Publication Information

{'id': 'https://openalex.org/W2034716886', 'doi': 'https://doi.org/10.1074/jbc.m100055200', 'title': 'Processive Phosphorylation of p130Cas by Src Depends on SH3-Polyproline Interactions', 'display_name': 'Processive Phosphorylation of p130Cas by Src Depends on SH3-Polyproline Interactions', 'publication_year': 2001, 'publication_date': '2001-07-01', 'ids': {'openalex': 'https://openalex.org/W2034716886', 'doi': 'https://doi.org/10.1074/jbc.m100055200', 'mag': '2034716886', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/11389136'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m100055200', 'pdf_url': 'http://www.jbc.org/article/S0021925819316254/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819316254/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5044921651', 'display_name': 'Patricia Pellicena', 'orcid': 'https://orcid.org/0000-0002-0575-4448'}, 'institutions': [{'id': 'https://openalex.org/I59553526', 'display_name': 'Stony Brook University', 'ror': 'https://ror.org/05qghxh33', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I59553526']}, {'id': 'https://openalex.org/I1327163397', 'display_name': 'State University of New York', 'ror': 'https://ror.org/01q1z8k08', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I1327163397']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Patricia Pellicena', 'raw_affiliation_strings': ['Department of Physiology and Biophysics, School of Medicine, State University of New York at Stony Brook, Stony Brook, New York 11794-8661'], 'affiliations': [{'raw_affiliation_string': 'Department of Physiology and Biophysics, School of Medicine, State University of New York at Stony Brook, Stony Brook, New York 11794-8661', 'institution_ids': ['https://openalex.org/I59553526', 'https://openalex.org/I1327163397']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5050315454', 'display_name': 'W. Todd Miller', 'orcid': 'https://orcid.org/0000-0002-6566-0064'}, 'institutions': [{'id': 'https://openalex.org/I59553526', 'display_name': 'Stony Brook University', 'ror': 'https://ror.org/05qghxh33', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I59553526']}, {'id': 'https://openalex.org/I1327163397', 'display_name': 'State University of New York', 'ror': 'https://ror.org/01q1z8k08', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I1327163397']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'W. Todd Miller', 'raw_affiliation_strings': ['Department of Physiology and Biophysics, School of Medicine, State University of New York at Stony Brook, Stony Brook, New York 11794-8661'], 'affiliations': [{'raw_affiliation_string': 'Department of Physiology and Biophysics, School of Medicine, State University of New York at Stony Brook, Stony Brook, New York 11794-8661', 'institution_ids': ['https://openalex.org/I59553526', 'https://openalex.org/I1327163397']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 2, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 2.639, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 124, 'citation_normalized_percentile': {'value': 0.999974, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 96, 'max': 97}, 'biblio': {'volume': '276', 'issue': '30', 'first_page': '28190', 'last_page': '28196'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10169', 'display_name': 'Protein Kinase Regulation and GTPase Signaling', 'score': 0.9994, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10169', 'display_name': 'Protein Kinase Regulation and GTPase Signaling', 'score': 0.9994, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11016', 'display_name': 'Monoclonal and Polyclonal Antibodies Research', 'score': 0.9953, 'subfield': {'id': 'https://openalex.org/subfields/2741', 'display_name': 'Radiology, Nuclear Medicine and Imaging'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T10929', 'display_name': 'Wnt/β-catenin signaling in development and cancer', 'score': 0.9939, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/polyproline-helix', 'display_name': 'Polyproline helix', 'score': 0.89451385}, {'id': 'https://openalex.org/keywords/tyrosine-protein-kinase-csk', 'display_name': 'Tyrosine-protein kinase CSK', 'score': 0.62468755}], 'concepts': [{'id': 'https://openalex.org/C109300003', 'wikidata': 'https://www.wikidata.org/wiki/Q4384651', 'display_name': 'Polyproline helix', 'level': 3, 'score': 0.89451385}, {'id': 'https://openalex.org/C196347352', 'wikidata': 'https://www.wikidata.org/wiki/Q24771787', 'display_name': 'SH3 domain', 'level': 4, 'score': 0.8637762}, {'id': 'https://openalex.org/C108636557', 'wikidata': 'https://www.wikidata.org/wiki/Q21109354', 'display_name': 'Proto-oncogene tyrosine-protein kinase Src', 'level': 3, 'score': 0.860393}, {'id': 'https://openalex.org/C197153747', 'wikidata': 'https://www.wikidata.org/wiki/Q24780316', 'display_name': 'SH2 domain', 'level': 4, 'score': 0.8456228}, {'id': 'https://openalex.org/C11960822', 'wikidata': 'https://www.wikidata.org/wiki/Q242736', 'display_name': 'Phosphorylation', 'level': 2, 'score': 0.76678073}, {'id': 'https://openalex.org/C183141693', 'wikidata': 'https://www.wikidata.org/wiki/Q5005962', 'display_name': 'Tyrosine-protein kinase CSK', 'level': 5, 'score': 0.62468755}, {'id': 'https://openalex.org/C2777553839', 'wikidata': 'https://www.wikidata.org/wiki/Q14330986', 'display_name': 'Tyrosine phosphorylation', 'level': 3, 'score': 0.54502344}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.49830818}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.3684836}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.34717327}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.3470453}, {'id': 'https://openalex.org/C2779281246', 'wikidata': 'https://www.wikidata.org/wiki/Q172847', 'display_name': 'Peptide', 'level': 2, 'score': 0.15911672}], 'mesh': [{'descriptor_ui': 'D010455', 'descriptor_name': 'Peptides', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': True}, {'descriptor_ui': 'D010750', 'descriptor_name': 'Phosphoproteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D011506', 'descriptor_name': 'Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D016392', 'descriptor_name': 'Proto-Oncogene Proteins pp60(c-src)', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001665', 'descriptor_name': 'Binding Sites', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D050719', 'descriptor_name': 'Crk-Associated Substrate Protein', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015536', 'descriptor_name': 'Down-Regulation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004789', 'descriptor_name': 'Enzyme Activation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005822', 'descriptor_name': 'Genetic Vectors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005822', 'descriptor_name': 'Genetic Vectors', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007700', 'descriptor_name': 'Kinetics', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016297', 'descriptor_name': 'Mutagenesis, Site-Directed', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015688', 'descriptor_name': 'Oncogene Protein pp60(v-src)', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015688', 'descriptor_name': 'Oncogene Protein pp60(v-src)', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D010455', 'descriptor_name': 'Peptides', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010455', 'descriptor_name': 'Peptides', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D010750', 'descriptor_name': 'Phosphoproteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010766', 'descriptor_name': 'Phosphorylation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010770', 'descriptor_name': 'Phosphotransferases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010770', 'descriptor_name': 'Phosphotransferases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D011485', 'descriptor_name': 'Protein Binding', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017434', 'descriptor_name': 'Protein Structure, Tertiary', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011505', 'descriptor_name': 'Protein-Tyrosine Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011505', 'descriptor_name': 'Protein-Tyrosine Kinases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D011518', 'descriptor_name': 'Proto-Oncogene Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011518', 'descriptor_name': 'Proto-Oncogene Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D051572', 'descriptor_name': 'Proto-Oncogene Proteins c-hck', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016392', 'descriptor_name': 'Proto-Oncogene Proteins pp60(c-src)', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051381', 'descriptor_name': 'Rats', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D050717', 'descriptor_name': 'Retinoblastoma-Like Protein p130', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015398', 'descriptor_name': 'Signal Transduction', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013997', 'descriptor_name': 'Time Factors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D020798', 'descriptor_name': 'Two-Hybrid System Techniques', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014443', 'descriptor_name': 'Tyrosine', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014443', 'descriptor_name': 'Tyrosine', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D018909', 'descriptor_name': 'src Homology Domains', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m100055200', 'pdf_url': 'http://www.jbc.org/article/S0021925819316254/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/11389136', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m100055200', 'pdf_url': 'http://www.jbc.org/article/S0021925819316254/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 39, 'referenced_works': ['https://openalex.org/W1510825962', 'https://openalex.org/W1566146550', 'https://openalex.org/W1592624151', 'https://openalex.org/W1900495018', 'https://openalex.org/W1956850831', 'https://openalex.org/W1975637940', 'https://openalex.org/W1976214697', 'https://openalex.org/W1977186059', 'https://openalex.org/W2002473468', 'https://openalex.org/W2007745785', 'https://openalex.org/W2011762975', 'https://openalex.org/W2015314915', 'https://openalex.org/W2015422987', 'https://openalex.org/W2021913501', 'https://openalex.org/W2022495919', 'https://openalex.org/W2025925786', 'https://openalex.org/W2026907934', 'https://openalex.org/W2028105686', 'https://openalex.org/W2034140083', 'https://openalex.org/W2048603846', 'https://openalex.org/W2052092007', 'https://openalex.org/W2058236761', 'https://openalex.org/W2062191082', 'https://openalex.org/W2065289702', 'https://openalex.org/W2068172713', 'https://openalex.org/W2068897525', 'https://openalex.org/W2070359381', 'https://openalex.org/W2076674954', 'https://openalex.org/W2080556167', 'https://openalex.org/W2109384031', 'https://openalex.org/W2117372001', 'https://openalex.org/W2146578030', 'https://openalex.org/W2153122962', 'https://openalex.org/W2164682544', 'https://openalex.org/W224148732', 'https://openalex.org/W2334308089', 'https://openalex.org/W2407690945', 'https://openalex.org/W2411161468', 'https://openalex.org/W45936251'], 'related_works': ['https://openalex.org/W27407150', 'https://openalex.org/W2473186428', 'https://openalex.org/W2069546498', 'https://openalex.org/W2041794326', 'https://openalex.org/W2034716886', 'https://openalex.org/W2032116260', 'https://openalex.org/W2027497451', 'https://openalex.org/W2015219339', 'https://openalex.org/W1503880077', 'https://openalex.org/W113286307'], 'abstract_inverted_index': {'Many': [0, 236], 'in': [1, 33, 102, 117, 141, 186, 210, 237, 269, 338, 353, 377, 422, 446, 532, 562, 732, 808, 825, 839, 981, 1002, 1009, 1062, 1090, 1114, 1120, 1155, 1185, 1241, 1281, 1339, 1393, 1405, 1409, 1451, 1554, 1811, 1815, 1864, 1948, 1998, 2077, 2150, 2202, 2246, 2310, 2346, 2356, 2392, 2409, 2517, 2528, 2643, 2758, 2802, 2989, 2994, 3011, 3057, 3062, 3113, 3166, 3174, 3253, 3336, 3371, 3542, 3562, 3611, 3682, 3747, 3764, 3782, 3862, 3956, 3982, 4012, 4038, 4048, 4067, 4161, 4219, 4259, 4274, 4379, 4392, 4412], 'vivo': [2, 238, 840, 1406, 1820], 'substrates': [3, 239, 822, 841, 1202, 1457, 1472, 2104, 2241], 'of': [4, 43, 81, 89, 107, 125, 130, 144, 155, 177, 181, 202, 220, 231, 240, 279, 317, 325, 343, 361, 366, 380, 391, 413, 417, 438, 456, 467, 487, 497, 525, 537, 540, 565, 571, 589, 670, 680, 728, 750, 771, 791, 828, 842, 956, 960, 963, 988, 992, 1059, 1078, 1085, 1110, 1177, 1182, 1190, 1234, 1237, 1246, 1278, 1285, 1319, 1330, 1356, 1373, 1389, 1421, 1455, 1470, 1509, 1646, 1658, 1729, 1757, 1818, 1851, 1965, 1993, 2001, 2020, 2028, 2146, 2157, 2169, 2175, 2195, 2233, 2272, 2316, 2328, 2336, 2359, 2448, 2503, 2510, 2531, 2561, 2657, 2669, 2682, 2704, 2722, 2733, 2738, 2825, 2840, 2920, 2968, 2997, 3014, 3018, 3033, 3065, 3080, 3085, 3095, 3101, 3103, 3124, 3160, 3243, 3264, 3290, 3297, 3327, 3387, 3398, 3492, 3603, 3629, 3642, 3650, 3685, 3714, 3769, 3776, 3785, 3882, 3896, 3904, 3921, 3929, 3933, 3947, 3953, 3962, 3980, 3997, 4003, 4033, 4061, 4099, 4151, 4159, 4196, 4215, 4237, 4254, 4257, 4277, 4284, 4296, 4361, 4373, 4424], 'Src': [5, 13, 69, 95, 111, 158, 197, 241, 249, 305, 331, 347, 394, 433, 472, 741, 1198, 1292, 1357, 1427, 1471, 1746, 1766, 2031, 2046, 2060, 2101, 2160, 2240, 3859, 3922, 3963, 3977, 4026, 4035, 4054, 4069, 4087, 4389], 'family': [6, 242, 742, 1293, 1358, 1508], 'tyrosine': [7, 46, 243, 282, 490, 508, 526, 566, 591, 671, 723, 743, 769, 844, 968, 994, 1067, 1252, 1424, 3834], 'kinases': [8, 198, 244, 434, 592, 672, 682, 724, 744, 845, 995, 1068, 1199, 1359], 'possess': [9, 245, 673], 'sequences': [10, 246, 903, 1205, 1362, 1720], 'conforming': [11, 247, 4126], 'to': [12, 77, 195, 214, 216, 228, 248, 313, 431, 450, 452, 464, 494, 584, 820, 831, 966, 1474, 1506, 1761, 1866, 2011, 2050, 2089, 2163, 2214, 2507, 2694, 2753, 2787, 2807, 2880, 3157, 3237, 3294, 3393, 3553, 3842, 3848, 3878, 3891, 3925, 4040, 4127, 4156, 4200, 4261, 4270, 4300, 4357], 'homology': [14, 250, 473], '2': [15, 251, 2360, 3262, 3288], 'and': [16, 19, 50, 62, 139, 252, 255, 286, 298, 375, 535, 573, 756, 778, 797, 816, 823, 879, 907, 997, 1173, 1276, 1385, 1446, 1517, 1603, 1717, 1752, 1863, 1959, 2004, 2087, 2153, 2172, 2207, 2217, 2238, 2270, 2303, 2396, 2412, 2446, 2512, 2557, 2671, 2684, 2766, 2783, 2792, 2812, 2816, 2837, 2885, 2889, 2906, 2944, 3023, 3029, 3040, 3071, 3116, 3127, 3192, 3209, 3228, 3278, 3319, 3382, 3413, 3443, 3489, 3573, 3625, 3678, 3691, 3712, 3735, 3778, 3789, 3807, 3809, 3846, 3858, 3884, 3911, 3935, 3976, 3991, 4025, 4086, 4211, 4245, 4363, 4384, 4401, 4416, 4433], '3': [17, 253], '(SH2': [18, 254], 'SH3)': [20, 256], 'domain-binding': [21, 105, 257, 341, 850, 1665, 4133, 4305], 'motifs.': [22, 258], 'One': [23, 259, 955], 'such': [24, 260, 1502], 'substrate': [25, 40, 188, 222, 261, 276, 424, 458, 568, 587, 676, 739, 772, 970, 1116, 1157, 2065, 2079, 2564, 3653, 4282, 4426], 'is': [26, 31, 262, 267, 492, 761, 1073, 1118, 1395, 1407, 1500, 1595, 1853, 2161, 2197, 2505, 4027, 4096, 4115, 4390, 4403], 'p130Cas,': [27, 263], 'a': [28, 39, 63, 160, 164, 264, 275, 299, 396, 400, 495, 538, 748, 1000, 1121, 1153, 1160, 1328, 1366, 1410, 1507, 1550, 1963, 2014, 2036, 2081, 2095, 2106, 2227, 2244, 2311, 2406, 2473, 2515, 2649, 2845, 2937, 2961, 2979, 2986, 3003, 3083, 3093, 3099, 3167, 3238, 3250, 3554, 3579, 3706, 3757, 3902, 3988, 4044, 4065, 4123, 4265, 4367], 'protein': [29, 265, 821, 1383, 1553, 3345, 3358], 'that': [30, 66, 152, 172, 183, 266, 302, 388, 408, 419, 735, 785, 837, 855, 976, 1084, 1158, 1197, 1363, 1513, 1594, 1721, 2100, 2190, 2935, 3968, 4051, 4073, 4107, 4149, 4396], 'hyperphosphorylated': [32, 268], 'v-Src': [34, 270, 998, 2402, 2875, 2895, 3679, 3886, 4094], 'transformed': [35, 271, 1556], 'cells.': [36, 272], 'Cas': [37, 90, 108, 131, 156, 182, 215, 232, 273, 326, 344, 367, 392, 418, 451, 468, 1504, 1588, 1647, 1713, 1758, 1852, 1856, 1994, 2029, 2051, 2071, 2158, 2170, 2196, 2206, 2237, 2606, 2692, 2763, 2803, 3039, 3126, 3339, 3365, 3388, 3406, 3677, 3737, 3770, 3857, 3875, 3975, 4004, 4024, 4045, 4085, 4102, 4121, 4160, 4197, 4238, 4244, 4258, 4278, 4285, 4383, 4400], 'contains': [38, 274, 1589, 1648, 2072, 4122, 4286], 'domain': [41, 60, 71, 113, 204, 277, 296, 307, 349, 440, 485, 760, 807, 861, 900, 979, 991, 1113, 1176, 1240, 1593, 1728, 1748, 2177, 2235, 2668, 2681, 2847, 2999, 3017, 3881, 3894, 3932, 4009, 4037, 4056, 4071, 4283, 4360, 4427], 'consisting': [42, 278], '15': [44, 280, 1649, 2073, 3207, 4287], 'potential': [45, 281, 1650, 1662, 2074, 4288], 'phosphorylation': [47, 143, 154, 219, 230, 283, 379, 390, 455, 466, 1125, 1181, 1243, 1245, 1277, 1331, 1344, 1375, 1404, 1425, 1651, 1817, 1859, 2027, 2054, 2068, 2075, 2156, 2171, 3768, 3821, 4158, 4276, 4289, 4371, 4413, 4423], 'sites,': [48, 284], 'C-': [49, 285], 'N-terminal': [51, 287, 1591, 3037], 'polyproline': [52, 128, 179, 193, 288, 364, 415, 429, 1367, 1391, 1755, 2193, 2800, 4124, 4154, 4194, 4236], 'regions': [53, 88, 289, 324, 4256], 'fitting': [54, 290], 'the': [55, 68, 79, 87, 97, 103, 110, 126, 136, 168, 178, 191, 200, 212, 221, 291, 304, 315, 323, 333, 339, 346, 362, 372, 404, 414, 427, 436, 448, 457, 523, 533, 563, 586, 667, 789, 805, 814, 826, 829, 853, 859, 957, 961, 974, 978, 989, 993, 1003, 1057, 1076, 1079, 1086, 1091, 1111, 1150, 1156, 1166, 1174, 1178, 1186, 1235, 1238, 1250, 1282, 1286, 1291, 1340, 1380, 1390, 1419, 1444, 1452, 1466, 1558, 1606, 1654, 1726, 1736, 1740, 1753, 1999, 2018, 2043, 2057, 2078, 2090, 2144, 2155, 2173, 2191, 2198, 2231, 2300, 2317, 2337, 2357, 2501, 2508, 2558, 2562, 2613, 2624, 2644, 2666, 2673, 2679, 2686, 2695, 2727, 2759, 2798, 2810, 2822, 2834, 2883, 2903, 2941, 2948, 2990, 2995, 3012, 3015, 3063, 3133, 3295, 3298, 3325, 3328, 3332, 3425, 3485, 3547, 3626, 3640, 3651, 3683, 3715, 3720, 3750, 3766, 3773, 3783, 3799, 3819, 3826, 3843, 3863, 3868, 3879, 3892, 3905, 3908, 3916, 3926, 3930, 3937, 3994, 4006, 4020, 4031, 4034, 4049, 4053, 4068, 4082, 4108, 4112, 4128, 4152, 4192, 4204, 4224, 4227, 4234, 4252, 4275, 4292, 4301, 4358, 4370, 4393, 4397, 4425], 'consensus': [56, 292, 1655, 1741, 4131, 4293], 'sequence': [57, 293, 1329, 1737, 1742, 1756, 2194, 2210, 2801, 4195], 'for': [58, 92, 294, 328, 505, 763, 788, 896, 1165, 1397, 1423, 1461, 1543, 1597, 1743, 1765, 2343, 2398, 3092, 3206, 3405, 3411, 3416, 3440, 3633, 3697, 4369], 'SH3': [59, 203, 295, 439, 798, 817, 849, 1354, 1447, 1592, 1727, 2234, 4132], 'ligands,': [61, 297], 'YDYV': [64, 300], 'motif': [65, 301, 1392, 2179], 'binds': [67, 303, 901, 4052], 'SH2': [70, 104, 112, 306, 340, 348, 796, 815, 847, 899, 964, 990, 1071, 1080, 1112, 1167, 1175, 1239, 1324, 1445, 1664, 1747, 2893, 3016, 4036, 4055, 4070, 4117, 4304], 'when': [72, 308, 1333, 1732, 4388, 4428], 'phosphorylated.': [73, 309], 'In': [74, 310, 576, 812, 1147, 1188, 2025, 2042, 2056, 2185, 2498, 3546, 4418], 'an': [75, 311, 726, 809, 1590, 2633, 2701, 3349, 3730], 'effort': [76, 312], 'understand': [78, 314], 'mechanisms': [80, 316], 'processive': [82, 161, 218, 318, 397, 454, 1124, 1242, 2037, 2044, 2082, 2107, 2220, 3820], 'phosphorylation,': [83, 319, 2221], 'we': [84, 320, 1193, 2188, 3001, 3823, 3866, 3900, 4042, 4354], 'have': [85, 114, 321, 350, 582, 725, 782, 1194, 2180], 'explored': [86, 322], 'necessary': [91, 327, 1396], 'interaction': [93, 134, 329, 370, 4022, 4083, 4110, 4205, 4398], 'with': [94, 233, 330, 469, 904, 1006, 1065, 1401, 1605, 1653, 1725, 2094, 2308, 3143, 3261, 3287, 3303, 3570, 3638, 3804, 4005, 4101, 4291, 4430], 'using': [96, 148, 332, 384, 579, 2405, 2612, 2809, 2882, 2902, 2933, 3424, 3484], 'yeast': [98, 334, 2639, 2645, 2991, 3426, 3441, 3479, 3827, 3850, 3864, 3870, 3948, 3957, 3998, 4267], 'two-hybrid': [99, 335, 2646, 2992, 3419, 3828, 4268], 'system.': [100, 336, 2314, 2762, 3829], 'Mutations': [101, 337], 'region': [106, 129, 180, 208, 342, 365, 416, 444, 1813, 2200, 4125], 'or': [109, 121, 345, 357, 514, 1480, 1560, 2038, 2178, 2604, 2778, 2866, 4064, 4119], 'little': [115, 351, 4079], 'effect': [116, 352, 4080], 'Cas-Src': [118, 354], 'complex': [119, 355, 1399, 2203], 'formation': [120, 356, 1400, 2019, 2204], 'phosphorylation.': [122, 189, 358, 425, 2250], 'However,': [123, 359, 721, 4437], 'disruption': [124, 360], 'C-terminal': [127, 192, 363, 428, 1718, 1754, 2192, 2318, 2799, 4153, 4193, 4235], 'completely': [132, 368, 4240], 'abolishes': [133, 369], 'between': [135, 371, 1170, 2205, 3856, 4023, 4084, 4111, 4206, 4243, 4382, 4399, 4414], 'two': [137, 175, 225, 373, 411, 461, 3543, 4113], 'proteins': [138, 150, 374, 386, 488, 1061, 1512, 2757, 3389, 3955, 4114], 'results': [140, 376, 980, 4011, 4376], 'impaired': [142, 378, 982, 1816, 4157], 'Cas.': [145, 381, 4374], 'Kinetic': [146, 382, 2092], 'analyses': [147, 383], 'purified': [149, 385, 2413, 3342, 3675], 'indicated': [151, 387, 2559, 3774, 3800], 'multisite': [153, 389], 'by': [157, 393, 803, 1075, 1083, 1249, 1290, 1426, 1557, 1962, 2030, 2034, 2105, 2159, 2324, 2334, 2414, 2472, 2629, 2770, 2899, 2915, 3249, 3343, 3560, 3621, 3646, 3705, 3727, 3740, 3754, 3802, 3812, 3815, 3987, 3992, 4279], 'follows': [159, 395], 'rather': [162, 398], 'than': [163, 399, 678, 1209], 'distributive': [165, 401], 'mechanism.': [166, 402, 2041], 'Furthermore,': [167, 403, 1056, 4091], 'kinetic': [169, 405], 'studies': [170, 406, 578, 2647], 'show': [171, 407, 2189], 'there': [173, 409], 'are': [174, 184, 410, 420, 745, 786, 1337, 1449, 1661, 1759, 3445, 3978, 4377], 'properties': [176, 412], 'important': [185, 421, 787], 'enhancing': [187, 423], 'First,': [190, 426], 'serves': [194, 430, 2213, 2225], 'activate': [196, 432, 1465], 'through': [199, 435, 2230], 'process': [201, 437, 1122, 2232], 'displacement.': [205, 441, 2236], 'Second,': [206, 442], 'this': [207, 443, 506, 1148, 1171, 1191, 1413, 1812, 2186, 2499, 2983, 3983, 4062, 4207], 'aids': [209, 445], 'anchoring': [211, 447], 'kinase': [213, 449, 527, 567, 793, 801, 830, 969, 1010, 1151, 1179, 1253, 1294, 1609, 2152, 2216, 2228, 2347, 2393, 3845], 'facilitate': [217, 453, 1418], 'domain.': [223, 459, 1168, 2697], 'The': [224, 460, 502, 518, 758, 774, 795, 835, 898, 1108, 1353, 1387, 1468, 1642, 1847, 1990, 2166, 2251, 2260, 2386, 2443, 2638, 2719, 2781, 2892, 2951, 3021, 3107, 3199, 3232, 3256, 3282, 3357, 3385, 3395, 3478, 3617, 3723, 3794, 4213, 4247, 4281, 4375], 'processes': [226, 462, 1949], 'combine': [227, 463], 'ensure': [229, 465], 'high': [234, 470, 905, 1161, 1744], 'efficiency.': [235, 471, 984], 'viral': [474], 'polyacrylamide': [475], 'gel': [476], 'electrophoresis': [477], 'wild': [478, 3407], 'type': [479, 1368, 4129], 'optical': [480], 'density': [481, 3084], '×': [482, 3087], '10−3': [483], 'binding': [484, 1163, 1322, 1459, 1478, 1763, 2667, 3893, 3931, 4008, 4039, 4076, 4242, 4260, 4359], 'Phosphorylation': [486, 2315], 'on': [489, 2320, 2341, 2632, 2775, 3324, 3348, 3515, 3700, 3729, 3756, 4081], 'residues': [491, 770], 'central': [493, 1643], 'variety': [496, 539, 1964], 'intracellular': [498], 'signal': [499, 1960, 2988], 'transduction': [500, 1961], 'pathways.': [501], 'enzymes': [503], 'responsible': [504, 762, 1596], 'modification,': [507], 'kinases,': [509, 3835], 'occur': [510, 3861], 'as': [511, 1351, 1549, 1950, 1952, 2005, 2013, 2226, 2417, 2514, 2744, 2868, 2978, 3985, 4226, 4366], 'transmembrane': [512, 1966], 'receptors': [513, 1871, 1967], 'nonreceptor': [515, 843, 1251], 'cytoplasmic': [516, 722], 'proteins.': [517, 773, 3851], 'uncontrolled': [519], 'signaling': [520, 2023], 'resulting': [521, 3010], 'from': [522, 766, 973, 1348, 2063, 2257, 2266, 2618, 2651, 2726, 2821, 2844, 2963, 3331, 3391, 4198], 'deregulation': [524], 'activity': [528, 802, 1005, 1011, 2399, 2469, 3605, 3641, 3996, 4015, 4217], 'has': [529, 1715, 1945, 2008, 2277, 2450, 4145], 'been': [530, 1946, 2009, 2182, 2278, 2451, 4146], 'implicated': [531, 731, 1947], 'onset': [534], 'progression': [536], 'human': [541, 2297], 'malignancies': [542], '(1Biscardi': [543], 'J.S.': [544], 'Tice': [545], 'D.A.': [546, 2426], 'Parsons': [547, 1799], 'S.J.': [548, 1524, 1971], 'Adv.': [549], 'Cancer': [550], 'Res.': [551], '1999;': [552, 2460], '76:': [553], '61-119Crossref': [554], 'PubMed': [555, 626, 648, 661, 716, 874, 891, 950, 1022, 1037, 1051, 1103, 1142, 1228, 1271, 1492, 1538, 1583, 1637, 1708, 1788, 1842, 1889, 1909, 1939, 1985, 2126, 2138, 2291, 2381, 2440, 2463, 2493, 2599, 3460, 3473, 3506, 3533, 3595, 3667, 4185, 4348], 'Google': [556, 629, 649, 664, 719, 877, 894, 953, 1025, 1040, 1054, 1106, 1145, 1231, 1274, 1315, 1440, 1495, 1541, 1586, 1640, 1711, 1791, 1807, 1845, 1892, 1912, 1942, 1988, 2129, 2141, 2294, 2384, 2441, 2466, 2496, 2602, 2717, 2859, 2931, 3463, 3476, 3509, 3536, 3598, 3670, 4188, 4351], 'Scholar).': [557, 665, 720, 954, 1055, 1107, 1146, 1232, 1316, 1441, 1496, 1587, 1641, 1712, 1808, 1846, 1943, 1989, 2142, 2295, 2385, 2442, 2467, 2497, 2718, 3477, 3510, 3537, 3599, 3671, 4189, 4352], 'Thus,': [558, 1415, 4019], 'considerable': [559], 'interest': [560], 'exists': [561], 'study': [564], 'selection,': [569], 'regulation': [570, 790], 'activity,': [572], 'biological': [574, 1849], 'function.': [575, 794], 'vitro': [577], 'peptide': [580, 1201, 2096, 2563], 'libraries': [581], 'helped': [583], 'determine': [585], 'specificities': [588], 'several': [590], '(2Songyang': [593, 683, 2566], 'Z.': [594, 684, 910, 1668, 2567, 4308], 'Carraway': [595, 685, 2568], 'III,': [596, 686, 2569], 'K.L.': [597, 687, 2570], 'Eck': [598, 688, 2571], 'M.J.': [599, 615, 689, 705, 2572, 2588], 'Harrison': [600, 690, 2573], 'S.C.': [601, 691, 2478, 2574], 'Feldman': [602, 692, 2575], 'R.A.': [603, 693, 2576], 'Mohammadi': [604, 694, 2577], 'M.': [605, 695, 914, 1042, 1305, 1672, 1875, 1895, 2366, 2370, 2578, 4312], 'Schlessinger': [606, 696, 2579], 'J.': [607, 639, 652, 697, 1217, 1256, 1301, 1310, 1483, 1579, 1777, 1831, 1878, 1898, 1928, 2115, 2286, 2374, 2431, 2580, 4174], 'Hubbard': [608, 698, 2581], 'S.R.': [609, 699, 2582], 'Smith': [610, 700, 2583], 'D.P.': [611, 701, 2584], 'Eng': [612, 702, 2585], 'C.': [613, 703, 2586], 'Lorenzo': [614, 704, 2587], 'Poner': [616, 706, 2589], 'B.A.J.': [617, 707, 2590], 'Mayer': [618, 708, 2591, 2966], 'B.J.': [619, 709, 1028, 1094, 1127, 2592], 'Cantley': [620, 710, 941, 1699, 2593, 4339], 'L.C.': [621, 711, 942, 1700, 2594, 4340], 'Nature.': [622, 712, 2287, 2377, 2595, 3469], '1995;': [623, 713, 1134, 1268, 2490, 2596], '373:': [624, 714, 2597], '536-539Crossref': [625, 715, 2598], 'Scopus': [627, 662, 717, 875, 892, 951, 1023, 1038, 1052, 1104, 1143, 1229, 1272, 1438, 1493, 1539, 1584, 1638, 1709, 1789, 1843, 1890, 1910, 1940, 1986, 2127, 2139, 2292, 2382, 2464, 2494, 2600, 3461, 3474, 3507, 3534, 3596, 3668, 4186, 4349], '(861)': [628, 718, 2601], 'Scholar,': [630, 650, 1026, 1792, 1893, 1913, 3464], '3Till': [631], 'J.H.': [632], 'Annan': [633], 'R.S.': [634], 'Carr': [635], 'S.A.': [636], 'Miller': [637, 1215, 2113, 2132, 2375, 2429, 2456, 2851], 'W.T.': [638, 1216, 2114, 2133, 2376, 2430, 2457, 2852], 'Biol.': [640, 1033, 1046, 1099, 1133, 1218, 1529, 1633, 1778, 1832, 1879, 1899, 1929, 1976, 2116, 2432, 4175], 'Chem.': [641, 1219, 1779, 1833, 1880, 1900, 1930, 2117, 2433, 4176], '1994;': [642, 658, 1034, 1100, 1489, 1580, 3454, 3500, 3527, 3589, 3661], '269:': [643], '7423-7428Abstract': [644], 'Full': [645, 888, 947, 1137, 1139, 1223, 1225, 1533, 1535, 1705, 1783, 1785, 1837, 1839, 1884, 1886, 1904, 1906, 1934, 1936, 1980, 1982, 2121, 2123, 2437, 3457, 3503, 3530, 3592, 3664, 4180, 4182, 4345], 'Text': [646, 889, 948, 1138, 1140, 1224, 1226, 1534, 1536, 1706, 1784, 1786, 1838, 1840, 1885, 1887, 1905, 1907, 1935, 1937, 1981, 1983, 2122, 2124, 2438, 3458, 3504, 3531, 3593, 3665, 4181, 4183, 4346], 'PDF': [647, 890, 949, 1141, 1227, 1537, 1707, 1787, 1841, 1888, 1908, 1938, 1984, 2125, 2439, 3459, 3505, 3532, 3594, 3666, 4184, 4347], '4Wu': [651], 'Ma': [653, 1484], 'Q.N.': [654, 1485], 'Lam': [655, 1486], 'K.S.': [656, 1487], 'Biochemistry.': [657, 1488, 2134, 2489], '33:': [659, 1490], '14825-14833Crossref': [660, 1491], '(101)': [663, 1494], 'Surprisingly,': [666], 'catalytic': [668, 759, 806, 860, 1087, 2304, 2838, 3912], 'domains': [669, 730, 780, 799, 818, 965, 1072, 1088, 1325, 1355, 1448, 1463, 2149, 2305, 2839, 3913], 'less': [674], 'rigorous': [675], 'specificity': [677, 856, 908, 971, 1077, 1117], 'those': [679], 'Ser/Thr': [681], 'array': [727], 'accessory': [729], 'protein-protein': [733], 'interactions': [734, 1350, 1378, 1417, 3838, 3855], 'can': [736, 1326, 1345, 1364, 2102, 3839, 3860, 4239], 'further': [737, 3285, 3341, 3743], 'influence': [738], 'selection.': [740], 'organized': [746], 'into': [747, 1600, 2747, 2861, 2976], 'set': [749], 'modular': [751, 1991], 'domains:': [752], 'unique,': [753], 'SH3,1': [754], 'SH2,': [755, 776, 2302, 2836, 3910], 'catalytic.': [757], 'transferring': [764], 'phosphate': [765], 'ATP': [767, 2362], 'onto': [768, 3566], 'noncatalytic': [775], 'SH3,': [777, 2301, 2835, 3909], 'unique': [779, 3917], 'each': [781, 2067, 2176, 3634], 'multiple': [783, 1334, 2053, 2147], 'roles': [784], 'cellular': [792], 'regulate': [800], 'maintaining': [804], 'inactive': [810, 2874, 4093], 'conformation.': [811], 'addition,': [813], 'bind': [819], 'aid': [824], 'localization': [827, 1599], 'specific': [832], 'subcellular': [833], 'compartments.': [834], 'fact': [836], 'many': [838], 'contain': [846, 1476, 3831], 'and/or': [848], 'motifs': [851, 1280, 1460, 1660, 4298], 'supports': [852], 'notion': [854], 'arises': [857], 'outside': [858], '(see': [862, 1519], 'Refs.': [863], '5Brown': [864], 'M.T.': [865, 1013, 1796], 'Cooper': [866, 1014, 2711, 2925], 'J.A.': [867, 881, 1015, 2712, 2926], 'Biochim.': [868, 1016], 'Biophys.': [869, 1017], 'Acta.': [870, 1018], '1996;': [871, 1019, 1780, 1804, 1834, 1881, 2714, 2856, 2928, 4177], '1287:': [872, 1020], '121-149Crossref': [873, 1021], '(1096)': [876, 1024], 'Scholar': [878, 895, 1542], '6Cooper': [880], 'Howell': [882], 'B.': [883, 940, 1698, 2850, 4338], 'Cell.': [884, 943, 1032, 1047, 1098, 1433, 1632, 1701, 2854, 4341], '1993;': [885, 944, 1702, 2434, 4342], '73:': [886], '1051-1054Abstract': [887], '(506)': [893], 'reviews).': [897], 'phosphotyrosine-containing': [902], 'affinity': [906, 1162, 1745], '(7Songyang': [909, 1667, 4307], 'Shoelson': [911, 1669, 2421, 4309], 'S.E.': [912, 1670, 2422, 4310], 'Chaudhuri': [913, 1671, 4311], 'Gish': [915, 1673, 4313], 'G.': [916, 1674, 4314], 'Pawson': [917, 1675, 4315], 'T.': [918, 924, 1571, 1614, 1624, 1676, 1682, 1768, 1822, 1921, 1927, 4165, 4316, 4322], 'Haser': [919, 1677, 4317], 'W.G.': [920, 1678, 4318], 'King': [921, 1679, 4319], 'F.': [922, 1680, 2282, 2368, 4320], 'Roberts': [923, 1681, 4321], 'Ratnofsky': [925, 1683, 4323], 'S.': [926, 1266, 1569, 1620, 1626, 1684, 3449, 3466, 3495, 3522, 3584, 3656, 4324], 'Lechleider': [927, 1685, 4325], 'R.J.': [928, 1686, 4326], 'Neel': [929, 1687, 4327], 'B.G.': [930, 1688, 4328], 'Birge': [931, 1689, 4329], 'R.B.': [932, 1690, 4330], 'Fajardo': [933, 1691, 4331], 'J.E.': [934, 1692, 4332], 'Chou': [935, 1693, 4333], 'M.M.': [936, 1694, 4334], 'Hanafusa': [937, 1695, 4335], 'H.': [938, 1129, 1573, 1577, 1618, 1622, 1630, 1696, 1776, 1830, 4173, 4336], 'Schaffhausen': [939, 1697, 4337], '72:': [945, 1703, 4343], '767-778Abstract': [946, 1704, 4344], '(2462)': [952, 1710, 4350], 'first': [958, 3824], 'indications': [959], 'ability': [962], 'modulate': [967], 'came': [972], 'observation': [975], 'altering': [977], 'transformation': [983, 3480], 'For': [985, 3601, 3672, 3762, 3898], 'example,': [986], 'deletion': [987], 'v-Abl': [996], 'causes': [999], 'loss': [1001], 'transforming': [1004], 'no': [1007, 3832, 4410], 'reduction': [1008, 2516], '(5Brown': [1012], '8Mayer': [1027], 'Baltimore': [1029, 1095], 'D.': [1030, 1096, 2482], 'Mol.': [1031, 1045, 1097, 1432, 1631, 2853], '14:': [1035, 1101], '2883-2894Crossref': [1036, 1102], '(161)': [1039, 1105], 'Scholar,9Tian': [1041], 'Martin': [1043], 'G.S.': [1044], '1997;': [1048, 1312, 1435, 1634, 1901, 2288, 2378], '8:': [1049], '1183-1193Crossref': [1050], '(6)': [1053], 'pattern': [1058], 'tyrosine-phosphorylated': [1060, 1552, 3954], 'cells': [1063, 1555, 2411, 3051, 3081, 3108, 3162, 3400, 3618, 3630, 4163], 'transfected': [1064], 'chimeric': [1066], 'containing': [1069, 1203, 2533, 3240, 3708], 'heterologous': [1070], 'dictated': [1074], 'domain,': [1081, 2080], 'not': [1082, 2181, 2211, 3847, 3942, 3965, 4104, 4116], 'used': [1089, 2397, 2642, 2786, 3026, 3401, 3632, 3901, 4364], 'chimeras': [1092], '(8Mayer': [1093], 'involvement': [1109, 1997, 4273], 'directing': [1115, 2247], 'apparent': [1119], 'termed': [1123], '(10Mayer': [1126], 'Hirai': [1128, 1576, 1629, 1775, 1829, 4172], 'Sakai': [1130, 1615, 1769, 1823, 4166], 'R.': [1131, 1258, 1563, 1616, 1770, 1824, 1877, 3451, 3497, 3524, 3586, 3658, 4167], 'Curr.': [1132], '5:': [1135], '296-305Abstract': [1136], '(265)': [1144], 'process,': [1149], 'phosphorylates': [1152], 'site': [1154, 1164, 1172, 2939, 2946, 3006, 4050, 4063, 4306], 'becomes': [1159], 'Interaction': [1169], 'facilitates': [1180], 'subsequent': [1183], 'tyrosines': [1184], 'substrate.': [1187, 1342, 1503], 'support': [1189], 'notion,': [1192], 'shown': [1195], 'previously': [1196, 2280, 2453, 4148], 'phosphorylate': [1200, 2103], 'SH2-binding': [1204], '10-fold': [1206], 'more': [1207], 'efficiently': [1208], 'controls': [1210], '(11Pellicena': [1211, 2109], 'P.': [1212, 2110, 2420], 'Stowell': [1213, 2111], 'K.R.': [1214, 2112], '1998;': [1220, 1931, 2118], '273:': [1221, 1932, 2119], '15325-15328Abstract': [1222, 2120], '(61)': [1230, 2128], 'Examples': [1233], 'role': [1236, 2174, 2245], 'include': [1244], 'RNA': [1247], 'polymerase': [1248, 2916], 'Abl': [1254], '(12Duyster': [1255], 'Baskaran': [1257], 'Wang': [1259], 'J.Y.': [1260], 'Proc.': [1261], 'Natl.': [1262], 'Acad.': [1263], 'Sci.': [1264], 'U.': [1265], 'A.': [1267, 1565, 1798, 3255], '92:': [1269], '1555-1559Crossref': [1270], '(108)': [1273], 'Scholar)': [1275, 2603, 2860, 2932], 'ITAM': [1279], 'ζ': [1283], 'chain': [1284, 2917], 'T': [1287], 'cell': [1288, 1953, 1955, 3170], 'receptor': [1289], 'Lck': [1295], '(13Lewis': [1296], 'L.A.': [1297], 'Chung': [1298], 'C.D.': [1299], 'Chen': [1300], 'Parnes': [1302], 'J.R.': [1303], 'Moran': [1304], 'Patel': [1306], 'V.P.': [1307], 'Miceli': [1308], 'M.C.': [1309], 'Immunol.': [1311], '159:': [1313], '2292-2300PubMed': [1314], 'By': [1317], 'virtue': [1318], 'their': [1320, 2248, 4272], 'phosphotyrosine': [1321, 4075], 'abilities,': [1323], 'coordinate': [1327], 'events': [1332], 'target': [1335], 'sites': [1336, 1652, 1666, 1764, 2076, 4290], 'present': [1338], 'same': [1341, 3627, 4225], 'Processive': [1343], 'conceivably': [1346], 'arise': [1347], 'polyproline-SH3': [1349], 'well.': [1352], 'recognize': [1360], 'proline-rich': [1361, 1719], 'adopt': [1365], 'II': [1369, 4130], 'helix.': [1370], 'An': [1371], 'example': [1372], 'enhanced': [1374], 'involving': [1376], 'SH3-polyproline': [1377], 'involves': [1379], 'actin': [1381], 'filament-associated': [1382], 'AFAP-110': [1384, 1394, 1422], 'Src.': [1386, 1402, 1730, 2208, 4212, 4246, 4262, 4280], 'integrity': [1388], 'stable': [1398], 'Impaired': [1403], 'observed': [1408, 4021], 'mutant': [1411, 3392, 4046], 'lacking': [1412, 3915], 'polyproline.': [1414], 'SH3-mediated': [1416], 'presentation': [1420], '(14Guappone': [1428], 'A.C.': [1429], 'Flynn': [1430], 'D.C.': [1431], 'Biochem.': [1434, 2855], '75:': [1436], '243-252Crossref': [1437], '(47)': [1439], 'Because': [1442, 2070, 2982], 'both': [1443, 1481, 2151, 3960, 4431], 'involved': [1450, 2201], 'intramolecular': [1453], 'inhibition': [1454], 'Src,': [1456], 'possessing': [1458], 'these': [1462, 1659, 4220, 4297], 'could': [1464, 1722, 2032], 'kinase.': [1467], 'majority': [1469], 'identified': [1473, 1547], 'date': [1475], 'SH3/2': [1477], 'motifs,': [1479], '(4Wu': [1482], 'p130Cas': [1497], '(Crk-associated': [1498], 'substrate)': [1499], 'one': [1501], 'belongs': [1505], 'structurally': [1510], 'related': [1511, 2239], 'also': [1514, 1714, 2224], 'includes': [1515], 'Hef': [1516], 'Sin': [1518], 'Ref.': [1520], "15O'Neill": [1521], 'G.M.': [1522, 1969], 'Fashena': [1523, 1970], 'Golemis': [1525, 1972], 'E.A.': [1526, 1973], 'Trends': [1527, 1974, 3452, 3498, 3525, 3587, 3659], 'Cell': [1528, 1975, 3154], '2000;': [1530, 1977, 2135], '10:': [1531, 1978, 3455, 3501, 3528, 3590, 3662], '111-119Abstract': [1532, 1979], '(266)': [1540, 1987], 'review).': [1544], 'It': [1545, 1944, 4144], 'was': [1546, 2255, 2264, 2306, 2322, 2332, 2389, 2403, 2470, 2610, 2805, 2842, 2878, 2897, 2913, 2960, 2974, 3042, 3129, 3201, 3234, 3258, 3284, 3301, 3340, 3366, 3402, 3481, 3631, 3644, 3703, 3738, 3771, 3876, 3889, 4223], 'originally': [1548], 'prominently': [1551], 'v-src': [1559, 2819], 'v-crkoncogenes': [1561], '(16Sakai': [1562], 'Iwamatsu': [1564], 'Hirano': [1566], 'N.': [1567, 1923, 2455], 'Ogawa': [1568, 1619], 'Tanaka': [1570], 'Mano': [1572], 'Yazaki': [1574, 1627, 1773, 1827, 4170], 'Y.': [1575, 1628, 1774, 1828, 4171], 'EMBO': [1578], '13:': [1581], '3748-3756Crossref': [1582], '(598)': [1585], 'its': [1598, 1996, 2064], 'focal': [1601, 1607], 'adhesions': [1602], 'interacts': [1604], 'adhesion': [1608], 'FAK': [1610], '(Fig.': [1611, 4016, 4057, 4088, 4141, 4405, 4435], '1A)': [1612], '(17Nakamoto': [1613], 'Honda': [1617], 'Ueno': [1621], 'Suzuki': [1623], 'Aizawa': [1625], '17:': [1635], '3884-3897Crossref': [1636], '(138)': [1639], '"substrate': [1644], 'domain"': [1645], 'YXXP.': [1656, 4294], 'Nine': [1657, 4295], 'Crk': [1663, 2973, 3019, 4303], 'N-': [1716], 'potentially': [1723], 'interact': [1724], 'Finally,': [1731], 'phosphorylated,': [1733], 'Tyr-668': [1734, 1751], '(in': [1735], 'pYDYV)': [1738], 'fits': [1739], 'binding.': [1749], 'Both': [1750, 3919], 'known': [1760], 'be': [1762, 2164, 3840], '(18Nakamoto': [1767, 1821, 4164], 'Ozawa': [1771, 1825, 4168], 'K.': [1772, 1826, 1897, 2710, 2924, 4169], '271:': [1781, 1835, 1882, 4178], '8959-8965Abstract': [1782, 1836, 4179], '(216)': [1790, 1844, 4187], '19Burnham': [1793], 'M.R.': [1794], 'Harte': [1795], 'Richardson': [1797], 'J.T.': [1800], 'Bouton': [1801], 'A.H.': [1802], 'Oncogene.': [1803, 2713, 2927], '12:': [1805, 2715, 2929], '2467-2472PubMed': [1806], 'Indeed,': [1809], 'mutations': [1810, 2625], 'result': [1814], 'Casin': [1819], 'exact': [1848], 'function': [1850], 'still': [1854, 4097], 'unclear.': [1855], 'undergoes': [1857], 'rapid': [1858], 'after': [1860, 2066], 'mitogenic': [1861], 'stimulation': [1862], 'response': [1865], 'fibronectin': [1867], 'attachment': [1868], 'via': [1869], 'integrin': [1870], '(20Petruzzelli': [1872], 'L.': [1873], 'Takami': [1874], 'Herrera': [1876], '7796-7801Abstract': [1883], '(72)': [1891], '21Ojaniemi': [1894], 'Vuori': [1896], '272:': [1902], '25993-25998Abstract': [1903], '(93)': [1911], '22Nakamura': [1914], 'I.': [1915, 2284, 2364], 'Jimi': [1916], 'E.': [1917], 'Duong': [1918], 'L.T.': [1919], 'Sasaki': [1920], 'Takahashi': [1922], 'Rodan': [1924], 'G.A.': [1925], 'Suda': [1926], '11144-11149Abstract': [1933], '(111)': [1941], 'diverse': [1951], 'migration,': [1954], 'cycle': [1956], 'control,': [1957], 'apoptosis,': [1958], "(15O'Neill": [1968], 'nature': [1992], 'suggests': [1995], 'creation': [2000], 'multiprotein': [2002], 'complexes,': [2003], 'such,': [2006], 'it': [2007, 2223, 4365], 'proposed': [2010], 'act': [2012], 'docking': [2015], 'intermediary': [2016], 'during': [2017, 2052], 'cytoskeleton-': [2021], 'dependent': [2022], 'networks.': [2024], 'principle,': [2026], 'proceed': [2033], 'either': [2035], 'nonprocessive': [2039, 2058], '(distributive)': [2040], 'mechanism,': [2045, 2059], 'would': [2047, 2061, 2084], 'remain': [2048], 'bound': [2049], 'events.': [2055], 'dissociate': [2062], 'event.': [2069], 'mechanism': [2083, 2108], 'confer': [2085], 'speed': [2086], 'efficiency': [2088], 'reaction.': [2091], 'experiments': [2093, 3420, 3763, 4248], 'model': [2097], 'system': [2098], 'indicate': [2099], 'Scholar,23Scott': [2130], 'M.P.': [2131], '39:': [2136], '14531-14537Crossref': [2137], '(44)': [2140], 'Given': [2143], 'existence': [2145], 'complementary': [2148], 'substrate,': [2154, 2218], 'likely': [2162], 'complex.': [2165], 'mechanistic': [2167], 'details': [2168], 'examined': [2183], 'closely.': [2184], 'study,': [2187], 'primary': [2199, 4109], 'This': [2209, 3702, 4407], 'only': [2212, 4387], 'anchor': [2215], 'allowing': [2219], 'but': [2222, 3914], 'activator': [2229], 'therefore': [2242, 3836], 'play': [2243], 'own': [2249], 'antiphosphotyrosine': [2252], 'antibody': [2253, 2263], '4G10': [2254], 'purchased': [2256], 'Upstate': [2258], 'Biotechnology.': [2259], 'monoclonal': [2261], 'anti-p130Cas': [2262], 'obtained': [2265, 2914], 'Transduction': [2267], 'Laboratories.': [2268], 'Expression': [2269, 3136], 'purification': [2271, 2447], 'C-terminally': [2273], 'phosphorylated': [2274, 3736], '(down-regulated)': [2275], 'Hck': [2276, 2298], 'described': [2279, 2418, 2452, 3446, 4249], '(24Sicheri': [2281], 'Moarefi': [2283], 'Kuriyan': [2285, 2373], '385:': [2289, 2379], '602-609Crossref': [2290], '(1050)': [2293], 'Briefly,': [2296], 'comprising': [2299, 2833], 'coexpressed': [2307, 4391], 'CSK': [2309], 'baculovirus': [2312, 2407, 2760, 3035], 'expression': [2313, 2640, 2761, 2953, 3871], 'tail': [2319], 'Tyr-527': [2321], 'verified': [2323, 2628], 'mass': [2325], 'spectrometry.': [2326], 'Autophosphorylation': [2327], 'Y416': [2329], '(c-Src': [2330], 'numbering)': [2331], 'performed': [2333, 2773, 3541], 'incubation': [2335], 'enzyme': [2338, 2388], '(5': [2339], 'mg/ml)': [2340], 'ice': [2342], '1': [2344, 2544, 3188, 3272, 3383, 3557, 4017, 4058, 4089, 4142], 'h': [2345, 3097], 'assay': [2348, 2394, 2476, 2993, 3549, 3990, 4269, 4408], 'buffer': [2349, 2395, 2532, 3176, 3212, 3254, 3265, 3291, 3304], '(20': [2350, 3214, 3267, 3306], 'mm': [2351, 2361, 2535, 2542, 2547, 3178, 3183, 3186, 3189, 3215, 3220, 3223, 3226, 3268, 3276, 3311, 3314, 3317, 3362, 3373, 3378, 3693], 'Tris,': [2352, 2536, 3374], 'pH': [2353, 2537, 3180, 3217, 3270, 3308, 3375, 3695], '7.5/20': [2354], 'mmMgCl2)': [2355], 'presence': [2358, 3064, 3684, 3784], '(25Moarefi': [2363], 'LaFevre-Bernt': [2365], 'Sicheri': [2367], 'Huse': [2369], 'Lee': [2371], 'C.H.': [2372], '650-653Crossref': [2380], '(543)': [2383], 'autophosphorylated': [2387], 'then': [2390, 3235, 3259], 'diluted': [2391], 'measurements.': [2400], 'Full-length': [2401], 'produced': [2404, 4043], 'vector': [2408, 2728, 2954, 4010], 'Sf9': [2410, 3050, 3161, 3399], 'immunoaffinity': [2415], 'chromatography,': [2416], '(26Garcia': [2419], 'George': [2423], 'S.T.': [2424], 'Hinds': [2425], 'Goldberg': [2427], 'A.R.': [2428], '268:': [2435], '25146-25151Abstract': [2436], 'cloning,': [2444], 'expression,': [2445], 'His-v-Src': [2449, 3788], '(27Yokoyama': [2454], 'FEBS': [2458], 'Lett.': [2459], '456:': [2461], '403-408Crossref': [2462], '(13)': [2465], 'Kinase': [2468], 'measured': [2471, 2513, 4218], 'continuous': [2474], 'spectrophotometric': [2475], '(28Barker': [2477], 'Kassel': [2479], 'D.B.': [2480], 'Weigl': [2481], 'Huang': [2483], 'X.': [2484], 'Luther': [2485], 'M.A.': [2486], 'Knight': [2487], 'W.B.': [2488], '34:': [2491], '14843-14851Crossref': [2492], '(164)': [2495], 'assay,': [2500], 'production': [2502, 3013], 'ADP': [2504], 'coupled': [2506], 'oxidation': [2509], 'NADH': [2511], 'absorbance': [2518], 'at': [2519, 2525, 2660, 2741, 2940, 2947, 3007, 3054, 3082, 3098, 3118, 3151, 3171, 3203, 3360, 3368, 3575, 3719, 3798], '340': [2520], 'nm.': [2521], 'Reactions': [2522], 'were': [2523, 2627, 2648, 2768, 2790, 3027, 3052, 3090, 3109, 3148, 3163, 3421, 3513, 3540, 3551, 3609, 3619, 3680, 3717, 3725, 3752, 3780, 3796, 3810, 3923, 3941, 3973], 'carried': [2524, 3130, 3149, 3422, 3482], '30': [2526, 3576], '°C': [2527, 3056, 3120, 3370, 3577], '500': [2529, 3219], 'µl': [2530], '100': [2534, 3185, 3310, 3313, 3692], '7.5,': [2538, 3376, 3696], '10': [2539, 3689, 3698], 'mmMgCl2,': [2540, 3690], '0.5': [2541, 3490, 3709], 'ATP,': [2543, 3711], 'mmphosphoenolpyruvate,': [2545], '0.28': [2546], 'NADH,': [2548], '89': [2549], 'units/ml': [2550, 2554], 'pyruvate': [2551], 'kinase,': [2552], '124': [2553], 'lactate': [2555], 'dehydrogenase,': [2556], 'amount': [2560, 4214], 'AEEEIYGEFEAKKKKG': [2565], 'recombinant': [2605, 3034, 3676], 'protein.': [2607, 3299], 'Site-directed': [2608], 'mutagenesis': [2609, 2616, 2772], 'accomplished': [2611, 3043, 3302], 'QuikChange': [2614], 'site-directed': [2615, 2771], 'kit': [2617], 'Stratagene': [2619], 'following': [2620, 3044, 3132, 3869], 'manufacturer': [2621, 3045], 'recommendations.': [2622], 'All': [2623, 3146], 'introduced': [2626, 2936, 3002, 3844], 'DNA': [2630, 2636, 2820], 'sequencing': [2631], 'ABI373': [2634], 'automated': [2635], 'sequencer.': [2637], 'vectors': [2641, 2664, 2677], 'gift': [2650, 2732, 2962], 'Dr.': [2652, 2964], 'James': [2653, 2734], 'Bliska': [2654], '(State': [2655], 'University': [2656, 2737], 'New': [2658, 2739], 'York': [2659, 2740], 'Stony': [2661, 2742], 'Brook).': [2662], 'pBDMI': [2663, 2867, 2977], 'encode': [2665, 2678], 'GAL4': [2670, 2683, 4362], 'carry': [2672, 2685], 'marker': [2674], 'TRP1.': [2675], 'pADMI': [2676], 'activation': [2680, 2696, 2998, 3880], 'markerLEU2.': [2687], 'pADMI-Cas': [2688, 2729, 2779], 'encodes': [2689], 'full-length': [2690, 3874], 'rat': [2691, 2723], 'fused': [2693, 3877, 3890, 3924, 4355], 'pADMI-Cas/Src': [2698], 'additionally': [2699], 'coexpresses': [2700], 'active': [2702], 'form': [2703, 2721], 'c-Src': [2705, 2909], '(G2E,': [2706, 2910], 'Y416F,': [2707, 2911], 'Y527F)': [2708, 2912], '(29Keegan': [2709, 2923], '1537-1544PubMed': [2716, 2930], 'short': [2720], 'Caswas': [2724], 'subcloned': [2725, 2843, 2975], '(a': [2730], 'generous': [2731], 'Bliska,': [2735], 'State': [2736], 'Brook)': [2743], 'aBamHI/NotI': [2745], 'fragment': [2746], 'pFastBac': [2748, 2776], 'HTb': [2749], '(Life': [2750, 2863, 3047, 3074, 3140], 'Technologies,': [2751, 2864, 3048, 3075, 3141], 'Inc.)': [2752, 2865, 3142], 'produce': [2754], 'N-terminally': [2755], 'histidine-tagged': [2756, 3125], 'mutants': [2764, 3041, 3128], 'CasY668F': [2765, 2789, 4434], 'CasPPX': [2767, 3779, 4420], 'generated': [2769, 2985], 'directly': [2774], 'HTb-Cas': [2777], 'vectors.': [2780], 'forward': [2782, 2811, 2884, 3022], 'reverse': [2784, 2813, 2886, 3024], 'primers': [2785, 2814, 2887, 2904, 2934, 3025], 'generate': [2788], 'GGGGGTTGGATGGAGGACTTTGACTACGTTCATCTGC': [2791], 'GCAGATGAACGTAGTCAAAGTCCTCCATCCAACCCCC,': [2793], 'respectively.': [2794, 2818, 2891, 2908, 3031], 'To': [2795, 2871, 3742, 3817, 3852, 4029], 'obtain': [2796], 'CasPPX,': [2797, 4210], 'RPLPSPPKF': [2804], 'mutated': [2806, 2879, 4191], 'RSLGSPGKF': [2808], 'CCAGTCACGCTCTCTAGGCTCACCTGGAAAGTTCACCTCCC': [2815], 'GGGAGGTGAACTTTCCAGGTGAGCCTAGAGAGCGTGACTGG,': [2817], 'Schmidt-Ruppin': [2823], 'strain': [2824, 3427], 'Rous': [2826], 'sarcoma': [2827], 'virus': [2828], '(encoding': [2829], 'amino': [2830, 4139], 'acids': [2831], '77–526,': [2832], 'v-Src)': [2841], 'pGEX2T-SH3-SH2-catalytic': [2846], 'plasmid': [2848, 2921, 3493], '(30Xu': [2849], '158:': [2857], '57-63PubMed': [2858], 'pFastBacHTb': [2862], 'aBamHI/EcoRI': [2869], 'fragment.': [2870, 2981], 'make': [2872], 'catalytically': [2873, 4092], '(v-SrcKD)': [2876], 'Lys-295': [2877], 'arginine': [2881], 'AGAGTGGCCATAAGGACTCTGAAGCCC': [2888], 'GGGCTTCAGAGTCCTTATGGCCACTCT,': [2890], 'domain-inactive': [2894], '(vSrcSH2D)': [2896], 'constructed': [2898, 3867], 'mutating': [2900], 'R175K': [2901], 'ACCTTCTTGGTCAAGGAGAGCGAGACG': [2905], 'CGTCTCGCTCTCCTTGACCAAGAAGGT,': [2907], 'reaction': [2918, 3716], 'amplification': [2919], 'pBTM116': [2922], 'BamHI': [2938], '5′': [2942], 'end': [2943], 'anEcoRI': [2945], '3′': [2949], 'end.': [2950], 'mammalian': [2952, 4162], 'EBB-Crk': [2955], 'encoding': [2956, 3907], 'wild-type': [2957], 'chicken': [2958], 'Crk2': [2959], 'Bruce': [2965], '(University': [2967], 'Connecticut': [2969], 'Health': [2970], 'Science': [2971], 'Center).': [2972], 'BamHI/NotI': [2980], 'construct': [2984], 'positive': [2987], 'absence': [2996], 'partners,': [3000], 'stop': [3004], 'codon/XbaI': [3005], 'codon': [3008], '125': [3009], 'alone.': [3020], 'GTTTCCCGATCCATCTAGAACAGTGGCG': [3028], 'CGCCACTGTTCCTAGATGGATCGGGAAAC,': [3030], 'Generation': [3032], 'expressing': [3036, 3959], 'polyhistidine-tagged': [3038], 'recommendations': [3046], 'Inc.).': [3049, 3076], 'grown': [3053, 3610], '27': [3055], 'Excell': [3058], '401': [3059], '(JRH': [3060], 'Biosciences)': [3061], '5%': [3066], 'fetal': [3067], 'calf': [3068], 'serum': [3069], '(Cellgro)': [3070], '1%': [3072, 3193], 'penicillin/streptomycin': [3073], 'Approximately': [3077], '600': [3078, 3623], 'ml': [3079, 3242], '1.5–2': [3086], '106': [3088], 'cells/ml': [3089], 'infected': [3091], 'period': [3094], '72': [3096], 'multiplicity': [3100], 'infection': [3102], '5–10': [3104], 'plaque-forming': [3105], 'units/cell.': [3106], 'centrifuged,': [3110], 'rinsed': [3111], 'once': [3112], 'phosphate-buffered': [3114], 'saline,': [3115], 'stored': [3117, 3367], '−70': [3119], 'until': [3121, 3578, 3614], 'needed.': [3122], 'Purification': [3123], 'out': [3131, 3150, 3423, 3483], 'Bac-to-Bac': [3134], 'Baculovirus': [3135], 'System': [3137], 'instruction': [3138], 'manual': [3139], 'some': [3144, 3337, 3748], 'modifications.': [3145], 'steps': [3147], '4': [3152], '°C.': [3153], 'pellets': [3155], 'corresponding': [3156], '600–1200-ml': [3158], 'cultures': [3159], 'lysed': [3164, 3559], 'twice': [3165], 'French': [3168], 'pressure': [3169], '650': [3172], 'p.s.i.': [3173], 'lysis': [3175, 3637], '(50': [3177], 'Tris-HCl,': [3179, 3216, 3269, 3694], '8.5,': [3181, 3218, 3271, 3309], '5': [3182, 3225, 3241, 3275, 3316], '2-mercaptoethanol,': [3184, 3227, 3277, 3318], 'KCl,': [3187, 3221, 3274, 3312, 3379], 'phenylmethylsulfonyl': [3190], 'fluoride,': [3191], 'Nonidet': [3194], 'P-40': [3195], 'plus': [3196], 'protease': [3197], 'inhibitors).': [3198], 'lysate': [3200, 3233], 'centrifuged': [3202], '10,000': [3204], '×g': [3205], 'min': [3208, 3699], 'dialyzed': [3210], 'against': [3211], 'A': [3213, 3292, 3622], '20': [3222, 3372], 'imidazole,': [3224, 3315], '10%': [3229, 3279, 3320, 3380], '(v/v)': [3230, 3280, 3321], 'glycerol).': [3231, 3281, 3322], 'applied': [3236], 'column': [3239, 3257, 3283, 3353], 'nickel-nitrilotriacetic': [3244, 3333], 'acid': [3245, 3334], 'resin': [3246], '(Qiagen)': [3247], 'followed': [3248, 3704, 3814], '10-volume': [3251], 'wash': [3252], 'washed': [3260, 3286], 'volumes': [3263, 3289], 'B': [3266], 'm': [3273], 'prior': [3293], 'elution': [3296], 'Elution': [3300], 'C': [3305, 3927], 'mmTris-HCl,': [3307], 'Depending': [3323], 'purity': [3326], 'fractions': [3329], 'eluted': [3330, 3359], 'column,': [3335], 'cases': [3338], 'fast': [3344], 'liquid': [3346, 3563], 'chromatography': [3347], 'analytical': [3350], 'MonoQ': [3351], 'HR5/5': [3352], '(Amersham': [3354], 'Pharmacia': [3355], 'Biotech).': [3356], '∼250': [3361], 'NaCl.': [3363], 'Purified': [3364], '−20': [3369], '50': [3377], 'glycerol,': [3381], 'mmdithiothreitol.': [3384], 'yield': [3386], 'varied': [3390], 'mutant.': [3394], 'overall': [3396], 'yield/liter': [3397], '2–3': [3403], 'mg': [3404, 3410, 3415], 'type,': [3408], '0.2': [3409], 'CasY668F,': [3412], '6': [3414], 'CasPPX.': [3417], 'Yeast': [3418, 3830], 'Y153': [3428], '(MATa': [3429], 'ura3-52leu2-3,': [3430], '112': [3431], 'his3-200': [3432], 'ade2-101trp1-901': [3433], 'gal4Δ': [3434], 'gal80Δ': [3435], 'LYS2::GAL1-HIS3': [3436], 'GAL1::GAL1-lacZ).': [3437], 'General': [3438], 'procedures': [3439], 'growth': [3442, 3518], 'maintenance': [3444], 'elsewhere': [3447], '(31Fields': [3448, 3494, 3521, 3583, 3655], 'Sternglanz': [3450, 3496, 3523, 3585, 3657], 'Genet.': [3453, 3499, 3526, 3588, 3660], '286-292Abstract': [3456, 3502, 3529, 3591, 3663], '(530)': [3462, 3508, 3535, 3597, 3669], '32Fields': [3465], 'Song': [3467], 'O.': [3468], '1989;': [3470], '340:': [3471], '245-246Crossref': [3472], '(4971)': [3475], 'lithium': [3486], 'acetate': [3487], 'method': [3488], 'µg': [3491], 'Double': [3511], 'transformants': [3512, 3608, 4222], 'selected': [3514], 'Leu-Trp': [3516], 'SD-selective': [3517], 'agar': [3519], 'plates': [3520], 'β-galactosidase': [3538, 3604, 3643, 3995, 4014, 4216], 'assays': [3539], 'ways.': [3544], '(i)': [3545, 3873], 'filter': [3548, 3568], 'colonies': [3550], 'transferred': [3552], 'Whatman': [3555], 'No.': [3556], 'filter,': [3558], 'freezing': [3561], 'nitrogen,': [3564], 'layered': [3565], 'another': [3567], 'presoaked': [3569], '5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside/Z': [3571], 'buffer,': [3572], 'incubated': [3574, 3681, 3781], 'blue': [3580], 'color': [3581], 'developed': [3582, 4264], '(ii)': [3600, 3885], 'quantitation': [3602], '3–5': [3606], 'independent': [3607], 'selective': [3612], 'media': [3613], 'midlog': [3615], 'phase.': [3616], 'normalized': [3620], 'nm,': [3624], 'number': [3628], 'measurement.': [3635], 'After': [3636], 'chloroform/SDS,': [3639], 'detected': [3645, 3739], 'spectrophotometrically': [3647], 'measuring': [3648, 3993], 'cleavage': [3649], 'chromogenic': [3652], 'o-nitrophenyl-3-D-galactoside': [3654], 'pulse-chase': [3673], 'experiments,': [3674, 3749], '0.1': [3686], 'µm': [3687], '[γ-32P]ATP,': [3688], 'ice.': [3701], 'chase': [3707], 'mmunlabeled': [3710], 'aliquots': [3713], 'withdrawn': [3718], 'specified': [3721], 'times.': [3722], 'reactions': [3724, 3751, 3795], 'analyzed': [3726, 3753, 3811], 'SDS/PAGE': [3728, 3755, 3813], '8%': [3731], 'acrylamide/0.2%': [3732], 'bis-acrylamide': [3733, 3760], 'gel,': [3734], 'autoradiography.': [3741, 3816], 'separate': [3744], 'intermediate': [3745], 'products': [3746, 3940, 3972], '9%': [3758], 'acrylamide/0.075%': [3759], 'gel.': [3761], 'which': [3765], 'total': [3767], 'monitored,': [3772], 'amounts': [3775], 'CasWT': [3777, 4415, 4432], '150': [3786], 'nm': [3787], '0.25': [3790], 'mm[γ-32]ATP': [3791], '(140': [3792], 'cpm/pmol).': [3793], 'stopped': [3797], 'times': [3801], 'mixing': [3803], 'Laemmli': [3805], 'Buffer': [3806], 'boiling': [3808], 'test': [3818, 3853, 4030, 4251], 'model,': [3822], 'employed': [3825], 'true': [3833], 'phosphotyrosine-dependent': [3837, 4404], 'attributed': [3841], 'endogenous': [3849], 'whether': [3854], 'system,': [3865, 3984, 4394], 'vectors:': [3872], 'GAL4,': [3883, 3934], '(or': [3887], 'c-Src)': [3888], '(BD)': [3895], 'GAL4.': [3897], 'v-Src,': [3899], 'portion': [3903], 'gene': [3906], 'region.': [3918], 'forms': [3920, 3961], 'terminus': [3928], 'consequently': [3936], 'final': [3938], 'fusion': [3939, 3971], 'myristoylated.': [3943], 'Antiphosphotyrosine': [3944], 'Western': [3945], 'blots': [3946], 'lysates': [3949, 3958, 3999], 'showed': [3950, 4409], 'elevated': [3951], 'levels': [3952], '(data': [3964, 4103], 'shown),': [3966, 4105], 'implying': [3967], 'our': [3969], 'BD-Src': [3970], 'active.': [3974], 'capable': [3979, 4098], 'interacting': [3981, 4100], 'revealed': [3986], 'filter-binding': [3989], '(Fig.1': [4000, 4230], 'B).': [4001, 4018, 4090], 'Co-transfection': [4002], 'empty': [4007], 'undetectable': [4013], 'specific.': [4028], 'importance': [4032, 4253], 'Cas,': [4041], '(Y668F)': [4047], 'A).': [4059, 4143], 'Mutation': [4060], 'mutation': [4066, 4150], '(R175K)': [4072], 'abrogates': [4074], '(v-SrcSH2D)': [4077], 'had': [4078], '(K295R)': [4095], 'confirming': [4106, 4395], 'domain-': [4118], 'phosphotyrosine-dependent.': [4120], 'sequence,': [4134], 'RXLPPLPRΦ': [4135], '(Φ': [4136], '=': [4137], 'hydrophobic': [4138], 'acid)': [4140], 'reported': [4147], 'leads': [4155], 'We': [4190, 4202, 4263], 'RPLPSPP': [4199], 'RSLGSPG.': [4201], 'assayed': [4203], 'mutant,': [4208], 'designated': [4209], 'double': [4221], 'negative': [4228], 'control': [4229], 'C).': [4231], 'Therefore,': [4232, 4353], 'disrupting': [4233], 'abolish': [4241], 'above': [4250], 'certain': [4255], 'second': [4266], 'probe': [4271], 'conform': [4299], 'optimal': [4302], 'CrkSH2': [4356, 4385, 4402], '"reporter"': [4368], 'status': [4372], 'summarized': [4378], 'Fig.2.': [4380], 'Binding': [4381], 'occurs': [4386], '2).': [4406, 4436], 'difference': [4411], 'CasY668F.': [4417], 'contrast,': [4419], 'exhibits': [4421], 'reduced': [4422], 'compared': [4429], 'interacti': [4438]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2034716886', 'counts_by_year': [{'year': 2024, 'cited_by_count': 1}, {'year': 2023, 'cited_by_count': 2}, {'year': 2022, 'cited_by_count': 3}, {'year': 2021, 'cited_by_count': 2}, {'year': 2020, 'cited_by_count': 3}, {'year': 2019, 'cited_by_count': 1}, {'year': 2018, 'cited_by_count': 2}, {'year': 2017, 'cited_by_count': 3}, {'year': 2016, 'cited_by_count': 4}, {'year': 2015, 'cited_by_count': 4}, {'year': 2014, 'cited_by_count': 4}, {'year': 2013, 'cited_by_count': 8}, {'year': 2012, 'cited_by_count': 6}], 'updated_date': '2024-12-11T14:02:40.142254', 'created_date': '2016-06-24'}