Serum Response Factor-dependent Regulation of the Smooth Muscle Calponin Gene

Name: Work Video:
Duration: 3 min 30 s
Joseph M. Miano; Michael Carlson; Jeffrey A. Spencer; Ravi Misra
{'id': 'https://openalex.org/W2051307565', 'doi': 'https://doi.org/10.1074/jbc.275.13.9814', 'title': 'Serum Response Factor-dependent Regulation of the Smooth Muscle Calponin Gene', 'display_name': 'Serum Response Factor-dependent Regulation of the Smooth Muscle Calponin Gene', 'publication_year': 2000, 'publication_date': '2000-03-01', 'ids': {'openalex': 'https://openalex.org/W2051307565', 'doi': 'https://doi.org/10.1074/jbc.275.13.9814', 'mag': '2051307565', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/10734136'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.275.13.9814', 'pdf_url': 'http://www.jbc.org/article/S0021925818301030/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925818301030/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5080731495', 'display_name': 'Joseph M. Miano', 'orcid': 'https://orcid.org/0000-0001-7522-3207'}, 'institutions': [{'id': 'https://openalex.org/I204308271', 'display_name': 'Medical College of Wisconsin', 'ror': 'https://ror.org/00qqv6244', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I204308271']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Joseph M. Miano', 'raw_affiliation_strings': ['Department of Physiology, Medical College of Wisconsin, Milwaukee, Wisconsin 53226, USA.'], 'affiliations': [{'raw_affiliation_string': 'Department of Physiology, Medical College of Wisconsin, Milwaukee, Wisconsin 53226, USA.', 'institution_ids': ['https://openalex.org/I204308271']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5109163576', 'display_name': 'Michael Carlson', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I204308271', 'display_name': 'Medical College of Wisconsin', 'ror': 'https://ror.org/00qqv6244', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I204308271']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Michael J. Carlson', 'raw_affiliation_strings': ['Department of Physiology, Medical College of Wisconsin, Milwaukee, Wisconsin 53226.'], 'affiliations': [{'raw_affiliation_string': 'Department of Physiology, Medical College of Wisconsin, Milwaukee, Wisconsin 53226.', 'institution_ids': ['https://openalex.org/I204308271']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5013672302', 'display_name': 'Jeffrey A. Spencer', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I204308271', 'display_name': 'Medical College of Wisconsin', 'ror': 'https://ror.org/00qqv6244', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I204308271']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Jeffrey A. Spencer', 'raw_affiliation_strings': ['Department of Biochemistry, Medical College of Wisconsin, Milwaukee, Wisconsin 53226.'], 'affiliations': [{'raw_affiliation_string': 'Department of Biochemistry, Medical College of Wisconsin, Milwaukee, Wisconsin 53226.', 'institution_ids': ['https://openalex.org/I204308271']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5110228392', 'display_name': 'Ravi Misra', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I204308271', 'display_name': 'Medical College of Wisconsin', 'ror': 'https://ror.org/00qqv6244', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I204308271']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Ravi P. Misra', 'raw_affiliation_strings': ['Department of Biochemistry, Medical College of Wisconsin, Milwaukee, Wisconsin 53226.'], 'affiliations': [{'raw_affiliation_string': 'Department of Biochemistry, Medical College of Wisconsin, Milwaukee, Wisconsin 53226.', 'institution_ids': ['https://openalex.org/I204308271']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 3.78, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 117, 'citation_normalized_percentile': {'value': 0.911445, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 96, 'max': 97}, 'biblio': {'volume': '275', 'issue': '13', 'first_page': '9814', 'last_page': '9822'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T11041', 'display_name': 'Ubiquitin and proteasome pathways', 'score': 0.9943, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T11041', 'display_name': 'Ubiquitin and proteasome pathways', 'score': 0.9943, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10604', 'display_name': 'RNA Research and Splicing', 'score': 0.9886, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T12620', 'display_name': 'Signaling Pathways in Disease', 'score': 0.9868, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/calponin', 'display_name': 'Calponin', 'score': 0.88975996}], 'concepts': [{'id': 'https://openalex.org/C2781122658', 'wikidata': 'https://www.wikidata.org/wiki/Q24744812', 'display_name': 'Calponin', 'level': 3, 'score': 0.88975996}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.4949538}, {'id': 'https://openalex.org/C69053785', 'wikidata': 'https://www.wikidata.org/wiki/Q907394', 'display_name': 'Serum response factor', 'level': 4, 'score': 0.49341646}, {'id': 'https://openalex.org/C2992686903', 'wikidata': 'https://www.wikidata.org/wiki/Q208453', 'display_name': 'Smooth muscle', 'level': 2, 'score': 0.48279226}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.45399293}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.39554247}, {'id': 'https://openalex.org/C126322002', 'wikidata': 'https://www.wikidata.org/wiki/Q11180', 'display_name': 'Internal medicine', 'level': 1, 'score': 0.38960278}, {'id': 'https://openalex.org/C134018914', 'wikidata': 'https://www.wikidata.org/wiki/Q162606', 'display_name': 'Endocrinology', 'level': 1, 'score': 0.36616713}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.3465165}, {'id': 'https://openalex.org/C86339819', 'wikidata': 'https://www.wikidata.org/wiki/Q407384', 'display_name': 'Transcription factor', 'level': 3, 'score': 0.2337183}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.2178267}, {'id': 'https://openalex.org/C71924100', 'wikidata': 'https://www.wikidata.org/wiki/Q11190', 'display_name': 'Medicine', 'level': 0, 'score': 0.20125017}], 'mesh': [{'descriptor_ui': 'D002135', 'descriptor_name': 'Calcium-Binding Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D005786', 'descriptor_name': 'Gene Expression Regulation', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D009130', 'descriptor_name': 'Muscle, Smooth', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D009687', 'descriptor_name': 'Nuclear Proteins', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001483', 'descriptor_name': 'Base Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002135', 'descriptor_name': 'Calcium-Binding Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000096985', 'descriptor_name': 'Calponins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002478', 'descriptor_name': 'Cells, Cultured', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004247', 'descriptor_name': 'DNA', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004742', 'descriptor_name': 'Enhancer Elements, Genetic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005786', 'descriptor_name': 'Gene Expression Regulation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007438', 'descriptor_name': 'Introns', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008297', 'descriptor_name': 'Male', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008840', 'descriptor_name': 'Microfilament Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008969', 'descriptor_name': 'Molecular Sequence Data', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009130', 'descriptor_name': 'Muscle, Smooth', 'qualifier_ui': 'Q000166', 'qualifier_name': 'cytology', 'is_major_topic': False}, {'descriptor_ui': 'D009130', 'descriptor_name': 'Muscle, Smooth', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009687', 'descriptor_name': 'Nuclear Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D009687', 'descriptor_name': 'Nuclear Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011485', 'descriptor_name': 'Protein Binding', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051381', 'descriptor_name': 'Rats', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017207', 'descriptor_name': 'Rats, Sprague-Dawley', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D026362', 'descriptor_name': 'Serum Response Factor', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.275.13.9814', 'pdf_url': 'http://www.jbc.org/article/S0021925818301030/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/10734136', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.275.13.9814', 'pdf_url': 'http://www.jbc.org/article/S0021925818301030/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 59, 'referenced_works': ['https://openalex.org/W1501827434', 'https://openalex.org/W1534692597', 'https://openalex.org/W1565320229', 'https://openalex.org/W1606477282', 'https://openalex.org/W1817814372', 'https://openalex.org/W1843334120', 'https://openalex.org/W1890134050', 'https://openalex.org/W1903798411', 'https://openalex.org/W1912592877', 'https://openalex.org/W1945199177', 'https://openalex.org/W1965372133', 'https://openalex.org/W1969642416', 'https://openalex.org/W1969664410', 'https://openalex.org/W1975916930', 'https://openalex.org/W1978458232', 'https://openalex.org/W1982779207', 'https://openalex.org/W1983438549', 'https://openalex.org/W1983651838', 'https://openalex.org/W1990111972', 'https://openalex.org/W1992010506', 'https://openalex.org/W1993243592', 'https://openalex.org/W2005150284', 'https://openalex.org/W2005870664', 'https://openalex.org/W2013741570', 'https://openalex.org/W2018006603', 'https://openalex.org/W2020672093', 'https://openalex.org/W2023687572', 'https://openalex.org/W2025224640', 'https://openalex.org/W2027135709', 'https://openalex.org/W2027196409', 'https://openalex.org/W2035430192', 'https://openalex.org/W2056438653', 'https://openalex.org/W2059080932', 'https://openalex.org/W2059832428', 'https://openalex.org/W2066041822', 'https://openalex.org/W2066198185', 'https://openalex.org/W2067009338', 'https://openalex.org/W2068218887', 'https://openalex.org/W2069863621', 'https://openalex.org/W2070493586', 'https://openalex.org/W2072644380', 'https://openalex.org/W2082291109', 'https://openalex.org/W2082533282', 'https://openalex.org/W2082647085', 'https://openalex.org/W2083257797', 'https://openalex.org/W2091127606', 'https://openalex.org/W2091643606', 'https://openalex.org/W2112873780', 'https://openalex.org/W2133203551', 'https://openalex.org/W2133205696', 'https://openalex.org/W2134812217', 'https://openalex.org/W2138144532', 'https://openalex.org/W2138569805', 'https://openalex.org/W2148059610', 'https://openalex.org/W2149628530', 'https://openalex.org/W2151180509', 'https://openalex.org/W2279275424', 'https://openalex.org/W2337013501', 'https://openalex.org/W4294216491'], 'related_works': ['https://openalex.org/W80142313', 'https://openalex.org/W4230981849', 'https://openalex.org/W2954547227', 'https://openalex.org/W2885852096', 'https://openalex.org/W2408969984', 'https://openalex.org/W2373333738', 'https://openalex.org/W2363621962', 'https://openalex.org/W2006160253', 'https://openalex.org/W1995002689', 'https://openalex.org/W1843334120'], 'abstract_inverted_index': {'Smooth': [0, 187, 402, 1170], 'muscle': [1, 15, 28, 60, 93, 129, 145, 161, 183, 188, 202, 215, 247, 280, 316, 332, 348, 370, 375, 385, 403, 702, 938, 977, 1171, 3436], 'calponin': [2, 29, 130, 184, 189, 216, 317, 371, 386, 1172], 'is': [3, 11, 190, 198, 562, 628, 958, 969, 1085, 1176, 1292, 1511, 3713, 4144, 4218], 'a': [4, 65, 133, 191, 252, 320, 410, 478, 554, 567, 785, 963, 1076, 1089, 1159, 1514, 1573, 1923, 1938, 1946, 2022, 2046, 2097, 2299, 2315, 2366, 2438, 2707, 2750, 2951, 3039, 3056, 3178, 3354, 3528, 3555, 3617, 3664, 3750, 3797, 3817, 3932, 3948, 4105, 4127, 4379], 'multifunctional,': [5, 192], 'thin': [6, 193], 'filament-associated': [7, 194], 'protein': [8, 176, 195, 363, 3248, 3548, 3629], 'whose': [9, 196, 416], 'expression': [10, 40, 157, 197, 227, 344, 484, 794, 1175, 1291, 1342, 1365, 1508, 2339, 2421, 3249, 3712], 'restricted': [12, 37, 199, 224, 1058, 1178, 1294, 3715, 3977], 'to': [13, 43, 122, 200, 230, 309, 469, 634, 788, 796, 812, 961, 1179, 1193, 1295, 1357, 1453, 1487, 1667, 1723, 1922, 1941, 2032, 2063, 2170, 2175, 2220, 2242, 2271, 2348, 2356, 2433, 2437, 2496, 2580, 2684, 2697, 2738, 2869, 2887, 2930, 2939, 2967, 2975, 3161, 3210, 3216, 3232, 3237, 3292, 3365, 3389, 3431, 3564, 3576, 3625, 3716, 3864, 3980, 4025, 4044, 4233, 4350, 4362], 'smooth': [14, 27, 50, 59, 92, 128, 138, 144, 160, 182, 201, 214, 237, 246, 279, 315, 325, 331, 347, 369, 374, 384, 701, 976, 3435], 'cell': [16, 203, 376, 404, 426, 1541, 1695, 3218, 3259, 4078], 'lineages': [17, 204, 406, 978, 1181, 1306, 3718], 'in': [18, 177, 185, 205, 364, 372, 481, 553, 815, 831, 871, 926, 972, 1068, 1073, 1080, 1168, 1182, 1303, 1307, 1343, 1545, 1572, 1836, 1853, 1931, 2045, 2191, 2211, 2340, 2465, 2469, 2484, 2533, 2572, 2587, 2611, 2616, 2618, 2631, 2642, 2651, 2661, 2721, 2785, 2803, 2814, 2848, 3044, 3069, 3122, 3156, 3185, 3489, 3780, 3804, 3816, 3820, 3827, 3837, 3841, 3849, 3854, 3859, 3875, 3902, 3918, 3931, 3964, 3993, 4141, 4146, 4162, 4175, 4184, 4228, 4244, 4292, 4341], 'developing': [19, 206, 1183], 'and': [20, 71, 142, 173, 207, 258, 329, 360, 474, 558, 699, 751, 779, 795, 937, 975, 981, 1072, 1184, 1531, 1565, 1569, 1618, 1624, 1652, 1664, 1692, 1715, 1721, 1788, 1832, 1863, 1880, 1888, 2107, 2180, 2198, 2218, 2222, 2254, 2269, 2306, 2398, 2467, 2536, 2609, 2620, 2629, 2690, 2713, 2730, 2754, 2766, 2783, 2828, 2845, 2872, 2915, 2972, 3110, 3128, 3159, 3173, 3227, 3247, 3303, 3322, 3338, 3358, 3371, 3392, 3434, 3486, 3512, 3520, 3531, 3559, 3568, 3579, 3609, 3691, 3829, 4074, 4124, 4160, 4165, 4242, 4257, 4352, 4373], 'postnatal': [21, 208, 982, 1185], 'tissues.': [22, 209], 'Although': [23, 210, 544, 956, 1289], 'the': [24, 55, 101, 108, 118, 127, 150, 174, 178, 211, 242, 288, 295, 305, 314, 337, 361, 365, 420, 461, 545, 622, 637, 700, 806, 832, 836, 858, 863, 872, 876, 895, 927, 1056, 1079, 1196, 1330, 1368, 1377, 1465, 1480, 1524, 1586, 1668, 1727, 1763, 1830, 1837, 1854, 1898, 1907, 1912, 1917, 1943, 1980, 1987, 1990, 2029, 2037, 2052, 2055, 2059, 2070, 2074, 2077, 2084, 2120, 2124, 2161, 2228, 2243, 2249, 2341, 2357, 2419, 2521, 2526, 2544, 2626, 2646, 2662, 2740, 2849, 2870, 2916, 2934, 2942, 3002, 3011, 3026, 3029, 3047, 3104, 3114, 3169, 3206, 3217, 3228, 3262, 3330, 3542, 3626, 3655, 3776, 3781, 3784, 3789, 3809, 3812, 3824, 3842, 3847, 3850, 3856, 3865, 3870, 3891, 3897, 3908, 3926, 3942, 3958, 3961, 3972, 4001, 4007, 4011, 4040, 4051, 4180, 4185, 4205, 4209, 4223, 4234, 4250, 4253, 4262, 4272, 4277, 4300, 4316, 4358], 'physiology': [25, 212], 'of': [26, 39, 58, 78, 107, 120, 158, 181, 213, 226, 245, 265, 294, 307, 345, 368, 400, 412, 424, 464, 471, 548, 556, 566, 601, 625, 704, 808, 835, 862, 875, 894, 930, 1055, 1082, 1199, 1469, 1483, 1509, 1526, 1589, 1706, 1726, 1762, 1766, 1857, 1906, 1933, 1945, 1982, 2028, 2040, 2058, 2076, 2087, 2123, 2165, 2184, 2196, 2245, 2248, 2261, 2343, 2351, 2369, 2396, 2403, 2411, 2488, 2547, 2586, 2625, 2648, 2664, 2676, 2743, 2762, 2769, 2788, 2796, 2802, 2834, 2840, 2853, 2861, 2885, 2944, 2981, 2999, 3028, 3042, 3046, 3103, 3113, 3180, 3183, 3188, 3214, 3285, 3314, 3332, 3547, 3671, 3676, 3749, 3778, 3783, 3793, 3796, 3811, 3873, 3890, 3914, 3929, 3945, 3960, 3985, 4015, 4048, 4099, 4112, 4117, 4208, 4212, 4252, 4280, 4307, 4348, 4360], 'has': [30, 217, 1153, 1381], 'been': [31, 218, 647, 1154, 1382, 1718], 'studied': [32, 219, 3901], 'extensively,': [33, 220], 'thecis-elements': [34, 221], 'governing': [35, 222, 1363], 'its': [36, 223, 1297, 3903], 'pattern': [38, 225], 'have': [41, 228, 646, 1354, 1459, 1717, 2110], 'yet': [42, 229], 'be': [44, 231, 467, 551, 962, 1488], 'identified.': [45, 232], 'Here': [46, 233], 'we': [47, 234, 1458, 1474, 1504, 2050, 2092, 2159, 2335, 3619, 3787, 3976, 4282], 'report': [48, 235], 'on': [49, 126, 236, 313, 1986, 2156, 2706, 2812, 2950, 3353, 3554, 3641, 3989, 4104], 'muscle-specific': [51, 139, 238, 326], 'enhancer': [52, 110, 124, 140, 239, 297, 311, 327, 1477, 3922, 3974, 4138], 'activity': [53, 125, 240, 312, 423, 1302, 1478, 1944, 2039, 2086, 3782, 3822, 3838, 3867, 3884, 3923, 3959, 3992, 4139], 'within': [54, 241, 1367, 1479, 1523, 2119, 4276], 'first': [56, 243, 869, 1481, 1764, 3791, 3813, 3871, 3898, 3909, 3927, 3943, 4013, 4110, 4181, 4210, 4254, 4278], 'intron': [57, 244, 1482, 1765, 1983, 1992, 2042, 2053, 3792, 3814, 3848, 3872, 3899, 3910, 3928, 3944, 3986, 4014, 4101, 4111, 4182, 4211, 4255, 4279], 'calponin.': [61, 162, 248, 349], 'Sequence': [62, 249], 'analysis': [63, 250, 3112, 3675, 4355], 'revealed': [64, 251, 3640, 4069, 4155], 'proximal': [66, 253, 873, 2162], 'consensus': [67, 102, 254, 289, 4215, 4235, 4301], 'intronic': [68, 74, 109, 170, 255, 261, 296, 357, 389, 2088, 2167], 'CArG': [69, 103, 115, 171, 256, 290, 302, 358, 390, 819, 924, 1066, 1092, 1496, 1918, 2089, 2125, 2168, 4216, 4236, 4274], 'box': [70, 104, 257, 291, 391, 820, 1093, 1517, 1919, 2126, 2169, 4217], 'two': [72, 259, 1875, 3669, 4062, 4238], 'distal': [73, 260], 'CArG-like': [75, 262, 4239], 'elements,': [76, 263], 'each': [77, 264, 1883, 2166, 2624, 2649, 3318], 'which': [79, 266, 867, 3035, 3167], 'bound': [80, 267], 'recombinant': [81, 268, 2582, 4297], 'serum': [82, 269, 377, 381, 864, 899, 1556, 1908, 2836], 'response': [83, 270, 378, 382, 865, 900, 935, 1909], 'factor': [84, 271, 379, 383, 901, 1163, 2898], '(SRF)': [85, 272, 902], 'as': [86, 88, 273, 275, 824, 1380, 1595, 1897, 1937, 2274, 2444, 3075, 3130, 3251, 3395, 3465, 3467, 3584, 3654, 3951, 3953, 4036, 4285, 4323, 4325], 'well': [87, 274, 3466, 3952, 4324], 'immunoreactive': [89, 276, 3637], 'SRF': [90, 121, 135, 152, 175, 277, 308, 322, 339, 362, 957, 1533, 1948, 2113, 2354, 2370, 2416, 2549, 2583, 2590, 2806, 2888, 2931, 3607, 4270, 4298, 4349, 4361], 'from': [91, 278, 1376, 1464, 1585, 1657, 1911, 1993, 2481, 3258, 3473, 4039, 4055, 4061, 4222, 4261, 4315, 4326], 'nuclear': [94, 281, 2797, 2987, 4313], 'extracts.': [95, 282], 'Site-directed': [96, 283], 'mutagenesis': [97, 284, 2095], 'studies': [98, 285, 3979], 'suggested': [99, 286], 'that': [100, 287, 621, 790, 810, 1359, 1485, 1506, 2958, 3808, 3941, 3956, 4296, 4330, 4357, 4369], 'mediates': [105, 292], 'much': [106, 293], 'activity;': [111, 298], 'mutating': [112, 299], 'all': [113, 300], 'three': [114, 301, 2185], 'elements': [116, 303, 800, 1362, 4240, 4275], 'abolished': [117, 304], 'ability': [119, 306], 'confer': [123, 310], 'promoter.': [131, 318, 3049], 'Cotransfecting': [132, 319], 'dominant-negative': [134, 151, 321, 338, 380, 1947, 2367, 3004], 'construct': [136, 153, 323, 340, 1949, 2062, 3826], 'attenuated': [137, 324], 'activity,': [141, 328, 3975], 'transducing': [143, 330], 'cells': [146, 333, 1654, 2229, 2272, 2295, 2407, 2482, 3074, 3127, 3153, 3170, 3229, 4167], 'with': [147, 334, 477, 1813, 1829, 1916, 2096, 2266, 2298, 2314, 2657, 2759, 2779, 3175, 3325, 3386, 3428, 3482, 3561, 3622, 3644, 3663, 3696, 3999, 4126, 4179, 4312, 4371], 'adenovirus': [148, 335, 3060, 3176], 'harboring': [149, 336], 'selectively': [154, 341], 'reduced': [155, 342, 3882], 'steady-state': [156, 343], 'endogenous': [159, 346, 1507], 'These': [163, 350, 1351], 'results': [164, 351, 1520, 3815, 3939, 4172], 'demonstrate': [165, 352], 'an': [166, 353, 632, 825, 1189, 1499, 1814, 2255, 2323, 2920, 3366, 3623, 3674, 4118, 4176], 'important': [167, 354], 'role': [168, 355, 3777], 'for': [169, 356, 564, 1384, 1730, 1882, 1900, 2687, 2718, 2809, 2877, 2919, 2960, 2978, 3100, 3234, 3245, 3307, 3328, 3362, 3377, 3534, 3581, 3685, 4027, 4076], 'boxes': [172, 359, 925, 1067, 2090], 'transcriptional': [179, 366, 638, 1197, 2038], 'control': [180, 367, 1939, 2075, 2257, 3027], 'vitro.': [186, 373], 'preinitiation': [387, 1466], 'complex': [388, 1467, 4306], 'electrophoretic': [392], 'mobility': [393, 4309], 'shift': [394], 'assay': [395, 2319, 2523], 'polymerase': [396, 2101], 'chain': [397, 754], 'reaction': [398, 2576], 'multiplicity': [399, 3179], 'infection': [401, 3181], '(SMC)1': [405], 'are': [407, 805, 1335, 1521, 2640, 3613, 3652, 4034, 4247], 'defined': [408, 823, 870, 2111], 'by': [409, 1491, 1700, 1865, 2203, 2389, 2520, 2993, 3063, 3107, 3261, 3311, 3541, 3681, 3869, 3925], 'battery': [411], 'cell-restricted': [413], 'differentiation': [414, 627, 939, 1201], 'genes': [415, 940, 1059, 1084, 1387, 1530], 'encoded': [417], 'proteins': [418, 3638], 'facilitate': [419, 2698, 3211], 'unique': [421], 'contractile': [422, 462], 'these': [425, 778, 1083, 1456, 2157, 3938], 'types': [427], '(1.Owens': [428], 'G.K.': [429, 715, 1138], 'Physiol.': [430, 610, 657], 'Rev.': [431, 611], '1995;': [432, 686, 719, 948, 1423, 2147], '75:': [433], '487-517Crossref': [434], 'PubMed': [435, 453, 519, 539, 594, 615, 661, 694, 727, 746, 774, 850, 888, 918, 951, 1003, 1025, 1049, 1109, 1130, 1144, 1215, 1234, 1264, 1284, 1324, 1403, 1426, 1446, 1613, 1640, 1689, 1755, 1783, 1805, 1973, 2014, 2136, 2150, 2286, 2382, 2456, 2511, 2565, 3090, 3145, 3276, 3419, 3460, 3601, 3736, 3769], 'Scopus': [436, 454, 520, 540, 595, 616, 695, 728, 747, 851, 889, 919, 952, 1004, 1026, 1050, 1110, 1131, 1145, 1216, 1235, 1265, 1285, 1325, 1404, 1447, 1614, 1641, 1756, 1784, 1806, 1974, 2015, 2137, 2151, 2287, 2383, 2457, 2512, 2566, 3091, 3146, 3277, 3420, 3461, 3602, 3737, 3770], '(1397)': [437], 'Google': [438, 456, 506, 522, 542, 597, 618, 662, 697, 730, 749, 775, 853, 891, 921, 954, 1006, 1028, 1052, 1112, 1133, 1147, 1218, 1237, 1267, 1287, 1327, 1406, 1427, 1449, 1616, 1643, 1690, 1758, 1786, 1808, 1976, 2017, 2139, 2153, 2289, 2385, 2459, 2514, 2568, 3093, 3148, 3279, 3422, 3463, 3604, 3739, 3772], 'Scholar,': [439, 507, 523, 1007, 1029, 1113, 1134, 1219, 1238, 1268, 1407, 1428], '2.Stull': [440], 'J.T.': [441], 'Gallagher': [442], 'P.G.': [443], 'Herring': [444], 'B.P.': [445, 652, 1411], 'Kamm': [446], 'K.E.': [447], 'Hypertension': [448], '(Dallas).': [449], '1991;': [450], '17:': [451, 1128], '723-732Crossref': [452], '(81)': [455], 'Scholar).': [457, 543, 598, 776, 854, 892, 955, 1053, 1148, 1288, 1328, 1450, 1759, 1977, 2154, 2290, 2460, 2515, 3094, 3149, 3280, 3423, 3605, 3773], 'In': [458, 631, 1471, 1747, 2332, 2880, 3411, 3452, 3862, 4231], 'pathophysiological': [459], 'states,': [460], 'phenotype': [463, 547, 569], 'SMCs': [465, 549, 1061, 1582, 3969], 'may': [466, 1534], 'subverted': [468], 'one': [470, 1063, 2472], 'growth,': [472], 'migration,': [473], 'matrix': [475], 'secretion': [476], 'coincident': [479], 'reduction': [480], 'SMC-restricted': [482, 644, 781, 792], 'gene': [483, 782, 793, 813, 839, 878, 1166, 1174, 1192, 1501, 1538, 2072, 2251, 2338, 2990, 3753], '(3.Horiuchi': [485], 'A.': [486, 494, 736, 762, 841, 1413, 1415, 1674, 3084, 3139], 'Nikaido': [487], 'T.': [488, 498, 525, 531], 'Ito': [489], 'K.': [490, 509, 511, 533, 577], 'Zhai': [491], 'Y.-L.': [492], 'Orii': [493], 'Taniguchi': [495], 'S.': [496, 500, 581, 672, 1115, 1227, 1430, 2143, 3080, 3135], 'Toki': [497], 'Fujii': [499], 'Lab.': [501], 'Invest.': [502], '1998;': [503, 516, 1046, 1443, 1752, 3416, 3457], '78:': [504], '839-846PubMed': [505], '4.Sobue': [508], 'Hayashi': [510], 'Nishida': [512], 'W.': [513], 'Horm.': [514], 'Res.': [515, 535, 1140, 1636, 2378, 2507], '50:': [517], '15-24Crossref': [518], '(36)': [521, 748], '5.Mano': [524], 'Luo': [526], 'Z.': [527, 1248], 'Malendowicz': [528], 'S.L.': [529], 'Evans': [530], 'Walsh': [532, 1437], 'Circ.': [534, 1139], '1999;': [536, 1141, 2453], '84:': [537, 1142], '647-654Crossref': [538], '(99)': [541], 'mature': [546], 'can': [550], 'compromised': [552], 'variety': [555], 'natural': [557], 'experimental': [559], 'settings,': [560], 'there': [561], 'evidence': [563], 'reacquisition': [565], 'differentiated': [568], '(6.Aikawa': [570], 'M.': [571, 575, 764, 906, 1203, 1205, 1223, 1225, 1347, 1389, 1417, 1440, 1703, 2553, 3078, 3133], 'Sakomura': [572], 'Y.': [573, 587, 756], 'Ueda': [574], 'Kimura': [576], 'Manabe': [578], 'I.': [579], 'Ishiwata': [580], 'Komiyama': [582], 'N.': [583, 1397, 3270], 'Yamaguchi': [584], 'H.': [585, 1391, 2375], 'Yazaki': [586], 'Nagai': [588], 'R.': [589, 609, 711, 880, 908, 910, 944, 995, 1793, 2128, 2373, 2555, 2557], 'Circulation.': [590, 1685], '1997;': [591, 658, 1017, 1106, 1127, 1802, 3087, 3142], '96:': [592], '82-90Crossref': [593], '(105)': [596, 953], 'This': [599], 'process': [600], 'phenotypic': [602, 641], 'modulation': [603], '(7.Chamley-Campbell': [604], 'J.': [605, 656, 666, 668, 683, 716, 734, 765, 993, 1014, 1207, 1246, 1250, 1253, 1273, 1313, 1602, 1772, 1962, 2003, 2392, 3086, 3141, 3590, 3725, 3758], 'Campbell': [606], 'G.R.': [607], 'Ross': [608], '1979;': [612], '59:': [613], '1-61Crossref': [614], '(1264)': [617], 'Scholar)': [619, 1617, 1691, 1787, 1809, 2018, 2569, 3464], 'implies': [620], 'genetic': [623], 'program': [624, 1198], 'SMC': [626, 1180, 1200, 1529, 1628, 1709, 1731, 3717, 3844, 3982, 4318], 'not': [629, 2429, 3745, 4332], 'fixed.': [630], 'effort': [633, 1151], 'begin': [635, 1452], 'understanding': [636, 1157], 'programs': [639], 'underlying': [640], 'modulation,': [642], 'several': [643, 1304, 1492, 4327], 'promoters': [645, 783], 'studied,': [648], 'including': [649], 'telokin': [650], '(8.Herring': [651], 'Smith': [653, 1681, 2448], 'A.F.': [654], 'Am.': [655], '272:': [659, 1018], 'C1394-C1404Crossref': [660], 'Scholar);': [663, 698, 2386, 3740], 'SM22': [664, 3031, 3433], '(9.Solway': [665], 'Seltzer': [667, 1245], 'Samaha': [669], 'F.F.': [670, 1240], 'Kim': [671, 986], 'Alger': [673], 'L.E.': [674], 'Niu': [675], 'Q.': [676], 'Morrisey': [677, 1243], 'E.E.': [678, 1244], 'Ip': [679, 1116, 1241], 'H.S.': [680, 1117, 1242], 'Parmacek': [681, 1122, 1251], 'M.S.': [682, 1123, 1252], 'Biol.': [684, 717, 766, 846, 999, 1015, 1045, 1105, 1126, 1254, 1274, 1314, 1442, 1603, 1751, 1773, 1963, 2004, 3415, 3456, 3591, 3726, 3759], 'Chem.': [685, 718, 767, 1016, 1255, 1275, 1315, 1604, 1774, 1964, 2005, 3592, 3727, 3760], '270:': [687, 720], '13460-13469Abstract': [688], 'Full': [689, 691, 722, 724, 771, 885, 915, 1020, 1022, 1259, 1261, 1279, 1281, 1319, 1321, 1608, 1610, 1778, 1780, 1968, 1970, 2009, 2011, 2133, 2562, 3596, 3598, 3731, 3733, 3764, 3766], 'Text': [690, 692, 723, 725, 772, 886, 916, 1021, 1023, 1260, 1262, 1280, 1282, 1320, 1322, 1609, 1611, 1779, 1781, 1969, 1971, 2010, 2012, 2134, 2563, 3597, 3599, 3732, 3734, 3765, 3767], 'PDF': [693, 726, 773, 887, 917, 1024, 1263, 1283, 1323, 1612, 1782, 1972, 2013, 2135, 2564, 3600, 3735, 3768], '(227)': [696], 'isoforms': [703], 'α-actin': [705, 838, 3437], '(10.Shimizu': [706], 'R.T.': [707], 'Blank': [708], 'R.S.': [709], 'Jervis': [710], 'Lawrenz-Smith': [712], 'S.C.': [713], 'Owens': [714, 1137], '7631-7643Abstract': [721], '(139)': [729], 'Scholar),': [731, 750, 922, 1644], 'γ-actin': [732], '(11.Qian': [733], 'Kumar': [735], 'Szucsik': [737], 'J.C.': [738], 'Lessard': [739], 'J.L.': [740, 1221], 'Dev.': [741, 998, 1044, 1104, 1399, 1441, 1750, 3414, 3455], 'Dyn.': [742], '1996;': [743, 1000, 1256, 1276, 1316, 1605, 1775, 1965, 2006, 3593, 3728, 3761], '207:': [744], '135-144Crossref': [745], 'myosin': [752], 'heavy': [753], '(12.Katoh': [755], 'Loukianov': [757], 'E.': [758, 760, 1434, 1795], 'Kopras': [759], 'Zilberman': [761], 'Periasamy': [763], '1994;': [768], '269:': [769], '30538-30545Abstract': [770], 'Analyzing': [777], 'other': [780, 1385, 1527], 'provides': [784], 'necessary': [786], 'foundation': [787], 'identifycis-elements': [789], 'mediate': [791, 1535], 'ascertain': [797], 'whether': [798, 4269], 'such': [799, 1536], 'and/or': [801, 1372], 'their': [802, 1069, 2635], 'transacting': [803], 'factors': [804], 'targets': [807], 'signals': [809], 'lead': [811], 'repression': [814], 'SMC-associated': [816], 'diseases.': [817], 'The': [818, 1519, 1626, 1671, 1886, 1952, 2194, 2225, 2745, 2772, 3606, 3801, 3916, 4109, 4135, 4290, 4338], 'was': [821, 868, 1811, 1935, 1955, 2019, 2189, 2518, 2570, 2680, 2747, 2807, 2866, 2910, 2937, 3008, 3023, 3036, 3225, 3256, 3426, 3539, 3678, 3839, 3894, 3900, 4023, 4114, 4310, 4364, 4378], 'originally': [822], 'evolutionarily': [826, 1493], 'conserved': [827, 1494], 'element': [828, 1910], '(CC(A/T)6GG)': [829], 'found': [830], '5′-promoter': [833, 1070, 1298, 3742], 'region': [834, 929, 1299], 'cardiac': [837], '(13.Minty': [840], 'Kedes': [842], 'L.': [843, 991, 1095, 1738, 2141, 3402, 3443], 'Mol.': [844, 1124], 'Cell.': [845, 881, 911, 1125, 1749, 2129, 2558, 3413, 3454], '1986;': [847, 882, 2130], '6:': [848], '2125-2136Crossref': [849], '(274)': [852], 'It': [855], 'also': [856], 'forms': [857], 'core': [859, 1378], 'binding': [860, 2816, 4347, 4359], 'sequence': [861, 2164, 2199, 2546, 3905, 4207], 'element,': [866], 'promoter': [874, 1332, 1914, 1930, 2048, 2061, 2080, 3032, 3893, 3934, 3963, 3991, 4107, 4149], 'c-fos': [877, 1913], '(14.Treisman': [879, 2127], '46:': [883, 2131], '567-574Abstract': [884, 2132], '(532)': [890, 2138], 'Homodimers': [893], 'immediate-early': [896], 'transcription': [897, 966, 1162, 1369, 2897, 3294, 4224, 4263], 'factor,': [898, 967], '(15.Norman': [903, 2550], 'C.': [904, 1121, 1432, 2551], 'Runswick': [905, 2552], 'Pollock': [907, 2554], 'Treisman': [909, 2556], '1988;': [912, 1400, 2559], '55:': [913, 1232, 2560], '989-1003Abstract': [914, 2561], '(704)': [920, 2567], 'bind': [923], 'regulatory': [928, 1361], 'viral': [931, 3096, 3118, 3151], 'genes,': [932, 936], 'early': [933, 2079, 4120], 'growth': [934], '(16.Johansen': [941], 'F.E.': [942], 'Prywes': [943, 994], 'Biochim.': [945], 'Biophys.': [946], 'Acta.': [947], '1242:': [949], '1-10Crossref': [950], 'often': [959], 'stated': [960], 'widely': [964, 1160], 'expressed': [965, 1161, 3653], 'it': [968, 1188], 'particularly': [970], 'enriched': [971], 'skeletal,': [973], 'cardiac,': [974], 'during': [979], 'embryonic': [980, 3071, 3124], 'development': [983], '(17.Croissant': [984], 'J.D.': [985, 1039, 2500], 'J.H.': [987], 'Eichele': [988], 'G.': [989, 2447], 'Goering': [990], 'Lough': [992], 'Schwartz': [996, 1012, 1040, 1704, 1741, 2393, 3405, 3446], 'R.J.': [997, 1013, 1041], '177:': [1001], '250-264Crossref': [1002], '(157)': [1005], '18.Belaguli': [1008], 'N.S.': [1009], 'Schildmeyer': [1010], 'L.A.': [1011], '18222-18231Abstract': [1019], '(120)': [1027], '19.Browning': [1030], 'C.L.': [1031], 'Culberson': [1032], 'D.E.': [1033], 'Aragon': [1034], 'I.V.': [1035], 'Fillmore': [1036], 'R.A.': [1037], 'Croissant': [1038], 'Zimmer': [1042, 2401], 'W.E.': [1043], '194:': [1047], '18-37Crossref': [1048], '(76)': [1051, 1757, 3421, 3462], 'Many': [1054], 'highly': [1057, 1177, 3714], 'defining': [1060], 'harbor': [1062], 'or': [1064, 1337, 2365, 2634, 2799, 2851, 2905, 3001, 3066, 3342, 3369, 4006, 4132], 'more': [1065, 3667, 4380], 'region,': [1071], 'at': [1074, 2116, 2237, 2470, 2538, 2593, 2694, 2715, 2756, 2874, 2924, 2963, 2983, 3166, 3177, 3319, 3707, 4056, 4249], 'least': [1075, 1874, 2238, 2471, 4057], 'few': [1077], 'cases,': [1078], 'vivoexpression': [1081], 'absolutely': [1086], 'dependent': [1087, 1512], 'upon': [1088, 1513], 'functional': [1090, 1515, 2085], 'SRF-binding': [1091, 1495], '(20.Li': [1094], 'Liu': [1096], 'Z.C.': [1097], 'Mercer': [1098], 'B.': [1099, 1393, 1395, 1684], 'Overbeek': [1100], 'P.': [1101, 3268], 'Olson': [1102, 1271, 1311, 1600, 1743, 1770, 1798, 1960, 2001, 3407, 3448, 3588, 3723, 3756], 'E.N.': [1103, 1272, 1312, 1601, 1744, 1771, 1799, 1961, 2002, 3408, 3449, 3589, 3724, 3757], '187:': [1107], '311-321Crossref': [1108], '(145)': [1111], '21.Kim': [1114], 'Lu': [1118], 'M.M.': [1119], 'Clendenin': [1120], '2266-2278Crossref': [1129], '(190)': [1132], '22.Mack': [1135], 'C.P.': [1136, 1420], '852-861Crossref': [1143], '(204)': [1146], 'A': [1149, 2182, 2541, 2927, 2986, 3833, 4019, 4065, 4151, 4214, 4294, 4304], 'major': [1150, 1728, 2121], 'therefore': [1152], 'directed': [1155], 'toward': [1156], 'how': [1158, 1532], 'confers': [1164], 'SMC-specific': [1165, 1476, 1537, 3747, 3921, 3949, 4137], 'activation': [1167, 3748, 3889], 'vivo.': [1169], '(SM-Calp)': [1173], 'tissues,': [1186], 'making': [1187], 'ideal': [1190], 'model': [1191], 'further': [1194, 2940], 'define': [1195], '(23.Gimona': [1202], 'Herzog': [1204], 'Vandekerchkhove': [1206], 'Small': [1208, 1228], 'J.V.': [1209, 1229], 'FEBS': [1210], 'Lett.': [1211], '1990;': [1212], '274:': [1213], '159-162Crossref': [1214], '(172)': [1217], '24.Duband': [1220], 'Gimona': [1222], 'Scatena': [1224], 'Sartore': [1226], 'Differentiation.': [1230], '1993;': [1231], '1-11Crossref': [1233], '(194)': [1236], '25.Samaha': [1239], 'Tang': [1247], 'Solway': [1249], '271:': [1257, 1277, 1317, 1606, 1776, 1966, 2007, 3594, 3729, 3762], '395-403Abstract': [1258], '(94)': [1266], '26.Miano': [1269], 'J.M.': [1270, 1310, 1599, 1746, 1769, 1791, 1797, 1959, 2000, 3410, 3451, 3587, 3722, 3755], '7095-7103Abstract': [1278, 1318, 1607, 1777, 1967, 2008, 3595, 3730, 3763], '(112)': [1286, 1326, 1615, 1785, 1975, 2016, 3603, 3738, 3771], 'SM-Calp': [1290, 1364, 1484, 1510, 1810, 2041, 2906, 3334, 3610, 3711, 3785, 3794, 3874, 3892, 3930, 3946, 3962, 3990, 4016, 4100, 4113, 4334], 'tightly': [1293], 'SMCs,': [1296, 3876], 'displays': [1300], 'promiscuous': [1301], 'non-SMC': [1305, 3878, 3965, 4328], 'vitro': [1308, 2574, 2588, 2804], '(26.Miano': [1309, 1598, 1768, 1958, 1999, 3586, 3721, 3754], 'Paradoxically,': [1329], 'same': [1331, 3857, 4008, 4136], 'constructs': [1333], 'either': [1334, 2352, 2415, 3329, 3360, 4000], 'inactive': [1336], 'show': [1338, 1505, 3807, 4295, 4344], 'ectopic': [1339], '(position': [1340], 'effect-mediated)': [1341], 'transgenic': [1344], 'mice.': [1345], '2J.': [1346], 'Miano,': [1348], 'unpublished': [1349], 'observations.': [1350], 'divergent': [1352], 'data': [1353, 2431, 3651, 3672, 3690, 3802, 3917, 4033, 4049, 4291, 4339], 'led': [1355], 'us': [1356], 'hypothesize': [1358], 'cell-specific': [1360, 3888], 'lie': [1366], 'unit': [1370], 'itself': [1371], 'reside': [1373], 'great': [1374], 'distances': [1375], 'promoter,': [1379, 3786], 'described': [1383, 1596, 1956, 2275, 2445, 3076, 3131, 3252, 3396, 3585, 3614, 4286], 'muscle-restricted': [1386], '(27.Donoghue': [1388], 'Ernst': [1390], 'Wentworth': [1392], 'Nadal-Ginard': [1394, 1683], 'Rosenthal': [1396], 'Genes': [1398], '2:': [1401], '1779-1790Crossref': [1402], '(125)': [1405], '28.Goldhamer': [1408], 'D.J.': [1409], 'Brunk': [1410], 'Faerman': [1412], 'King': [1414], 'Shani': [1416], 'Emerson': [1418], 'Jr.,': [1419], 'Development': [1421], '(Camb.).': [1422], '121:': [1424], '637-649Crossref': [1425], '29.Raguz': [1429], 'Hobbs': [1431], 'Yague': [1433], 'Ioannou': [1435], 'P.A.': [1436], 'F.S.': [1438], 'Antoniou': [1439], '201:': [1444], '26-42Crossref': [1445], '(33)': [1448], 'To': [1451, 1978, 2035, 2082, 3774, 4267], 'distinguish': [1454], 'between': [1455, 1621, 4072, 4158], 'possibilities,': [1457], 'analyzed': [1460, 1828, 2313, 3099], 'nucleotide': [1461, 4206], 'sequences': [1462, 1985, 2044, 3743, 3955, 3988, 4103], '3′': [1463, 2027], '(PIC)': [1468], 'SM-Calp.': [1470, 4213], 'this': [1472, 2066, 3981, 4147], 'report,': [1473], 'describe': [1475], 'appears': [1486], 'mediated': [1489], 'entirely': [1490], 'boxes.': [1497], 'Using': [1498], 'adenovirus-mediated': [1500], 'transfer': [1502], 'approach,': [1503], 'SRF-CArG': [1516], 'axis.': [1518], 'discussed': [1522], 'context': [1525, 3906], 'SRF-dependent': [1528], 'expression.': [1539], 'All': [1540, 1708, 1849, 2461, 2529, 3688], 'lines': [1542, 1696, 1710, 4329], 'were': [1543, 1570, 1583, 1619, 1655, 1697, 1827, 1851, 1878, 1895, 2201, 2207, 2232, 2264, 2296, 2312, 2435, 2463, 2493, 2531, 2591, 2601, 2654, 2704, 2734, 2775, 2948, 2970, 3053, 3098, 3120, 3154, 3171, 3199, 3230, 3242, 3290, 3351, 3383, 3479, 3525, 3552, 3573, 3639, 3661, 3694, 3703, 3997, 4173], 'grown': [1544, 1665, 2483], "Dulbecco's": [1546, 3189], 'modified': [1547, 3190], "Eagle's": [1548, 3191], 'medium': [1549, 2236, 3192, 3224], 'containing': [1550, 2543, 3193, 3492, 4010], 'high': [1551, 2098], 'glucose,': [1552], '10%': [1553, 3498, 3556], 'fetal': [1554, 3195], 'bovine': [1555, 2835, 3196], '(Life': [1557], 'Technologies,': [1558, 2605], 'Inc.),': [1559, 2904], '2': [1560, 2842, 3806, 4143], 'mml-glutamine,': [1561], '100': [1562, 1566, 2786, 3508], 'units/ml': [1563], 'penicillin,': [1564], 'μg/ml': [1567, 3509, 3514, 3518, 3522], 'streptomycin': [1568], 'maintained': [1571], 'humidified': [1574], 'incubator': [1575], '(37': [1576], '°C,': [1577], '5%': [1578], 'CO2).': [1579], 'Rat': [1580], 'aortic': [1581, 1694, 1712, 3831, 4084], 'isolated': [1584, 3257], 'thoracic': [1587], 'aortas': [1588], 'adult': [1590], 'male': [1591], 'Harlan': [1592], 'Sprague-Dawley': [1593], 'rats': [1594], 'previously': [1597, 1720, 1957], 'used': [1620, 1896, 1936, 2571, 2938], 'passages': [1622], '15': [1623, 2922], '25.': [1625], 'A7r5': [1627, 3843], 'line': [1629, 3879, 4079, 4319], '(30.Kimes': [1630], 'B.W.': [1631], 'Brandt': [1632], 'B.L.': [1633], 'Exp.': [1634], 'Cell': [1635, 3477], '1976;': [1637], '98:': [1638], '349-366Crossref': [1639], '(322)': [1642], 'Balb/c': [1645], '3T3': [1646], 'fibroblasts,': [1647], 'L6': [1648, 4133, 4166], 'skeletal': [1649], 'myoblasts,': [1650], 'COS-7,': [1651], 'HeLa': [1653], 'purchased': [1656, 2602], 'American': [1658], 'Type': [1659], 'Culture': [1660], 'Collection': [1661], '(Manassas,': [1662], 'VA)': [1663], 'according': [1666, 2495], "supplier's": [1669], 'specifications.': [1670, 2528], 'PAC1': [1672, 3828, 3968, 4131, 4164, 4317], '(31.Rothman': [1673], 'Kulik': [1675], 'T.J.': [1676, 2145], 'Taubman': [1677], 'M.B.': [1678], 'Berk': [1679], 'B.C.': [1680], 'C.W.J.': [1682], '1992;': [1686, 2379], '86:': [1687], '1977-1986Crossref': [1688], 'pup': [1693], 'kindly': [1698, 2387], 'provided': [1699, 1835, 2388, 2992], 'Dr.': [1701, 2390, 2399, 2994, 3474], 'Stephen': [1702], '(University': [1705, 2402], 'Washington).': [1707], '(rat': [1711], 'SMC,': [1713], 'A7r5,': [1714], 'PAC1)': [1716], 'characterized': [1719], 'shown': [1722, 2641, 4035, 4145], 'express': [1724, 4333], 'most': [1725, 1901], 'markers': [1729], 'identity': [1732, 2943], '(32.Firulli': [1733, 3397, 3438], 'A.B.': [1734, 3398, 3439], 'Han': [1735, 3399, 3440], 'D.': [1736, 3400, 3441], 'Kelly-Roloff': [1737, 3401, 3442], 'Koteliansky': [1739, 3403, 3444], 'V.E.': [1740, 3404, 3445], 'S.M.': [1742, 3406, 3447], 'Miano': [1745, 3409, 3450], 'Vitro': [1748, 3412, 3453], '34:': [1753, 3417, 3458], '217-226Crossref': [1754, 3418, 3459], 'Dideoxynucleotide': [1760], 'sequencing': [1761], 'mouse': [1767, 3030, 3468], 'human': [1789, 2548, 3070, 3123], '(33.Miano': [1790], 'Krahe': [1792], 'Garcia': [1794], 'Elliott': [1796], 'Gene': [1800], '(Amst.).': [1801], '197:': [1803], '215-224Crossref': [1804], '(18)': [1807], 'performed': [1812, 2093, 2464, 3427, 4283], 'ABI': [1815], '377': [1816], 'automated': [1817], 'DNA': [1818], 'sequencer': [1819], '(Applied': [1820], 'Biosystems,': [1821, 3016], 'Inc.,': [1822, 1846, 1870, 2606, 2671, 2893, 3017], 'Foster': [1823], 'City,': [1824], 'CA).': [1825, 1872, 3348], 'Sequences': [1826], 'FASTA': [1831], 'FINDPATTERNS': [1833], 'algorithms': [1834], 'GCG': [1838], 'Wisconsin': [1839], 'Package': [1840], '(Version': [1841, 3700], '10.0,': [1842], 'Genetics': [1843], 'Computer': [1844], 'Group,': [1845], 'Madison,': [1847, 1893], 'WI).': [1848], 'plasmids': [1850, 1877, 1891, 2188, 3052], 'amplified': [1852], 'XL-Blue': [1855], 'strain': [1856], 'bacteria': [1858], '(Stratagene,': [1859], 'La': [1860], 'Jolla,': [1861], 'CA)': [1862, 2608], 'purified': [1864, 2705, 2773, 3129, 3372], 'solid-phase': [1866], 'anion-exchange': [1867], 'chromatography': [1868], '(QIAGEN': [1869], 'Valencia,': [1871], 'At': [1873], 'independent': [1876, 2186, 2476, 4063, 4177], 'generated': [1879, 3695], 'tested': [1881, 2190, 3880], 'reporter': [1884, 1902, 1954, 2067, 2250, 2318, 2337, 2427, 2989, 3752, 3799, 4003, 4009, 4021, 4042, 4123], 'construct.': [1885, 2478, 4108], 'pGL3-basic': [1887], 'pGL3': [1889, 2060], 'promoter-luciferase': [1890], '(Promega,': [1892], 'WI)': [1894], 'backbone': [1899, 2412], 'genes.': [1903], 'Two': [1904], 'copies': [1905], '(GATGTCCATATTAGGACATC,': [1915], 'underlined)': [1920], 'linked': [1921, 2355], 'herpes': [1924, 2358], 'simplex': [1925, 2359], 'virus': [1926, 2360, 3215], 'thymidine': [1927], 'kinase': [1928, 2667], 'minimal': [1929], 'front': [1932], 'pGL2': [1934], 'plasmid': [1940, 2068, 2258, 2413, 2422, 2440, 2477, 2542, 3014, 3106, 4022, 4129], 'test': [1942, 3684, 4068, 4154], '(see': [1950, 2172, 4188], 'below).': [1951], '−549CalpLuc': [1953, 1988, 3798, 3825, 4002, 4041, 4073], 'assess': [1979, 2036], 'influence': [1981], '1': [1984, 2043, 2239, 2349, 2727, 2760, 2800, 2883, 3221, 3513, 3517, 3521, 3913, 3987, 4102], 'reporter,': [1989], '1.7-kilobase': [1991], 'our': [1994, 2424], 'original': [1995], 'CALP-5': [1996], 'λ': [1997], 'clone': [1998], 'ligated': [2020], 'into': [2021, 2054, 3010, 3038, 3055, 4130], 'uniqueSalI': [2023], 'site': [2024, 2057, 3041, 4226, 4265], 'located': [2025], 'just': [2026], 'polyadenylation': [2030], 'signal': [2031], 'create': [2033, 2064], '−549CalpLuc-I.': [2034], 'heterologous': [2047, 3933, 4106, 4148], 'context,': [2049], 'cloned': [2051, 3009, 3037, 3788, 4115, 4183], 'SalI': [2056], 'SV40Luc-I;': [2065], 'contains': [2069, 3947], 'luciferase': [2071, 2310, 2317, 3751, 3821, 3860, 3883, 4032, 4122], 'under': [2073, 3025, 4287], 'SV40': [2078, 4119], '(Promega).': [2081], 'address': [2083], '(ICs),': [2091], 'site-directed': [2094], 'fidelity': [2099, 2200], 'PfuDNA': [2100], '(QuikChange,': [2102], 'Stratagene).': [2103], 'Methylation': [2104], 'interference': [2105], 'assays': [2106, 3250, 3382], 'x-ray': [2108, 2976, 3642], 'crystallography': [2109], 'critical': [2112], 'contact': [2114], 'points': [2115], 'guanine': [2117], 'residues': [2118], 'groove': [2122], 'Scholar,34.Pellegrini': [2140], 'Tan': [2142], 'Richmond': [2144], 'Nature.': [2146], '376:': [2148], '490-498Crossref': [2149], '(298)': [2152], 'Based': [2155], 'studies,': [2158], 'mutated': [2160], 'CC(A/T)': [2163], 'GTC': [2171], 'Fig.': [2173, 2632, 2652, 3805, 3919, 4142, 4202, 4229, 4245, 4342], '4)': [2174, 2633, 2653, 4246], 'generate': [2176, 2581], '−549CalpLuc-mut-IC1,': [2177], '−549CalpLuc-mut-IC2,': [2178], '−549CalpLuc-mut-IC3,': [2179], '−549CalpLuc-mut-IC1–3.': [2181], 'minimum': [2183], 'mutant': [2187, 2636, 3005], 'transient': [2192], 'transfections.': [2193], 'presence': [2195, 2342, 2663, 2852, 3810], 'mutations': [2197], 'verified': [2202], 'dideoxynucleotide': [2204, 3378], 'sequencing.': [2205, 3379], 'Cells': [2206, 3198, 3241, 3996], 'seeded': [2208], '(25,000': [2209], 'cells/cm2)': [2210], '24-well': [2212], 'dishes': [2213, 3158], '(Costar': [2214], 'Corp.,': [2215], 'Cambridge,': [2216], 'MA)': [2217], 'allowed': [2219, 3160, 3231], 'attach': [2221], 'grow': [2223, 3162, 3233], 'overnight.': [2224], 'following': [2226, 2525, 2912], 'day,': [2227], '(∼60–70%': [2230], 'confluent)': [2231], 'refed': [2233], 'fresh': [2234], 'complete': [2235, 3223], 'h': [2240, 2293, 2720], 'prior': [2241, 2966], 'addition': [2244, 4232], 'DNA.': [2246], 'Complexes': [2247], '(1': [2252, 3316], 'μg/well)': [2253, 2350], 'internal': [2256, 3367], '(50': [2259], 'ng/well': [2260], 'pRL-tkRenilla,': [2262], 'Promega)': [2263, 2443, 2579], 'coprecipitated': [2265], 'calcium': [2267], 'phosphate': [2268], 'applied': [2270], 'essentially': [2273, 3855], '(35.Graham': [2276], 'F.L.': [2277], 'Van': [2278], 'der': [2279], 'Eb': [2280], 'A.J.': [2281], 'Virology.': [2282], '1973;': [2283], '52:': [2284], '456-467Crossref': [2285], '(6492)': [2288], 'Approximately': [2291, 2858], '60': [2292], 'post-transfection,': [2294], 'harvested': [2297, 3244], 'mild': [2300], 'detergent': [2301], '(Passive': [2302], 'Lysis': [2303], 'Buffer,': [2304], 'Promega),': [2305], 'both': [2307, 4163], 'firefly': [2308], 'andRenilla': [2309], 'activities': [2311], 'dual': [2316], 'system': [2320], '(Promega)': [2321], 'using': [2322], 'AutoLumat': [2324], 'LB': [2325], '953': [2326], 'luminometer': [2327], '(EG&G': [2328], 'Berthold,': [2329], 'Gaithersburg,': [2330], 'MD).': [2331], 'some': [2333, 2881], 'experiments,': [2334], 'assayed': [2336], 'varying': [2344, 2979, 4028], 'amounts': [2345, 2410], '(10': [2346], 'ng': [2347], 'wild-type': [2353], 'virion': [2361], 'protein,': [2362], 'VP16': [2363], '(SRF-VP16),': [2364], 'form': [2368], '(SRFpm1': [2371], '(36.Prywes': [2372], 'Zhu': [2374], 'Nucleic': [2376, 2505], 'Acids': [2377, 2506], '20:': [2380], '513-520Crossref': [2381], '(55)': [2384], 'Robert': [2391], '(Baylor': [2394], 'College': [2395, 2998], 'Medicine)': [2397, 3000], 'Warren': [2400], 'South': [2404], 'Alabama)).': [2405], 'Control': [2406], 'received': [2408], 'equivalent': [2409], 'without': [2414], 'insert.': [2417], 'Because': [2418, 3967], 'SRF-VP16': [2420, 2434], 'influenced': [2423], 'pRL-tk': [2425], 'Renilla': [2426, 4020, 4128], '(data': [2428], 'shown),': [2430], 'pertaining': [2432], 'normalized': [2436], 'promoterlessRenilla': [2439], '(pRL-null': [2441], 'Renilla,': [2442], '(37.Behre': [2446], 'L.T.': [2449], 'Tenen': [2450], 'D.G.': [2451], 'BioTechniques.': [2452], '26:': [2454], '24-26Crossref': [2455], '(69)': [2458], 'transfections': [2462], 'quadruplicate': [2466], 'repeated': [2468], 'additional': [2473, 2921], 'experiment': [2474, 4178], 'per': [2475], 'Nuclear': [2479], 'extracts': [2480, 2530, 3549, 4314], '150-mm': [2485], 'plates': [2486], '(total': [2487], '∼2': [2489], '×': [2490], '108': [2491], 'cells)': [2492], 'prepared': [2494, 3121], 'established': [2497], 'methods': [2498], '(38.Dignam': [2499], 'Lebovitz': [2501], 'R.M.': [2502], 'Roeder': [2503], 'R.G.': [2504], '1983;': [2508], '11:': [2509], '1475-1489Crossref': [2510], '(9159)': [2513], 'Protein': [2516, 3537], 'concentration': [2517, 3538], 'determined': [2519, 3540], 'BCA': [2522, 3543], '(Pierce)': [2524], "manufacturer's": [2527], 'snap-frozen': [2532], 'liquid': [2534, 2598], 'nitrogen': [2535], 'stored': [2537, 2592], '−80': [2539, 2594, 2757, 2984], '°C.': [2540, 2595, 2985], 'full-length': [2545], 'anin': [2573], 'transcription/translation': [2575], '(TnT': [2577], 'system,': [2578], 'protein.': [2584], 'Samples': [2585, 2947, 3524], 'translated': [2589, 2805], 'High': [2596, 3116], 'performance': [2597], 'chromatography-purified': [2599], 'oligonucleotides': [2600, 2622], 'commercially': [2603], '(Operon': [2604], 'Alameda,': [2607], 'dissolved': [2610], 'sterile': [2612], 'water.': [2613], 'Sense': [2614], '(shown': [2615], 'boldface': [2617, 2630, 2643], 'Fig.4)': [2619], 'antisense': [2621], 'encompassing': [2623], 'ICs': [2627], '(underlined': [2628], 'counterparts': [2637], '(mutant': [2638], 'bases': [2639], 'italics': [2644], 'below': [2645], '5′-nucleotides': [2647], 'IC': [2650], 'individually': [2655], 'labeled': [2656, 2677, 2862], '[γ-32P]dATP': [2658], '(3000': [2659], 'Ci/mmol)': [2660], 'T4': [2665], 'polynucleotide': [2666], '(New': [2668], 'England': [2669], 'Biolabs': [2670], 'Beverly,': [2672], 'MA).': [2673], 'Each': [2674, 3021, 4046], 'pair': [2675], 'oligonucleotide': [2678, 2702, 2856, 3368], 'probes': [2679, 2703, 2774, 3430], 'then': [2681, 2691, 2735, 2776, 2867, 2973, 3243, 3359, 3487, 3532, 3574], 'mixed,': [2682], 'heated': [2683], '65': [2685], '°C': [2686, 2717, 2758, 3306], '5': [2688, 2825, 3058, 3535, 4321, 4336], 'min,': [2689], 'slowly': [2692], 'cooled': [2693], 'room': [2695, 2875, 2925], 'temperature': [2696, 2876], 'annealing.': [2699], 'Labeled': [2700], 'double-stranded': [2701], 'nondenaturing': [2708, 2952], '6%': [2709, 2953], 'polyacrylamide': [2710, 2954, 3557], 'gel;': [2711], 'excised;': [2712], 'eluted': [2714], '50': [2716], '4': [2719, 2767, 3238, 4203], '0.5m': [2722], 'sodium': [2723], 'acetate': [2724], '(pH': [2725, 2790, 3496], '5.2),': [2726], 'mm': [2728, 2819, 2826, 2830, 2843, 3494, 3503, 3506], 'EDTA,': [2729, 3507], '0.1%': [2731], 'SDS.': [2732], 'Probes': [2733], 'centrifuged': [2736], 'briefly': [2737], 'pellet': [2739], 'small': [2741], 'pieces': [2742], 'acrylamide.': [2744], 'supernatant': [2746], 'passed': [2748], 'over': [2749, 3205, 3823], 'filter': [2751], 'column': [2752, 4047], '(Whatman)': [2753], 'precipitated': [2755], 'μl': [2761, 2787, 2801, 2884], 'glycogen': [2763], '(20': [2764], 'mg/ml)': [2765], 'volumes': [2768], '100%': [2770], 'ethanol.': [2771], 'centrifuged,': [2777], 'washed': [2778, 3172, 3480], '70%': [2780], 'ethanol,': [2781], 'recentrifuged,': [2782], 'resuspended': [2784], 'Tris/EDTA': [2789], '8.0).': [2791], 'For': [2792, 3150, 3281], 'EMSAs,': [2793], '∼5': [2794], 'μg': [2795, 2833, 2839], 'extract': [2798], 'incubated': [2808, 2873, 2918, 3174, 3620], '10': [2810, 3203, 3502], 'min': [2811, 2923, 2962, 3204, 3317], 'ice': [2813], '1×': [2815], 'buffer': [2817, 3491], '(40': [2818], 'KCl,': [2820], '0.4': [2821], 'mmMgCl2,': [2822], '4%': [2823], 'glycerol,': [2824, 3499], 'HEPES,': [2827], '2.4': [2829], 'EDTA),': [2831], '16': [2832], 'albumin,': [2837], '0.125': [2838], 'poly(dI-dC),': [2841], 'spermidine,': [2844], '0.2': [2846], 'mmdithiothreitol': [2847], 'absence': [2850], 'unlabeled': [2854, 4376], 'competitor': [2855], '(>100×).': [2857], '50,000': [2859], 'cpm': [2860], 'probe': [2863, 2913], '(∼0.2–0.5': [2864], 'pm)': [2865], 'added': [2868], 'mixture': [2871, 2917], '20': [2878], 'min.': [2879, 3536], 'samples,': [2882], 'antiserum': [2886], '(sc-335,': [2889], 'Santa': [2890, 2894, 2901, 3632], 'Cruz': [2891, 2902, 3633], 'Biotechnology,': [2892, 2903, 3634], 'Cruz,': [2895], 'CA),': [2896], 'YY1': [2899], '(sc-281,': [2900], '(clone': [2907], 'hCP;': [2908], 'Sigma)': [2909], 'included': [2911], 'addition,': [2914], 'temperature.': [2926], 'second': [2928], 'antibody': [2929, 3624], '(raised': [2932], 'against': [2933], 'NH2': [2935], 'terminus)': [2936], 'confirm': [2941, 3565], 'nucleoprotein': [2945, 4305], 'complexes.': [2946], 'resolved': [2949, 3352, 3553], 'gel': [2955, 3357, 3558], '(19:1': [2956], 'acrylamide/bisacrylamide)': [2957], 'pre-ran': [2959], '30': [2961], '150': [2964], 'V': [2965], 'loading.': [2968, 3570], 'Gels': [2969], 'vacuum-dried': [2971], 'exposed': [2974], 'film': [2977, 3643], 'periods': [2980, 3235], 'time': [2982], 'lacZ': [2988], '(kindly': [2991], 'Yassemi': [2995], 'Capetanaki,': [2996], 'Baylor': [2997], 'SRFpm1': [3003], '(DNSRF)': [3006], 'cDNA': [3007, 3297, 3429], 'pCA3': [3012, 3043], 'shuttle': [3013, 3051, 3105], '(Microbix': [3015], 'Toronto,': [3018], 'Ontario,': [3019], 'Canada).': [3020], 'transgene': [3022], 'placed': [3024], '(−445': [3033], 'nucleotides),': [3034], 'BglII': [3040], 'place': [3045], 'cytomegalovirus': [3048], 'Recombinant': [3050], 'integrated': [3054], 'serotype': [3057], 'replication-defective': [3059], '(strain': [3061], 'dl327)': [3062], 'direct': [3064, 3746], 'ligation': [3065], 'homologous': [3067], 'recombination': [3068], 'kidney': [3072, 3125], '293': [3073, 3126], '(39.Foschi': [3077, 3132], 'Chari': [3079, 3134], 'Dunn': [3081, 3136], 'M.J.': [3082, 3137], 'Sorokin': [3083, 3138], 'EMBO': [3085, 3140], '16:': [3088, 3143], '6439-6451Crossref': [3089, 3144], '(142)': [3092, 3147], 'Crude': [3095], 'lysates': [3097], 'proper': [3101, 3904], 'integration': [3102], 'restriction': [3108], 'digestion': [3109], 'PCR': [3111, 3315, 3349], 'transgene.': [3115], 'titer': [3117], 'stocks': [3119], 'transductions,': [3152], 'plated': [3155], '100-mm': [3157], 'until': [3163], '∼80–90%': [3164], 'confluent,': [3165], 'time,': [3168], '(m.o.i.)': [3182], '10–100': [3184], '0.6': [3186], 'ml': [3187], '2%': [3194, 3500], 'serum.': [3197], 'gently': [3200], 'rocked': [3201], 'every': [3202, 3877, 4077], '1-h': [3207], 'incubation': [3208], 'period': [3209], 'uniform': [3212], 'adsorption': [3213], 'monolayer.': [3219], 'After': [3220], 'h,': [3222], 'added,': [3226], 'up': [3236], 'days': [3239], 'post-transduction.': [3240], 'mRNA': [3246], 'below.': [3253], 'Total': [3254], 'RNA': [3255, 3287], 'monolayers': [3260, 3478], 'guanidinium': [3263], 'isothiocyanate/acid': [3264], 'phenol': [3265], 'method': [3266], '(40.Chomczynski': [3267], 'Sacchi': [3269], 'Anal.': [3271], 'Biochem.': [3272], '1987;': [3273], '162:': [3274], '156-159Crossref': [3275], '(63176)': [3278], 'reverse': [3282, 3293, 3339], 'transcription-PCR,': [3283], 'samples': [3284, 3546, 3572, 4059], 'total': [3286], '(∼5': [3288], 'μg)': [3289, 3551], 'subjected': [3291], '(first': [3295], 'strand': [3296], 'synthesis': [3298], 'kit,': [3299], 'Amersham': [3300], 'Pharmacia': [3301, 3648], 'Biotech)': [3302], 'denaturation': [3304], '(94': [3305], '3': [3308], 'min),': [3309], 'followed': [3310, 3680], '25': [3312], 'cycles': [3313], '94,': [3320], '55,': [3321], '72': [3323], '°C)': [3324], 'primers': [3326], 'specific': [3327], '5′-end': [3331], 'rat': [3333, 3432, 3830, 4083], '(forward': [3335], 'primer,': [3336, 3340], '5′-ATGTCTTCCGCACACTTTAAC-3′;': [3337], '5′-TCGATCCACTCTCTCAGCTCC-3′)': [3341], 'glyceraldehyde-3-phosphate': [3343], 'dehydrogenase': [3344], '(CLONTECH,': [3345], 'Palo': [3346], 'Alto,': [3347], 'products': [3350], '1%': [3355], 'agarose': [3356], 'blotted': [3361], 'Southern': [3363], 'hybridization': [3364], 'excised': [3370], '(Qiaquick': [3373], 'column,': [3374], 'QIAGEN': [3375], 'Inc.)': [3376], 'RNase': [3380], 'protection': [3381], 'carried': [3384], 'out': [3385], 'radiolabeled': [3387], 'riboprobes': [3388], 'SM-Calp,': [3390, 4281], 'α-tubulin,': [3391], '18': [3393], 'S': [3394], 'Northern': [3424], 'blotting': [3425, 3583], 'retinoic': [3469], 'acid': [3470], 'receptor-α': [3471], '(gift': [3472], 'Pierre': [3475], 'Chambon).': [3476], 'twice': [3481], 'cold': [3483], 'phosphate-buffered': [3484], 'saline': [3485], 'scraped': [3488], 'extraction': [3490], '55': [3493], 'Tris-HCl': [3495], '6.8),': [3497], 'SDS,': [3501], 'dithiothreitol,': [3504], '0.5': [3505], 'phenylmethylsulfonyl': [3510], 'fluoride,': [3511], 'pepstatin': [3515], 'A,': [3516], 'leupeptin,': [3519], 'aprotinin.': [3523], 'sheared': [3526], 'through': [3527], '23-gauge': [3529], 'needle': [3530], 'boiled': [3533], 'assay.': [3544], 'Initially,': [3545], '(25–50': [3550], 'stained': [3560], 'Coomassie': [3562], 'Blue': [3563], 'sample': [3566], 'integrity': [3567], 'equal': [3569], 'Parallel': [3571], 'electroblotted': [3575], 'nitrocellulose': [3577], '(Bio-Rad)': [3578], 'processed': [3580], 'Western': [3582], '(1:2000)': [3608], '(1:5000)': [3611], 'antisera': [3612], 'above.': [3615], 'As': [3616], 'control,': [3618], 'blots': [3621], 'SH2': [3627], 'adaptor': [3628], 'Grb-2': [3630], '(c-7,': [3631], 'Inc.).': [3635], 'Specific': [3636], 'ECL': [3645], 'reagents': [3646], '(Amersham': [3647], 'Biotech,).': [3649], 'Transfection': [3650], 'mean': [3656, 4052], '±': [3657, 4053], 'S.E.': [3658, 4054], 'Paired': [3659], 'comparisons': [3660], 'made': [3662], 'ttest.': [3665], 'Where': [3666], 'than': [3668, 4368], 'groups': [3670], 'occur,': [3673], 'variance': [3677], 'performed,': [3679], "Tukey's": [3682], 'post-hoc': [3683], 'intergroup': [3686], 'comparisons.': [3687], 'graphical': [3689], 'statistical': [3692], 'analyses': [3693], 'GraphPAD': [3697], 'Prism': [3698], 'software': [3699], '2.0).': [3701], 'Data': [3702], 'considered': [3704], 'statistically': [3705], 'significant': [3706, 4070, 4156], 'p': [3708], '<': [3709, 4081, 4169], '0.05.': [3710], '(Fig.': [3719, 3885, 4320, 4335], '1)': [3720], 'however,': [3741], 'do': [3744, 4331], 'determine': [3775, 4268], '3′-sequences': [3779], 'entire': [3790, 4012], 'downstream': [3795, 4116, 4260], 'gene.': [3800], 'depicted': [3803], '2–3-fold': [3818], 'increase': [3819, 3836], 'SMCs.': [3832], 'smaller': [3834], 'incremental': [3835], 'noted': [3840], 'line.': [3845], 'Cloning': [3846], 'opposite': [3851, 4186], 'orientation': [3852, 4187], 'resulted': [3853], 'elevation': [3858], 'activity.2': [3861], 'contrast': [3863], 'enhancer-like': [3866], 'contributed': [3868], 'showed': [3881], '2).': [3886], 'Comparable': [3887], 'observed': [3895, 4311, 4370], 'when': [3896], '(i.e.': [3907], 'follows': [3911], 'exon': [3912], 'SM-Calp).2': [3915], '3document': [3920], 'conferred': [3924], 'context.': [3935, 4150], 'Taken': [3936], 'together,': [3937], 'suggest': [3940], 'enhancer(s)': [3950], 'repressive': [3954], 'mitigate': [3957], 'lineages.': [3966], 'consistently': [3970], 'yielded': [3971], 'highest': [3973], 'subsequent': [3978], 'line.Figure': [3983], '2Effect': [3984], 'cultured': [3994], 'cells.': [3995, 4134], 'transfected': [3998], '(black': [4004], 'bars)': [4005], '(hatched': [4017], 'bars).': [4018], 'cotransfected': [4024, 4125], 'correct': [4026], 'transfection': [4029], 'efficiencies.': [4030], 'Normalized': [4031], '-fold': [4037], 'changes': [4038], '(set': [4043], '1).': [4045], 'represents': [4050], 'eight': [4058], 'derived': [4060], 'studies.': [4064], 'two-tailed': [4066, 4152], 'pairedt': [4067, 4153], 'differences': [4071, 4157], '−549CalpLuc-I': [4075], '(p': [4080, 4168], '0.05).RASMC,': [4082], 'SMCs;': [4085], 'RLU,': [4086], 'relative': [4087, 4191], 'light': [4088, 4192], 'units.View': [4089, 4193], 'Large': [4090, 4194], 'Image': [4091, 4195], 'Figure': [4092, 4196], 'ViewerDownload': [4093, 4197], 'Hi-res': [4094, 4198], 'image': [4095, 4199], 'Download': [4096, 4200], '(PPT)Figure': [4097], '3Effect': [4098], 'promoter-driven': [4121], 'documented': [4140], 'SV40Luc': [4159], 'SV40Luc-I': [4161], '0.01).': [4170], 'Similar': [4171], 'seen': [4174], 'Footnote': [4189], '2).RLU,': [4190], '(PPT)': [4201], 'shows': [4204], 'present': [4219, 4248], '+852': [4220], 'nucleotides': [4221, 4259], 'start': [4225, 4264], '(IC1': [4227], '4).': [4230], 'box,': [4237], '(IC2': [4241], 'IC3': [4243], '3′-end': [4251], '(+1530': [4256], '+1745': [4258], ').': [4266], 'binds': [4271, 4299], 'individual': [4273], 'EMSA': [4284], '“Experimental': [4288], 'Procedures.”': [4289], 'Fig.5': [4293], 'IC1': [4302, 4363], 'element.': [4303], 'comparable': [4308], 'A)': [4322], 'B).': [4337], 'presented': [4340], '6': [4343], 'comparatively': [4345], 'weak': [4346], 'IC2': [4351, 4372], 'IC3.': [4353], 'Densitometric': [4354], 'indicated': [4356], '>200': [4365], 'times': [4366], 'greater': [4367], 'IC3.2': [4374], 'Indeed,': [4375], 'IC1oligonucleotide': [4377], 'effe': [4381]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2051307565', 'counts_by_year': [{'year': 2024, 'cited_by_count': 3}, {'year': 2023, 'cited_by_count': 1}, {'year': 2022, 'cited_by_count': 1}, {'year': 2020, 'cited_by_count': 1}, {'year': 2019, 'cited_by_count': 2}, {'year': 2017, 'cited_by_count': 1}, {'year': 2016, 'cited_by_count': 3}, {'year': 2015, 'cited_by_count': 4}, {'year': 2014, 'cited_by_count': 5}, {'year': 2013, 'cited_by_count': 1}, {'year': 2012, 'cited_by_count': 9}], 'updated_date': '2024-12-11T18:35:07.557196', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
