 59, 120, 126, 146, 164, 171, 180, 352, 386, 391, 409, 446, 496, 509, 514, 521, 548, 596, 639, 677, 709, 751, 859, 864, 900, 925, 948, 964, 1011, 1016, 1036, 1060, 1082, 1095, 1105, 1119, 1152, 1185, 1208, 1223, 1304, 1370, 1375, 1435, 1511, 1584, 1608, 1657, 1696, 1732, 1741, 1771, 1780, 1814, 1833, 1849, 1926, 1938, 1947, 1975, 2154, 2168, 2232, 2273, 2291, 2332, 2367, 2374, 2405, 2443, 2494, 2510, 2730, 2759, 2848, 2857, 2893, 2952, 3021, 3146, 3148, 3182, 3279, 3338, 3341, 3373, 3403, 3408, 3477, 3557, 3592, 3661, 3712, 3764, 3816, 3902, 3920, 3924, 3956], 'Ahmed': [27, 47, 3839], 'Al-Qahtani': [28, 48], 'From': [33, 49], 'Biology': [35], 'Department,': [36], 'College': [37], 'Science,': [39], 'King': [40, 55, 974, 1181, 3897], 'Khalid': [41, 975], 'University,': [42, 976], 'Abha,': [43, 977], 'Biological': [51], 'Medical': [53], 'Research,': [54], 'Faisal': [56, 1182], 'Specialist': [57, 1183], 'Hospital': [58, 1184, 2617], 'Research': [60, 1178, 1186], 'Centre,': [61], 'Riyadh,': [62, 2677], 'Published': [65], 'Online:3': [66], 'Jun': [67], '2010https://doi.org/10.4103/0256-4947.62826SectionsPDF': [68], 'ToolsAdd': [69], 'to': [70, 97, 316, 343, 357, 372, 377, 419, 573, 585, 614, 654, 670, 727, 763, 775, 786, 819, 823, 834, 839, 950, 988, 1033, 1056, 1138, 1197, 1379, 1843, 1879, 1893, 1909, 1911, 1918, 1922, 1968, 1976, 2017, 2060, 2194, 2224, 2254, 2287, 2295, 2308, 2329, 2431, 2453, 2770, 3245, 3344, 3766], 'favoritesDownload': [71], 'citationTrack': [72], 'citations': [73], 'ShareShare': [74], 'onFacebookTwitterLinked': [75], 'InRedditEmail': [76], 'AboutAbstractBACKGROUND': [77], 'AND': [78, 130, 879], 'OBJECTIVES:': [79], 'Chloroquine': [80, 1862], 'has': [81, 298, 602, 723, 1895, 2034, 2131], 'been': [82, 603, 739, 759, 773, 1551, 1560, 1955, 2035, 2239, 2306], 'drug': [84, 382, 531, 1806, 1870, 2515, 2521, 2798, 2843, 2956, 3022, 3287], 'choice': [86, 533, 1872], 'for': [87, 92, 177, 190, 322, 436, 474, 534, 606, 702, 1040, 1087, 1227, 1420, 1553, 1642, 1681, 1746, 1873, 1943, 2030, 2334, 2490, 2498, 2846, 2895, 3124, 3150, 3696, 3698, 3900, 3913, 3927], 'treatment': [89, 536, 2086, 2508, 2522, 3771], 'malaria': [91, 326, 359, 403, 412, 437, 476, 539, 569, 616, 729, 802, 891, 904, 1554, 1564, 1874, 2503, 2507, 2520, 2613, 2638, 2673, 2708, 2959, 3632], 'many': [93, 1812, 1988], 'decades.': [94], 'We': [95], 'aimed': [96, 1842], 'examine': [98], 'molecular': [100, 1101, 1219, 1309, 1516, 1915, 2128, 2488, 3122, 3551], 'basis': [101], 'among': [105, 867, 3224], 'isolates': [108, 259, 1384, 1854, 2162, 2206, 2243, 2421, 2462, 2935, 3026, 3413, 3485, 3520, 3801], 'southwestern': [111, 874, 1857], 'region': [112, 701, 875], 'by': [116, 161, 197, 239, 338, 464, 571, 622, 923, 969, 1241, 1263, 1330, 1360, 1566, 1652, 1847, 3710, 3893], 'analyzing': [117], 'K76T': [119, 179, 193, 204, 858, 1282, 1946, 1995, 2186, 3215, 3523], 'N86Y': [121, 182, 209, 860, 1497, 1949, 2394, 2413, 2449], 'PfCRT': [125, 178, 192, 750, 770, 863, 1094, 1118, 1281, 1374, 1831, 1925, 1945, 1970, 1984, 2048, 2068, 2096, 2115, 2138, 2151, 2185, 2219, 2236, 2457, 2892, 3303], 'PfMDR1': [127, 181, 208, 280, 307, 815, 1096, 1120, 1376, 1496, 1839, 1948, 1978, 2304, 2323, 2350, 2365, 2393, 2412, 2448], 'genes,': [128, 748], 'respectively.PATIENTS': [129], 'METHODS:': [131], 'P': [132, 350, 353, 362, 465, 650, 703, 752, 868, 1382, 1416, 1571, 1677, 1802, 1903, 2160, 2204, 2316, 2464], 'falciparum-infected': [133, 1417, 1678], 'blood': [134, 908, 941, 985, 1002, 1418, 1679], 'spot': [135], 'samples': [136, 173, 188, 212, 235, 287, 697, 917, 942, 986, 1286, 1297, 1325, 1355, 1419, 1472, 1501, 1504, 1530, 1548, 1605, 1634, 1680, 1765, 1932, 1940, 1974, 1981, 2357], '(n=121)': [137, 888], 'were': [138, 152, 159, 195, 214, 237, 817, 886, 911, 921, 931, 943, 1004, 1031, 1072, 1123, 1145, 1155, 1211, 1290, 1313, 1520, 1534, 1639, 1933, 1941, 1966, 2327, 2370], 'collected': [139, 922], 'on': [140, 485, 1075, 1795, 3514], 'filter': [141, 999, 3105], 'papers.': [142], 'DNA': [143, 252, 1091, 1165, 1172, 1347, 1414, 1646, 1675, 1850, 3102], 'was': [144, 281, 618, 682, 967, 980, 1014, 1054, 1085, 1167, 1863, 1986, 2014, 2088, 2098, 2119, 2141, 2179, 2192, 2222, 2260, 2341, 2347, 2396, 2415, 3890], 'extracted': [145, 981, 3103], 'fragments': [147, 1092, 1737], 'above': [150], 'genes': [151, 1228, 3061, 3271, 3340, 3375], 'amplified': [153, 176, 189, 1324, 1577, 1942], 'using': [154, 1189, 1213, 2855], 'nested': [155, 1316, 1409, 1523, 1670], 'PCR.': [156], 'The': [157, 368, 557, 594, 939, 1052, 1625, 1721, 2000, 2062, 2181, 2247, 2411, 2487, 3906], 'amplicons': [158, 1306, 1513], 'digested': [160, 1124, 1143, 1329], 'ApoI': [162, 219, 1132, 1589, 1613], 'enzyme': [163, 1131], 'sequenced.RESULTS:': [165], 'Of': [166, 779, 1527, 1573], '121': [168, 1285, 1500], 'samples,': [169, 1578, 2377], '95': [170, 1296, 1323, 1937], '112': [172, 1503, 1630, 1939], 'could': [174, 1327, 1549, 1558, 2284], 'be': [175, 373, 820, 1328, 2195, 2225, 2285, 2330], 'mutations,': [183, 1950], 'respectively.': [184, 1951], 'All': [185, 953, 1142], 'mutation': [194, 304, 783, 836, 1337, 1483, 1996, 2009, 2140, 2187, 2221, 2395, 2414, 2450, 3216], 'undigestible': [196], 'ApoI,': [198, 240, 1331], 'suggesting': [199, 241, 1332], 'presence': [201, 226, 243, 856, 1334, 1481, 1593, 1617, 1777, 1992, 2182], 'mutation.': [205], 'For': [206, 1114, 1961], 'mutation,': [210], '65/109': [211], '(59.6%)': [213, 1580], 'digestible': [215, 238], 'when': [216, 2492], 'treated': [217, 3177], 'with': [218, 411, 439, 467, 627, 777, 907, 995, 1047, 1125, 1157, 1458, 1475, 1719, 1768, 1805, 1823, 1957, 2049, 2077, 2925, 3067, 3178, 3285, 3521, 3559, 3807], 'a': [221, 331, 576, 587, 604, 693, 711, 961, 1044, 1057, 1561, 1567, 2008, 2107, 2427, 2615, 2640, 3304, 3307, 3590, 3894], 'pattern,': [222], 'suggestive': [223, 2479], 'investigated': [229, 299, 1229, 1818, 2104, 2125], 'wild': [230, 1369, 1781], 'allele': [231, 247, 263, 274, 1726, 2117, 2178, 2325, 3701], '(N86).': [232], 'However,': [233, 270, 541, 1876, 1929], '44/109': [234], '(40.4%)': [236, 1604], 'mutated': [246, 262, 272, 1620, 2177], '(Y)': [248], 'at': [249, 264, 275, 788, 841, 973, 1019, 1038, 1062, 1170, 1176, 1484, 1783, 1834, 2010, 2055, 2671], 'position': [250, 791, 844, 1489, 2013, 2056], '86.': [251], 'sequencing': [253, 1166, 1173, 1348, 1647, 1851], 'confirmed': [254, 906, 1356, 1648, 1990], 'these': [255, 1354, 1547, 1845], 'results.CONCLUSION:': [256], 'Surprisingly,': [257], 'all': [258, 742, 1931], 'exhibited': [260], 'codon': [265, 276, 1622, 1827, 1835], '76': [266, 1828, 2057], '(K76T)': [267, 792], 'PfCRT.': [269], 'mutant': [273, 1371, 1748, 1779], '86': [277, 1836], '(N86Y)': [278, 845], 'found': [282, 710, 797, 818, 2036, 2099, 2120, 2193, 2223, 2328, 2348, 2416, 2433], '40.4%': [284, 2333], 'studied.': [288], 'To': [289], 'our': [290, 2072, 2320], 'knowledge,': [291], 'this': [292, 851, 884, 914, 958, 1070, 1231, 1542, 2258], 'is': [293, 330, 370, 431, 482, 529, 551, 565, 643, 795, 1792, 2025, 2074, 2264, 2426, 2439, 2478, 3581, 3805, 3937, 3965], 'first': [295, 683], 'study': [296, 313, 691, 959, 966, 1071, 1919, 2073, 2091, 2110, 2149, 2199, 2259, 3889], 'that': [297, 566, 590, 635, 663, 1341, 1546, 1556, 1638, 2007, 2037, 2095, 2133, 2171, 2214, 2349, 2388, 2432, 2446], 'existence': [301], 'country.': [311, 456, 1861], 'This': [312, 1544, 2263], 'will': [314, 2500], 'contribute': [315], 'development': [318], 'new': [320, 1058, 3151], 'strategies': [321], 'therapeutic': [323], 'intervention': [324], 'against': [325, 554, 2704], 'Arabia.IntroductionMalaria': [329], 'serious': [332], 'global': [333], 'public': [334], 'health': [335, 625], 'problem': [336, 605], 'caused': [337, 463, 1565], 'protozoan': [340], 'belonging': [342], 'genus': [345], 'Plasmodium.': [346], 'Whereas': [347], 'vivax,': [349], 'malariae,': [351], 'ovale': [354], 'give': [355], 'rise': [356, 388], 'considerable': [358], 'morbidity,': [360], 'only': [361, 781, 1936], 'results': [364, 413, 1358, 1650], 'high': [366, 2064], 'mortality.': [367], 'disease': [369], 'considered': [371, 432, 2265], 're-emerging,': [374], 'largely': [375], 'due': [376], 'spread': [379, 597], 'malarial': [381, 2242], 'resistance,': [383, 385], 'insecticide': [384], 'population': [390, 398, 501, 1905], 'travel.1': [392], 'About': [393], '40%': [394], "world's": [397], 'lives': [399], 'areas': [401, 648, 806, 2209, 2383], 'transmission': [404], 'nearly': [406], '100': [407], 'countries,': [408, 516], 'infection': [410, 892, 2482], '1.1-2.7': [415], 'million': [416], 'deaths': [417], 'annually.2,3According': [418], 'World': [421], 'Health': [422, 2808], 'Organization': [423], 'Eastern': [424, 2620, 2802, 3858], 'Mediterranean': [425, 2803], 'Region': [426, 2621], '(WHO-EMR)': [427], 'report,': [428], 'an': [433, 3851, 3938], 'endemic': [434, 743, 805, 2245], 'country': [435, 508, 2212], 'transmission,4': [438], 'most': [440], 'cases': [441, 461, 617, 881, 905], 'diagnosed': [442, 2670], 'Jazan': [445, 700, 901, 2851], 'Aseer': [447, 899], 'regions': [448, 2436], 'located': [449], 'part': [453, 1858], 'Nearly': [457], '96%': [458], 'are': [462, 1109, 1727, 1744, 3065], 'Anopheles': [468], 'arabiensis': [469], 'being': [470], 'main': [472], 'vector': [473], 'transmission.5–8The': [475], 'control': [477, 487, 525, 728], 'program': [478], 'based': [483, 1074], 'mainly': [484], 'integrated': [486], 'measures,': [488], 'including': [489], 'indoor': [490], 'spraying': [491], 'insecticides,': [493], 'case': [494], 'detection,': [495], 'treatment.': [497], 'High': [498], 'rates': [499], 'movement': [502], 'expatriates': [504], 'working': [505], 'pilgrims': [510], 'between': [511, 3399], 'malaria-endemic': [515, 667], 'such': [517, 673], 'as': [518, 674, 1868, 1935, 2496], 'Sudan,': [519], 'India,': [520], 'Yemen,': [522], 'complicate': [523], 'disease.9,10Chloroquine': [528], 'complicated': [538], 'cases.': [540], 'another': [542, 2003], 'combination': [543, 632], 'two': [545, 747, 1736, 2926], 'drugs': [546], '(sulfadoxine': [547], 'pyrimethamine': [549, 2997], '[SP])': [550], 'also': [552], 'effective': [553], 'disease.': [556], 'current': [558], 'mainstream': [559], 'view': [560], 'antimalarial': [563, 2732, 3246, 3286], 'action': [564, 2733, 3145], 'kills': [568], 'binding': [572], 'its': [574], 'target,': [575], 'nonprotein': [577], 'molecule,': [578], 'ferriprotoporphyrin': [579, 2771], 'IX': [580], 'lysosomes': [582], '(food': [583], 'vacuoles)': [584], 'form': [586, 963, 1562], 'toxic': [588], 'complex': [589], 'lyses': [591], 'parasites.11': [593], 'emergence': [595, 719], '(CQR)': [601], 'world': [607], 'health.12': [608], 'In': [609, 850, 2106, 2319, 2362], 'Arabia,': [611, 672], 'strategy': [613], 'treat': [615], 'changed': [619], '2008': [621], 'authorities': [626], 'introduction': [629], 'artemisinin': [631], 'therapy': [633], '(ACT)': [634], 'consists': [636], 'SP': [638], 'artemisinin.13': [640], 'one': [644, 1050], 'few': [647], 'where': [649, 680, 2083, 2345, 2437], 'remained': [652], 'sensitive': [653], 'until': [656, 1064], 'early': [658, 687], '1990s': [659], 'despite': [660], 'fact': [662], 'CQR': [664, 681, 712, 737, 824, 833, 1822, 1998, 2018, 2158, 2315, 2438, 2454], 'emerged': [665], 'countries': [668], 'close': [669], 'Iran,': [675], 'Pakistan,': [676], 'East': [678, 2806], 'Africa': [679], 'reported': [684, 2094, 2111, 2240, 2342, 2445], '1980s.14,15': [688], 'A': [689, 1078, 2090, 2127, 2148, 2197, 2338, 3564], 'recent': [690, 2108, 2198], 'examined': [692, 854], 'limited': [694], 'number': [695], 'chloroquine-resistant': [705, 2932, 3125, 3737], 'transporter': [706, 3270, 3624, 3813], '(PfCRT)': [707], 'rate': [713], '89.5%.16Over': [715], 'years,': [717], 'drug-resistant': [721], 'hampered': [724], 'efforts': [726], 'worldwide.': [730], 'Since': [731], 'late': [733], '1950s,': [734], 'reports': [735], 'have': [738, 758, 772, 831, 1550, 1559, 1817, 1954, 2238, 2305], 'documented': [740, 1956], 'areas.': [744, 2246], 'Mutations': [745], 'namely,': [749], 'multidrug-resistant': [754], '1': [756, 1158, 1216, 1273, 1398, 1434, 1695, 3705], '(PfMDR1)': [757], 'implicated': [760], 'chloroquine.17': [764], 'Several': [765, 828], 'point': [766, 2152, 3404, 3475], 'shown': [774, 2132], 'correlate': [776], 'resistance.': [778], 'these,': [780], 'lysine': [785, 2041], 'threonine': [787, 2050], '76th': [790, 1486], 'CRT': [794], 'significantly': [796], 'resistant': [799, 2799], 'strains': [800], 'different': [804, 1958], 'world.18,19': [809], 'Other': [810], 'observed': [812], 'strongly': [821, 2015], 'linked': [822, 1921, 2016], 'various': [826], 'regions.20': [827], 'field': [829, 1813], 'studies': [830, 1816, 1989, 2082], 'related': [832, 2294], 'aspargine': [838], 'tyrosine': [840], '86th': [843, 1785, 2012], 'MDR1': [848], 'protein.21,22': [849], 'study,': [852, 2321], 'we': [853, 1841], 'PfMDR1,': [865], 'respectively,': [866], 'Arabia.PATIENTS': [878], 'METHODSThe': [880], 'studied': [882], 'report': [885], 'individuals': [887], 'suspected': [889], 'who': [893, 955], 'visit': [894], 'Malaria': [896, 2585, 2668, 2826, 3855], 'Center': [897, 1179, 1187], 'Provinces.': [902], 'Only': [903], 'microscopic': [909], 'examination': [910], 'included': [912], 'study.': [915, 1543], 'Blood': [916], '(nearly': [918], '50': [919], 'μL)': [920], 'finger-pricking': [924], 'three': [926, 1627, 2208, 2381], 'drops': [927], 'each': [929, 1034], 'patient': [930, 1446, 1471, 1707, 1764], 'blotted': [932], 'onto': [933], 'Whatman': [934], '(3': [935], 'mm)': [936], 'chromatography': [937], 'paper.': [938], 'spotted': [940, 984], 'placed': [944, 1005], 'plastic': [946], 'bags': [947], 'transported': [949], 'laboratory.': [952], 'participated': [956], 'signed': [960], 'consent': [962], 'approved': [968], 'Ethics': [971], 'Committee': [972], 'Arabia.DNA': [979], 'according': [987, 1137, 1196], 'method': [990, 1363], 'Sakihama': [992, 3086], 'et': [993, 1964, 2756, 2881, 2920, 3053, 3172, 3267, 3435, 3470, 3508, 3547, 3614, 3657, 3693, 3841], 'al': [994, 1965], 'some': [996], 'modifications.23': [997], 'Briefly,': [998], 'papers': [1000], 'containing': [1001], 'spots': [1003], 'into': [1006, 2164], '1.5': [1007], 'mL': [1008], 'Eppendorf': [1009], 'tubes': [1010], '0.5%': [1012], 'saponin': [1013], 'added': [1015, 1032], 'incubated': [1017, 1037], 'overnight': [1018], '4°C.': [1020], 'One': [1021], 'hundred': [1022], 'microliters': [1023], '5%': [1025], 'Chelex-100': [1026], 'solution': [1027], '(Bio-Rad': [1028], 'Laboratories,': [1029, 1135], 'USA)': [1030, 1207], 'tube': [1035, 1059], '100°C': [1039], '5': [1041], 'minutes': [1042], 'heating': [1045], 'block': [1046], 'vortexing': [1048], 'every': [1049], 'minute.': [1051], 'supernatant': [1053], 'transferred': [1055], 'stored': [1061], '4°C': [1063], 'further': [1065], 'processing.The': [1066], 'primers': [1067, 1084], 'used': [1068, 1540, 1913], 'originally': [1073], 'published': [1076], 'data.24': [1077], 'set': [1079], 'outer': [1081], 'inner': [1083], 'synthesized': [1086], 'amplification': [1089, 1300, 1405, 1507, 1632, 1666, 3098], 'genes.': [1097], 'Primer': [1098], 'sequences,': [1099], 'expected': [1100, 1218, 1308, 1425, 1515, 1686], 'weight': [1102, 1220, 1310, 1517], 'amplicons,': [1104, 1222], 'PCR': [1107, 1121, 1225, 1317, 1351, 1404, 1410, 1442, 1456, 1467, 1524, 1665, 1671, 1703, 1717, 1756, 1760, 1959, 2475, 2856, 3097], 'conditions': [1108, 1226, 1539], 'illustrated': [1110], 'Table': [1112], '1.': [1113], 'digestions,': [1115], 'aliquots': [1116], 'products': [1122, 1144, 1301, 1352, 1411, 1457, 1508, 1672, 1718, 1722], '10': [1126], 'U': [1127], 'restriction': [1130, 1452, 1462, 1713, 2858], '(New': [1133], 'England': [1134], 'USA),': [1136], "manufacturer's": [1140, 1199], 'recommendations.': [1141], 'electrophoretically': [1146], 'processed': [1147], '2%': [1149], 'agarose': [1150], 'gels': [1151], 'bands': [1154, 1587, 1611, 1637], 'visualized': [1156, 1314, 1521], 'mg/mL': [1159], 'ethidium': [1160], 'bromide': [1161], 'under': [1162, 1537, 3942], 'UV': [1163], 'light.': [1164], 'carried': [1168], 'out': [1169], 'core': [1174], 'facility': [1175], '(KFSHRC),': [1188], 'BigDye': [1190], 'Terminator': [1191], 'v3.1': [1192, 1202], 'Cycle': [1193, 1203], 'Sequencing': [1194, 1204], 'Kit': [1195], 'instructions': [1200], '(BigDyeTerminator': [1201], 'Kit,': [1205], 'Applera,': [1206], 'sequences': [1210], 'analyzed': [1212], 'DNASTAR': [1214], 'software.Table': [1215], 'Primers,': [1217], 'study.PrimersSequence': [1232], "(5'–3')Size": [1233], '(bp)PCR': [1234], 'conditionsFirst': [1235], 'round': [1236, 1258], 'PfMDR1OMDR1/FTGTTGAAAGATGGGTAAAGAGCAGAAAGAG66094°C,': [1237], '3': [1238, 1255, 1260, 1276], 'min': [1239, 1261], 'followed': [1240, 1262], '45': [1242], 'cycles': [1243, 1265], '(94°C,': [1244, 1266], '30': [1245, 1249, 1252, 1267, 1270], 'sesc;': [1246], '56': [1247], '°C,': [1248], 'secs;': [1250, 1268, 1271], '60°C,': [1251, 1254], 'secs);': [1253], 'minOMDR1/RTACTTTCTTATTACATATGACACCACAAAC': [1256], 'PfCRTOCRT/FCCGTTAATAATAAATACACGCAC1389OCRT/RCGGATGTTACAAAACTATAGTTACSecond': [1257], 'PfMDR1IMDR1/FGTCAAACGTGCATTTTTATTAATGACCATTTA56094°C,': [1259], '40': [1264], '47°C,': [1269], '68°C,': [1272], 'min);': [1274], '64°C,': [1275], 'minsIMDR1/RAAAGATGGTAACCTCAGTATCAAAGAGAG': [1277], 'PfCRTICRT/FTGTGCTCATGTGTTTAAACTT145ICRT/RCAAAACTATAGTTACCAATTTTGRESULTSAnalysis': [1278], 'codonOf': [1283, 1498], 'examined,': [1287, 1531], '26': [1288], '(21.5%)': [1289], 'not': [1291, 1535, 1640, 1930, 2026], 'amplifiable': [1292, 1536, 1934], 'but': [1293], 'remaining': [1295, 1626], '(78.5%)': [1298], 'gave': [1299, 1581, 1606], '(Table': [1302, 1509], '2)': [1303, 1510], '(145': [1311], 'bp)': [1312, 1519], 'after': [1315, 1451, 1473, 1522, 1588, 1612, 1712, 1766, 1882], '(Figure': [1318, 1345, 1364, 1525, 1623, 1655], '1a).': [1319], 'None': [1320], '(100%)': [1326], 'interest': [1339], '(76T)': [1340], 'indicates': [1342], '1b).': [1346], 'obtained': [1359, 1450, 1651, 1711], 'PCR/RFLP': [1362, 1653], '1c).Table': [1365], '2': [1366, 1659], 'Prevalence': [1367], 'alleles': [1372, 1782, 2369, 3763], 'conferring': [1377], 'Southwest': [1386], 'parts': [1387], 'Arabia.GeneNWild': [1390], 'AlleleMutant': [1391], 'AlleleMutation': [1392], '(%)PfCRT9576K': [1393], '(0/95)76T': [1394], '(95/95)100PfMDR110986N': [1395], '(65/109)86Y': [1396], '(44/109)40.4Figure': [1397], '(A)': [1399, 1660], 'Agarose': [1400, 1661], 'gel': [1401, 1662], 'typical': [1403, 1664, 2267], 'patterns': [1406, 1667], 'PFCRT': [1421], 'gene,': [1422, 1683, 1840, 2004], 'showing': [1423], 'product': [1426, 1443, 1468, 1687, 1704, 1761], '154': [1428], 'bp.': [1429, 1690], 'M:': [1430, 1691, 1750], '100-bp': [1431, 1692, 1751], 'ladder,': [1432, 1693, 1752], 'lanes': [1433, 1440, 1465, 1694, 1701, 1753, 1758], '2:': [1436, 1697], 'no-template': [1437, 1698], 'negative': [1438, 1699], 'controls,': [1439, 1700], '3-6:': [1441, 1702], 'representative': [1445, 1470, 1706, 1763, 1773], 'samples.': [1447, 1708], '(B)': [1448, 1709], 'Patterns': [1449, 1710], 'digestion': [1453, 1463, 1474, 1644, 1714, 1767, 2472], 'ApoI.': [1459, 1476, 1720, 1769], 'Lane': [1460], '1:': [1461, 1754], 'control,': [1464, 2504], '2-5:': [1466, 1759], '(C)': [1477], 'Chromatogram': [1478], 'confirming': [1479, 1775], 'amino': [1487, 1786, 2045, 2053, 2928], 'acid': [1488, 1787, 2929], 'highlighted': [1490], 'yellowDownload': [1492], 'FigureAnalysis': [1493], 'analyzed,': [1502], '(92.5%)': [1505], 'yielded': [1506], '(560': [1518], '2a).': [1526], 'total': [1529], '9': [1532], '(7.5%)': [1533], 'suggested': [1545], 'misdiagnosed': [1552], 'or': [1555, 2298, 3306], 'it': [1557, 2024, 2033, 2346], 'species': [1568], 'other': [1569, 1601, 2081, 3272], 'than': [1570, 1884, 3273, 3583], 'falciparum.': [1572], '109': [1575], 'correctly': [1576], '65': [1579], '250,': [1582], '231,': [1583], '79': [1585, 1733], 'bp': [1586, 1610, 1731, 1740, 1743], 'digestion,': [1590, 1614], 'indicating': [1591, 1615], 'wild-type': [1596, 1725], '86N': [1597, 2366], 'codon.': [1598], 'On': [1599], 'hand,': [1602], '44': [1603], '481': [1607, 1739], '97': [1609, 1742], '86Y': [1621, 2324, 2351, 2368], '2b).': [1624], '(of': [1628], 'yielding': [1631], 'products)': [1633], 'showed': [1635, 2170, 2213, 2387, 2470], 'faint': [1636], 'appropriate': [1641], 'assay.': [1645], 'analysis': [1654, 2468, 3438], '2c': [1656], '2d).Figure': [1658], 'PFMDR1': [1682], 'giving': [1684], '560': [1689], '250': [1728], 'bp,': [1729, 1734], '231': [1730], 'while,': [1735], 'evident': [1745], 'alleles.': [1749], 'undigested': [1755], 'product,': [1757, 2476], '(C': [1770], 'D)': [1772], 'chromatograms': [1774], 'position.Download': [1788], 'FigureDISCUSSIONAt': [1789], 'present,': [1790], 'there': [1791], 'little': [1793], 'information': [1794], 'association': [1797, 1820], 'genetic': [1799], 'variation': [1800], 'Arabia.': [1810], 'As': [1811], 'laboratory': [1815, 2020, 2675], 'specific': [1824], 'investigate': [1844], 'PCR-RFLP': [1848, 2467], 'technologies': [1852], 'introduced': [1864], '1940s': [1867], 'treatment.25': [1875], 'parasite': [1877, 1891, 2514], 'appeared': [1881, 2352], 'more': [1883, 2452, 3582], '60': [1885], 'years': [1886], 'intensive': [1888], 'use.': [1889], 'Extended': [1890], 'exposure': [1892], 'necessitated': [1896], 'exploration': [1898], 'characteristics': [1901], 'genetics': [1906], 'relation': [1908], 'chloroquine.We': [1912], 'standard': [1914], 'biology': [1916], 'methods': [1917], 'PfMDR': [1927], 'genes.24': [1928], 'Such': [1952], 'problems': [1953], 'conditions.': [1960], 'example,': [1962], 'Sutherland': [1963, 3160], 'able': [1967], 'amplify': [1969, 1977], '98/108': [1972], '(90.7%)': [1973], '74/108': [1980], '(68.5%).26When': [1982], 'identified,': [1987], 'parasites.27': [1999], 'investigation': [2001], 'PfMDR1,28': [2005], 'revealed': [2006], 'clones,': [2021], 'even': [2022], 'though': [2023], 'sole': [2028], 'requirement': [2029], 'CQR.29': [2031], 'Globally,': [2032], 'replacement': [2038], '(a': [2042], 'positively': [2043], 'charged': [2044], 'acid)': [2046, 2054], '(an': [2051], 'uncharged': [2052], 'confers': [2058], 'chloroquine.30': [2061], 'very': [2063], 'prevalence': [2065, 2109, 2129, 2135], '76T': [2069, 2097, 2116, 2139, 2176, 2220, 2458], 'variant': [2070], 'agreement': [2076], 'findings': [2079], 'clinical': [2084, 2556, 3342], 'failure': [2087], 'evident.31': [2089], 'Iran': [2093, 2344], '99%': [2101], 'samples.32': [2105], 'Thailand,': [2113, 2363], 'frequency': [2118, 2173, 2216, 2390, 2428], '99.1%': [2122], 'samples.33': [2126], 'survey': [2130], 'over': [2142], '90%': [2143], 'Yunnan': [2145, 3446], 'province,': [2146], 'China.34': [2147], 'level': [2156, 2311, 3478, 3796], 'imported': [2163], 'Europe': [2165], 'Congo': [2167], 'Tanzania': [2169], '71.4%.35': [2180], 'Papua': [2189, 3525], 'New': [2190, 3526], 'Guinea': [2191], '92.9%.36': [2196], 'Philippines': [2202, 2386], 'describing': [2203], '100%': [2226], 'Kalinga,': [2228], '80%': [2229], 'Palawan,': [2231], '87%': [2233], 'Mindanao.37Different': [2235], 'haplotypes': [2237, 2280, 3660], 'CQR-associated': [2248], 'haplotype': [2249, 2268, 3627], '(amino': [2250], 'acids': [2251, 2978], '72': [2253], '76)': [2255], 'detected': [2256, 2302], 'CVIET.': [2262], 'Southeast': [2271, 2423, 3741], 'Asia': [2272], 'African': [2275, 2435], 'continent.38': [2276], 'Finding': [2277], 'same': [2279, 2485], 'attributed': [2286], 'continuous': [2289], 'travel': [2290], 'human': [2292], 'migration': [2293], 'employment,': [2296], 'tourism,': [2297], 'religious': [2299], 'pilgrimage.39,40Currently,': [2300], 'hypothesized': [2307], 'augment': [2309], 'parasites.24,41': [2318], 'frequencies': [2326], '59.6%': [2331], 'N86': [2336], 'allele.': [2337], 'similar': [2339, 2430], 'finding': [2340], '72%': [2354], 'Sistan-Baluchistan': [2360], 'Province.31': [2361], 'identified': [2371], '75.5%': [2373], '20%': [2375], 'respectively.32': [2378], 'Isolates': [2379], 'distinct': [2382], '39%': [2397], 'Kalinga': [2399], 'town,': [2400, 2404], '35%': [2401], 'Palawan': [2403], '93%': [2406], 'Mindanao': [2408], 'town': [2409], 'isolates.36': [2410], '23.1%': [2418], 'Iran,42': [2424], 'which': [2425, 2477, 3951], 'pattern': [2429], 'well': [2440], 'established.43': [2441], 'Babiker': [2442, 3783], 'colleagues': [2444], 'contributes': [2451], 'background': [2459], 'Sudanese': [2461, 3800], 'falciparum.44': [2465], 'Our': [2466], 'consistently': [2469], 'incomplete': [2471], 'multiclonal': [2481], 'parasites.45': [2486], 'markers': [2489, 2845, 3123, 3552], 'CQR,': [2491], 'optimized': [2493], 'validated': [2495], 'tools': [2497], 'surveillance,': [2499], 'help': [2501], 'guide': [2505], 'national': [2506], 'policies,': [2509], 'monitor': [2511], 'changes': [2512, 2518], 'susceptibility': [2516, 3023], 'following': [2517], 'policy.ARTICLE': [2523], 'REFERENCES:1.': [2524], 'Greenwood': [2525], 'B,': [2526, 3757], 'Mutabingwa': [2527], 'T.': [2528], '"Malaria': [2529, 2553], '2002"': [2531], '.': [2532, 2560, 2592, 2625, 2646, 2680, 2713, 2736, 2773, 2786, 2805, 2830, 2860, 2901, 2939, 2961, 2999, 3033, 3075, 3108, 3128, 3153, 3190, 3229, 3248, 3349, 3381, 3416, 3449, 3488, 3528, 3567, 3595, 3635, 3670, 3714, 3743, 3775, 3821, 3860], 'Nature.': [2533, 2561], '2002;': [2534, 3196, 3779], '415:670-2.': [2535], 'Google': [2536, 2543, 2564, 2572, 2598, 2631, 2652, 2663, 2686, 2720, 2742, 2778, 2793, 2812, 2836, 2867, 2906, 2945, 2969, 3007, 3039, 3084, 3113, 3135, 3158, 3198, 3234, 3253, 3294, 3322, 3355, 3386, 3421, 3456, 3494, 3533, 3572, 3600, 3643, 3679, 3718, 3750, 3781, 3827, 3866], 'Scholar2.': [2537], 'WHO.': [2538], '2008.': [2539], 'Available': [2540, 2569], 'from:': [2541, 2570], 'http://www.apps.who.int/malaria/wmr2008/malaria2008.pdf.': [2542], 'Scholar3.': [2544], 'Nahlen': [2545], 'BL,': [2546], 'Korenromp': [2547], 'EL,': [2548], 'Miller': [2549], 'JM,': [2550, 2919], 'Shibuya': [2551], 'K.': [2552, 3095], 'risk:': [2554], 'estimating': [2555], 'episodes': [2557], 'malaria"': [2559, 3127], '2005;': [2562, 2791, 3251, 3292, 3598], '437:E3.': [2563], 'Scholar4.': [2565], 'WHO/': [2566], 'EMRO.': [2567], '2006.': [2568], 'http://www.emro.who.int/index.asp.': [2571], 'Scholar5.': [2573], 'Malik': [2574], 'GM,': [2575], 'Seidi': [2576], 'O,': [2577, 3686], 'El-Taher': [2578], 'A,': [2579, 3091, 3116, 3163, 3207, 3264, 3329, 3393, 3469, 3499, 3605, 3723, 3788], 'Mohammed': [2580, 3910], 'AS.': [2581], '"Clinical': [2582], 'Aspects': [2583], 'Asir': [2588], 'Region,': [2589], 'Arabia"': [2591, 2624, 2645, 2679, 2712], 'Ann': [2593, 2714], 'Med.': [2595, 3132], '1998;': [2596, 3156], '18:15-7.': [2597], 'Scholar6.': [2599], 'Bashwari': [2600], 'LA,': [2601], 'Mandil': [2602], 'AM,': [2603, 3830], 'Bahnassy': [2604], 'AA,': [2605, 2697, 2815], 'Al-Shamsi': [2606], 'MA,': [2607, 3209], 'Bukhari': [2608], 'HA.': [2609], '"Epidemiological': [2610], 'profile': [2611], 'university': [2616], 'Med': [2627, 2648, 2682, 2716, 3080, 3194, 3451, 3639, 3675], 'J.': [2628, 2649, 2683, 2809], '2001;': [2629, 2718, 3082, 3111, 3133, 3353, 3825], '22:133-8.': [2630], 'Scholar7.': [2632], 'Al-Tawfiq': [2633], 'JA.': [2634], '"Epidemiology': [2635], 'travel-related': [2637], 'non-malarious': [2641], 'area': [2642], '2006;': [2650, 2740, 2776, 3384, 3492, 3531], '27:86-9.': [2651], 'Scholar8.': [2653], 'Ministry': [2654], 'Health.': [2656, 3453], '2006Saudi': [2657], 'Arabia:': [2658], '(annual': [2659], 'statistics': [2660], 'book),': [2661], 'MOH.': [2662], 'Scholar9.': [2664], 'Alkhalife': [2665], 'IS.': [2666], '"Imported': [2667], 'infections': [2669], 'referral': [2674], '2003;': [2684, 2810, 2943, 3232], '24:1068-72.': [2685], 'Scholar10.': [2687], 'Ghalib': [2688], 'HW,': [2689], 'Al-Ghamdi': [2690], 'S,': [2691, 3201, 3203, 3258, 3262, 3360, 3540, 3607, 3648, 3650, 3838, 3840], 'Akood': [2692, 2818], 'M,': [2693, 2747, 2819, 3138, 3171, 3461, 3538, 3790], 'Haridi': [2694], 'AE,': [2695], 'Ageel': [2696], 'Abdalla': [2698], 'RE.': [2699], '"Therapeutic': [2700], 'efficacy': [2701], 'uncomplicated,': [2705], 'plasmodium': [2706, 3335], 'south-western': [2710], 'Trop': [2715, 3079, 3193, 3450, 3638, 3674], 'Parasitol.': [2717, 2864, 3036, 3110, 3319], '95:773-9.': [2719], 'Scholar11.': [2721], 'Fitch': [2722], 'CD,': [2723], 'Russell': [2724], 'NV.': [2725], '"Accelerated': [2726], 'denaturation': [2727], 'hemoglobin': [2729], 'chloroquine"': [2735], 'Antimicrob': [2737, 2940, 3289, 3776], 'Agents': [2738, 2941, 3290, 3777], 'Chemother.': [2739, 2942, 3291, 3778], '50:2415-9.': [2741], 'Scholar12.': [2743], 'Bray': [2744], 'PG,': [2745, 3603, 3759], 'Mungthin': [2746], 'Hastings': [2748], 'IM,': [2749], 'Biagini': [2750], 'GA,': [2751, 3692], 'Saidu': [2752], 'DK,': [2753], 'Lakshmanan': [2754], 'V,': [2755, 3205], 'al.': [2757, 2882, 2921, 3054, 3173, 3268, 3436, 3471, 3509, 3548, 3615, 3658, 3694, 3842], '"PfCRT': [2758], 'trans-vacuolar': [2761], 'proton': [2762], 'electrochemical': [2763], 'gradient:': [2764], 'regulating': [2765], 'access': [2767], 'IX"': [2772], 'Mol': [2774, 2902, 3034], 'Microbiol.': [2775], '62:238-51.': [2777], 'Scholar13.': [2779], 'Ashley': [2780], 'EA,': [2781, 3546], 'White': [2782], 'NJ.': [2783], '"Artemisinin-based': [2784], 'combinations"': [2785], 'Curr': [2787, 2962], 'Opin': [2788], 'Infect': [2789, 2832, 2965, 3351, 3489, 3746, 3823, 3862], 'Dis.': [2790, 2833, 3352, 3747, 3824, 3863], '18:531-6.': [2792], 'Scholar14.': [2794], 'Abdel-Hameed': [2795], 'AA.': [2796], '"Antimalarial': [2797], 'Region"': [2804], 'Mediterr': [2807], '9:492-508.': [2811], 'Scholar15.': [2813], 'Alrajhi': [2814], 'Rahim': [2816], 'I,': [2817, 3503], 'Hazmi': [2820], '"Chloroquine-Resistant': [2822], 'cerebral': [2825], 'achloroquine-Susceptible': [2828], 'Area"': [2829], 'J': [2831, 2861, 3131, 3192, 3350, 3637, 3745, 3822, 3861], '1999;': [2834], '180:1738-41.': [2835], 'Scholar16.': [2837], 'Al': [2838], 'Harthi': [2839], 'SA.': [2840], '"Detection': [2841], 'pyrimethamine-sulfadoxine': [2849], 'area,': [2852], 'digestion"': [2859], 'Egypt': [2862], 'Soc': [2863, 3078, 3673], '2007;': [2865, 3320, 3454, 3677], '37:17-30.': [2866], 'Scholar17.': [2868], 'Fidock': [2869], 'DA,': [2870], 'Nomura': [2871], 'T,': [2872, 3089, 3093, 3497, 3536], 'Talley': [2873], 'AK,': [2874], 'Cooper': [2875, 3574], 'RA,': [2876, 3575], 'Dzekunov': [2877], 'SM,': [2878, 3725], 'Ferdig': [2879, 3578], 'MT,': [2880, 3237, 3682], '"Mutations': [2883, 3055], 'P.': [2886, 3630], 'digestive': [2888], 'vacuole': [2889], 'transmembrane': [2890], 'protein': [2891], 'evidence': [2894], 'their': [2896], 'role': [2897], 'resistance"': [2900, 2998], 'Cell.': [2903], '2000;': [2904], '6:861-71.': [2905], 'Scholar18.': [2907], 'Chen': [2908], 'N,': [2909, 3087, 3505, 3542, 3656], 'Kyle': [2910], 'DE,': [2911], 'Pasay': [2912], 'C,': [2913, 3459], 'Fowler': [2914], 'EV,': [2915], 'Baker': [2916], 'J,': [2917, 3013, 3165, 3358], 'Peters': [2918], '"pfcrt': [2922], 'allelic': [2923], 'types': [2924], 'novel': [2927], 'Philippines"': [2938], '47:3500-5.': [2944], 'Scholar19.': [2946], 'Hayton': [2947], 'K,': [2948, 3389, 3395], 'Su': [2949], 'XZ.': [2950], '"Genetic': [2951], 'biochemical': [2953], 'aspects': [2954], 'parasites"': [2960], 'Drug': [2963], 'Targets': [2964], 'Disord.': [2966], '2004;': [2967, 3641, 3864], '4:1-10.': [2968], 'Scholar20.': [2970], 'Foote': [2971], 'SJ,': [2972, 3786], 'Galatis': [2973], 'D,': [2974], 'Cowman': [2975, 3238], 'AF.': [2976, 3239], '"Amino': [2977], 'dihydrofolate': [2981], 'reductase-thymidylate': [2982], 'synthase': [2983], 'cycloguanil': [2990], 'differ': [2992], 'those': [2994], 'Proc': [3000], 'Natl': [3001], 'Acad': [3002], 'Sci': [3003], 'USA.': [3004], '1990;': [3005], '87:3014-7.': [3006], 'Scholar21.': [3008], 'Basco': [3009], 'LK,': [3010], 'Le': [3011], 'Bras': [3012], 'Rhoades': [3014], 'Z,': [3015, 3424, 3426], 'Wilson': [3016], 'CM.': [3017], '"Analysis': [3018], 'pfmdr1': [3020, 3243, 3372, 3409, 3512, 3734], 'fresh': [3025], 'subsaharan': [3031], 'Africa"': [3032, 3487], 'Biochem': [3035], '1995;': [3037], '74:157-66.': [3038], 'Scholar22.': [3040], 'Nagesha': [3041], 'HS,': [3042], 'Din-Syafruddin': [3043], ',': [3044], 'Casey': [3045], 'GJ,': [3046], 'Susanti': [3047], 'AI,': [3048], 'Fryauff': [3049], 'DJ,': [3050], 'Reeder': [3051], 'JC,': [3052], 'pfmdr,': [3058], 'dhfr,': [3059], 'dhps': [3060], 'associated': [3066, 3284, 3367, 3806], 'vivo-drug': [3069], 'West': [3072], 'Papua,': [3073], 'Indonesia"': [3074], 'Trans': [3076, 3671], 'R': [3077, 3672], 'Hyg.': [3081, 3195, 3640, 3676], '95:43-9.': [3083], 'Scholar23.': [3085], 'Mitamura': [3088], 'Kaneko': [3090, 3498], 'Horii': [3092], 'Tanabe': [3094], '"Long': [3096], 'paper': [3106], 'blots"': [3107], 'Exp': [3109], '97:50-4.': [3112], 'Scholar24.': [3114], 'Djimde': [3115], 'Doumbo': [3117], 'OK,': [3118], 'Corteses': [3119], 'JF.': [3120], '"A': [3121], 'N': [3129], 'Engl': [3130], '344:257-63.': [3134], 'Scholar25.': [3136], 'Foley': [3137], 'Tilley': [3139], 'L.': [3140], '"Quinoline': [3141, 3365], 'antimalarials:': [3142], 'mechanisms': [3143], 'prospects': [3149], 'agents"': [3152], 'Pharmacol': [3154], 'Ther.': [3155], '79:55-87.': [3157], 'Scholar26.': [3159], 'CJ,': [3161, 3167, 3684], 'Alloueche': [3162], 'Curtis': [3164], 'Drakeley': [3166, 3683], 'Ord': [3168], 'R,': [3169, 3688], 'Duraisingh': [3170, 3236, 3681], '"Gambian': [3174], 'children': [3175], 'successfully': [3176], 'can': [3180], 'harbor': [3181], 'transmit': [3183], 'gametocytes': [3186], 'carrying': [3187], 'genes"': [3189], 'Am': [3191, 3636], '67:578-85.': [3197], 'Scholar27.': [3199], 'Vinayak': [3200], 'Biswas': [3202], 'Dev': [3204], 'Kumar': [3206], 'Ansari': [3208], 'Sharma': [3210], 'YD.': [3211], '"Prevalence': [3212, 3472], 'pfcrt': [3219, 3337, 3407, 3474, 3522], 'responders': [3226], 'India"': [3228, 3634, 3669], 'Acta': [3230, 3249, 3382, 3417, 3529, 3596], 'Trop.': [3231, 3250, 3383, 3418, 3530, 3597], '87:287-93.': [3233], 'Scholar28.': [3235], '"Contribution': [3240], 'drug-resistance"': [3247], '94:181-90.': [3252], 'Scholar29.': [3254], 'Anderson': [3255], 'TJ,': [3256], 'Nair': [3257], 'Qin': [3259], 'H,': [3260, 3507], 'Singlam': [3261], 'Brockman': [3263], 'Paiphun': [3265], 'L,': [3266, 3432], '"Are': [3269], 'locus': [3277], '(pfcrt)': [3278, 3625, 3815], 'multidrug': [3280, 3817], '(pfmdr)': [3283], 'resistance?"': [3288], '49:2180-8.': [3293], 'Scholar30.': [3295], 'Sanchez': [3296], 'CP,': [3297], 'Stein': [3298], 'WD,': [3299], 'Lanzer': [3300], '"Is': [3302], 'channel': [3305], 'carrier?': [3308], 'Two': [3309], 'competing': [3310], 'models': [3311], 'explaining': [3312], 'falciparum?"': [3317], 'Trends': [3318], '23:332-9.': [3321], 'Scholar31.': [3323], 'Dorsey': [3324], 'G,': [3325, 3690], 'Kamya': [3326], 'MR,': [3327], 'Singh': [3328], 'Rosenthal': [3330], 'PJ.': [3331], '"Polymorphisms': [3332], 'pfmdr-1': [3339], 'response': [3343, 3664, 3765], 'Kampala,': [3347], 'Uganda"': [3348], '183:1417-20.': [3354], 'Scholar32.': [3356], 'Ursing': [3357], 'Zakeri': [3359], 'Gil': [3361], 'JP,': [3362], 'Björkman': [3363], 'A.': [3364], 'polymorphisms': [3368], 'pfcrt,': [3371], 'pfmrp': [3374], 'Plasmodiumm': [3377], 'Iran"': [3380, 3742], '97:352-6.': [3385], 'Scholar33.': [3387], 'Rungsihirunrat': [3388], 'Chaijareonkul': [3390], 'W,': [3391, 3430], 'Seugorn': [3392], 'Na-Bangchang': [3394], 'Thaithong': [3396], 'S.': [3397], '"Association': [3398, 3549], 'phenotypes': [3402], 'Thailand"': [3415], '2009;': [3419, 3570], '109:37-40.': [3420], 'Scholar34.': [3422], 'Yang': [3423], 'Zhang': [3425, 3433], 'Sun': [3427], 'X,': [3428, 3434], 'Wan': [3429], 'Cui': [3431], '"Molecular': [3437], 'Province,': [3447], 'China"': [3448], 'Int': [3452, 3744], '12:1051-60.': [3455], 'Scholar35.': [3457], 'Severini': [3458], 'Menegon': [3460], 'Sannella': [3462], 'AR,': [3463], 'Paglia': [3464], 'MG,': [3465], 'Narciso': [3466], 'P,': [3467, 3792], 'Matteelli': [3468], 'Genet': [3490], 'Evol.': [3491], '6:262-8.': [3493], 'Scholar36.': [3495], 'Mita': [3496], 'Hombhanje': [3500], 'F,': [3501, 3721, 3727, 3729], 'Hwaihwanje': [3502], 'Takahashi': [3504], 'Osawa': [3506], '"Role': [3510], 'Guinea"': [3527], '98:137-44.': [3532], 'Scholar37.': [3534], 'Hatabu': [3535], 'Iwagami': [3537], 'Kawazu': [3539], 'Taguchi': [3541], 'Escueta': [3543], 'AD,': [3544], 'Villacorte': [3545], 'crt': [3556], 'mdr1': [3558], 'vitro': [3561], 'resistance:': [3563], 'Philippine': [3565], 'study"': [3566], 'Parasitol': [3568], 'Int.': [3569], '58:166-70.': [3571], 'Scholar38.': [3573], 'Hartwig': [3576], 'CL,': [3577], 'MT.': [3579], '"Pfcrt': [3580, 3659], 'gene:': [3589], 'functional': [3591], 'evolutionary': [3593], 'perspective"': [3594], '94:170-80.': [3599], 'Scholar39.': [3601], 'Vathsala': [3602], 'Pramanik': [3604], 'Dhanasekaran': [3606], 'Devi': [3608], 'CU,': [3609], 'Pillai': [3610], 'CR,': [3611], 'Subbarao': [3612], 'SK,': [3613], '"Widespread': [3616], 'occurrence': [3617], 'svmnt': [3628], '70:256-9.': [3642], 'Scholar40.': [3644], 'Pati': [3645], 'SS,': [3646], 'Mishra': [3647], 'Mohanty': [3649], 'Mohapatra': [3651], 'DN,': [3652], 'Sahu': [3653], 'PK,': [3654], 'Priyadarshi': [3655], 'in-vivo': [3662], 'Sundergarh': [3666], 'district,': [3667], 'Orissa,': [3668], '101:650-4.': [3678], 'Scholar41.': [3680], 'Muller': [3685], 'Bailey': [3687], 'Snounou': [3689], 'Targett': [3691], '"Evidence': [3695], 'selection': [3697], 'tyrosine-86': [3700], 'pfmdr': [3704], 'amodiaquine"': [3713], 'Parasitology.': [3715], '1997;': [3716], '114:205-11.': [3717], 'Scholar42.': [3719], 'Jalousian': [3720], 'Dalimi': [3722], 'Samiee': [3724], 'Ghaffarifar': [3726], 'Soleymanloo': [3728], 'Naghizadeh': [3730], 'R.': [3731], '"Mutation': [3732], 'isolates,': [3740], '2008;': [3748], '12:630-4.': [3749], 'Scholar43.': [3751], 'Mawili-Mboumba': [3752], 'DP,': [3753], 'Kun': [3754], 'JF,': [3755], 'Lell': [3756], 'Kremsner': [3758], 'Ntoumi': [3760], 'F.': [3761], '"Pfmdr1': [3762], 'ultra': [3767], 'low': [3768], 'dose': [3769], 'mefloquine': [3770], 'Gabonese': [3773], 'patients"': [3774], '46:166-70.': [3780], 'Scholar44.': [3782], 'HA,': [3784], 'Pringle': [3785], 'Abdel-Muhsin': [3787, 3829], 'Mackinnon': [3789, 3831], 'Hunt': [3791], 'Walliker': [3793], 'D.': [3794], '"High': [3795], '(pfmdr1)"': [3820], '183:1535-8.': [3826], 'Scholar45.': [3828], 'MJ,': [3832], 'Ali': [3833], 'E,': [3834], 'Nassir': [3835], 'el-KA,': [3836], 'Suleiman': [3837], '"Evolution': [3843], 'Drug-Resistance': [3845], 'Genes': [3846], 'Area': [3852], 'Seasonal': [3854], 'Transmission': [3856], 'Sudan"': [3859], '189:1239-44.': [3865], 'Scholar': [3867], 'Previous': [3868], 'article': [3869, 3871, 3940], 'Next': [3870], 'FiguresReferencesRelatedDetails': [3872], 'Volume': [3873], '30,': [3874], 'Issue': [3875], '3May–Jun': [3876], '2010': [3877, 3887], 'Metrics': [3878], 'History': [3879], 'Received1': [3880], 'November': [3881], '2009Accepted1': [3882], 'January': [3883], '2010Published': [3884], 'online3': [3885], 'June': [3886], 'AcknowledgementsThis': [3888], 'fully': [3891], 'supported': [3892], 'grant': [3895], 'Abdulaziz': [3898], 'City': [3899], 'Science': [3901], 'Technology': [3903], '(KACST)': [3904], '(LR-4-13).': [3905], 'authors': [3907], 'thank': [3908], 'Professor': [3909], 'N.': [3911], 'Al-Ahdal': [3912], 'his': [3914], 'critical': [3915], 'revision': [3916], 'manuscript': [3919], 'Damian': [3921], 'Dela': [3922], 'Cruz': [3923], 'Marie': [3925], 'Bohol': [3926], 'expert': [3928], 'technical': [3929], 'assistance.InformationCopyright': [3930], '©': [3931], '2010,': [3932], 'Annals': [3933], 'MedicineThis': [3936], 'open-access': [3939], 'distributed': [3941], 'terms': [3944], 'Creative': [3947], 'Commons': [3948], 'Attribution': [3949], 'License,': [3950], 'permits': [3952], 'unrestricted': [3953], 'use,': [3954], 'distribution,': [3955], 'reproduction': [3957], 'any': [3959], 'medium,': [3960], 'provided': [3961], 'work': [3964], 'properly': [3966], 'cited.PDF': [3967], 'download': [3968]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W1970947265', 'counts_by_year': [{'year': 2024, 'cited_by_count': 1}, {'year': 2023, 'cited_by_count': 1}, {'year': 2022, 'cited_by_count': 1}, {'year': 2021, 'cited_by_count': 3}, {'year': 2020, 'cited_by_count': 1}, {'year': 2019, 'cited_by_count': 1}, {'year': 2015, 'cited_by_count': 4}, {'year': 2014, 'cited_by_count': 1}, {'year': 2013, 'cited_by_count': 1}, {'year': 2012, 'cited_by_count': 3}], 'updated_date': '2024-12-16T07:24:55.310736', 'created_date': '2016-06-24'}