Evidence for a Six-transmembrane Domain Structure of Presenilin 1

Name: Work Video:
Duration: 3 min 30 s
Sylvain Lehmann; Roberto Chiesa; David A. Harris
{'id': 'https://openalex.org/W2070654470', 'doi': 'https://doi.org/10.1074/jbc.272.18.12047', 'title': 'Evidence for a Six-transmembrane Domain Structure of Presenilin 1', 'display_name': 'Evidence for a Six-transmembrane Domain Structure of Presenilin 1', 'publication_year': 1997, 'publication_date': '1997-05-01', 'ids': {'openalex': 'https://openalex.org/W2070654470', 'doi': 'https://doi.org/10.1074/jbc.272.18.12047', 'mag': '2070654470', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/9115271'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.272.18.12047', 'pdf_url': 'http://www.jbc.org/article/S0021925818405546/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925818405546/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5026244795', 'display_name': 'Sylvain Lehmann', 'orcid': 'https://orcid.org/0000-0001-6117-562X'}, 'institutions': [{'id': 'https://openalex.org/I204465549', 'display_name': 'Washington University in St. Louis', 'ror': 'https://ror.org/01yc7t268', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I204465549']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Sylvain Lehmann', 'raw_affiliation_strings': ['From the Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri, 63110'], 'affiliations': [{'raw_affiliation_string': 'From the Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri, 63110', 'institution_ids': ['https://openalex.org/I204465549']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5028263534', 'display_name': 'Roberto Chiesa', 'orcid': 'https://orcid.org/0000-0002-3842-3733'}, 'institutions': [{'id': 'https://openalex.org/I204465549', 'display_name': 'Washington University in St. Louis', 'ror': 'https://ror.org/01yc7t268', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I204465549']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Roberto Chiesa', 'raw_affiliation_strings': ['From the Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri, 63110'], 'affiliations': [{'raw_affiliation_string': 'From the Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri, 63110', 'institution_ids': ['https://openalex.org/I204465549']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5032728621', 'display_name': 'David A. Harris', 'orcid': 'https://orcid.org/0000-0002-6985-5790'}, 'institutions': [{'id': 'https://openalex.org/I204465549', 'display_name': 'Washington University in St. Louis', 'ror': 'https://ror.org/01yc7t268', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I204465549']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'David A. Harris', 'raw_affiliation_strings': ['From the Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri, 63110'], 'affiliations': [{'raw_affiliation_string': 'From the Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri, 63110', 'institution_ids': ['https://openalex.org/I204465549']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 15.228, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 154, 'citation_normalized_percentile': {'value': 0.852156, 'is_in_top_1_percent': False, 'is_in_top_10_percent': False}, 'cited_by_percentile_year': {'min': 97, 'max': 98}, 'biblio': {'volume': '272', 'issue': '18', 'first_page': '12047', 'last_page': '12051'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10086', 'display_name': "Alzheimer's disease research and treatments", 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2737', 'display_name': 'Physiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10086', 'display_name': "Alzheimer's disease research and treatments", 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2737', 'display_name': 'Physiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T10617', 'display_name': 'Cellular transport and secretion', 'score': 0.9979, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11150', 'display_name': 'Endoplasmic Reticulum Stress and Disease', 'score': 0.9905, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [], 'concepts': [{'id': 'https://openalex.org/C175344181', 'wikidata': 'https://www.wikidata.org/wiki/Q907198', 'display_name': 'Presenilin', 'level': 4, 'score': 0.6562743}, {'id': 'https://openalex.org/C118892022', 'wikidata': 'https://www.wikidata.org/wiki/Q7834587', 'display_name': 'Transmembrane domain', 'level': 3, 'score': 0.5955371}, {'id': 'https://openalex.org/C24530287', 'wikidata': 'https://www.wikidata.org/wiki/Q424204', 'display_name': 'Transmembrane protein', 'level': 3, 'score': 0.5176016}, {'id': 'https://openalex.org/C36503486', 'wikidata': 'https://www.wikidata.org/wiki/Q11235244', 'display_name': 'Domain (mathematical analysis)', 'level': 2, 'score': 0.47017282}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.46588153}, {'id': 'https://openalex.org/C70721500', 'wikidata': 'https://www.wikidata.org/wiki/Q177005', 'display_name': 'Computational biology', 'level': 1, 'score': 0.41505513}, {'id': 'https://openalex.org/C12554922', 'wikidata': 'https://www.wikidata.org/wiki/Q7100', 'display_name': 'Biophysics', 'level': 1, 'score': 0.37624907}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.34549528}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.23279285}, {'id': 'https://openalex.org/C71924100', 'wikidata': 'https://www.wikidata.org/wiki/Q11190', 'display_name': 'Medicine', 'level': 0, 'score': 0.17958632}, {'id': 'https://openalex.org/C33923547', 'wikidata': 'https://www.wikidata.org/wiki/Q395', 'display_name': 'Mathematics', 'level': 0, 'score': 0.13670555}, {'id': 'https://openalex.org/C126322002', 'wikidata': 'https://www.wikidata.org/wiki/Q11180', 'display_name': 'Internal medicine', 'level': 1, 'score': 0.124828756}, {'id': 'https://openalex.org/C41625074', 'wikidata': 'https://www.wikidata.org/wiki/Q176088', 'display_name': 'Membrane', 'level': 2, 'score': 0.086942166}, {'id': 'https://openalex.org/C170493617', 'wikidata': 'https://www.wikidata.org/wiki/Q208467', 'display_name': 'Receptor', 'level': 2, 'score': 0.07582322}, {'id': 'https://openalex.org/C502032728', 'wikidata': 'https://www.wikidata.org/wiki/Q11081', 'display_name': "Alzheimer's disease", 'level': 3, 'score': 0.07159677}, {'id': 'https://openalex.org/C2779134260', 'wikidata': 'https://www.wikidata.org/wiki/Q12136', 'display_name': 'Disease', 'level': 2, 'score': 0.0}, {'id': 'https://openalex.org/C134306372', 'wikidata': 'https://www.wikidata.org/wiki/Q7754', 'display_name': 'Mathematical analysis', 'level': 1, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': True}, {'descriptor_ui': 'D017433', 'descriptor_name': 'Protein Structure, Secondary', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D017398', 'descriptor_name': 'Alternative Splicing', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000544', 'descriptor_name': 'Alzheimer Disease', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000544', 'descriptor_name': 'Alzheimer Disease', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D000595', 'descriptor_name': 'Amino Acid Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001483', 'descriptor_name': 'Base Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019556', 'descriptor_name': 'COS Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002462', 'descriptor_name': 'Cell Membrane', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002462', 'descriptor_name': 'Cell Membrane', 'qualifier_ui': 'Q000648', 'qualifier_name': 'ultrastructure', 'is_major_topic': False}, {'descriptor_ui': 'D017931', 'descriptor_name': 'DNA Primers', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004285', 'descriptor_name': 'Dogs', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005091', 'descriptor_name': 'Exons', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006031', 'descriptor_name': 'Glycosylation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': 'Q000096', 'qualifier_name': 'biosynthesis', 'is_major_topic': False}, {'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D008861', 'descriptor_name': 'Microsomes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008861', 'descriptor_name': 'Microsomes', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D008961', 'descriptor_name': 'Models, Structural', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008969', 'descriptor_name': 'Molecular Sequence Data', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009154', 'descriptor_name': 'Mutation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010179', 'descriptor_name': 'Pancreas', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010179', 'descriptor_name': 'Pancreas', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D053764', 'descriptor_name': 'Presenilin-1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011388', 'descriptor_name': 'Prolactin', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011388', 'descriptor_name': 'Prolactin', 'qualifier_ui': 'Q000096', 'qualifier_name': 'biosynthesis', 'is_major_topic': False}, {'descriptor_ui': 'D014176', 'descriptor_name': 'Protein Biosynthesis', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011993', 'descriptor_name': 'Recombinant Fusion Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011993', 'descriptor_name': 'Recombinant Fusion Proteins', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D011993', 'descriptor_name': 'Recombinant Fusion Proteins', 'qualifier_ui': 'Q000096', 'qualifier_name': 'biosynthesis', 'is_major_topic': False}, {'descriptor_ui': 'D011994', 'descriptor_name': 'Recombinant Proteins', 'qualifier_ui': 'Q000096', 'qualifier_name': 'biosynthesis', 'is_major_topic': False}, {'descriptor_ui': 'D011994', 'descriptor_name': 'Recombinant Proteins', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D011994', 'descriptor_name': 'Recombinant Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014158', 'descriptor_name': 'Transcription, Genetic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014162', 'descriptor_name': 'Transfection', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.272.18.12047', 'pdf_url': 'http://www.jbc.org/article/S0021925818405546/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/9115271', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.272.18.12047', 'pdf_url': 'http://www.jbc.org/article/S0021925818405546/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 31, 'referenced_works': ['https://openalex.org/W1586011710', 'https://openalex.org/W1598597771', 'https://openalex.org/W1972706019', 'https://openalex.org/W1975304761', 'https://openalex.org/W1981845572', 'https://openalex.org/W1990668385', 'https://openalex.org/W1995592117', 'https://openalex.org/W1997074474', 'https://openalex.org/W2005681172', 'https://openalex.org/W2020063796', 'https://openalex.org/W2025242397', 'https://openalex.org/W2027543801', 'https://openalex.org/W2035189018', 'https://openalex.org/W2038697935', 'https://openalex.org/W2040091117', 'https://openalex.org/W2045153164', 'https://openalex.org/W2046209489', 'https://openalex.org/W2053156705', 'https://openalex.org/W2053303814', 'https://openalex.org/W2070068402', 'https://openalex.org/W2073776794', 'https://openalex.org/W2075175573', 'https://openalex.org/W2081998222', 'https://openalex.org/W2083633251', 'https://openalex.org/W2095745901', 'https://openalex.org/W2101077392', 'https://openalex.org/W2128931247', 'https://openalex.org/W2144907624', 'https://openalex.org/W2166797577', 'https://openalex.org/W591207719', 'https://openalex.org/W647709929'], 'related_works': ['https://openalex.org/W4251950681', 'https://openalex.org/W4226003420', 'https://openalex.org/W3139212548', 'https://openalex.org/W2950908918', 'https://openalex.org/W2085284578', 'https://openalex.org/W2069507816', 'https://openalex.org/W2063733034', 'https://openalex.org/W2063622603', 'https://openalex.org/W2008793857', 'https://openalex.org/W1991518782'], 'abstract_inverted_index': {'Mutations': [0, 176], 'in': [1, 60, 91, 101, 111, 146, 177, 236, 267, 277, 287, 322, 431, 452, 475, 695, 722, 918, 923, 1107, 1112, 1217, 1223, 1285, 1297, 1372, 1578, 1596, 1606, 1622, 1627, 1679, 1753, 1775, 1781, 2246, 2283, 2312, 2470, 2509, 2523, 2580, 2623, 2713, 2731, 2878, 2970, 3007, 3021, 3049, 3129, 3131, 3137, 3193, 3196, 3436, 3509, 3513, 3524, 3543, 3562, 3569, 3645, 3652, 3672, 3675, 3684, 3745, 3797, 3808, 3926, 4093, 4174, 4189, 4249, 4280, 4307, 4336, 4359, 4408, 4652], 'genes': [2, 178], 'encoding': [3, 179, 479, 2133, 3003], 'presenilin': [4, 7, 80, 134, 163, 180, 183, 256, 310, 339, 374, 377, 405, 408, 485, 489, 697, 1374, 2053], '1': [5, 81, 135, 181, 257, 311, 486, 2308, 2368, 2519, 2725, 2745, 3180, 4163], 'and': [6, 29, 108, 122, 143, 165, 182, 205, 284, 298, 319, 341, 429, 438, 455, 460, 488, 496, 734, 740, 927, 1110, 1172, 1215, 1287, 1360, 1366, 1603, 1625, 1752, 1771, 1804, 1993, 2165, 2212, 2228, 2254, 2270, 2278, 2366, 2399, 2449, 2453, 2521, 2544, 2562, 2583, 2631, 2641, 2674, 2678, 2865, 2906, 3056, 3100, 3181, 3195, 3199, 3301, 3340, 3418, 3427, 3456, 3489, 3534, 3668, 3674, 3689, 3701, 3704, 3716, 3795, 3913, 4082, 4091, 4104, 4133, 4156, 4169, 4194, 4226, 4246, 4267, 4302, 4310, 4330, 4347, 4378, 4612, 4614, 4658, 4664, 4782, 4797, 4816, 4830, 4833, 4846], '2': [8, 184, 490, 2375, 3072, 3152, 3157, 3177, 3329, 3353, 3373, 3417], 'account': [9, 185], 'for': [10, 186, 1612, 1802, 2051, 2139, 2142, 2145, 2148, 2151, 2154, 2157, 2160, 2163, 2167, 2210, 2307, 2461, 2550, 2612, 2659, 2693, 2766, 3188, 3752, 3789, 3937, 4119, 4232, 4240, 4315, 4650, 4788, 4808, 4820, 4824, 4836, 4852], 'the': [11, 26, 34, 39, 43, 85, 119, 125, 141, 147, 155, 162, 171, 187, 202, 210, 215, 219, 261, 295, 301, 317, 323, 331, 338, 347, 432, 480, 685, 696, 1056, 1100, 1108, 1113, 1120, 1169, 1227, 1292, 1342, 1347, 1351, 1373, 1379, 1572, 1576, 1585, 1589, 1598, 1619, 1623, 1628, 1631, 1639, 1654, 1661, 1675, 1680, 1683, 1687, 1693, 1705, 1708, 1713, 1717, 1733, 1744, 1761, 1764, 1776, 1789, 2052, 2084, 2093, 2123, 2128, 2131, 2134, 2173, 2180, 2217, 2229, 2284, 2291, 2313, 2325, 2400, 2416, 2541, 2615, 2624, 2691, 2714, 2722, 2776, 2809, 2813, 2852, 2860, 2871, 2879, 2882, 2889, 2929, 2987, 2995, 3004, 3013, 3037, 3050, 3060, 3083, 3130, 3138, 3305, 3321, 3347, 3388, 3409, 3422, 3433, 3450, 3463, 3469, 3473, 3494, 3520, 3544, 3560, 3579, 3588, 3607, 3620, 3626, 3662, 3678, 3692, 3695, 3698, 3707, 3710, 3714, 3733, 3742, 3746, 3785, 3798, 3802, 3906, 3921, 3945, 3949, 3955, 3963, 3969, 3976, 3988, 4073, 4077, 4085, 4094, 4120, 4147, 4180, 4202, 4206, 4210, 4213, 4221, 4233, 4241, 4244, 4256, 4264, 4287, 4293, 4298, 4308, 4326, 4331, 4360, 4365, 4370, 4404, 4610, 4619, 4747, 4766, 4769, 4792, 4801, 4809, 4849, 4855], 'majority': [12, 188], 'of': [13, 15, 33, 38, 57, 70, 84, 118, 124, 158, 161, 173, 189, 191, 209, 214, 233, 246, 260, 294, 300, 334, 337, 349, 434, 468, 547, 684, 687, 718, 738, 921, 1077, 1095, 1229, 1279, 1341, 1350, 1355, 1378, 1571, 1575, 1584, 1593, 1600, 1618, 1630, 1641, 1671, 1674, 1686, 1695, 1707, 1712, 1716, 1735, 1743, 1747, 1791, 1997, 2043, 2068, 2122, 2130, 2172, 2179, 2185, 2286, 2296, 2304, 2317, 2324, 2334, 2342, 2385, 2415, 2472, 2526, 2628, 2639, 2654, 2672, 2682, 2690, 2707, 2716, 2740, 2753, 2790, 2796, 2812, 2881, 2931, 2934, 2972, 2976, 2986, 3015, 3052, 3066, 3082, 3140, 3320, 3387, 3412, 3453, 3465, 3519, 3547, 3566, 3587, 3591, 3614, 3664, 3680, 3735, 3748, 3909, 3941, 3948, 3965, 3971, 3978, 3990, 3993, 4025, 4084, 4102, 4144, 4167, 4183, 4186, 4205, 4212, 4224, 4235, 4243, 4255, 4259, 4286, 4297, 4320, 4328, 4333, 4355, 4364, 4403, 4607, 4626, 4672, 4765, 4772, 4791, 4795, 4800, 4848], 'cases': [14, 190, 686], 'early-onset': [16, 192, 688], 'familial': [17, 193, 689], "Alzheimer's": [18, 174, 194, 350, 352, 360, 391, 453, 548], 'disease.': [19, 175, 195, 351], 'The': [20, 196, 699, 1035, 2065, 2113, 2118, 2169, 2197, 2202, 2220, 2235, 2408, 2747, 2892, 3333, 3357, 3390, 4165, 4628, 4667], 'presenilins': [21, 197, 1036, 1655, 1688, 1718, 4309], 'have': [22, 53, 95, 198, 229, 271, 470, 702, 746, 2728, 2761, 2792, 2896, 2923, 3648, 3958], 'been': [23, 199, 471, 703, 2924, 3104, 3186, 3650, 3984], 'localized': [24, 200, 1167], 'to': [25, 79, 127, 154, 170, 201, 255, 303, 330, 346, 473, 693, 925, 1040, 1072, 1168, 1647, 1700, 1784, 2280, 2339, 2465, 2540, 2599, 2700, 2888, 2909, 2927, 3025, 3036, 3202, 3369, 3459, 3479, 3493, 3559, 3585, 3642, 3697, 3709, 3986, 4292, 4395, 4716, 4723, 4758, 4762, 4778], 'endoplasmic': [27, 203, 380, 411], 'reticulum': [28, 204], 'Golgi,': [30, 206], 'but': [31, 207, 1116, 1290, 2038, 3403, 3467, 4644, 4750], 'which': [32, 61, 208, 237, 1582, 1616, 1626, 1672, 2205, 2732, 2759, 2884, 4190, 4713], 'multiple': [35, 211, 747], 'hydrophobic': [36, 212, 369, 400, 748, 2742, 3475, 4160], 'segments': [37, 139, 213, 315, 749, 1673, 2010, 2067, 2706, 3476, 3738, 4173, 4275], 'polypeptide': [40, 216, 1586, 1620, 1676, 2815, 2988, 4257, 4366], 'chain': [41, 217, 1587, 1677, 2989, 4258, 4367], 'span': [42, 218, 2721, 3691], 'lipid': [44, 220, 1590, 2996, 3495, 3743, 4748], 'bilayer': [45, 221, 3496, 3744], 'is': [46, 77, 222, 253, 417, 423, 1102, 1166, 1208, 1232, 1300, 1592, 1729, 2736, 2749, 2885, 2980, 3134, 3147, 3200, 3425, 3428, 3602, 3814, 3940, 3952, 4151, 4157, 4196, 4217, 4261, 4304, 4645, 4714, 4736], 'unclear.': [47, 223], 'To': [48, 224, 3506], 'address': [49, 225, 3732], 'this': [50, 226, 1230, 1298, 2794, 3183, 4199, 4316, 4598, 4734], 'question,': [51, 227], 'we': [52, 130, 228, 306, 2760, 2895, 3439, 3516, 3915, 3957], 'constructed': [54, 230, 2729], 'a': [55, 62, 231, 238, 418, 919, 1041, 1074, 1156, 1163, 1669, 1721, 1998, 2044, 2077, 2079, 2190, 2263, 2436, 2600, 2604, 2733, 2750, 2799, 2900, 2910, 2932, 2973, 3008, 3311, 3460, 3541, 3598, 3615, 3933, 3972, 3991, 4117, 4184, 4268, 4373, 4397, 4640, 4648, 4725, 4760, 4785], 'series': [56, 232], 'chimeric': [58, 234], 'molecules': [59, 235, 4358, 4781], 'topologically': [63, 239, 2886], 'neutral': [64, 240], 'reporter': [65, 126, 241, 302, 2170, 2230, 2735, 2748, 2861, 2911, 3973], 'protein': [66, 242, 483, 1042, 1076, 1101, 1294, 1375, 1762, 2405, 2446, 2901, 3143, 3351, 3609, 3951, 4207, 4245], '(a': [67, 243], 'C-terminal': [68, 244, 2182, 2751, 4270, 4726], 'fragment': [69, 245, 1382, 2231, 2752, 3313, 3335, 3358, 3392, 3600, 4407, 4727, 4735], 'prolactin)': [71, 247], 'containing': [72, 104, 248, 280, 2394, 2514], 'three': [73, 249, 476, 2207, 2763, 3307, 3593], 'artificial': [74, 250, 2903], 'glycosylation': [75, 120, 251, 296, 2904, 3128, 3565, 3665, 3791, 3980], 'sites': [76, 121, 252, 297, 2209, 2765, 2905, 3788, 3981], 'fused': [78, 254, 2737], 'following': [82, 258, 2135, 2417, 3610, 4718], 'each': [83, 259, 2597, 2739, 3518], '10': [86, 262, 2705], 'potential': [87, 156, 263, 332], 'transmembrane': [88, 138, 264, 314, 1800, 2009, 3474, 3725, 4065, 4128, 4172, 4620, 4731], 'domains': [89, 265, 1617, 1801, 4066], 'identified': [90, 266], 'hydrophobicity': [92, 268, 1736, 1792], 'plots.': [93, 269, 1737], 'We': [94, 270, 1738, 2727, 2961, 2998, 3161, 3527, 4135, 4251, 4804, 4839], 'expressed': [96, 272, 917, 1161, 3517, 3807], 'these': [97, 167, 273, 343, 1601, 1642, 1702, 2741, 2965, 3508, 3548, 3567, 3592, 3737, 4352], 'chimeras': [98, 274, 2070, 2174, 2730, 3006, 3308, 3568], 'by': [99, 109, 275, 285, 425, 930, 1055, 1383, 2073, 2097, 2127, 2177, 2290, 2322, 2431, 2451, 2586, 2676, 2781, 2917, 3106, 3540, 4400], 'translation': [100, 276, 2297, 2335, 3046, 3146, 3323, 3511, 3813], 'reticulocyte': [102, 278, 2268, 2647, 3009, 3563], 'lysate': [103, 279, 2269, 2648, 3010], 'canine': [105, 281, 2271, 3016], 'pancreatic': [106, 282, 2272, 3017], 'microsomes': [107, 283, 2273, 3150, 3362], 'synthesis': [110, 286], 'transfected': [112, 288, 1096, 1218, 1358, 2533, 3197, 3621, 3653], 'COS': [113, 289, 2683, 3525, 3570], 'cells.': [114, 290, 3526], 'Based': [115, 291, 3431], 'on': [116, 292, 492, 1050, 1119, 1732, 1788, 2310, 2603, 2857, 3173, 3432, 3962, 4139, 4740, 4826, 4854], 'utilization': [117, 293, 3667], 'sensitivity': [123, 299], 'protease': [128, 304, 2326, 2363, 2395, 2573, 3370, 3669], 'digestion,': [129, 305], 'provide': [131, 307, 2968, 4784], 'evidence': [132, 308, 1204, 1344, 2969], 'that': [133, 309, 422, 701, 745, 1099, 1206, 1276, 1363, 1369, 1651, 1760, 1794, 2002, 2718, 2775, 2806, 2913, 2963, 2983, 3163, 3309, 3378, 3421, 3441, 3468, 3530, 3578, 3601, 3804, 3918, 3944, 4058, 4142, 4198, 4220, 4253, 4351, 4636, 4728], 'has': [136, 312, 3103, 3185, 3920, 3982, 4060, 4237], 'six': [137, 313, 1766, 2006, 4062], 'with': [140, 316, 1653, 1692, 1725, 1768, 1992, 2225, 2232, 2252, 2258, 2327, 2362, 2404, 2413, 2445, 2534, 2553, 2559, 2566, 2620, 2651, 2669, 2687, 2902, 2994, 3032, 3093, 3149, 3315, 3325, 3365, 3396, 3405, 3552, 3583, 3741, 3801, 4023, 4076, 4282, 4357, 4385, 4647, 4746], 'N': [142, 318, 1770, 3410, 3423, 3451, 3715, 4078], 'C': [144, 320, 1772, 3717, 4080, 4294], 'termini': [145, 321, 1773, 3718], 'cytoplasm.': [148, 324, 1681, 1777, 4095, 4361], 'This': [149, 325, 1778, 3782], 'model': [150, 326, 1779, 2975, 3679, 3783, 4118, 4231, 4630], 'provides': [151, 327], 'important': [152, 328, 4238, 4279], 'clues': [153, 329, 1699], 'functions': [157, 333, 1296, 4314, 4638], 'different': [159, 335, 477, 708, 3953], 'parts': [160, 336, 1583], 'molecule': [164, 340, 2912], 'how': [166, 342, 1701, 4741], 'might': [168, 344, 2807, 4349], 'relate': [169, 345], 'pathogenesis': [172, 348], 'disease': [353], '(AD)': [354], '1The': [355, 386], 'abbreviations': [356, 387], 'used': [357, 388, 2279, 2925], 'are:': [358, 389], 'AD,': [359, 390], 'disease;': [361, 392], 'APP,': [362, 393, 4396], 'amyloid': [363, 394, 436, 481], 'precursor': [364, 395, 482], 'protein;': [365, 396], 'HA,': [366, 397], 'hemagglutinin;': [367, 398], 'HR,': [368, 399], 'region;': [370, 401], 'PRL,': [371, 402], 'prolactin;': [372, 403], 'PS1,': [373, 404, 3938], '1;': [375, 406], 'PS2,': [376, 407, 3914], '2;': [378, 409, 3155], 'ER,': [379, 410, 1109, 2883], 'reticulum;': [381, 412], 'PAGE,': [382, 413], 'polyacrylamide': [383, 414], 'gel': [384, 415], 'electrophoresis.': [385, 416], 'debilitating': [419], 'neurodegenerative': [420], 'disorder': [421], 'characterized': [424], 'dementia,': [426], 'neuronal': [427, 1157], 'loss,': [428], 'accumulation': [430], 'brain': [433, 926, 1224], 'extracellular': [435, 2890], 'plaques': [437], 'intraneuronal': [439], 'neurofibrillary': [440], 'tangles': [441], '(1Iqbal': [442], 'K': [443, 2294, 2622, 3327, 3443, 3612], 'Mortimer': [444], 'J.A.': [445, 2832, 3109, 3498, 3757], 'Winblad': [446], 'B.': [447, 586, 818, 960, 1303, 1412, 1560, 1874, 4440, 4588], 'Wisniewski': [448], 'H.M.': [449], 'Research': [450], 'Advances': [451], 'Disease': [454, 1025, 2103], 'Related': [456], 'Disorders.': [457], 'John': [458], 'Wiley': [459], 'Sons,': [461], 'Chichester,': [462], 'United': [463], 'Kingdom2012Google': [464], 'Scholar).': [465, 681, 732, 913, 1034, 1067, 1091, 1154, 1202, 1272, 1337, 1569, 1987, 2064, 2504, 2850, 2960, 3298, 3505, 3781, 3904, 4018], 'Familial': [466], 'forms': [467, 1278, 3081, 4799], 'AD': [469, 690], 'linked': [472], 'mutations': [474, 694, 700, 1371, 1703, 4322], 'genes,': [478], '(APP),': [484], '(PS1),': [487], '(PS2)': [491], 'chromosomes': [493], '21,': [494], '14,': [495], '1,': [497], 'respectively': [498], '(2Levy-Lahad': [499, 750, 1806], 'E.': [500, 528, 751, 779, 1311, 1330, 1504, 1506, 1510, 1807, 1835, 4532, 4534, 4538], 'Wasco': [501, 657, 752, 889, 1147, 1318, 1517, 1808, 1945, 3233, 4545], 'W.': [502, 658, 753, 890, 1148, 1390, 1502, 1518, 1809, 1946, 3234, 3273, 3879, 4418, 4530, 4546], 'Poorkaj': [503, 754, 1511, 1810, 4539], 'P.': [504, 755, 1002, 1307, 1328, 1402, 1426, 1429, 1512, 1811, 3279, 3885, 4430, 4454, 4457, 4540], 'Romano': [505, 756, 1812], 'D.M.': [506, 757, 1124, 1813, 3210], 'Oshima': [507, 758, 1814], 'J.': [508, 759, 992, 998, 1008, 1085, 1255, 1420, 1498, 1542, 1562, 1815, 1980, 2824, 2844, 3121, 3275, 3881, 4448, 4526, 4570, 4590, 4695], 'Pettingell': [509, 760, 1816], 'W.H.': [510, 761, 1817], 'Yu': [511, 762, 1537, 1818, 4565], 'C.E.': [512, 763, 1819], 'Jondro': [513, 764, 1820], 'P.D.': [514, 765, 1821], 'Schmidt': [515, 766, 1822], 'S.D.': [516, 767, 1823], 'Wang': [517, 768, 987, 1460, 1824, 4488], 'K.': [518, 578, 628, 769, 810, 860, 952, 1305, 1398, 1532, 1825, 1866, 1916, 2488, 3859, 4426, 4560], 'Crowley': [519, 770, 1826], 'A.C.': [520, 636, 771, 868, 1827, 1924], 'Fu': [521, 772, 1828], 'Y.H.': [522, 773, 1829], 'Guenette': [523, 774, 1830], 'Y.': [524, 572, 614, 775, 804, 846, 946, 1548, 1831, 1860, 1902, 2490, 2494, 3861, 3865, 4576], 'Galas': [525, 776, 1832], 'D.': [526, 594, 650, 777, 826, 882, 968, 1060, 1388, 1406, 1424, 1431, 1484, 1522, 1550, 1552, 1833, 1882, 1938, 4416, 4434, 4452, 4459, 4512, 4550, 4578, 4580], 'Nemens': [527, 778, 1834], 'Wijsman': [529, 780, 1836], 'E.M.': [530, 781, 1837], 'Bird': [531, 782, 1495, 1838, 4523], 'T.D.': [532, 783, 1496, 1839, 4524], 'Schellenberg': [533, 784, 1513, 1840, 4541], 'G.D.': [534, 785, 1841], 'Tanzi': [535, 666, 786, 898, 1145, 1184, 1515, 1842, 1954, 3231, 3251, 3827, 4543], 'R.E.': [536, 667, 787, 899, 1146, 1185, 1843, 1955, 2817, 3232, 3252, 3828], 'Science.': [537, 788, 1322, 1333, 1844], '1995;': [538, 605, 678, 789, 837, 910, 979, 1020, 1064, 1845, 1893, 1966, 1984, 2836, 3113, 3502, 3761, 3778], '269:': [539, 790, 1846], '973-977Google': [540, 791, 1847], 'Scholar,': [541, 560, 608, 792, 840, 982, 1023, 1326, 1437, 1482, 1530, 1848, 1896, 1969, 2830, 2839, 2948, 3116, 3240, 3269, 3764, 3845, 3875, 4465, 4510, 4558], '3Busfield': [542], 'F.': [543, 553, 1249, 1447, 2426, 2486, 3857, 4475, 4689, 4818], 'Goate': [544, 550, 2100, 4807], 'A.M.': [545, 551], 'Pathobiology': [546], 'Disease.in:': [549], 'Ashall': [552], 'Academic': [554], 'Press,': [555], 'San': [556], 'Diego,': [557], 'CA1995:': [558], '59-75Google': [559], '4Rogaev': [561, 793, 1849], 'E.I.': [562, 612, 794, 844, 936, 1850, 1900], 'Sherrington': [563, 795, 937, 1409, 1851, 4437], 'R.': [564, 610, 796, 842, 938, 1140, 1408, 1410, 1416, 1461, 1516, 1852, 1898, 2834, 3111, 3226, 3500, 3759, 3776, 4436, 4438, 4444, 4489, 4544], 'Rogaeva': [565, 615, 797, 847, 939, 1853, 1903], 'E.A.': [566, 616, 798, 848, 940, 1854, 1904], 'Levesque': [567, 617, 799, 849, 941, 1395, 1855, 1905, 4423], 'G.': [568, 618, 626, 800, 850, 858, 942, 990, 1000, 1235, 1245, 1392, 1396, 1441, 1453, 1514, 1856, 1906, 1914, 1973, 2014, 4032, 4420, 4424, 4469, 4481, 4542, 4675, 4685], 'Ikeda': [569, 619, 801, 851, 943, 1857, 1907], 'M.': [570, 620, 802, 852, 944, 984, 1004, 1253, 1386, 1400, 1463, 1488, 1492, 1500, 1508, 1544, 1858, 1908, 2022, 2026, 2480, 2482, 2939, 3291, 3766, 3851, 3853, 3897, 3998, 4040, 4044, 4414, 4428, 4491, 4516, 4520, 4528, 4536, 4572, 4693], 'Liang': [571, 613, 803, 845, 945, 1859, 1901], 'Chi': [573, 621, 805, 853, 947, 1861, 1909], 'H.': [574, 622, 806, 854, 948, 986, 1414, 1862, 1910, 2496, 3867, 4442], 'Lin': [575, 623, 807, 855, 949, 1863, 1911], 'C.': [576, 624, 725, 808, 856, 950, 994, 1016, 1078, 1251, 1486, 1534, 1536, 1864, 1912, 2941, 3281, 3768, 3887, 4000, 4121, 4339, 4514, 4562, 4564, 4691], 'Holman': [577, 627, 809, 859, 951, 1865, 1915], 'Tsuda': [579, 629, 811, 861, 953, 1867, 1917], 'T.': [580, 630, 812, 862, 954, 1247, 1313, 1394, 1449, 1868, 1918, 2020, 2484, 2492, 3855, 3863, 4038, 4422, 4477, 4687], 'Mar': [581, 631, 813, 863, 955, 1869, 1919], 'L.': [582, 590, 596, 632, 644, 646, 814, 822, 828, 864, 876, 878, 956, 964, 970, 1014, 1243, 1321, 1332, 1520, 1546, 1556, 1558, 1870, 1878, 1884, 1920, 1932, 1934, 4548, 4574, 4584, 4586, 4683], 'Sorbi': [583, 639, 815, 871, 957, 1871, 1927], 'S.': [584, 588, 640, 654, 816, 820, 872, 886, 958, 962, 1082, 1197, 1422, 1455, 1459, 1475, 1524, 1564, 1872, 1876, 1928, 1942, 2943, 3264, 3770, 3840, 4002, 4450, 4483, 4487, 4503, 4552, 4592], 'Nacmias': [585, 817, 959, 1873], 'Placentini': [587, 819, 961, 1875], 'Amaducci': [589, 821, 963, 1877], 'Chumakov': [591, 647, 823, 879, 965, 1879, 1935], 'I.': [592, 642, 648, 824, 874, 880, 966, 1062, 1418, 1880, 1930, 1936, 2059, 4109, 4446], 'Cohen': [593, 825, 967, 1881], 'Lannfelt': [595, 827, 969, 1519, 1883, 4547], 'Fraser': [597, 670, 829, 902, 971, 1425, 1885, 1958, 4453], 'P.E.': [598, 671, 830, 903, 972, 1886, 1959], 'Rommens': [599, 672, 831, 904, 973, 1419, 1887, 1960, 4447], 'J.M.': [600, 673, 832, 905, 974, 1888, 1961], 'St.': [601, 674, 833, 906, 975, 1427, 1889, 1962, 3282, 3888, 4455], 'George-Hyslop': [602, 675, 834, 907, 976, 1428, 1890, 1963, 4456], 'P.H.': [603, 676, 835, 908, 977, 1891, 1964, 3285, 3891], 'Nature.': [604, 677, 836, 909, 978, 1063, 1565, 1892, 1965, 4593], '376:': [606, 838, 980, 1894], '775-778Google': [607, 839, 981, 1895], '5Sherrington': [609, 841, 1897], 'Rogaev': [611, 843, 1899], 'Li': [625, 857, 1913, 4103], 'Foncin': [633, 865, 1921], 'J.F.': [634, 866, 1922], 'Bruni': [635, 867, 1923], 'Montesi': [637, 869, 1925], 'M.P.': [638, 870, 1926], 'Rainero': [641, 873, 1929], 'Pinessi': [643, 875, 1931], 'Nee': [645, 877, 1933], 'Pollen': [649, 881, 1937], 'Brookes': [651, 883, 1939], 'A.,': [652, 884, 1940], 'P.,': [653, 885, 1941], 'Polinsky': [655, 887, 1943], 'R.J.': [656, 888, 1944], 'Da': [659, 891, 1947], 'Silva': [660, 892, 1948], 'H.A.R.': [661, 893, 1949], 'Haines': [662, 894, 1950], 'J.L.': [663, 895, 1951], 'Pericak-Vance': [664, 896, 1952], 'M.A.': [665, 897, 1953], 'Roses': [668, 900, 1956], 'A.D.': [669, 901, 1957], '375:': [679, 911, 1967], '754-760Google': [680, 912, 1968], 'Over': [682], '50%': [683], 'are': [691, 736, 916, 928, 1274, 1609, 1990, 2855, 3087, 3091, 3477, 3484, 3581, 3719, 4021, 4228, 4323, 4390, 4744], 'attributable': [692], 'genes.': [698], 'described': [704, 2289, 2570, 2635, 2645, 3751, 4669], 'include': [705], 'over': [706], '35': [707], 'amino': [709, 742, 1212, 2136, 2183, 2711, 3447, 3487, 4154], 'acid': [710], 'substitutions,': [711], 'as': [712, 714, 1220, 1222, 1660, 2076, 2189, 2288, 2569, 2634, 2644, 2768, 2770, 2783, 2785, 2798, 3169, 3398, 3400, 3538, 4171, 4639, 4655], 'well': [713, 1221, 2769, 2784, 3399], 'an': [715, 2048, 2213, 2524, 2771, 3205, 3383, 3406], 'in-frame': [716], 'deletion': [717, 4200], 'exon': [719, 2089], '9': [720], '(reviewed': [721, 4335], 'Ref.': [723, 4337], '6Haass': [724, 4338], 'Curr.': [726, 2953, 4011, 4340], 'Opin.': [727, 2954, 4012, 4341], 'Neurol.': [728, 4342], '1996;': [729, 1151, 1199, 1269, 1323, 1334, 1527, 1566, 2034, 2061, 2501, 3237, 3266, 3295, 3842, 3872, 3901, 4052, 4111, 4343, 4555, 4594, 4709], '9:': [730, 4344], '254-259Google': [731, 4345], 'PS1': [733, 1160, 1207, 1365, 1748, 1803, 2003, 2066, 2080, 2221, 2473, 2717, 3190, 3413, 3681, 3806, 3912, 4059, 4123, 4145, 4225, 4236, 4260, 4356, 4377, 4393, 4412, 4637, 4651, 4673, 4773, 4810], 'PS2': [735, 1280, 1805, 3919], 'polypeptides': [737], '467': [739], '448': [741], 'acids,': [743], 'respectively,': [744], 'These': [914, 3076, 4274], 'proteins': [915, 1602, 1650, 2474, 2564, 2632, 2777, 2854, 2937, 3019, 3040, 3166, 3523, 3549, 3580, 3595, 3630, 3755, 3996, 4380, 4389], 'number': [920, 2789, 2933, 3992, 4319], 'tissues': [922], 'addition': [924, 2638], 'encoded': [929, 2206], 'several': [931, 1610], 'alternatively': [932], 'spliced': [933], 'mRNAs': [934, 2256, 2282, 3002], '(4Rogaev': [935], '7Cruts': [983], 'Backhovens': [985], 'S.Y.': [988], 'Vangassen': [989], 'Theuns': [991], 'Dejonghe': [993], 'Wehnert': [995], 'A.': [996, 1198, 1404, 2012, 2425, 2476, 3265, 3841, 3847, 4030, 4432, 4817], 'Devoecht': [997], 'Dewinter': [999], 'Cras': [1001], 'Bruyland': [1003], 'Datson': [1005], 'N.': [1006, 1494, 2478, 3849, 4522], 'Weissenbach': [1007], 'Dendunnen': [1009], 'J.T.': [1010], 'Martin': [1011], 'J.J.': [1012], 'Hendriks': [1013], 'Vanbroeckhoven': [1015], 'Hum.': [1017], 'Mol.': [1018], 'Genet.': [1019], '4:': [1021], '2363-2371Google': [1022], "8Alzheimer's": [1024, 2102], 'Collaborative': [1026, 2104], 'Group,': [1027, 2105], 'Nat.': [1028, 1149, 1432, 1525, 2106, 3235, 4460, 4553], 'Genet.,': [1029, 2107], '11,': [1030, 2108], '1995,': [1031, 2109], '219,': [1032, 2110], '222.Google': [1033, 2111], 'exhibit': [1037], 'significant': [1038], 'homology': [1039, 1071, 3910], 'from': [1043, 2041, 2083, 2265, 2276, 2867, 2870, 3023, 3204, 3449, 3619, 3694, 3706, 3954, 4100, 4179, 4290], 'Caenorhabditis': [1044], 'elegans': [1045, 1079, 4122], 'called': [1046], 'SEL-12,': [1047, 4311], 'which,': [1048], 'based': [1049, 3961], 'genetic': [1051], 'evidence,': [1052], 'modulates': [1053], 'signaling': [1054], 'LIN-12/Notch': [1057], 'pathway': [1058], '(9Levitan': [1059], 'Greenwald': [1061, 2058, 4105, 4108], '377:': [1065], '351-354Google': [1066], 'They': [1068], 'show': [1069], 'weaker': [1070], 'SPE-4,': [1073], 'membrane': [1075, 1122, 1573, 1684, 1714, 1745, 1765, 2723, 2810, 2936, 2977, 3693, 3923, 3946, 3995, 4203, 4222, 4388, 4770], 'sperm': [1080], "(10L'Hernault": [1081], 'Arduengo': [1083], 'P.M.': [1084], 'Cell': [1086, 2845, 3122], 'Biol.': [1087, 2825, 2846, 2956, 3123, 4014], '1992;': [1088, 2847, 3124], '119:': [1089], '55-68Google': [1090], 'Immunofluorescence': [1092], 'localization': [1093, 3586], 'studies': [1094, 2791], 'cells': [1097, 1219, 2506, 2577, 2684, 3198, 3571, 3622, 3657, 3676, 3809, 4409], 'indicate': [1098, 1368], 'present': [1103], 'at': [1104, 2301, 2380, 2458, 2596, 2608, 2662, 2696, 2708], 'steady-state': [1105], 'primarily': [1106], 'perhaps': [1111], 'Golgi': [1114, 1634, 4613], 'also,': [1115], 'probably': [1117, 3481, 4616], 'not': [1118, 3059, 3381, 3404, 3632, 3638, 3723, 3731, 3815, 3983, 4070], 'plasma': [1121], '(11Kovacs': [1123, 3209], 'Fausett': [1125, 3211], 'H.J.': [1126, 3212], 'Page': [1127, 3213], 'K.J.': [1128, 3214], 'Kim': [1129, 1244, 1421, 1452, 3215, 4449, 4480, 4684], 'T.W.': [1130, 3216], 'Moir': [1131, 3217], 'R.D.': [1132, 1136, 3218, 3222], 'Merriam': [1133, 3219], 'D.E.': [1134, 3220], 'Hollister': [1135, 3221], 'Hallmark': [1137, 3223], 'O.G.': [1138, 3224], 'Mancini': [1139, 3225], 'Felsenstein': [1141, 1180, 3227, 3247, 3823], 'K.M.': [1142, 1181, 3228, 3248, 3824], 'Hyman': [1143, 3229], 'B.T.': [1144, 3230], 'Med.': [1150, 1433, 1526, 3236, 4461, 4554], '2:': [1152, 1528, 1985, 3238, 4556], '224-229Google': [1153, 3239], 'In': [1155, 3012, 3557], 'cell': [1158, 1170], 'line,': [1159], 'using': [1162, 1656, 1749, 2075, 2188, 2262], 'viral': [1164], 'vector': [1165], 'body': [1171], 'dendrites': [1173], '(12Cook': [1174, 3817], 'D.G.': [1175, 3242, 3818], 'Sung': [1176, 3243, 3819], 'J.C.': [1177, 3244, 3820], 'Golde': [1178, 3245, 3821], 'T.E.': [1179, 3246, 3822], 'Wojczyk': [1182, 3249, 3825], 'B.S.': [1183, 3250, 3826], 'Trojanowski': [1186, 3253, 3829], 'J.Q.': [1187, 3254, 3830], 'Lee': [1188, 1238, 1399, 1444, 1974, 3255, 3831, 4427, 4472, 4678], 'V.M.Y.': [1189, 3256, 3832], 'Doms': [1190, 3257, 3833], 'R.W.': [1191, 3258, 3834], 'Proc.': [1192, 3259, 3835], 'Natl.': [1193, 3260, 3836], 'Acad.': [1194, 3261, 3837], 'Sci.': [1195, 3262, 3838], 'U.': [1196, 3263, 3839], '93:': [1200, 3267, 3843], '9223-9228Google': [1201, 3268, 3844], 'Recent': [1203], 'indicates': [1205], 'proteolytically': [1209], 'cleaved': [1210], 'between': [1211, 3472, 3911, 4072, 4088, 4300, 4325, 4376], 'acids': [1213, 2184, 2712, 3448], '260': [1214], '320': [1216, 4090], 'tissue,': [1225], 'although': [1226, 2964, 3727, 4383], 'significance': [1228], 'cleavage': [1231, 4671], 'unclear': [1233, 1301], '(13Thinakaran': [1234, 4674], 'Borchelt': [1236, 2015, 4033, 4676], 'D.R.': [1237, 1439, 2016, 4034, 4467, 4677], 'M.K.': [1239, 1445, 1975, 4473, 4679], 'Slunt': [1240, 2017, 4035, 4680], 'H.H.': [1241, 1971, 2018, 4036, 4681], 'Spitzer': [1242, 4682], 'Ratovitsky': [1246, 1448, 2019, 4037, 4476, 4686], 'Davenport': [1248, 1446, 4474, 4688], 'Nordstedt': [1250, 4690], 'Seeger': [1252, 1462, 2025, 4043, 4490, 4692], 'Hardy': [1254, 1497, 1561, 4525, 4589, 4694], 'Levey': [1256, 1464, 4492, 4696], 'A.I.': [1257, 1465, 4493, 4697], 'Gandy': [1258, 1466, 2027, 4045, 4494, 4698], 'S.E.': [1259, 1467, 2028, 4046, 4495, 4699], 'Jenkins': [1260, 1470, 4498, 4700], 'N.A.': [1261, 1471, 4499, 4701], 'Copeland': [1262, 1468, 4496, 4702], 'N.G.': [1263, 1469, 4497, 4703], 'Price': [1264, 1472, 2029, 4047, 4500, 4704], 'D.L.': [1265, 1473, 2030, 4048, 4501, 4705], 'Sisodia': [1266, 1476, 1976, 2031, 4049, 4504, 4706], 'S.S.': [1267, 1477, 1977, 2032, 4050, 4505, 4707], 'Neuron.': [1268, 1478, 2033, 2060, 2835, 2944, 3112, 3501, 3760, 3771, 3777, 4003, 4051, 4110, 4506, 4708], '17:': [1270, 1480, 2035, 2062, 4053, 4112, 4508, 4710], '181-190Google': [1271, 4711], 'There': [1273, 1608], 'reports': [1275], 'recombinant': [1277], 'can': [1281, 1689, 2778, 2914, 2967], 'positively': [1282], 'regulate': [1283], 'apoptosis': [1284], 'lymphocytes': [1286], 'PC12': [1288], 'cells,': [1289, 1359, 3515], 'whether': [1291, 3736], 'endogenous': [1293], 'normally': [1295], 'way': [1299], '(14Wolozin': [1302], 'Iwasaki': [1304], 'Vito': [1306], 'Ganjei': [1308], 'J.K.': [1309, 2952, 4010], 'Lacana': [1310, 1329], 'Sunderland': [1312], 'Zhao': [1314], 'B.Y.': [1315], 'Kusiak': [1316], 'J.W.': [1317], 'V.': [1319], 'Dadamio': [1320], '274:': [1324], '1710-1713Google': [1325], '15Vito': [1327], "D'Adamio": [1331], '271:': [1335], '521-525Google': [1336], 'Taken': [1338, 3660], 'together,': [1339, 3661], 'none': [1340], 'available': [1343], 'clearly': [1345], 'identifies': [1346], 'physiological': [1348], 'role': [1349, 1605, 4248, 4649], 'presenilins.': [1352], 'However,': [1353, 3968, 4096], 'analysis': [1354, 1742, 3729], 'patient': [1356], 'fibroblasts,': [1357], 'transgenic': [1361], 'mice': [1362], 'co-express': [1364], 'APP': [1367, 4608], 'pathogenic': [1370, 1696, 4321], 'enhance': [1376], 'production': [1377, 4402], 'amyloidgenic': [1380], 'Aβ42': [1381], '1.5–2-fold': [1384], '(16Citron': [1385, 4413], 'Westaway': [1387, 4415], 'Xia': [1389, 3272, 3878, 4417], 'Carlson': [1391, 4419], 'Diehl': [1393, 4421], 'Johnson-Wood': [1397, 4425], 'Seubert': [1401, 4429], 'Davis': [1403, 4431], 'Kholodenko': [1405, 4433], 'Motter': [1407, 4435], 'Perry': [1411, 4439], 'Yao': [1413, 4441], 'Strome': [1415, 4443], 'Lieverburg': [1417, 4445], 'Schenk': [1423, 4451], 'Selkoe': [1430, 1521, 2023, 4041, 4458, 4549], '1997;': [1434, 4462], '3:': [1435, 2958, 4016, 4463], '67-72Google': [1436, 4464], '17Borchelt': [1438, 4466], 'Thinakaran': [1440, 1972, 2013, 4031, 4468], 'Eckman': [1442, 1485, 1533, 4470, 4513, 4561], 'C.B.': [1443, 4471], 'Prada': [1450, 1539, 4478, 4567], 'C.-M.': [1451, 4479], 'Seekins': [1454, 4482], 'Yager': [1456, 1549, 4484, 4577], 'D.,': [1457, 4485], 'H.H.,': [1458, 4486], 'Younkin': [1474, 1523, 1563, 4502, 4551, 4591], '1966;': [1479, 4507], '1005-1013Google': [1481, 4509], '18Scheuner': [1483, 4511], 'Jensen': [1487, 4515], 'Song': [1489, 4517], 'X.': [1490, 1538, 2057, 4107, 4518, 4566], 'Citron': [1491, 3290, 3896, 4519], 'Suzuki': [1493, 4521], 'Hutton': [1499, 1543, 4527, 4571], 'Kukull': [1501, 4529], 'Larson': [1503, 4531], 'Levylahad': [1505, 4533], 'Viitanen': [1507, 4535], 'Peskind': [1509, 4537], '864-870Google': [1529, 4557], '19Duff': [1531, 4559], 'Zehr': [1535, 4563], 'C.M.': [1540, 4568], 'Pereztur': [1541, 4569], 'Buee': [1545, 4573], 'Harigaya': [1547, 4575], 'Morgan': [1551, 4579], 'Gordon': [1553, 4581], 'M.N.': [1554, 4582], 'Holcomb': [1555, 4583], 'Refolo': [1557, 4585], 'Zenk': [1559, 4587], '383:': [1567, 4595], '710-713Google': [1568, 4596], 'Determination': [1570], 'topology': [1574, 1685, 1715, 1746, 2050, 2930, 3682, 3924, 3947, 3989, 4204, 4234, 4629, 4771], 'presenilins,': [1577], 'other': [1579, 2935, 3061, 3627, 3994, 4386, 4763], 'words': [1580], 'defining': [1581], 'traverse': [1588], 'bilayer,': [1591, 4749], 'enormous': [1594], 'importance': [1595], 'understanding': [1597], 'function': [1599, 1640, 1706, 4242], 'their': [1604, 2247], 'AD.': [1607, 4250], 'reasons': [1611], 'this.': [1613], 'First,': [1614], 'knowing': [1615], 'lie': [1621, 1678], 'cytoplasm': [1624], 'lumen': [1629, 2880], 'ER': [1632, 4371, 4387, 4611], 'or': [1633, 1665, 1798, 2007, 2315, 2428, 2626, 2920, 3810, 3975, 4063, 4208, 4622, 4662], 'will': [1635, 1719, 2862, 4774, 4783], 'dictate': [1636], 'hypotheses': [1637], 'about': [1638], 'domains.': [1643], 'Second,': [1644], 'experimental': [1645, 2984], 'attempts': [1646, 4777], 'identify': [1648, 2704], 'cytoplasmic': [1649, 2872, 3470, 3696, 3711, 4283, 4288, 4624], 'interact': [1652], 'screening': [1657], 'procedures': [1658], 'such': [1659, 4654], 'yeast': [1662], 'two-hybrid': [1663], 'system': [1664, 3133], 'interaction': [1666, 2993, 4375, 4599], 'cloning': [1667], 'require': [1668], 'knowledge': [1670, 1711], 'Third,': [1682], 'be': [1690, 2779, 2863, 2915, 3394, 4278, 4721], 'correlated': [1691], 'positions': [1694], 'mutations,': [1697], 'providing': [1698], 'alter': [1704, 4353], 'proteins.': [1709, 4284], 'Finally,': [1710], 'allow': [1720], 'more': [1722], 'detailed': [1723], 'comparison': [1724], 'possible': [1726, 1730, 2982, 3943, 4197], 'homologues': [1727], 'than': [1728, 3346, 3606], 'simply': [1731], 'basis': [1734, 1790], 'report': [1739], 'here': [1740, 3960, 4632], 'our': [1741, 3728, 3930, 4097], 'bothin': [1750], 'vitro': [1751, 3132, 3194, 3510, 3673, 3812], 'vivo': [1754], 'expression': [1755], 'systems.': [1756], 'Our': [1757, 1988, 4019, 4230], 'results': [1758, 2469, 3512, 3663, 4020, 4098], 'suggest': [1759, 3677], 'spans': [1763, 4146], 'times,': [1767], 'both': [1769, 3192, 3671], 'located': [1774], 'stands': [1780], 'marked': [1782], 'contrast': [1783, 3558], 'ones': [1785], 'originally': [1786], 'proposed': [1787, 4116, 4631], 'plots': [1793, 2703], 'hypothesized': [1795], 'either': [1796, 2005, 4061, 4618], 'seven': [1797, 3628], 'nine': [1799], '20Slunt': [1970], 'Amyloid': [1978], 'Int.': [1979], 'Exp.': [1981], 'Clin.': [1982], 'Invest.': [1983], '188-190Google': [1986], 'conclusions': [1989], 'consistent': [1991, 3800, 4022, 4646], 'significantly': [1994], 'extend': [1995], 'those': [1996, 2042, 3643, 4024, 4101], 'recent': [1999], 'report,': [2000], 'suggesting': [2001, 4312], 'possesses': [2004], 'eight': [2008, 2588, 4064, 4127], '(21Doan': [2011, 4029], 'Podlisny': [2021, 3276, 3882, 4039], 'D.J.': [2024, 3271, 3877, 4042], '1023-1030Google': [2036, 4054], 'Scholar),': [2037, 3127, 4346, 4597, 4712], 'they': [2039, 3086, 3483], 'differ': [2040, 4099], 'second': [2045], 'study': [2046], 'proposing': [2047], 'eight-transmembrane': [2049], 'homologue': [2054, 4124], 'SEL-12': [2055, 4125, 4175, 4227], '(22Li': [2056, 4106], '1015-1021Google': [2063, 4113], 'HR-PRL': [2069], 'were': [2071, 2223, 2237, 2244, 2250, 2274, 2402, 2410, 2443, 2456, 2507, 2532, 2548, 2557, 2578, 2666, 2685, 3028, 3303, 3363, 3536, 4753], 'generated': [2072, 2176], 'PCR,': [2074], 'template': [2078, 2191], 'cDNA': [2081], 'derived': [2082, 3618], 'RNA': [2085, 2260], 'splice': [2086], 'variant': [2087], 'lacking': [2088], '4': [2090, 2670, 3624, 3647], '(which': [2091], 'encodes': [2092], 'sequence': [2094, 2124, 2132, 2715], 'VSRQ)': [2095], '(provided': [2096], 'Dr.': [2098, 2432], 'Alison': [2099, 4806], '(Ref.': [2101], 'Scholar)).': [2112], '5′': [2114, 2198], 'primer': [2115, 2120, 2199], 'was': [2116, 2175, 2200, 2299, 2337, 2397, 2618, 2649, 3047, 3336, 3359, 3572, 4176, 4192], 'GATCAGGAATTCATGACAGAGTTACCTGCACCG.': [2117], '3′': [2119, 2203], 'consisted': [2121], 'GACTAGGGTAACCAA': [2125], 'followed': [2126, 2321], 'complement': [2129], 'acids:': [2137], '122–128': [2138], 'HR1-PRL,': [2140, 3054, 3299], '151–157': [2141], 'HR2-PRL,': [2143], '181–187': [2144], 'HR3-PRL,': [2146, 3055, 3300], '209–215': [2147], 'HR4-PRL,': [2149], '233–239': [2150], 'HR5-PRL,': [2152], '271–277': [2153], 'HR6-PRL,': [2155], '370–376': [2156], 'HR7-PRL,': [2158], '397–403': [2159], 'HR8-PRL,': [2161], '423–429': [2162], 'HR9-PRL,': [2164], '457–463': [2166], 'HR10-PRL.': [2168], 'segment': [2171, 3974, 4299], 'amplification': [2178], '148': [2181], 'bovine': [2186, 2754], 'prolactin,': [2187], 'pBP292': [2192], '(American': [2193], 'Type': [2194], 'Culture': [2195], 'Collection).': [2196], 'GATCAGGAATTCGATCTTGGTTACCATGGCCCTCAACAGCTGCCAT.': [2201], 'primer,': [2204], 'consensus': [2208, 2764, 3787], 'N-glycosylation': [2211], 'HA': [2214, 2772], 'tag,': [2215], 'had': [2216], 'sequence:': [2218], 'CTGCTATCTAGACTATGCGTAATCTGGAACATCGTATGGGTACATAGTTCCGTTCATGGATCCGTTAGTGCAGTTGTTGTTGTAGATGAT.': [2219], 'fragments': [2222, 2236, 3636], 'digested': [2224], 'EcoRI': [2226], 'andBstEII,': [2227], 'BstEII': [2233], 'andXbaI.': [2234], 'ligated': [2238], 'intoEcoRI-XbaI-digested': [2239], 'pcDNA3': [2240], '(Invitrogen).': [2241], 'All': [2242], 'constructs': [2243], 'sequenced': [2245], 'entirety.': [2248], 'Plasmids': [2249], 'linearized': [2251], 'XbaI': [2253], 'capped': [2255], 'synthesized': [2257, 2856, 3191], 'T7': [2259], 'polymerase': [2261], 'kit': [2264], 'Ambion.': [2266], 'Rabbit': [2267], 'obtained': [2275, 3651], 'Promega': [2277], 'translate': [2281], 'presence': [2285, 2314, 2625, 3051, 3139], '[35S]methionine': [2287], 'manufacturer.': [2292], 'Proteinase': [2293], 'treatment': [2295, 3319, 3551], 'reactions': [2298], 'performed': [2300, 3048, 3148], 'final': [2302], 'concentration': [2303], '50': [2305, 2348], 'μg/ml': [2306], 'h': [2309, 2546, 2552, 2661, 2695], 'ice': [2311], 'absence': [2316, 2627, 3014], '0.5%': [2318, 2353, 2356, 2359, 2391], 'Triton': [2319, 2354, 2392, 2629, 3366], 'X-100,': [2320, 2355], 'inactivation': [2323], '3': [2328, 2551, 2613, 3099], 'mm': [2329, 2346, 2349, 2389], 'phenylmethylsulfonyl': [2330, 2370], 'fluoride.': [2331], '6': [2332, 2660], 'μl': [2333, 2341, 2384], 'reaction': [2336], 'added': [2338], '40': [2340], 'lysis': [2343, 2560, 2640], 'buffer': [2344, 2387, 2561], '(150': [2345], 'NaCl,': [2347, 2390], 'Tris': [2350], '(pH': [2351], '7.5),': [2352], 'sodium': [2357], 'deoxycholate,': [2358], 'SDS)': [2360], 'supplemented': [2361], 'inhibitors': [2364, 2396], '(pepstatin': [2365], 'leupeptin,': [2367], 'μg/ml;': [2369], 'fluoride,': [2371], '0.5': [2372], 'mm;': [2373], 'EDTA,': [2374], 'mm).': [2376], 'After': [2377, 2606, 2637], '5': [2378, 2462], 'min': [2379, 2463], '25': [2381], '°C,': [2382], '160': [2383], 'dilution': [2386, 2642], '(50': [2388], 'X-100)': [2393], 'added,': [2398], 'samples': [2401, 3090], 'precleared': [2403], 'A-Sepharose': [2406, 2447], 'beads.': [2407], 'supernatants': [2409], 'then': [2411, 2667], 'incubated': [2412], 'one': [2414, 3956, 4348], 'rabbit': [2418], 'antibodies:': [2419], 'anti-HA': [2420, 2567, 2782, 3033, 3316, 3401], '(Babco),': [2421], 'anti-bovine': [2422], 'prolactin': [2423, 2734, 2755, 2797], '(Dr.': [2424], 'Parlow),': [2427], 'anti-PS1': [2429], '(prepared': [2430], 'Jeanne': [2433, 4812], 'Nerbonne': [2434], 'against': [2435, 3408], 'synthetic': [2437, 3001], 'peptide': [2438], 'encompassing': [2439, 4272], 'residues': [2440, 3793, 4089], '26–42).': [2441], 'Immunocomplexes': [2442], 'collected': [2444, 2579], 'beads': [2448], 'analyzed': [2450, 2675], 'SDS-PAGE': [2452, 2677, 3174], 'autoradiography.': [2454, 2679], 'Samples': [2455], 'heated': [2457], '60': [2459], '°C': [2460, 2698], 'prior': [2464, 2699, 3368], 'SDS-PAGE,': [2466], 'since': [2467, 2801, 3085, 4149], 'boiling': [2468], 'aggregation': [2471], '(23Yamamoto': [2475], 'Sahara': [2477, 3848], 'Usami': [2479, 3850], 'Okochi': [2481, 3852], 'Kondo': [2483, 3854], 'Kametani': [2485, 3856], 'Tanaka': [2487, 3858], 'Yahagi': [2489, 3860], 'Shirasawa': [2491, 3862], 'Itoyama': [2493, 3864], 'Mori': [2495, 3866], 'Biochem.': [2497, 3868], 'Biophys.': [2498, 3869], 'Res.': [2499, 3870], 'Commun.': [2500, 3871], '226:': [2502, 3873], '536-541Google': [2503, 3874], 'COS-7': [2505], 'grown': [2508], "Dulbecco's": [2510], 'modified': [2511, 4201], "Eagle's": [2512], 'medium': [2513], '10%': [2515], 'fetal': [2516], 'calf': [2517], 'serum,': [2518], 'mmpyruvate,': [2520], 'penicillin/streptomycin': [2522], 'atmosphere': [2525], '5%': [2527], 'C02,': [2528], '95%': [2529], 'air.': [2530], 'Cells': [2531], 'LipofectAMINE': [2535], '(Life': [2536], 'Technologies,': [2537], 'Inc.)': [2538], 'according': [2539], "manufacturer's": [2542], 'directions': [2543], '48': [2545], 'later': [2547], 'labeled': [2549, 2576], '[35S]methionine.': [2554], 'Labeled': [2555], 'cultures': [2556], 'extracted': [2558], 'PS1-PRL': [2563, 3164, 3521], 'immunoprecipitated': [2565, 2633, 3395], 'antibody': [2568, 2918, 3317, 3407], 'above.': [2571, 2636], 'For': [2572], 'digestion': [2574, 3371, 3613], 'experiments,': [2575], 'phosphate-buffered': [2581], 'saline': [2582], 'gently': [2584], 'homogenized': [2585], 'passage': [2587], 'times': [2589], 'through': [2590, 4609], '0.25-mm': [2591], 'diameter': [2592], 'plastic': [2593], 'tubing': [2594], 'attached': [2595], 'end': [2598, 4327, 4332], '27-gauge': [2601], 'needle': [2602], 'syringe.': [2605], 'centrifugation': [2607], '700': [2609], '×': [2610], 'g': [2611], 'min,': [2614], 'postnuclear': [2616, 3616], 'supernatant': [2617, 3617], 'treated': [2619, 2650, 2686, 3092], 'proteinase': [2621, 3326, 3442, 3611], 'X-100': [2630, 3367], 'buffers': [2643], 'above,': [2646], '0.025': [2652], 'unit/ml': [2653, 2689], 'N-glycosidase': [2655, 3094, 3553], 'F': [2656, 3095, 3554], '(Boehringer': [2657], 'Mannheim)': [2658], '37': [2663, 2697], '°C.': [2664], 'Proteins': [2665], 'precipitated': [2668], 'volumes': [2671], 'methanol': [2673], 'Diluted': [2680], 'lysates': [2681], '0.01': [2688], 'enzyme': [2692], '16': [2694], 'immunoprecipitation.': [2701], 'Hydrophobicity': [2702], 'least': [2709], '15': [2710], 'could': [2719, 3393, 4756], 'potentially': [2720], '(Fig.': [2724, 2744, 3071, 3151, 3328, 3352, 3372, 3414, 3623], 'A).': [2726, 3556, 4164], 'after': [2738, 3030, 3318], 'regions': [2743, 4764], 'B).': [2746], '(residues': [2756], '82–229)': [2757], 'onto': [2758], 'appended': [2762], 'N-glycosylation,': [2767], 'tag': [2773], 'so': [2774], 'recognized': [2780, 2916], 'anti-prolactin': [2786, 3397], 'antibodies.': [2787], 'A': [2788, 4318], 'utilized': [2793], 'portion': [2795, 3386], 'reporter,': [2800], 'it': [2802, 2876, 2908, 2979, 3379, 3576, 3939, 4137, 4150, 4195, 4634, 4752, 4755], 'lacks': [2803, 4729], 'any': [2804, 3634, 4730], 'signals': [2805], 'influence': [2808], 'orientation': [2811], 'adjacent': [2814], '(24Rothman': [2816], 'Andrews': [2818], 'D.W.': [2819], 'Calayag': [2820], 'M.C.': [2821], 'Lingappa': [2822], 'V.R.': [2823], 'Chem.': [2826], '1988;': [2827], '263:': [2828], '10470-10480Google': [2829], '25Bennett': [2831], 'Dingeldine': [2833, 3110, 3499, 3758], '14:': [2837, 3114, 3503, 3762, 3779], '373-384Google': [2838, 3115, 3504, 3763], '26Chavez': [2840, 3117], 'R.A.': [2841, 3118], 'Hall': [2842, 3119], 'Z.W.': [2843, 3120], '116:': [2848, 3125], '385-393Google': [2849, 3126], 'When': [2851, 3045], 'fusion': [2853, 3039, 3165, 3522, 3594, 3629, 3970], 'membrane-attached': [2858], 'ribosomes,': [2859], 'glycosylated': [2864, 3080, 3337, 3350, 3816], 'protected': [2866, 3312, 3334, 3391, 3599, 3635], 'proteases': [2868], 'applied': [2869], 'surface': [2873], 'only': [2874, 3306, 3531, 4158], 'if': [2875, 4751], 'resides': [2877], 'equivalent': [2887], 'space.': [2891], 'two': [2893, 3786, 4074], 'techniques': [2894, 2966], 'combined': [2897], 'here,': [2898], 'tagging': [2899], 'fusing': [2907], 'binding': [2919], 'enzymatic': [2921, 4181], 'activity,': [2922], 'individually': [2926], 'map': [2928], '(27Hollmann': [2938, 3997], 'Maron': [2940, 3767, 3999], 'Heinemann': [2942, 3769, 4001], '1994;': [2945, 3772, 4004], '13:': [2946, 3773, 4005], '1331-1343Google': [2947, 3774, 4006], '28Hennessey': [2949], 'E.S.': [2950, 4008], 'Broome-Smith': [2951, 4009], 'Struct.': [2955, 4013], '1993;': [2957, 4015], '524-531Google': [2959, 4017], 'recognize': [2962], 'support': [2971, 3932], 'specific': [2974], 'topology,': [2978], 'always': [2981], 'modifications': [2985], 'may': [2990, 4276], 'perturb': [2991], 'its': [2992, 4247], 'bilayer.': [2997], 'first': [2999], 'translated': [3000], 'PS1-prolactin': [3005, 3966], 'system.': [3011], 'microsomes,': [3018, 3053], 'ranging': [3020], 'size': [3022], '33': [3024], '70': [3026, 3446], 'kDa': [3027, 3344, 3604], 'recovered': [3029], 'immunoprecipitation': [3031], 'antibody,': [3034], 'corresponding': [3035, 3348], 'unglycosylated': [3038, 3142], '(Fig.2': [3041, 3096], 'A,': [3042, 3073, 3153, 3330, 3354, 3374], 'lane': [3043, 3074, 3154, 3159, 3331, 3355, 3375], '1).': [3044], 'HR5-PRL': [3057, 3302, 3457, 3535], '(but': [3058], 'constructs)': [3062], 'yielded': [3063], 'additional': [3064], 'products': [3065, 3078], 'slightly': [3067], 'higher': [3068], 'molecular': [3069, 3437, 3545], 'weight': [3070, 3546], '2).': [3075, 3356], 'larger': [3077], 'represent': [3079, 3382], 'proteins,': [3084], 'eliminated': [3088, 3360], 'when': [3089, 3145, 3361], 'B,': [3097, 3158, 3178], 'lanes': [3098, 3179, 3416], '4).': [3101], 'As': [3102], 'observed': [3105, 3187, 3529], 'others': [3107], '(25Bennett': [3108, 3497, 3756], 'inefficient,': [3135], 'resulting': [3136], 'some': [3141, 3753], 'even': [3144], 'Fig.': [3156, 3176, 3646, 3685, 3927, 4162], '3).': [3160, 3332], 'noted': [3162], 'often': [3167], 'migrated': [3168, 3341], 'closely': [3170, 3491, 3740], 'spaced': [3171], 'doublets': [3172], '(see': [3175, 4161], '2);': [3182], 'phenomenon': [3184], 'full-length': [3189, 3805], 'likely': [3201, 4602], 'result': [3203], 'uncharacterized': [3206], 'posttranslational': [3207], 'modification': [3208], '12Cook': [3241], '29Selkoe': [3270, 3876], 'Zhang': [3274, 3880], 'M.B.': [3277, 3883], 'Amarante': [3278, 3884], 'Haass': [3280, 3886], 'George': [3283, 3889], 'Hyslop': [3284, 3890], 'Teplow': [3286, 3892], 'D.B.': [3287, 3893], 'Koo': [3288, 3894], 'E.H.': [3289, 3895], 'Soc.': [3292, 3898], 'Neurosci.': [3293, 3899], 'Abst.': [3294, 3900], '22:': [3296, 3902], '278Google': [3297, 3903], 'also': [3304, 3596, 3649, 4218, 4840], 'produced': [3310], 'reactive': [3314], 'microsome-containing': [3322], 'mixture': [3324], '(not': [3338, 3658], 'shown)': [3339], 'approximately': [3342, 3445], '7': [3343], 'lower': [3345], 'intact': [3349, 3514, 3608], 'permeabilized': [3364], '4),': [3376, 3419], 'demonstrating': [3377], 'does': [3380, 3730], 'intrinsically': [3384], 'protease-resistant': [3385], 'molecule.': [3389], 'antibodies,': [3402], 'terminus': [3411, 3424, 3452], '3,': [3415], 'indicating': [3420], 'protease-accessible': [3426], 'therefore': [3429, 3490, 4277], 'cytoplasmic.': [3430, 3720], '7-kDa': [3434], 'reduction': [3435, 3542], 'size,': [3438], 'infer': [3440], 'removes': [3444], 'HR1-,': [3454, 3532], 'HR3-,': [3455, 3533], '(up': [3458], 'point': [3461, 4787], 'near': [3462], 'beginning': [3464], 'HR1),': [3466], 'loops': [3471], 'resistant': [3478], 'cleavage,': [3480], 'because': [3482], 'short': [3485, 4152, 4623], '(<10': [3486], 'acids)': [3488, 4155], 'apposed': [3492], 'confirm': [3507], 'again': [3528], 'glycosylated,': [3537], 'indicated': [3539], 'upon': [3550], '(Fig.4': [3555], 'situation': [3561], 'lysate,': [3564], 'essentially': [3573], 'quantitative,': [3574], 'making': [3575], 'unlikely': [3577, 4138, 4635], 'heterogeneous': [3582], 'respect': [3584], 'reporter.': [3589, 4215], 'Each': [3590], 'produces': [3597], '∼7': [3603], 'smaller': [3605], 'B);': [3625], 'do': [3631, 3722], 'yield': [3633], '(data': [3637], 'shown).': [3639, 3659], 'Results': [3640], 'similar': [3641], 'shown': [3644, 3683, 3925], 'Chinese': [3654], 'hamster': [3655], 'ovary': [3656], 'site': [3666], 'protection': [3670], '5.': [3686, 3928], 'HR1,': [3687], 'HR3,': [3688], 'HR5': [3690], 'lumenal': [3699, 3708, 4379], 'side': [3700], 'HR2,': [3702], 'HR4,': [3703], 'HR6': [3705, 4291, 4329], 'side.': [3712], 'Both': [3713], 'HR7–HR10': [3721, 4743], 'constitute': [3724], 'domains,': [3726], 'issue': [3734], 'associate': [3739], 'manner': [3747], '“reentrant': [3749], 'loops”': [3750], 'channel': [3754], '27Hollmann': [3765], 'Scholar,30MacKinnon': [3775], '889-892Google': [3780], 'places': [3784], 'N-linked': [3790], '(asparagine': [3792], '275': [3794], '401)': [3796], 'cytoplasm,': [3799], 'fact': [3803], 'byin': [3811], '23Yamamoto': [3846], 'Given': [3905], 'high': [3907], 'degree': [3908], 'would': [3916, 4600, 4615, 4720, 4738], 'predict': [3917], 'same': [3922], 'Although': [3929], 'data': [3931, 4068], 'six-transmembrane': [3934], 'domain': [3935], 'structure': [3936], 'course': [3942], 'native': [3950], 'inferred': [3959, 4177], 'properties': [3964], 'fusions.': [3967], 'introduction': [3977], 'ectopic': [3979], 'found': [3985, 4324], 'disturb': [3987], 'Scholar,28Hennessey': [4007], 'Doan': [4026], 'et': [4027], 'al.': [4028], 'Scholar)': [4055, 4114], 'who': [4056, 4115], 'concluded': [4057], '(their': [4067], 'did': [4069], 'distinguish': [4071], 'possibilities),': [4075], 'terminus,': [4079, 4081, 4295], 'part': [4083], '“loop”': [4086], 'region': [4087, 4266, 4289, 4621], '390': [4092], 'having': [4126], 'segments,': [4129], 'including': [4130, 4263], 'HR1–HR6,': [4131], 'HR-8,': [4132], 'HR-9.': [4134], 'think': [4136], 'theoretical': [4140], 'grounds': [4141], 'HR8': [4143, 4168, 4191], 'membrane,': [4148], '(16': [4153], 'marginally': [4159], 'identification': [4166], 'HR9': [4170], 'indirectly': [4178], 'activity': [4182, 4211, 4794], 'pair': [4185], 'β-galactosidase': [4187], 'fusions': [4188], 'deleted,': [4193], 'altered': [4209], 'galactosidase': [4214], 'It': [4216], 'conceivable': [4219], 'topologies': [4223], 'different.': [4229], 'implications': [4239], 'find': [4252], 'most': [4254, 4601], 'cytoplasmic,': [4262], 'N-terminal': [4265], 'long': [4269], 'tail': [4271, 4625], 'HR7–HR10.': [4273], 'interactions': [4281], 'Much': [4285], 'exclusive': [4296], 'HR7': [4301, 4334], 'HR8,': [4303], 'highly': [4305], 'conserved': [4306], 'essential': [4313], 'domain.': [4317], 'speculate': [4350], 'associations': [4354, 4384], 'Since': [4362], 'little': [4363], 'protrudes': [4368], 'into': [4369], 'lumen,': [4372], 'direct': [4374], 'seems': [4381], 'unlikely,': [4382], 'possible.': [4391], 'If': [4392], 'binds': [4394], 'possibility': [4398], 'suggested': [4399], 'enhanced': [4401], 'Aβ': [4405], '42': [4406], 'expressing': [4410], 'mutant': [4411, 4798], 'occur': [4603, 4717], 'transiently': [4604], 'during': [4605], 'transit': [4606], 'involve': [4617], 'APP.': [4627], 'makes': [4633], 'conventional': [4641], 'G-protein-coupled': [4642], 'receptor,': [4643], 'processes': [4653], 'vesicle': [4656], 'docking': [4657], 'budding,': [4659], 'membrane-cytoskeletal': [4660], 'interactions,': [4661], 'ion': [4663], 'solute': [4665], 'transport.': [4666], 'recently': [4668], 'endoproteolytic': [4670], 'predicted': [4715], 'HR6,': [4719], 'expected': [4722], 'generate': [4724], 'segments.': [4732], 'Whether': [4733], 'soluble': [4737], 'depend': [4739], 'tightly': [4742], 'associated': [4745], 'diffusible': [4754], 'serve': [4757], 'transmit': [4759], 'signal': [4761], 'cell.': [4767], 'Knowing': [4768], 'now': [4775], 'facilitate': [4776], 'isolate': [4779], 'interacting': [4780], 'starting': [4786], 'further': [4789], 'investigations': [4790], 'biological': [4793], 'normal': [4796], 'protein.': [4802], 'ACKNOWLEDGEMENTS': [4803], 'thank': [4805], 'cDNA;': [4811], 'Nerbonne,': [4813], 'Athena': [4814], 'Guo,': [4815], 'Parlow': [4819], 'antibodies;': [4821], 'Jane': [4822], 'Wu': [4823], 'advice': [4825], 'automated': [4827], 'DNA': [4828], 'sequencing;': [4829], 'Brendan': [4831], 'Walsh': [4832], 'Dung': [4834], 'Le': [4835], 'technical': [4837], 'assistance.': [4838], 'acknowledge': [4841], 'Maurine': [4842], 'Linder,': [4843], 'Carl': [4844], 'Romano,': [4845], 'members': [4847], 'Harris': [4850], 'laboratory': [4851], 'comments': [4853], 'manuscript.': [4856]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2070654470', 'counts_by_year': [{'year': 2022, 'cited_by_count': 1}, {'year': 2020, 'cited_by_count': 1}, {'year': 2019, 'cited_by_count': 1}, {'year': 2016, 'cited_by_count': 2}, {'year': 2015, 'cited_by_count': 1}, {'year': 2014, 'cited_by_count': 1}, {'year': 2013, 'cited_by_count': 1}], 'updated_date': '2024-12-12T14:35:32.670095', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
