Title: Plasticity of Vascular Smooth Muscle α-Actin Gene Transcription
Abstract: Transcriptional activity of the mouse vascular smooth muscle (VSM) α-actin promoter was governed by both cell type and developmental stage-specific mechanisms. A purine-rich motif (PrM) located as –181 to –176 in the promoter was absolutely required for activation in mouse AKR-2B embryonic fibroblasts and partially contributed to activation in undifferentiated mouse BC3H1 myoblasts. Transcriptional enhancer factor 1 recognized the PrM and cooperated with other promoterbinding proteins to regulate serum growth factor-dependent transcription in both myoblasts and fibroblasts. Two distinct protein factors (VAC-ssBF1 and VAC-ssBF2) also were identified that bound sequence-specifically to single-stranded oligonucleotide probes that spanned both the PrM and a closely positioned negative regulatory element. VAC-ssBF1 and BF2 binding activity was detected in undifferentiated myoblasts, embryonic fibroblasts, and several smooth muscle tissues in the mouse and human. A myoblast-specific protein (VAC-RF1) also was detected that bound double-stranded probes containing a CArG-like sequence that previously was shown to impart strong, cell type specific repression. The binding activity of transcription enhancer factor 1, VAC-RF1, and VAC-ssBF1 was significantly diminished when confluent BC3H1 myoblasts differentiated into myocytes and expressed VSM α-actin mRNA after exposure to serum-free medium. The results indicated that cell type-specific control of the VSM α-actin gene promoter required the participation of multiple DNA-binding proteins, including two that were enriched in smooth muscle and had preferential affinity for single-stranded DNA. Transcriptional activity of the mouse vascular smooth muscle (VSM) α-actin promoter was governed by both cell type and developmental stage-specific mechanisms. A purine-rich motif (PrM) located as –181 to –176 in the promoter was absolutely required for activation in mouse AKR-2B embryonic fibroblasts and partially contributed to activation in undifferentiated mouse BC3H1 myoblasts. Transcriptional enhancer factor 1 recognized the PrM and cooperated with other promoterbinding proteins to regulate serum growth factor-dependent transcription in both myoblasts and fibroblasts. Two distinct protein factors (VAC-ssBF1 and VAC-ssBF2) also were identified that bound sequence-specifically to single-stranded oligonucleotide probes that spanned both the PrM and a closely positioned negative regulatory element. VAC-ssBF1 and BF2 binding activity was detected in undifferentiated myoblasts, embryonic fibroblasts, and several smooth muscle tissues in the mouse and human. A myoblast-specific protein (VAC-RF1) also was detected that bound double-stranded probes containing a CArG-like sequence that previously was shown to impart strong, cell type specific repression. The binding activity of transcription enhancer factor 1, VAC-RF1, and VAC-ssBF1 was significantly diminished when confluent BC3H1 myoblasts differentiated into myocytes and expressed VSM α-actin mRNA after exposure to serum-free medium. The results indicated that cell type-specific control of the VSM α-actin gene promoter required the participation of multiple DNA-binding proteins, including two that were enriched in smooth muscle and had preferential affinity for single-stranded DNA. The vascular smooth muscle (VSM) 1The abbreviations used are: VSMvascular smooth muscleTEF-1transcriptional enhancer factor 1CATchloramphenicol acetyltransferaseVAC-RF1vascular actin repressor factor 1DTTdithiothreitolPMSFphenylmethylsulfonyl fluoridebpbase pair(s)TVtransversionPrMpurine-rich motifPAGEpolyacrylamide gel electrophoresis. α-actin gene encodes one of four actin isoforms in higher vertebrates which normally are expressed as part of a myogenic differentiation program. However, there is a growing appreciation that this gene also is expressed in a variety of non-muscle tissues including a specialized cell type termed a "myofibroblast" (1Skalli O. Gabbiani G. Clark R.A.F. Henson P.M. The Molecular and Cellular Biology of Wound Repair. Plenum Publishing Corp, New York1988: 373-401Crossref Google Scholar). Although the origin of stromal myofibroblasts remains unclear, they may express a variety of smooth muscle markers and are closely associated with proliferative processes such as wound healing and non-malignant fibromatoses (2Sappino A.P. Schürch W. Gabbiani G. Lab. Invest. 1990; 63: 144-161PubMed Google Scholar), and desmoplastic stromal responses to a variety of neoplasias including carcinomas of both the breast (3Schürch W. Seemayer T.A. Lagacé R. Virchows Arch. A Pathol. Anat. 1981; 391 (abstr.): 125-139Crossref PubMed Scopus (71) Google Scholar, 4Lazard D. Sastre X. Frid M.G. Glukhova M. Thiery J.-P. Koteliansky V.E. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 999-1003Crossref PubMed Scopus (277) Google Scholar) and colon (3Schürch W. Seemayer T.A. Lagacé R. Virchows Arch. A Pathol. Anat. 1981; 391 (abstr.): 125-139Crossref PubMed Scopus (71) Google Scholar). Little is known of the mechanisms which regulate VSM α-actin expression in myofibroblasts but the proliferative nature of the pathological conditions associated with the appearance of these cells suggests an involvement of peptide growth factors. Similarly, vascular injuries that are accompanied by the release of growth factors such as transforming growth factor type β1, fibroblast growth factor, and platelet-derived growth factor represent a clinical situation where subpopulations of smooth muscle cells arise in the blood vessel wall which exhibit novel phenotypic properties and vary in the ability to express VSM α-actin (5Nabel E.G. Shum L. Pompili V.J. Yang Z. San H. Shu H.B. Liptay S. Gold L. Gordon D. Derynck R. Nabel G.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 10759-10763Crossref PubMed Scopus (343) Google Scholar, 6Babaev V.R. Bobryshev Y.V. Stenina O.V. Tararak E.M. Gabbiani G. Am. J. Pathol. 1990; 136: 1031-1042PubMed Google Scholar, 7Bondjers G. Glukhova M. Hansson G.K. Postnov Y.V. Reidy M.A. Schwartz S.M. Circulation. 1991; 84: 2-16Google Scholar, 8Kocher O. Gabbiani F. Gabbiani G. Reidy M.A. Cokay M.S. Peters H. Hüttner I. Lab. Invest. 1991; 65: 459-470PubMed Google Scholar). vascular smooth muscle transcriptional enhancer factor 1 chloramphenicol acetyltransferase vascular actin repressor factor 1 dithiothreitol phenylmethylsulfonyl fluoride base pair(s) transversion purine-rich motif polyacrylamide gel electrophoresis. Mechanisms involved in the modulation of VSM α-actin transcriptional activity as a consequence of smooth muscle injury or in specialized cell types such as myofibroblasts may share similarities with strategies utilized during normal development of the vascular system (9Bochaton-Piallat M.-L. Gabbiani F. Ropraz P. Gabbiani G. Differentiation. 1992; 49: 175-185Crossref PubMed Scopus (79) Google Scholar, 10Bochaton-Piallat M.-L. Gabbiani F. Ropraz P. Gabbiani G. Arterioscler. Thromb. 1993; 13: 1449-1455Crossref PubMed Google Scholar). Plasticity of VSM α-actin gene expression may represent one adaptation acquired by a variety of non-muscle and muscle cell types to manipulate intracellular contractile protein levels necessary for repairing tissue injuries or remodelling of the contractile apparatus. For this reason, identifying and characterizing the genetic elements involved in the modulation of VSM α-actin gene transcription in both myoblast and fibroblast lineages may provide some insight into molecular mechanisms that govern this plasticity and provide for better recognition of potentially useful clinical control points. As a first step toward understanding more about the mechanisms involved in transcriptional activation and repression of the VSM α-actin gene, we have identified and compared protein factors in mouse BC3H1 myogenic cell and AKR-2B embryonic fibroblast extracts that specifically interacted with its proximal promoter region. BC3H1 myoblasts are unique among muscle tissue culture cells in that they reproducibly demonstrate sustained activation of the VSM α-actin gene in response to the accumulation of cytodifferentiation permissive, extracellular matrix macromolecules (11Strauch A.R. Berman M.D. Miller H.R. J. Cell. Physiol. 1991; 146: 337-348Crossref PubMed Scopus (10) Google Scholar, 12Lee S.H. Yan H. Reeser J.C. Dillman J.M. Strauch A.R. J. Cell. Physiol. 1995; (in press)Google Scholar). Moreover, expression of this gene in differentiated BC3H1 myocytes can be rapidly and selectively repressed (12Lee S.H. Yan H. Reeser J.C. Dillman J.M. Strauch A.R. J. Cell. Physiol. 1995; (in press)Google Scholar, 13Stoflet E.S. Schmidt L.J. Elder P.K. Korf G.M. Foster D.N. Strauch A.R. Getz M.J. Mol. Biol. Cell. 1992; 3: 1073-1083Crossref PubMed Scopus (37) Google Scholar) which indicates the advantage of this line in elucidating the essential positive and negative components of VSM α-actin transcriptional plasticity. In contrast, while the VSM α-actin gene is not expressed in AKR-2B embryonic fibroblasts, transient activation can be achieved by exposing quiescent cells to serum growth factors (13Stoflet E.S. Schmidt L.J. Elder P.K. Korf G.M. Foster D.N. Strauch A.R. Getz M.J. Mol. Biol. Cell. 1992; 3: 1073-1083Crossref PubMed Scopus (37) Google Scholar). In this regard, AKR-2B fibroblasts represent a convenient model for examining aspects of smooth muscle actin regulation in transient myofibroblasts that may be difficult to study biochemically in the context of normal wound healing processes (14Darby I. Skalli O. Gabbiani G. Lab. Invest. 1990; 63: 21-29PubMed Google Scholar). Several nuclear protein factors that bound to closely-positioned regions of the VSM α-actin gene promoter involved in transcriptional activation and repression were identified in BC3H1 myogenic cells, AKR-2B fibroblasts, and several smooth muscle tissues. One factor, characterized in this report as a protein resembling the SV40-enhancer binding protein TEF-1, binds an inverted M-CAT consensus sequence previously identified in other muscle-specific contractile protein genes (15Mar J.H. Ordahl C.P. Mol. Cell. Biol. 1990; 10: 4271-4283Crossref PubMed Scopus (149) Google Scholar, 16Shimizu N. Prior G. Umeda P.K. Zak R. Nucleic Acids Res. 1992; 20: 1793-1799Crossref PubMed Scopus (31) Google Scholar, 17Flink I.L. Edwards J.G. Bahl J.J. Liew C.-C. Sole M. Morkin E. J. Biol. Chem. 1992; 267: 9917-9924Abstract Full Text PDF PubMed Google Scholar). Recent reports suggest that the TEF-1 protein may represent one member of a family of related transcriptional regulators that are expressed in a tissue-specific manner (18Farrance I.K.G. Mar J.H. Ordahl C.P. J. Biol. Chem. 1992; 267: 17234-17240Abstract Full Text PDF PubMed Google Scholar, 19Shimizu N. Smith G. Izumo S. Nucleic Acids Res. 1993; 21: 4103-4110Crossref PubMed Scopus (66) Google Scholar, 20Campbell S. Inamdar M. Rodrigues V. Raghavan V. Palazzolo M. Chovnick A. Genes & Dev. 1992; 6: 367-379Crossref PubMed Scopus (144) Google Scholar). TEF-1 activity was enriched in AKR-2B fibroblasts and undifferentiated BC3H1 myoblasts, but absent in mature myocytes cultivated in serum-free medium. An additional sequence-specific, double-stranded DNA binding activity also was detected in extracts prepared from whole BC3H1 myoblasts or isolated nuclei but not fibroblasts. This factor, designated vascular actin repressor factor 1 (VAC-RF1), bound specifically to DNA probes that overlapped a strong silencing element previously shown to be responsible for transcriptional repression in undifferentiated BC3H1 myoblasts (21Foster D.N. Min B. Foster L.K. Stoflet E.S. Sun S. Getz M.J. Strauch A.R. J. Biol. Chem. 1992; 267: 11995-12003Abstract Full Text PDF PubMed Google Scholar). Finally, we describe the binding properties of two sequence-specific proteins, designated VAC-ssBF1 and -BF2 in both fibroblast and myoblast extracts, that exhibited preferential affinity for single-stranded DNA. The binding site for both of these factors resided in a region of the promoter that contained an inverted repeat sequence with high potential to form cruciform structures. The sequence specificity, tissue distribution, and developmental regulation of these factors suggested that they may play an essential role in cell stage-specific transcriptional regulation of the VSM α-actin gene. We describe a model for transcriptional regulation which implicates multiple protein-DNA interactions that may involve alterations in DNA topology around the closely-linked positive and negative control elements within the mouse VSM α-actin promoter. Cell Culture and Transfection Methods—Mouse BC3H1 myogenic cells and AKR-2B embryonic fibroblasts were maintained in culture and transfected as described previously (13Stoflet E.S. Schmidt L.J. Elder P.K. Korf G.M. Foster D.N. Strauch A.R. Getz M.J. Mol. Biol. Cell. 1992; 3: 1073-1083Crossref PubMed Scopus (37) Google Scholar, 21Foster D.N. Min B. Foster L.K. Stoflet E.S. Sun S. Getz M.J. Strauch A.R. J. Biol. Chem. 1992; 267: 11995-12003Abstract Full Text PDF PubMed Google Scholar). Developmental stages of BC3H1 cells (21Foster D.N. Min B. Foster L.K. Stoflet E.S. Sun S. Getz M.J. Strauch A.R. J. Biol. Chem. 1992; 267: 11995-12003Abstract Full Text PDF PubMed Google Scholar) that were examined for trans-activation protein expression included subconfluent myoblasts (40–50% confluent), preconfluent myoblasts (80–90% confluent), and postconfluent myoblasts (100%). Full differentiation of quiescent BC3H1 myoblasts into highlyelongated myocytes was accomplished by exposing postconfluent cells to serum-free, N2 differentiation medium for a period of 4–5 days (21Foster D.N. Min B. Foster L.K. Stoflet E.S. Sun S. Getz M.J. Strauch A.R. J. Biol. Chem. 1992; 267: 11995-12003Abstract Full Text PDF PubMed Google Scholar). Plasmids used for transfections were purified using either Qiagen™ preparative resin and a protocol provided by the manufacturer (Qiagen, Chatsworth, CA) or double cesium chloride gradient centrifugation. The schedule for preparing extracts from transfected myoblasts at various developmental stages as well as the procedures used for CAT assays and quantitation of chromatograms have been described previously (21Foster D.N. Min B. Foster L.K. Stoflet E.S. Sun S. Getz M.J. Strauch A.R. J. Biol. Chem. 1992; 267: 11995-12003Abstract Full Text PDF PubMed Google Scholar). Construction of VSM α-Actin Promoter Mutations—Transversion mutants of the VSM α-actin promoter construct pC3VSMP4 (13Stoflet E.S. Schmidt L.J. Elder P.K. Korf G.M. Foster D.N. Strauch A.R. Getz M.J. Mol. Biol. Cell. 1992; 3: 1073-1083Crossref PubMed Scopus (37) Google Scholar), abbreviated in this work as VSMP4, were constructed using polymerase chain reaction amplification. Oligonucleotide primers with a 5′ SalI restriction site, which anchor deletions or create transversion mutations of certain nucleotides, were made on an Applied Biosystem model 394 DNA/RNA synthesizer and desalted over a Sephadex™ G-25 NAP column (Pharmacia, Piscataway, NJ) in distilled water. In polymerase chain reaction amplifications, each of these primers was paired with Bam27, the 3′ primer with a BamHI restriction site. Briefly, primers were annealed to 0.1–1 μg of template DNA (VSMP4) and amplified 30–35 cycles in a Perkin-Elmer (Norwalk, CT) DNA Thermacycler™ using polymerase chain reaction kit (Perkin-Elmer) reagents and reaction times (94 °C × 1 min; 50 °C × 2 min; 72 °C × 3 min). Polymerase chain reaction products were purified from 1–2% agarose gel slices using Costar (Cambridge, MA) Spin-X™ columns. Promoter fragments then were digested with SalI/BamI and ligated into the promoter-less reporter plasmid pBLCAT3 (22Luckow B. Schutz G. Nucleic Acids Res. 1987; 155490Crossref PubMed Scopus (1401) Google Scholar). Promoter constructs harboring StuI recognition site substitution mutations in place of CArG elements 1 or 2 were prepared as described previously (21Foster D.N. Min B. Foster L.K. Stoflet E.S. Sun S. Getz M.J. Strauch A.R. J. Biol. Chem. 1992; 267: 11995-12003Abstract Full Text PDF PubMed Google Scholar). Recombinant plasmid p99βAc-CAT was constructed for use as a positive control in primer extension assays by making a 99-base synthetic copy of the mouse β-actin proximal promoter region (-92 to +7) and its complement. Gel-purified oligonucleotides were phosphorylated, annealed, and inserted between the SalI and BamHI site of pBLCAT3. All cloned sequences described in this paper were confirmed by double-stranded dideoxy sequencing using a Sequenase™ kit (U. S. Biochemical Corp.). Primer extension assays were performed as described previously (4Lazard D. Sastre X. Frid M.G. Glukhova M. Thiery J.-P. Koteliansky V.E. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 999-1003Crossref PubMed Scopus (277) Google Scholar). Preparation of DNA-binding Protein Extracts—Whole cell extract of AKR-2B cells was prepared essentially as described by Zimarino and Wu (23Zimarino V. Wu C. Nature. 1987; 327 (abstr.): 727-730Crossref PubMed Scopus (250) Google Scholar). Briefly, 1–2 × 106 AKR-2B cells were plated in 162 cm2 peel-top culture flasks (Costar) and grown to 70–80% confluence in McCoys 5A (Life Technologies, Inc./BRL, Grand Island, NY) medium containing 5% fetal calf serum (Hyclone, Logan, UT) at 37 °C in a 5% CO2 atmosphere. Cells were harvested, sedimented at 300 × g, and rinsed several times in ice-cold Dulbecco's phosphate-buffered saline before freezing in liquid nitrogen. Whole cell extract was prepared from the frozen pellet by thawing and gently pipetting with a Pasteur pipette in 5 volumes of whole cell extract buffer containing 10 mm HEPES, pH 7.9, 0.4 M NaCl, 0.2 mm EDTA, 0.5 mm dithiothreitol (DTT), 5% glycerol, and 0.5 mm phenylmethylsulfonyl fluoride (PMSF) until the suspension was visually homogeneous. The lysate was centrifuged at 100,000 × g for 5 min at 4 °C and the supernatant frozen in liquid nitrogen and stored at –81 °C until used in EMSAs. Nuclear and cytosolic (S-100) fractions were prepared from BC3H1 cells essentially as described by Ausubel et al. (24Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.L. Struhl K. Current Protocols in Molecular Biology. John Wiley and Sons, New York1993Google Scholar), substituting 1.4 M KCl high salt buffer for the 1.2 M KCl high salt buffer. Whole cell extracts were prepared using a modified version of the method described by Hoeffler and Roeder (25Hoeffler W.K. Roeder R.G. Cell. 1985; 41: 955-963Abstract Full Text PDF PubMed Scopus (72) Google Scholar). Briefly, cells were rinsed twice with ice-cold phosphate-buffered saline and then resuspended in 1.5 packed cell volumes of hypotonic buffer containing 10 mm HEPES, pH 7.9, 10 mm KCl, 1.5 mm MgCl2, 0.5 mm DTT, 1 mm PMSF. The cells were allowed to swell for 20 min on ice and then lysed by 35 strokes with a type-B Dounce homogenizer pestle. The cell lysate volume was measured and supplemented with 1.67 volumes of high salt buffer containing 1.6 M KCl, 20 mm HEPES, pH 7.9, 1 mm DTT, 0.2 mm EDTA, 0.1 mm PMSF, and 20% glycerol. Lysate aliquots were gently agitated on a tilt shaker for 30 min at 4 °C, and then centrifuged at 100,000 × g for 60 min. The upper lipid layer was discarded and the clear supernatant dialyzed against a large excess of buffer containing 20 mm HEPES, pH 7.9, 100 mm KCl, 0.2 mm EDTA, 1 mm DTT, 0.1 mm PMSF, and 20% glycerol. Tissue extracts were prepared from 7–9-day-old mice following a modification of the procedure described by Taylor (26Taylor M.V. Nucleic Acids Res. 1991; 19: 2669-2675Crossref PubMed Scopus (11) Google Scholar). Tissues were removed, rinsed several times in ice-cold phosphate-buffered saline, and quick frozen with liquid nitrogen. Frozen tissues initially were ground to a fine powder and then processed by 30 strokes with a a type-B pestle in a Dounce homogenizer using 2 volumes of buffer containing 50 mm Tris-HCl, pH 7.9, 50 mm KCl, 1 mm DTT, 0.1 mm EDTA, 0.2 mm PMSF, and 25% glycerol. The homogenate was first clarified at 3000 × g for 30 min and the resulting supernatant immediately centrifuged at 100,000 × g for 90 min to yield the final supernatant which was frozen in liquid nitrogen and stored at –81 °C. Oligonucleotide Probes and Competitors—Five overlapping 30-bp oligonucleotides spanning the region of the VSM α-actin 5′-flanking region between –224 and –155 (Fig. 2), as well as six other double-stranded oligonucleotides used for binding and competition analysis (Table I), were synthesized and purified as described above. In some cases reverse and forward sets of oligonucleotides were labeled both separately and after annealing to allow analysis of both single- and double-stranded DNA-binding proteins in cell and tissue extracts. One additional 30-bp double-stranded oligonucleotide containing mutations in the CArG-like element (CCATAACGAGCTGAGCTGCCTAAAGGCCTA, mutated sequence is underlined) was obtained from a commercial source (Integrated DNA Technologies, Inc., Coralville, IA).Table INucleotide sequence of synthetic oligonucleotide probesProbeSequencePrM305′–tcqacGCAGAACAGA GGAATG CAGTGGAAGAGACCcg −3′mPrM303′–qCGTCTTGTCT CCTTAC GTCACCTTCTCTGGcctaq–5′5′–tcqacGCAGAACAGA TTAATG CAGTGGAAGAGACCq −3′cTNT3′–qCGTCTTGTCT AATTAC GTCACCTTCTCTGGcctaq–5′5′–tcqacGGCGCCCAGAG AGGAATG CAACACTTGTGAq −3′GT-IIC3′– qCCGCGGGTCTC TCCTTAC GTTGTGAACACTcctaq–5′5′–CCGAGAGAC ACATTCCA C ACATTCCA CTGC −3′3′–CTCTG TGTAAGGT G TGTAAGGT GACGGGCT–5′SphI-II5′–CCGAGAGAT GCATGCTT T GCATACTT CTGC −3′3′–CTCTA CGTACGAA A CGTATGAA GACGGGCT–5′PrMI-II5′–TCTTCCACTG CATTCC TCT CATTCC TCTGT −3′3′– GGTGAC GTAAGG AGA GTAAGG AGACAAGAC–5′ Open table in a new tab Electrophoretic Mobility Shift Assay (EMSA)—EMSAs were performed according to the method of Fried and Crothers (27Fried M. Crothers D.M. Nucleic Acids Res. 1981; 9 (abstr.): 6505-6525Crossref PubMed Scopus (1686) Google Scholar) except in some cases whole cell extracts were used in place of nuclear extract. Reactions typically contained 1.5–10 μg of protein extract, 0.5–2.0 μg of poly(dI-dC), 1–12 mm HEPES, pH 7.9, 60 mm KCl, or 105–340 mm NaCl, 0.3–0.9 mm DTT, 0.12–0.5 mm EDTA, 0.12 mm PMSF, 3.5–12% glycerol, and either 15,000 or 20,000 cpm (approximately 0.05–1 ng) of 32P-labeled probe in a 20-μ1 reaction volume. Probes were labeled with Klenow fragment (Life Technologies, Inc./BRL) and [α-32P]dNTP (ICN Biomedical, Costa Mesa, CA) or with T4 polynucleotide kinase (Life Technologies, Inc./BRL) and [γ-32P]ATP (ICN). In some cases, labeled probes were purified by electrophoresis on 8% polyacrylamide gels, eluted, and precipitated with ethanol before use. EMSA reaction mixtures were incubated for 30 min at room temperature before subjecting samples to electrophoretic analysis for approximately 1.5–2.5 h at 150 V in either 0.25 or 0.5 × TBE (0.5 × = 0.045 M Tris borate, 1 mm EDTA) on 4–5% nondenaturing polyacrylamide gels. For antibody supershift experiments, TEF-1 antiserum (3 μl, obtained from I. K. G. Farrance and C. P. Ordahl, University of California San Francisco) was added to reactions during the last 10 min of incubation prior to gel electrophoresis. Polyclonal TEF-1 antisera was prepared from a rabbit immunized with a mixture of three synthetic peptides derived from the chicken TEF-1 cDNA sequence. 2I. K. G. Farrance, personal communication. Following electrophoresis, the gels were dried and exposed to x-ray film (Sterling XR-100, BioWorld, Dublin, OH) for various periods. UV Cross-linking of DNA-Protein Complexes—Determination of the molecular weight of proteins bound to nucleic acid in EMSAs was performed essentially as described by Williams et al. (28Williams M. Brys A. Weiner A.M. Maizels N. Nucleic Acids Res. 1992; 20 (abstr.): 4935-4936Crossref PubMed Scopus (29) Google Scholar) except for some minor modifications. DNA probes labeled using Klenow fragment and [α-32P]dNTP were used in EMSAs as described above except that protein-DNA complexes were resolved on a 0.75-mm thick 5% polyacrylamide gel. The wet gel was irradiated under a 254-nm reflected UV lamp (Fotodyne Inc., New Berlin, WI) at 15–20 cm for 10 min and then exposed to x-ray film overnight at 4 °C to visualize mobility shifted complexes. DNA-protein complexes then were excised and denatured by boiling gel slices for 5 min in sample buffer containing 1% sodium dodecyl sulfate (SDS), 3 mm DTT, and 125 mm Tris-HCl, pH 6.8. A 5-µg aliquot of prestained protein molecular weight marker (high range mixture, Life Technologies, Inc./BRL) was precast into a 0.75-mm thick 5% SDS-polyacrylamide gel slice (0.1% SDS, 125 mm Tris-HCl, pH 6.8, 0.25 × TBE) and denatured in parallel. After denaturation, the gel slices were placed at the top of a 10 × 11.5-cm glass gel plate; 0.75-mm spacers were then fitted and a second plate clamped to the first. A 10% SDS-polyacryamide separating gel mixture was poured into the mold and allowed to polymerize, leaving about 0.5–1.0 cm between the bottom of the gel slices and the top of the separating gel. A stacking gel then was poured into the mold to fill the remaining volume between the two plates. Following electrophoresis at 200 V, the gel was dried and subjected to autoradiography for 4 days at –81 °C using intensifying screens. A Purine-rich Motif Is Essential to VSM α-Actin Promoter Activity—In previous studies we constructed a series of deletion mutants of the mouse VSM α-actin promoter and tested their ability to activate a linked CAT reporter gene following transfection into either BC3H1 myoblasts or AKR-2B fibroblasts (13Stoflet E.S. Schmidt L.J. Elder P.K. Korf G.M. Foster D.N. Strauch A.R. Getz M.J. Mol. Biol. Cell. 1992; 3: 1073-1083Crossref PubMed Scopus (37) Google Scholar, 21Foster D.N. Min B. Foster L.K. Stoflet E.S. Sun S. Getz M.J. Strauch A.R. J. Biol. Chem. 1992; 267: 11995-12003Abstract Full Text PDF PubMed Google Scholar). The results suggested the presence of a strong transcriptional silencing element mapping, in part, between –224 and –191 relative to the start of transcription. The size of this element appeared to be cell-type dependent since retention of a GGGA motif between –195 and –192 was sufficient to maintain a fully-repressed transcriptional state in AKR-2B fibroblasts, whereas it was only partially able to do so in subconfluent BC3H1 myoblasts. Full repression of myoblasts required an intact CArG-like element located between –203 and –194 (21Foster D.N. Min B. Foster L.K. Stoflet E.S. Sun S. Getz M.J. Strauch A.R. J. Biol. Chem. 1992; 267: 11995-12003Abstract Full Text PDF PubMed Google Scholar). In the absence of the 33-base pair silencing region, transcriptional activation in both cell types was found to require both a CArG motif at position –120 and –111 and an unidentified element positioned between –191 and –150. To further localize the activating element, a series of transversion (TV) mutations were introduced within the transcriptionally-active truncated promoter construct previously designated VSMP4 (13Stoflet E.S. Schmidt L.J. Elder P.K. Korf G.M. Foster D.N. Strauch A.R. Getz M.J. Mol. Biol. Cell. 1992; 3: 1073-1083Crossref PubMed Scopus (37) Google Scholar, 21Foster D.N. Min B. Foster L.K. Stoflet E.S. Sun S. Getz M.J. Strauch A.R. J. Biol. Chem. 1992; 267: 11995-12003Abstract Full Text PDF PubMed Google Scholar). As shown in Fig. 1, mutations within a 6-bp GGAATG sequence completely abolished VSM α-actin promoter activity in fibroblasts. This purine-rich motif (PrM) maps between–181 and –176 and is 100% conserved at the identical coordinates in the human, rat, and chicken VSM α-actin promoters (29Min B. Foster D.N. Strauch A.R. J. Biol. Chem. 1990; 265: 16667-16675Abstract Full Text PDF PubMed Google Scholar, 30Blank R.S. McQuinn T.C. Yin K.C. Thompson M.M. Takeyasu K. Schwartz R.J. Owens G.K. J. Biol. Chem. 1992; 267: 984-989Abstract Full Text PDF PubMed Google Scholar). Mutations within the PrM partially impaired promoter activity in undifferentiated subconfluent BC3H1 myoblasts but, interestingly, had no statistically significant effect in more developmentally advanced, postconfluent myoblasts (Fig. 1). Other mutations, with the exception of those encompassing the PrM (TV 181, TV 179, TV 177), were largely ineffective in reducing VSMP4 promoter activity in subconfluent BC3H1 myoblasts (data not shown). In an attempt to identify protein factors that interacted with the activating PrM, as well as with sequences immediately upstream which contributed to transcriptional silencing, whole cell protein extracts were prepared from AKR-2B fibroblasts and BC3H1 myoblasts and used in EMSAs. Individual double-stranded 30-bp oligonucleotides (designated ol-o5) from the overlapping set shown in Fig. 2 and spanning –224 to –155 of the VSM α-actin promoter were used as probes for these studies. A single shifted complex designated oligonucleotide 4-binding protein (o4BP) was detected in both fibroblast and myoblast extracts when probed with the oligonucleotide spanning from –194 to –165 that encompassed the PrM activating element (Fig. 2). However, a second distinctly shifted complex, designated oligonucleotide 1 binding protein (o1BP), was detected only in myoblast extracts in combination with probes spanning from –224 to –194 (o1) and from –215 to –185 (o2). The o1 and o2 probes overlapped in a region which contains a CArG-like element that previously was shown to impart musclerestricted transcriptional activity (21Foster D.N. Min B. Foster L.K. Stoflet E.S. Sun S. Getz M.J. Strauch A.R. J. Biol. Chem. 1992; 267: 11995-12003Abstract Full Text PDF PubMed Google Scholar). o4BP and the SV40 Enhancer Binding Protein TEF-1 have Similar DNA-binding Site Recognition Properties—The 6-bp VSM α-actin PrM is contained within a larger sequence (GAGGAATGC) which bears close similarity to the recognition sequences for two unrelated transcription factors. Thes