Specific β1 Integrin Site Selectively Regulates Akt/Protein Kinase B Signaling via Local Activation of Protein Phosphatase 2A

Name: Work Video:
Duration: 3 min 30 s
Roumen Pankov; Edna Cukierman; Katherine Clark; Kazue Matsumoto; Cornelia Hahn; Benoit Poulin; Kenneth M. Yamada
{'id': 'https://openalex.org/W1974001927', 'doi': 'https://doi.org/10.1074/jbc.m300879200', 'title': 'Specific β1 Integrin Site Selectively Regulates Akt/Protein Kinase B Signaling via Local Activation of Protein Phosphatase 2A', 'display_name': 'Specific β1 Integrin Site Selectively Regulates Akt/Protein Kinase B Signaling via Local Activation of Protein Phosphatase 2A', 'publication_year': 2003, 'publication_date': '2003-05-01', 'ids': {'openalex': 'https://openalex.org/W1974001927', 'doi': 'https://doi.org/10.1074/jbc.m300879200', 'mag': '1974001927', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/12637511'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m300879200', 'pdf_url': 'http://www.jbc.org/article/S0021925819549778/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819549778/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5019324330', 'display_name': 'Roumen Pankov', 'orcid': 'https://orcid.org/0000-0002-3157-3659'}, 'institutions': [{'id': 'https://openalex.org/I1299303238', 'display_name': 'National Institutes of Health', 'ror': 'https://ror.org/01cwqze88', 'country_code': 'US', 'type': 'government', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Roumen Pankov', 'raw_affiliation_strings': ['Craniofacial Developmental Biology and Regeneration Branch, NIDCR, National Institutes of Health, Bethesda, Maryland 20892-4370, USA.'], 'affiliations': [{'raw_affiliation_string': 'Craniofacial Developmental Biology and Regeneration Branch, NIDCR, National Institutes of Health, Bethesda, Maryland 20892-4370, USA.', 'institution_ids': ['https://openalex.org/I1299303238']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5038454044', 'display_name': 'Edna Cukierman', 'orcid': 'https://orcid.org/0000-0002-1452-9576'}, 'institutions': [{'id': 'https://openalex.org/I4210088259', 'display_name': 'National Institute of Dental and Craniofacial Research', 'ror': 'https://ror.org/004a2wv92', 'country_code': 'US', 'type': 'facility', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238', 'https://openalex.org/I4210088259']}, {'id': 'https://openalex.org/I1299303238', 'display_name': 'National Institutes of Health', 'ror': 'https://ror.org/01cwqze88', 'country_code': 'US', 'type': 'government', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Edna Cukierman', 'raw_affiliation_strings': ['Craniofacial Developmental Biology and Regeneration Branch, NIDCR, National Institutes of Health, Bethesda, Maryland 20892-4370'], 'affiliations': [{'raw_affiliation_string': 'Craniofacial Developmental Biology and Regeneration Branch, NIDCR, National Institutes of Health, Bethesda, Maryland 20892-4370', 'institution_ids': ['https://openalex.org/I4210088259', 'https://openalex.org/I1299303238']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5058445186', 'display_name': 'Katherine Clark', 'orcid': 'https://orcid.org/0000-0003-0797-9875'}, 'institutions': [{'id': 'https://openalex.org/I1299303238', 'display_name': 'National Institutes of Health', 'ror': 'https://ror.org/01cwqze88', 'country_code': 'US', 'type': 'government', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238']}, {'id': 'https://openalex.org/I4210088259', 'display_name': 'National Institute of Dental and Craniofacial Research', 'ror': 'https://ror.org/004a2wv92', 'country_code': 'US', 'type': 'facility', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238', 'https://openalex.org/I4210088259']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Katherine Clark', 'raw_affiliation_strings': ['Craniofacial Developmental Biology and Regeneration Branch, NIDCR, National Institutes of Health, Bethesda, Maryland 20892-4370'], 'affiliations': [{'raw_affiliation_string': 'Craniofacial Developmental Biology and Regeneration Branch, NIDCR, National Institutes of Health, Bethesda, Maryland 20892-4370', 'institution_ids': ['https://openalex.org/I1299303238', 'https://openalex.org/I4210088259']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5103352476', 'display_name': 'Kazue Matsumoto', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I4210088259', 'display_name': 'National Institute of Dental and Craniofacial Research', 'ror': 'https://ror.org/004a2wv92', 'country_code': 'US', 'type': 'facility', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238', 'https://openalex.org/I4210088259']}, {'id': 'https://openalex.org/I1299303238', 'display_name': 'National Institutes of Health', 'ror': 'https://ror.org/01cwqze88', 'country_code': 'US', 'type': 'government', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Kazue Matsumoto', 'raw_affiliation_strings': ['Craniofacial Developmental Biology and Regeneration Branch, NIDCR, National Institutes of Health, Bethesda, Maryland 20892-4370'], 'affiliations': [{'raw_affiliation_string': 'Craniofacial Developmental Biology and Regeneration Branch, NIDCR, National Institutes of Health, Bethesda, Maryland 20892-4370', 'institution_ids': ['https://openalex.org/I4210088259', 'https://openalex.org/I1299303238']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5106082464', 'display_name': 'Cornelia Hahn', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I4210088259', 'display_name': 'National Institute of Dental and Craniofacial Research', 'ror': 'https://ror.org/004a2wv92', 'country_code': 'US', 'type': 'facility', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238', 'https://openalex.org/I4210088259']}, {'id': 'https://openalex.org/I1299303238', 'display_name': 'National Institutes of Health', 'ror': 'https://ror.org/01cwqze88', 'country_code': 'US', 'type': 'government', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Cornelia Hahn', 'raw_affiliation_strings': ['Craniofacial Developmental Biology and Regeneration Branch, NIDCR, National Institutes of Health, Bethesda, Maryland 20892-4370'], 'affiliations': [{'raw_affiliation_string': 'Craniofacial Developmental Biology and Regeneration Branch, NIDCR, National Institutes of Health, Bethesda, Maryland 20892-4370', 'institution_ids': ['https://openalex.org/I4210088259', 'https://openalex.org/I1299303238']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5053371333', 'display_name': 'Benoit Poulin', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I1299303238', 'display_name': 'National Institutes of Health', 'ror': 'https://ror.org/01cwqze88', 'country_code': 'US', 'type': 'government', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238']}, {'id': 'https://openalex.org/I4210106489', 'display_name': 'National Heart Lung and Blood Institute', 'ror': 'https://ror.org/012pb6c26', 'country_code': 'US', 'type': 'facility', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238', 'https://openalex.org/I4210106489']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Benoit Poulin', 'raw_affiliation_strings': ['Laboratory of Cell Signaling, NHLBI, National Institutes of Health, Bethesda, Maryland 20892-0320'], 'affiliations': [{'raw_affiliation_string': 'Laboratory of Cell Signaling, NHLBI, National Institutes of Health, Bethesda, Maryland 20892-0320', 'institution_ids': ['https://openalex.org/I1299303238', 'https://openalex.org/I4210106489']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5052453881', 'display_name': 'Kenneth M. Yamada', 'orcid': 'https://orcid.org/0000-0003-1512-6805'}, 'institutions': [{'id': 'https://openalex.org/I4210088259', 'display_name': 'National Institute of Dental and Craniofacial Research', 'ror': 'https://ror.org/004a2wv92', 'country_code': 'US', 'type': 'facility', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238', 'https://openalex.org/I4210088259']}, {'id': 'https://openalex.org/I1299303238', 'display_name': 'National Institutes of Health', 'ror': 'https://ror.org/01cwqze88', 'country_code': 'US', 'type': 'government', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Kenneth M. Yamada', 'raw_affiliation_strings': ['Craniofacial Developmental Biology and Regeneration Branch, NIDCR, National Institutes of Health, Bethesda, Maryland 20892-4370'], 'affiliations': [{'raw_affiliation_string': 'Craniofacial Developmental Biology and Regeneration Branch, NIDCR, National Institutes of Health, Bethesda, Maryland 20892-4370', 'institution_ids': ['https://openalex.org/I4210088259', 'https://openalex.org/I1299303238']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 3, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 4.406, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 89, 'citation_normalized_percentile': {'value': 0.853872, 'is_in_top_1_percent': False, 'is_in_top_10_percent': False}, 'cited_by_percentile_year': {'min': 95, 'max': 96}, 'biblio': {'volume': '278', 'issue': '20', 'first_page': '18671', 'last_page': '18681'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10831', 'display_name': 'Cell Adhesion Molecules Research', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2723', 'display_name': 'Immunology and Allergy'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10831', 'display_name': 'Cell Adhesion Molecules Research', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2723', 'display_name': 'Immunology and Allergy'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T12672', 'display_name': 'Phagocytosis and Immune Regulation', 'score': 0.9993, 'subfield': {'id': 'https://openalex.org/subfields/2403', 'display_name': 'Immunology'}, 'field': {'id': 'https://openalex.org/fields/24', 'display_name': 'Immunology and Microbiology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10169', 'display_name': 'Protein Kinase Regulation and GTPase Signaling', 'score': 0.998, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/cd49c', 'display_name': 'CD49c', 'score': 0.6510683}, {'id': 'https://openalex.org/keywords/integrin-linked-kinase', 'display_name': 'Integrin-linked kinase', 'score': 0.4935869}], 'concepts': [{'id': 'https://openalex.org/C75217442', 'wikidata': 'https://www.wikidata.org/wiki/Q423650', 'display_name': 'Protein kinase B', 'level': 3, 'score': 0.70155215}, {'id': 'https://openalex.org/C195687474', 'wikidata': 'https://www.wikidata.org/wiki/Q409715', 'display_name': 'Integrin', 'level': 3, 'score': 0.68880945}, {'id': 'https://openalex.org/C156585808', 'wikidata': 'https://www.wikidata.org/wiki/Q18028043', 'display_name': 'Integrin, beta 6', 'level': 4, 'score': 0.66515356}, {'id': 'https://openalex.org/C4894155', 'wikidata': 'https://www.wikidata.org/wiki/Q4201950', 'display_name': 'CD49c', 'level': 5, 'score': 0.6510683}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.5865536}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.5645285}, {'id': 'https://openalex.org/C171779818', 'wikidata': 'https://www.wikidata.org/wiki/Q3799301', 'display_name': 'Integrin alpha M', 'level': 3, 'score': 0.557631}, {'id': 'https://openalex.org/C119524353', 'wikidata': 'https://www.wikidata.org/wiki/Q5145908', 'display_name': 'Collagen receptor', 'level': 4, 'score': 0.52709806}, {'id': 'https://openalex.org/C66417403', 'wikidata': 'https://www.wikidata.org/wiki/Q20970072', 'display_name': 'Integrin-linked kinase', 'level': 5, 'score': 0.4935869}, {'id': 'https://openalex.org/C62478195', 'wikidata': 'https://www.wikidata.org/wiki/Q828130', 'display_name': 'Signal transduction', 'level': 2, 'score': 0.49279264}, {'id': 'https://openalex.org/C11960822', 'wikidata': 'https://www.wikidata.org/wiki/Q242736', 'display_name': 'Phosphorylation', 'level': 2, 'score': 0.40609813}, {'id': 'https://openalex.org/C97029542', 'wikidata': 'https://www.wikidata.org/wiki/Q281417', 'display_name': 'Protein kinase A', 'level': 3, 'score': 0.31089294}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.28291884}, {'id': 'https://openalex.org/C170493617', 'wikidata': 'https://www.wikidata.org/wiki/Q208467', 'display_name': 'Receptor', 'level': 2, 'score': 0.16963679}, {'id': 'https://openalex.org/C82495950', 'wikidata': 'https://www.wikidata.org/wiki/Q14911732', 'display_name': 'Cyclin-dependent kinase 2', 'level': 4, 'score': 0.08309725}], 'mesh': [], 'locations_count': 1, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m300879200', 'pdf_url': 'http://www.jbc.org/article/S0021925819549778/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m300879200', 'pdf_url': 'http://www.jbc.org/article/S0021925819549778/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 92, 'referenced_works': ['https://openalex.org/W125565537', 'https://openalex.org/W1494507441', 'https://openalex.org/W1500795239', 'https://openalex.org/W1552764442', 'https://openalex.org/W1576773659', 'https://openalex.org/W1582432277', 'https://openalex.org/W1598459947', 'https://openalex.org/W1726025741', 'https://openalex.org/W178066091', 'https://openalex.org/W1785533687', 'https://openalex.org/W1901040110', 'https://openalex.org/W1909995282', 'https://openalex.org/W1931127206', 'https://openalex.org/W1962628502', 'https://openalex.org/W1965871583', 'https://openalex.org/W1968253797', 'https://openalex.org/W1969559111', 'https://openalex.org/W1972837970', 'https://openalex.org/W1973837499', 'https://openalex.org/W1974241409', 'https://openalex.org/W1981043027', 'https://openalex.org/W1982903538', 'https://openalex.org/W1983426119', 'https://openalex.org/W1988692408', 'https://openalex.org/W1993205500', 'https://openalex.org/W1998777645', 'https://openalex.org/W1999163644', 'https://openalex.org/W1999793253', 'https://openalex.org/W2002590458', 'https://openalex.org/W2003801710', 'https://openalex.org/W2010265636', 'https://openalex.org/W2013762859', 'https://openalex.org/W2017959339', 'https://openalex.org/W2020537787', 'https://openalex.org/W2028936118', 'https://openalex.org/W2035023695', 'https://openalex.org/W2038530843', 'https://openalex.org/W2038638713', 'https://openalex.org/W2041534105', 'https://openalex.org/W2043395027', 'https://openalex.org/W2044868069', 'https://openalex.org/W2046155579', 'https://openalex.org/W2048121649', 'https://openalex.org/W2050106278', 'https://openalex.org/W2056104802', 'https://openalex.org/W2065652048', 'https://openalex.org/W2066665315', 'https://openalex.org/W2066893159', 'https://openalex.org/W2068365812', 'https://openalex.org/W2068427129', 'https://openalex.org/W2071103751', 'https://openalex.org/W2072630322', 'https://openalex.org/W2074579328', 'https://openalex.org/W2078636606', 'https://openalex.org/W2081401313', 'https://openalex.org/W2088544660', 'https://openalex.org/W2089295555', 'https://openalex.org/W2091314328', 'https://openalex.org/W2094068658', 'https://openalex.org/W2099000660', 'https://openalex.org/W2103737185', 'https://openalex.org/W2105356859', 'https://openalex.org/W2107396952', 'https://openalex.org/W2110228428', 'https://openalex.org/W2123777674', 'https://openalex.org/W2127369178', 'https://openalex.org/W2128628585', 'https://openalex.org/W2130285647', 'https://openalex.org/W2130462086', 'https://openalex.org/W2134674137', 'https://openalex.org/W2137035181', 'https://openalex.org/W2137134545', 'https://openalex.org/W2142579731', 'https://openalex.org/W2145569043', 'https://openalex.org/W2146854995', 'https://openalex.org/W2153084734', 'https://openalex.org/W2153791193', 'https://openalex.org/W2154080202', 'https://openalex.org/W2155894151', 'https://openalex.org/W2157330541', 'https://openalex.org/W2164330595', 'https://openalex.org/W2168197406', 'https://openalex.org/W2168875502', 'https://openalex.org/W2169825848', 'https://openalex.org/W2257951877', 'https://openalex.org/W2344535896', 'https://openalex.org/W2346170562', 'https://openalex.org/W2399838398', 'https://openalex.org/W4213141530', 'https://openalex.org/W4240253200', 'https://openalex.org/W4243385699', 'https://openalex.org/W89084389'], 'related_works': ['https://openalex.org/W4313354036', 'https://openalex.org/W2951390327', 'https://openalex.org/W2924035994', 'https://openalex.org/W2138521103', 'https://openalex.org/W2108283255', 'https://openalex.org/W2100458140', 'https://openalex.org/W2040095760', 'https://openalex.org/W2011464439', 'https://openalex.org/W1973413713', 'https://openalex.org/W1651672993'], 'abstract_inverted_index': {'Integrin': [0, 233, 503], 'transmembrane': [1, 234, 504], 'receptors': [2, 235, 505], 'generate': [3, 236, 2391], 'multiple': [4, 237], 'signals,': [5, 238], 'but': [6, 156, 239, 389, 4033], 'how': [7, 240], 'they': [8, 241, 1647], 'mediate': [9, 242], 'specific': [10, 36, 67, 215, 243, 269, 300, 448, 1753, 1918, 1972, 2023, 3665], 'signaling': [11, 38, 220, 227, 244, 271, 453, 460, 1660, 1748, 1764, 1919, 2036], 'is': [12, 245, 1089, 1197, 1401, 1409, 1424, 1635, 2003, 2010, 4028, 4034], 'not': [13, 246], 'clear.': [14, 247], 'Here': [15, 248, 1954], 'we': [16, 54, 249, 287, 1931, 1955, 2028, 4020], 'test': [17, 250, 1922, 4004], 'the': [18, 24, 56, 108, 157, 167, 171, 201, 222, 229, 251, 257, 289, 341, 390, 400, 404, 434, 455, 462, 507, 656, 1078, 1367, 1412, 1587, 1612, 1639, 1720, 1778, 1785, 1893, 1906, 1940, 1957, 1963, 1990, 2160, 2340, 2346, 2354, 2358, 2371, 2374, 2378, 2425, 2476, 2539, 2583, 2619, 2640, 2668, 2745, 2756, 2799, 2923, 2959, 3023, 3056, 3080, 3088, 3098, 3122, 3152, 3236, 3294, 3304, 3370, 3423, 3438, 3459, 3476, 3486, 3505, 3613, 3658, 3683, 3708, 3732, 3745, 3750, 3860, 3884, 3923, 3936, 3966, 3991, 4040, 4065, 4073, 4151], 'hypothesis': [19, 252, 1924, 4006], 'that': [20, 31, 253, 264, 1202, 1361, 1408, 1656, 1716, 1751, 1945, 1988, 2001, 4007, 4044], 'particular': [21, 254, 4009], 'sequences': [22, 255, 1718], 'along': [23, 228, 256, 461, 1784], 'β1': [25, 64, 81, 125, 258, 297, 314, 358, 1588, 1941, 2046, 2392, 2402, 2442, 2608, 2937, 4067, 4154], 'integrin': [26, 51, 65, 82, 230, 259, 284, 298, 315, 463, 653, 805, 1363, 1589, 1624, 1721, 1740, 1754, 1771, 1786, 1927, 1942, 2134, 2327, 2341, 2393, 2403, 2443, 2609, 3704, 4018, 4051, 4068, 4088, 4091], 'cytoplasmic': [27, 52, 154, 231, 260, 285, 387, 464, 1626, 1654, 1772, 1943, 1965, 4052], 'domain': [28, 261, 1944, 1966], 'may': [29, 262], 'exist': [30, 263], 'are': [32, 265, 1628, 1648, 1723, 2427, 2478, 3988, 4045], 'intimately': [33, 266], 'related': [34, 267], 'to': [35, 114, 268, 347, 1745, 1933, 1983, 2021, 2031, 2044, 2353, 2369, 2390, 2398, 2438, 2625, 2636, 2667, 2712, 3034, 3052, 3333, 3368, 3504, 3523, 3657, 3756, 3891, 3998, 4030, 4080], 'integrin-mediated': [37, 71, 218, 270, 304, 451, 640, 813, 1659, 1763, 1951, 2035], 'pathways.': [39, 272, 1765, 1920], 'Using': [40, 273], 'systematic': [41, 274], 'alanine': [42, 275, 4057], 'mutagenesis': [43, 276, 2349], 'of': [44, 62, 79, 95, 129, 140, 159, 176, 200, 211, 224, 226, 277, 295, 312, 328, 362, 373, 392, 409, 433, 444, 457, 459, 642, 655, 658, 804, 815, 1080, 1086, 1209, 1283, 1369, 1414, 1418, 1614, 1727, 1730, 1761, 1769, 1781, 1895, 1905, 1925, 1929, 1959, 1993, 2006, 2373, 2380, 2570, 2573, 2580, 2582, 2632, 2639, 2708, 2724, 2758, 2801, 2819, 2867, 2903, 3022, 3238, 3296, 3372, 3381, 3479, 3578, 3598, 3682, 3723, 3787, 3954, 3961, 3978, 3993, 4062, 4086, 4150], 'amino': [45, 86, 278, 319, 1637, 1936, 4041], 'acids': [46, 279], 'conserved': [47, 280, 1737, 4046, 4076], 'between': [48, 281, 1619, 1642, 1738, 3629, 3734, 4047], 'different': [49, 282, 1435, 1717, 1739], 'β': [50, 283, 1623, 1770, 4050], 'domains,': [53, 286], 'identified': [55, 288, 4039], 'tryptophan': [57, 290, 1960], 'residue': [58, 291, 1938, 1980, 4058], 'at': [59, 84, 98, 292, 317, 331, 2717, 2889, 3007, 3013, 3271, 3437, 3573, 3741, 3907, 3957], 'position': [60, 293], '775': [61, 294, 1961], 'human': [63, 296, 2045, 2401, 2441, 2532, 4049, 4066, 4153], 'as': [66, 213, 299, 446, 664, 1280, 1967, 2267, 2546, 2775, 3511, 3626, 3672, 3731, 3739, 3771, 3799, 3862, 3990], 'and': [68, 101, 146, 193, 207, 301, 334, 379, 426, 440, 510, 517, 628, 645, 660, 667, 736, 807, 1211, 1404, 1432, 1491, 1644, 1661, 1697, 1908, 1911, 1971, 1976, 2009, 2103, 2106, 2146, 2155, 2159, 2170, 2178, 2183, 2186, 2188, 2200, 2202, 2212, 2233, 2257, 2377, 2521, 2599, 2680, 2704, 2706, 2726, 2737, 2743, 2749, 2773, 2803, 2813, 2845, 2875, 2909, 2997, 3026, 3043, 3077, 3101, 3119, 3162, 3178, 3203, 3232, 3255, 3274, 3308, 3375, 3408, 3420, 3445, 3475, 3520, 3533, 3548, 3562, 3589, 3609, 3635, 3641, 3749, 3845, 3883, 3889, 3913, 3922, 4054, 4096], 'necessary': [69, 302, 1970], 'for': [70, 217, 303, 450, 630, 1632, 1653, 1725, 1898, 1973, 2013, 2024, 2691, 2714, 2751, 2877, 2911, 2931, 3010, 3125, 3155, 3191, 3214, 3252, 3264, 3298, 3317, 3416, 3448, 3463, 3564, 3620, 3721, 3753, 3853, 3910, 4060, 4083], 'protein': [72, 141, 147, 305, 374, 380, 469, 473, 476, 483, 1090, 1200, 1373, 2191, 3725], 'kinase': [73, 206, 306, 439, 468, 470, 474, 484, 487, 669, 1091, 1201, 2162, 2192, 2206, 3430, 3490, 3497], 'B/Akt': [74, 307], 'survival': [75, 308, 631, 635, 814, 1088, 1952, 4032], 'signaling.': [76, 309, 1082, 1953], 'Stable': [77, 310], 'expression': [78, 311], 'a': [80, 106, 136, 214, 313, 339, 369, 447, 1198, 1415, 1615, 1735, 1746, 1752, 2004, 2011, 2471, 2493, 2614, 2630, 2643, 2732, 2809, 2881, 3165, 3206, 3341, 3347, 3525, 3627, 3649, 3664, 3673, 3785, 3944, 3950, 3958, 4008, 4084], 'mutated': [83, 316], 'this': [85, 160, 318, 393, 1081, 2041, 2649, 3302, 3480], 'acid': [87, 320, 495, 1937, 3470, 4042], 'in': [88, 93, 152, 166, 321, 326, 385, 399, 647, 812, 1411, 1658, 1950, 1962, 1986, 2339, 2361, 2470, 2504, 2593, 2682, 2684, 2849, 2949, 2965, 3038, 3064, 3130, 3151, 3180, 3235, 3246, 3261, 3293, 3324, 3402, 3422, 3567, 3600, 3694, 3896, 3901, 3920, 3965, 4016, 4064, 4137, 4146], 'GD25': [89, 322, 2487, 2671, 2934], 'β1-null': [90, 323, 2488], 'cells': [91, 109, 121, 324, 342, 354, 2576, 2672, 2696, 2728, 2746, 2762, 2805, 2935, 2960, 3110, 3142, 3175, 3290, 3305, 3460, 3509, 3555, 3579, 3599, 3765, 3836, 3861], 'resulted': [92, 131, 325, 364], 'reduction': [94, 327], 'Akt': [96, 130, 145, 180, 219, 329, 363, 378, 413, 452, 1096, 1196, 1284, 1370, 1493, 1974, 2002, 2025, 2161, 3489, 3496, 3517, 3549, 4024], 'phosphorylation': [97, 330, 1208, 1782, 3550, 3618], 'both': [99, 332, 1969], 'Ser473': [100, 333, 1212], 'Thr308': [102, 335, 1210], 'activation': [103, 199, 336, 432, 1288, 1975, 2707], 'sites.': [104, 337], 'As': [105, 338], 'consequence,': [107, 340], 'were': [110, 150, 343, 383, 2029, 2148, 2165, 2172, 2180, 2194, 2208, 2238, 2249, 2259, 2343, 2367, 2502, 2535, 2589, 2622, 2659, 2678, 2697, 2729, 2747, 2763, 2806, 2814, 2896, 2920, 2929, 2942, 2961, 3003, 3017, 3036, 3058, 3095, 3111, 3143, 3176, 3217, 3241, 3269, 3291, 3306, 3322, 3338, 3355, 3394, 3435, 3446, 3461, 3514, 3556, 3580, 3602, 3624, 3761, 3776, 3828, 3840, 3857, 3894, 3926, 3939, 3982], 'substantially': [111, 344], 'more': [112, 345], 'sensitive': [113, 346], 'serum': [115, 348, 2690, 2954, 3137, 3288, 3297, 3406, 3571, 3595], 'starvation-induced': [116, 349], 'apoptosis': [117, 350, 2638, 3285], 'when': [118, 351, 2926], 'compared': [119, 352], 'with': [120, 353, 649, 1434, 1586, 1650, 2424, 2475, 2538, 2606, 2661, 2686, 2699, 2720, 2740, 2765, 2770, 2808, 2816, 2864, 2880, 2900, 2951, 3079, 3113, 3116, 3121, 3146, 3183, 3197, 3243, 3257, 3276, 3312, 3340, 3346, 3411, 3452, 3466, 3473, 3537, 3559, 3585, 3591, 3607, 3648, 3687, 3702, 3718, 3744, 3778, 3784, 3842, 3847, 3943, 3970], 'expressing': [122, 355, 2577, 2618, 2673, 2936], 'wild': [123, 356, 2528, 2584], 'type': [124, 357, 2529, 2585], 'integrin.': [126, 173, 359, 406], 'This': [127, 360, 1979], 'inactivation': [128, 361, 1368], 'from': [132, 365, 2140, 2149, 2166, 2173, 2195, 2209, 2215, 2239, 2251, 2260, 2496, 2922, 3379, 3386, 3389, 3500, 3763, 3859], 'increased': [133, 366, 2637], 'dephosphorylation': [134, 367], 'by': [135, 170, 368, 403, 621, 1285, 1371, 1427, 2018, 2039, 2224, 2297, 2332, 2345, 2544, 2591, 2600, 2731, 3005, 3087, 3287, 3604, 3715, 3830, 3928, 3941], 'localized': [137, 370], 'active': [138, 371, 1205], 'population': [139, 372], 'phosphatase': [142, 148, 161, 375, 381, 394, 477, 1374, 1407, 3651, 3709, 3746], '2A.': [143, 376], 'Both': [144, 377], '2A': [149, 382, 478, 1375], 'present': [151, 384, 3484], 'β1integrin-organized': [153, 386], 'complexes,': [155, 388, 2760], 'activity': [158, 391, 657, 1992, 3491, 3547, 3645, 3677, 3693, 3728], 'was': [162, 395, 1359, 1946, 1981, 2139, 2214, 2221, 2265, 2294, 2329, 2492, 2710, 2862, 3366, 3483, 3492, 3518, 3535, 3646, 3670, 3678, 3697, 3713, 3729, 3797, 3887, 3918, 3968], '2.5': [163, 396, 2522], 'times': [164, 397, 2899, 3977], 'higher': [165, 398], 'complexes': [168, 401, 2008, 2723, 2800, 2861, 2895, 2928, 3032, 3696], 'organized': [169, 402], 'mutant': [172, 405, 2531, 2587, 2641], 'The': [174, 209, 407, 442, 2015, 2289, 2364, 2435, 2486, 2694, 2722, 2857, 2893, 3363, 3774, 3915, 3932], 'mutation': [175, 408, 1755, 2621], 'Trp775': [177, 212, 410, 445, 2019], 'specifically': [178, 411, 1948], 'affected': [179, 412, 2038], 'signaling,': [181, 414, 1930, 2026, 4019, 4026], 'without': [182, 415, 1914, 2855, 3200, 3310], 'effects': [183, 416, 1916], 'on': [184, 417, 1777, 1917, 2944, 2963, 3045, 3128, 3194, 3219, 3397, 3553, 3582, 3769, 3822, 3838, 4022], 'other': [185, 418, 2034, 2382], 'integrin-activated': [186, 419], 'pathways': [187, 420, 1729, 2037], 'including': [188, 421, 1902, 4090], 'phosphoinositide': [189, 422, 1292, 3833, 4001], '3-kinase,': [190, 423], 'MAPK,': [191, 424], 'JNK,': [192, 425], 'p38': [194, 427, 2185], 'nor': [195, 428], 'did': [196, 429], 'it': [197, 430, 1358, 1582], 'influence': [198, 431], 'integrin-responsive': [202, 435], 'kinases': [203, 436, 662], 'focal': [204, 437, 466, 1909, 4093], 'adhesion': [205, 438, 467, 646, 4094], 'Src.': [208, 441], 'identification': [210, 443, 1958], 'site': [216, 449, 1736, 4012], 'supports': [221, 454], 'concept': [223, 456], 'specificity': [225, 458, 1423], 'domain.': [232, 465], 'B': [471, 1092], '3-phosphoinositide-dependent': [472], '1': [475, 2715, 2817, 2838, 2846, 2901, 2972, 2974, 2987, 2998, 3329, 3467, 3854, 3911], 'platelet-derived': [479], 'growth': [480, 650], 'factor': [481], 'mitogen-activated': [482, 2190], 'c-Jun': [485, 2204], 'N-terminal': [486, 2205], 'phosphatidylinositol': [488], '3-kinase': [489, 1293, 3796], "Dulbecco's": [490, 2505], 'modified': [491, 2506], "Eagle's": [492, 2507], 'medium': [493, 2508, 2594, 3182, 3199, 3425], '1,4-piperazinediethanesulfonic': [494], 'fluorescence-activated': [496, 2603], 'cell': [497, 515, 624, 643, 817, 1087, 1912, 1977, 2490, 2604, 3172, 3209, 4031, 4097], 'sorting': [498], 'high': [499], 'pressure': [500], 'liquid': [501], 'chromatography': [502, 3821], 'sense': [506], 'extracellular': [508], 'environment': [509], 'convey': [511], 'bidirectional': [512], 'signals': [513], 'regulating': [514], 'behavior': [516], 'fate': [518], '(for': [519], 'recent': [520], 'reviews,': [521], 'see': [522], 'Refs.': [523, 671, 1439, 1665], '1Hynes': [524, 1666], 'R.O.': [525, 1667], 'Cell.': [526, 545, 878, 904, 939, 1301, 1347, 1390, 1668, 1842, 1881, 3808], '2002;': [527, 546, 566, 581, 597, 611, 679, 695, 710, 777, 794, 961, 981, 1323, 1392, 1569, 1669, 2126, 2563, 2792], '110:': [528, 1670], '673-687Abstract': [529, 1671], 'Full': [530, 532, 549, 551, 726, 728, 923, 925, 964, 966, 1326, 1328, 1452, 1454, 1572, 1574, 1672, 1674, 2281], 'Text': [531, 533, 550, 552, 727, 729, 924, 926, 965, 967, 1327, 1329, 1453, 1455, 1573, 1575, 1673, 1675, 2282], 'PDF': [534, 553, 730, 927, 968, 1330, 1456, 1576, 1676, 2283], 'PubMed': [535, 554, 569, 584, 600, 614, 682, 698, 713, 731, 746, 762, 780, 797, 841, 864, 883, 908, 928, 943, 969, 984, 1001, 1026, 1072, 1117, 1144, 1167, 1191, 1221, 1248, 1272, 1305, 1331, 1352, 1395, 1457, 1471, 1483, 1516, 1532, 1553, 1577, 1606, 1677, 1694, 1709, 1820, 1847, 1866, 1885, 2073, 2100, 2129, 2284, 2320, 2463, 2566, 2795, 3813, 3878, 4111, 4130], 'Scopus': [536, 555, 570, 585, 601, 615, 683, 699, 714, 732, 747, 763, 781, 798, 842, 865, 884, 909, 929, 944, 970, 985, 1002, 1027, 1073, 1118, 1145, 1168, 1192, 1222, 1249, 1273, 1306, 1332, 1353, 1396, 1458, 1472, 1484, 1517, 1533, 1554, 1578, 1607, 1678, 1710, 1821, 1848, 1886, 2074, 2285, 2321, 2464, 3814, 3879, 4112, 4131], '(6955)': [537, 1679], 'Google': [538, 557, 572, 587, 603, 617, 685, 701, 716, 734, 749, 765, 783, 800, 844, 867, 886, 911, 931, 946, 972, 987, 1004, 1029, 1054, 1075, 1120, 1147, 1170, 1194, 1224, 1251, 1275, 1308, 1334, 1355, 1398, 1460, 1474, 1486, 1519, 1535, 1556, 1580, 1609, 1680, 1695, 1712, 1800, 1823, 1850, 1867, 1888, 2076, 2101, 2130, 2287, 2323, 2466, 2567, 2796, 3816, 3881, 4114, 4133], 'Scholar,': [539, 558, 573, 588, 604, 686, 702, 717, 735, 750, 766, 784, 845, 868, 887, 912, 932, 947, 973, 988, 1005, 1030, 1055, 1121, 1148, 1171, 1225, 1252, 1309, 1335, 1461, 1475, 1520, 1536, 1557, 1681, 1696, 1801, 1824, 1851, 1868, 4115], '2Bokel': [540], 'C.': [541, 957, 1156, 1319], 'Brown': [542], 'N.H.': [543], 'Dev.': [544, 776, 1187], '3:': [547], '311-321Abstract': [548], '(314)': [556], '3Miranti': [559], 'C.K.': [560], 'Brugge': [561, 1344], 'J.S.': [562, 1345, 3802], 'Nat.': [563, 578, 676], 'Cell': [564, 579, 595, 634, 677, 693, 708, 721, 741, 757, 836, 859, 1021, 1067, 1478, 1601, 1689, 1704, 1795, 1861, 2124, 2167, 2458, 2561, 2790, 3501, 3759, 4106, 4125], 'Biol.': [565, 580, 596, 678, 694, 722, 742, 758, 837, 860, 879, 903, 918, 938, 959, 1022, 1068, 1300, 1321, 1348, 1391, 1567, 1705, 1843, 1880, 2459, 3809, 4107, 4126], '4:': [567, 582, 680], 'E83-E90Crossref': [568], '(696)': [571], '4Schwartz': [574, 672], 'M.A.': [575, 673, 719], 'Ginsberg': [576, 674, 1686], 'M.H.': [577, 675, 1687], 'E65-E68Crossref': [583, 681], '(682)': [586, 684], '5Damsky': [589, 687], 'C.H.': [590, 688, 834, 857], 'Ilic': [591, 689], 'D.': [592, 690, 822, 847, 896, 1100, 1227, 1254, 1874, 2275, 2308], 'Curr.': [593, 691, 739, 755, 773, 1702], 'Opin.': [594, 692, 740, 756, 774, 1703], '14:': [598, 696], '594-602Crossref': [599, 697], '(146)': [602, 700], '6Juliano': [605], 'R.L.': [606, 772, 790, 936, 977, 1298], 'Annu.': [607], 'Rev.': [608, 792], 'Pharmacol.': [609], 'Toxicol.': [610], '42:': [612], '283-323Crossref': [613], '(502)': [616], 'Scholar).': [618, 801, 1195, 1276, 1356, 1399, 1487, 1713, 1889, 2131, 2288, 2324, 2467, 2568, 2797, 3817], 'Signals': [619], 'transmitted': [620], 'integrins': [622, 2047, 2534, 2588, 2677, 2709, 2941, 4155], 'regulate': [623, 1366, 1989], 'migration,': [625], 'growth,': [626], 'differentiation,': [627], 'decisions': [629], 'or': [632, 652, 2530, 2586, 2663, 2675, 2915, 2939, 3083, 3279, 3639, 3783, 3791, 4011], 'death.': [633], 'can': [636, 1278, 1364, 1489, 1583], 'be': [637, 1743, 1984, 2022, 4014, 4081], 'regulated': [638, 1426], 'through': [639], 'modulation': [641], 'shape': [644], 'cooperation': [648], 'factors': [651], 'control': [654], 'tyrosine': [659], 'serine/threonine': [661], 'such': [663, 1750], 'FAK,1': [665], 'Src,': [666], 'integrin-linked': [668], '(see': [670, 1438, 1664], '7Stupack': [703], 'D.G.': [704, 1057], 'Cheresh': [705, 1064], 'D.A.': [706, 1065, 1685], 'J.': [707, 835, 858, 898, 917, 953, 955, 958, 1020, 1066, 1160, 1179, 1268, 1315, 1317, 1320, 1378, 1388, 1465, 1467, 1528, 1566, 1591, 1688, 1794, 1860, 2094, 2095, 2123, 2310, 2457, 2560, 2789, 3874, 4105, 4124], 'Sci.': [709, 1110, 1448, 1509, 1546, 1690, 1796, 1813, 1862, 2125, 2562, 2791], '115:': [711, 2127, 2564, 2793], '3729-3738Crossref': [712], '(514)': [715], '8Schwartz': [718], 'Trends': [720, 1446], '2001;': [723, 759, 920, 998, 1069, 1468, 1480, 1797, 1817], '11:': [724, 906, 941, 1189, 1303, 1883], '466-470Abstract': [725], '(301)': [733], '9Dedhar': [737], 'S.': [738, 855, 872, 1015, 1036, 1061, 1112, 1443, 1511, 1538, 1548, 1595, 1683, 1701, 1815, 1840, 1859, 1872, 2088, 2448], '2000;': [743, 838, 880, 905, 940, 1051, 1302, 1550, 1603, 1691, 1844, 1882], '12:': [744, 778], '250-256Crossref': [745], '(196)': [748], '10Frisch': [751], 'S.M.': [752], 'Screaton': [753], 'R.A.': [754, 1135, 2306], '13:': [760, 1481], '555-562Crossref': [761], '(1180)': [764], '11Howe': [767], 'A.K.': [768], 'Aplin': [769], 'A.E.': [770, 996], 'Juliano': [771, 789, 935, 976, 1297], 'Genet.': [775], '30-35Crossref': [779], '(249)': [782], '12Alahari': [785], 'S.K.': [786, 2065], 'Reddig': [787], 'P.J.': [788, 1216], 'Int.': [791], 'Cytol.': [793], '220:': [795], '145-184Crossref': [796], '(64)': [799], 'A': [802], 'variety': [803, 1417, 4085], 'heterodimers': [806], 'mechanisms': [808], 'have': [809, 1774, 1891], 'been': [810], 'implicated': [811], 'various': [816], 'types': [818], '(13Almeida': [819], 'E.A.C.': [820], 'Ili': [821], 'Han': [823, 1502], 'Q.': [824, 4119], 'Hauck': [825], 'C.R.': [826, 1559, 3870], 'Jin': [827], 'F.': [828, 1241, 2082], 'Kawakatsu': [829], 'H.': [830, 1034, 1123, 2112, 2450, 2549, 2778], 'Schlaepfer': [831, 850], 'D.D.': [832, 851], 'Damsky': [833, 856], '149:': [839], '741-754Crossref': [840], '(337)': [843], '14Ilic': [846], 'Almeida': [848], 'E.A.': [849], 'Dazin': [852], 'P.': [853, 1152, 1158, 1260, 1264, 1499], 'Aizawa': [854], '1998;': [861, 1529, 1863, 4127], '143:': [862], '547-560Crossref': [863], '(437)': [866], '15Danilkovitch': [869], 'A.': [870, 874, 1011, 1032, 1113, 1150, 1181, 1512, 1549, 1816, 1828, 2086, 2090, 2314, 4100, 4104], 'Donley': [871], 'Skeel': [873], 'Leonard': [875], 'E.J.': [876], 'Mol.': [877, 902, 937, 1299, 1346, 1389, 1841, 1879, 3807], '20:': [881, 999, 1845], '2218-2227Crossref': [882], '(99)': [885], '16Le': [888], 'Gall': [889], 'M.': [890, 1038, 1256, 1495, 1524, 1561, 1597, 1832, 2080, 2312], 'Chambard': [891], 'J.C.': [892], 'Breittmayer': [893], 'J.P.': [894, 1789], 'Grall': [895], 'Pouyssegur': [897], 'Van': [899], 'Obberghen-Schilling': [900], 'E.': [901, 916, 1154, 1477, 2456], '1103-1112Crossref': [907], '(156)': [910], '17Matter': [913], 'M.L.': [914], 'Ruoslahti': [915, 2334, 2455], 'Chem.': [919, 960, 1322, 1568], '276:': [921], '27757-27763Abstract': [922], '(209)': [930], '18Lee': [933], 'J.W.': [934, 975, 1296], '1973-1987Crossref': [942, 1304], '(143)': [945, 1307], '19Tian': [948, 1310], 'B.': [949, 1258, 1266, 1311, 1857, 2118, 2555, 2784], 'Lessan': [950, 1312], 'K.': [951, 1313, 1593, 1826, 1853, 2452], 'Kahm': [952, 1314], 'Kleidon': [954, 1316], 'Henke': [956, 1318], '277:': [962, 1246, 1324, 1570], '24667-24675Abstract': [963, 1325], '(138)': [971, 1333], '20Lee': [974], 'Biochim.': [978], 'Biophys.': [979], 'Acta.': [980], '1542:': [982], '23-31Crossref': [983], '(51)': [986, 1003], '21Kozlova': [989], 'N.I.': [990], 'Morozevich': [991], 'G.E.': [992], 'Chubukina': [993], 'A.N.': [994, 2061], 'Berman': [995], 'Oncogene.': [997], '4710-4717Crossref': [1000], '22Bachelder': [1006], 'R.E.': [1007], 'Ribick': [1008], 'M.J.': [1009, 1129, 2067], 'Marchetti': [1010], 'Falcioni': [1012], 'R.': [1013, 1131, 1522, 1805, 1807, 1834, 1855, 2114, 2551, 2780, 4121], 'Soddu': [1014], 'Davis': [1016], 'K.R.': [1017], 'Mercurio': [1018], 'A.M.': [1019], '1999;': [1023, 1449], '147:': [1024], '1063-1072Crossref': [1025], '(160)': [1028], '23Erdreich-Epstein': [1031], 'Shimada': [1033], 'Groshen': [1035], 'Liu': [1037], 'Metelitsa': [1039], 'L.S.': [1040], 'Kim': [1041], 'K.S.': [1042], 'Stins': [1043], 'M.F.': [1044], 'Seeger': [1045], 'R.C.': [1046], 'Durden': [1047], 'D.L.': [1048], 'Cancer': [1049, 2303], 'Res.': [1050, 1602, 2277], '60:': [1052], '712-721PubMed': [1053], '24Stupack': [1056], 'Puente': [1058], 'X.S.': [1059], 'Boutsaboualoy': [1060], 'Storgard': [1062], 'C.M.': [1063], '155:': [1070], '459-470Crossref': [1071], '(443)': [1074], 'Scholar),': [1076, 1610, 2077, 2102, 3882, 4134], 'indicating': [1077], 'complexity': [1079], 'An': [1083], 'important': [1084, 4082], 'effector': [1085], '(PKB),': [1093], 'also': [1094, 1365, 1584, 1999], 'called': [1095], '(25Songyang': [1097], 'Z.': [1098], 'Baltimore': [1099], 'Cantley': [1101], 'L.C.': [1102], 'Kaplan': [1103, 1136], 'D.R.': [1104, 1137], 'Franke': [1105, 1126], 'T.F.': [1106, 1127], 'Proc.': [1107, 1506, 1543, 1810], 'Natl.': [1108, 1507, 1544, 1811], 'Acad.': [1109, 1508, 1545, 1812], 'U.': [1111, 1510, 1547, 1814], '1997;': [1114, 1141, 1164, 1188, 1245, 1349], '94:': [1115], '11345-11350Crossref': [1116], '(323)': [1119], '26Dudek': [1122], 'Datta': [1124], 'S.R.': [1125], 'Birnbaum': [1128], 'Yao': [1130], 'Cooper': [1132], 'G.M.': [1133], 'Segal': [1134], 'Greenberg': [1138], 'M.E.': [1139], 'Science.': [1140, 1244], '275:': [1142], '661-665Crossref': [1143], '(2222)': [1146], '27Kauffmann-Zeh': [1149], 'Rodriguez-Viciana': [1151], 'Ulrich': [1153], 'Gilbert': [1155], 'Coffer': [1157, 1215], 'Downward': [1159], 'Evan': [1161], 'G.': [1162], 'Nature.': [1163, 1217], '385:': [1165], '544-548Crossref': [1166], '(1075)': [1169], '28Kennedy': [1172], 'S.G.': [1173], 'Wagner': [1174], 'A.J.': [1175], 'Conzen': [1176], 'S.D.': [1177, 2116, 2553, 2782], 'Jordan': [1178], 'Bellacosa': [1180], 'Tsichlis': [1182, 1342], 'P.N.': [1183, 1343], 'Hay': [1184], 'N.': [1185, 1262, 1382, 1540], 'Genes': [1186], '701-713Crossref': [1190], '(980)': [1193], 'Ser/Thr': [1199, 1406, 3650], 'becomes': [1203, 2646], 'fully': [1204], 'after': [1206, 2628, 2648, 3442, 3551, 3612, 3680, 3699, 3766], 'dual': [1207], '(29Burgering': [1213], 'B.M.': [1214], '1995;': [1218, 1706, 2070], '376:': [1219], '599-602Crossref': [1220], '(1884)': [1223], '30Stokoe': [1226], 'Stephens': [1228], 'L.R.': [1229], 'Copeland': [1230], 'T.': [1231, 1497, 1542, 1791, 1803, 1830, 2084, 2092, 4117], 'Gaffney': [1232], 'P.R.': [1233], 'Reese': [1234], 'C.B.': [1235], 'Painter': [1236], 'G.F.': [1237], 'Holmes': [1238], 'A.B.': [1239], 'McCormick': [1240], 'Hawkins': [1242], 'P.T.': [1243], '567-570Crossref': [1247], '(1054)': [1250], '31Alessi': [1253], 'Andjelkovic': [1255], 'Caudwell': [1257], 'Cron': [1259, 1498], 'Morrice': [1261], 'Cohen': [1263], 'Hemmings': [1265, 1444, 1504, 1525], 'EMBO': [1267, 1527], '1996;': [1269, 1513], '15:': [1270], '6541-6551Crossref': [1271], '(2530)': [1274], 'Integrins': [1277], 'act': [1279], 'positive': [1281, 2633], 'modulators': [1282], 'stimulating': [1286], 'its': [1287, 3521], 'pathway': [1289], 'involving': [1290], 'upstream': [1291], '(PI3K)': [1294], '(18Lee': [1295], '32King': [1336], 'W.G.': [1337], 'Mattaliano': [1338], 'M.D.': [1339, 2454], 'Chan': [1340], 'T.O.': [1341], '17:': [1350, 1530], '4406-4418Crossref': [1351], '(387)': [1354], 'Recently,': [1357], 'shown': [1360], 'an': [1362, 1402, 1935, 3156, 3495, 3971, 4056], 'affecting': [1372], '(PP2A)': [1376], '(33Ivaska': [1377], 'Nissinen': [1379], 'L.': [1380, 1599, 1870], 'Immonen': [1381], 'Eriksson': [1383], 'J.E.': [1384], 'Kahari': [1385], 'V.M.': [1386], 'Heino': [1387], '22:': [1393], '1352-1359Crossref': [1394], '(154)': [1397], 'PP2A': [1400, 1488, 1994, 2916, 3481, 3644, 3676, 3692, 3724, 3727, 3754], 'abundant': [1403], 'ubiquitous': [1405], 'involved': [1410, 1949, 1985, 4015], 'regulation': [1413, 1726, 1928], 'wide': [1416], 'cellular': [1419, 1900], 'activities.': [1420], 'Its': [1421], 'substrate': [1422, 2012], 'tightly': [1425], 'subunit': [1428, 1625, 3686], 'composition,': [1429], 'post-translational': [1430], 'modifications,': [1431], 'association': [1433], 'intracellular': [1436], 'components': [1437], '34Millward': [1440], 'T.A.': [1441], 'Zolnierowicz': [1442], 'B.A.': [1445, 1505, 1526], 'Biochem.': [1447, 1466, 3873], '24:': [1450], '186-191Abstract': [1451], '(713)': [1459], '35Janssens': [1462], 'V.': [1463], 'Goris': [1464], '353:': [1469], '417-439Crossref': [1470], '(1549)': [1473], '36Sontag': [1476], 'Signal.': [1479], '7-16Crossref': [1482], '(289)': [1485], 'dephosphorylate': [1490], 'inactivate': [1492], '(37Andjelkovic': [1494], 'Jakubowicz': [1496], 'Ming': [1500], 'X.-F.': [1501], 'J.-W.': [1503], '93:': [1514], '5699-5704Crossref': [1515], '(431)': [1518], '38Meier': [1521], 'Thelen': [1523], '7294-7303Crossref': [1531], '(149)': [1534], '39Sato': [1537], 'Fujita': [1539], 'Tsuruo': [1541], '97:': [1551], '10832-10837Crossref': [1552], '(846)': [1555], '40Yellaturu': [1558], 'Bhanoori': [1560], 'Neeli': [1562], 'I.': [1563, 2363], 'Rao': [1564], 'G.N.': [1565], '40148-40155Abstract': [1571], '(114)': [1579], 'Scholar);': [1581], 'associate': [1585], '(41Mulrooney': [1590], 'Foley': [1592], 'Vineberg': [1594], 'Barreuther': [1596], 'Grabel': [1598, 1792], 'Exp.': [1600], '258:': [1604], '332-341Crossref': [1605], '(48)': [1608], 'suggesting': [1611], 'possibility': [1613], 'close': [1616], 'spatial/functional': [1617], 'relationship': [1618], 'these': [1620, 1896, 2007, 3541, 4138], 'molecules.': [1621], 'Although': [1622], 'domains': [1627, 1773], 'relatively': [1629, 1947], 'short': [1630], '(except': [1631], 'β4,': [1633], 'which': [1634, 4027], '1000': [1636], 'acids,': [1638], 'rest': [1640], 'range': [1641], '46': [1643], '70': [1645], 'residues),': [1646], 'saturated': [1649], 'binding': [1651], 'sites': [1652, 1783], 'proteins': [1655], 'participate': [1657], 'cytoskeletal': [1662], 'interactions': [1663, 1987, 2016], '42Liu': [1682], 'Calderwood': [1684], '113:': [1692], '3563-3571Crossref': [1693], '43Yamada': [1698], 'K.M.': [1699, 2122, 2559, 2788], 'Miyamoto': [1700], '7:': [1707], '681-689Crossref': [1708], '(589)': [1711], 'We': [1714, 1998, 4037, 4071], 'hypothesized': [1715], 'within': [1719, 1939, 1995, 2400, 2440], 'tail': [1722, 1787], 'essential': [1724], 'distinct': [1728], 'signal': [1731, 3752, 4143], 'transduction.': [1732], 'In': [1733, 3456, 3661], 'fact,': [1734], 'subunits': [1741], 'might': [1742, 4013], 'dedicated': [1744], 'unique': [1747], 'pathway,': [1749], 'would': [1756], 'affect': [1757, 4142], 'only': [1758], 'one': [1759], 'out': [1760], 'many': [1762], 'Previous': [1766], 'mutational': [1767], 'studies': [1768], 'focused': [1775, 4021], 'mainly': [1776], 'possible': [1779], 'roles': [1780], '(44Mulrooney': [1788], 'Hong': [1790], 'L.B.': [1793], '114:': [1798], '2525-2533PubMed': [1799], '45Sakai': [1802], 'Jove': [1804], 'Fassler': [1806, 1833, 1854, 4120], 'Mosher': [1808, 1837, 4122], 'D.F.': [1809, 1838, 4123], '98:': [1818], '3808-3813Crossref': [1819], '(65)': [1822], '46Wennerberg': [1825], 'Armulik': [1827], 'Sakai': [1829], 'Karlsson': [1831], 'Schaefer': [1835], 'E.M.': [1836], 'Johansson': [1839, 1858], '5758-5765Crossref': [1846], '(79)': [1849], '47Wennerberg': [1852], 'Warmegard': [1856], '111:': [1864], '1117-1126Crossref': [1865], '48Levy': [1869], 'Broad': [1871], 'Diekmann': [1873], 'Evans': [1875], 'R.D.': [1876], 'Watt': [1877], 'F.M.': [1878], '453-466Crossref': [1884], '(133)': [1887], 'They': [1890], 'documented': [1892], 'importance': [1894], 'residues': [1897, 2399, 2439, 3530, 4043], 'basic': [1899, 4087], 'processes': [1901], 'adhesion,': [1903], 'organization': [1904], 'cytoskeleton': [1907], 'adhesions,': [1910], 'migration': [1913, 4098], 'identifying': [1915], 'To': [1921, 4003], 'our': [1923, 4005], 'site-specific': [1926], 'tried': [1932], 'identify': [1934, 2032], 'report': [1956], 'β1integrin': [1964, 3187], 'being': [1968], 'survival.': [1978], 'found': [1982, 2000], 'local': [1991], 'integrin-organized': [1996], 'complexes.': [1997], 'constituent': [2005], 'PP2A.': [2014, 2933], 'mediated': [2017], 'appear': [2020], 'since': [2027], 'unable': [2030], 'any': [2033, 2381], 'mutating': [2040], 'residue.': [2042], 'Antibodies': [2043, 2142], 'included': [2048], 'rat': [2049], 'monoclonal': [2050, 2055], 'antibody': [2051, 2108, 2135, 2137, 2220, 2610, 2772, 3188, 3689, 3705, 3782], '9EG7': [2052], '(Pharmingen),': [2053], 'mouse': [2054], 'antibodies': [2056, 2158, 2237, 2665, 3025, 3124, 3150, 3268, 3539, 3611, 3638, 3720], '12G10': [2057], '(49Mould': [2058], 'A.P.': [2059], 'Garratt': [2060], 'Askari': [2062], 'J.A.': [2063], 'Akiyama': [2064], 'Humphries': [2066], 'FEBS': [2068], 'Lett.': [2069], '363:': [2071], '118-122Crossref': [2072], '(125)': [2075], 'TS2/16': [2078, 2662], '(50Hemler': [2079], 'Sanchez-Madrid': [2081], 'Flotte': [2083], 'Krensky': [2085], 'Burakoff': [2087], 'Bhan': [2089], 'Springer': [2091], 'Strominger': [2093], 'Immunol.': [2096], '1984;': [2097], '132:': [2098], '3011-3018Crossref': [2099], 'K20': [2104, 2611, 2664, 2771, 3189], '(Immunotech),': [2105], 'rabbit': [2107, 2218], 'Rab': [2109], '4080': [2110], '(51Tran': [2111, 2548, 2777], 'Pankov': [2113, 2550, 2779], 'Tran': [2115, 2552, 2781], 'Hampton': [2117, 2554, 2783], 'Burgess': [2119, 2556, 2785], 'W.H.': [2120, 2557, 2786], 'Yamada': [2121, 2558, 2787], '2031-2040Crossref': [2128, 2565, 2794], 'Anti-mouse': [2132], 'α5': [2133], '(monoclonal': [2136], '1928)': [2138], 'Chemicon.': [2141], 'against': [2143, 3540], 'actin,': [2144], 'tubulin,': [2145], 'vinculin': [2147], 'Sigma;': [2150], 'anti-total': [2151, 2156, 2184, 2189, 2203, 3636], 'Akt,': [2152], 'anti-phospho-Akt,': [2153], 'anti-phospho-PDK1,': [2154], 'PDK1': [2157], 'assay': [2163, 3498, 3652, 3747], 'kit': [2164, 2350, 3499, 3653, 3748], 'Signaling;': [2168], 'anti-PP2A': [2169, 3688, 3719], 'anti-phospho-FKHRL1': [2171], 'Upstate': [2174], 'Biotechnology,': [2175], 'Inc.;': [2176], 'anti-phospho-FAK': [2177], 'anti-phospho-Src': [2179], 'fromBioSource;': [2181], 'anti-phospho-': [2182, 2187, 2201], '(MAPK)': [2193], 'New': [2196], 'England': [2197], 'Biolabs;': [2198], 'anti-Bcl-2': [2199], '(JNK)': [2207], 'Santa': [2210], 'Cruz;': [2211], 'anti-α-actinin': [2213], 'ICN.': [2216], 'Anti-talin': [2217], 'polyclonal': [2219], 'generously': [2222, 2295], 'provided': [2223, 2296, 2331], 'Dr.': [2225, 2298], 'Keizo': [2226], 'Takenaga': [2227], '(NIDCR,': [2228], 'NIH,': [2229], 'Bethesda,': [2230], 'MD).': [2231], 'Cy3-': [2232], 'fluorescein': [2234, 3147, 3184, 3280], 'isothiocyanate-conjugated': [2235, 3148, 3185, 3281], 'secondary': [2236, 3090, 3149, 3277], 'Jackson': [2240], 'ImmunoResearch': [2241], 'Laboratories.': [2242], 'Sheep': [2243, 2651], 'anti-mouse': [2244, 2652], 'magnetic': [2245, 2654, 2733, 2811], 'microbeads': [2246], '(4.5': [2247, 2656], 'μm)': [2248], 'purchased': [2250], 'Dynal.': [2252], 'Okadaic': [2253], 'acid,': [2254], 'AG1433,': [2255], 'PD98059,': [2256], 'UO126': [2258], 'Calbiochem.': [2261], 'Human': [2262, 2325], 'plasma': [2263], 'fibronectin': [2264, 3220, 3588, 3770, 3839], 'purified': [2266], 'previously': [2268, 3863], 'described': [2269, 2547, 2776, 3512, 3772, 3800, 3864], '(52Miekka': [2270], 'S.I.': [2271], 'Ingham': [2272], 'K.C.': [2273, 3806], 'Menache': [2274], 'Thromb.': [2276], '1982;': [2278], '27:': [2279], '1-14Abstract': [2280], '(246)': [2286], 'pHA262pur': [2290, 2543], 'puromycin': [2291, 2540, 2598], 'resistance': [2292], 'plasmid': [2293], 'Hein': [2299], 'te': [2300], 'Riele': [2301], '(Netherlands': [2302], 'Institute)': [2304], '(53Lacalle': [2305], 'Pulido': [2307], 'Vara': [2309], 'Zalacain': [2311], 'Jimenez': [2313], 'Gene': [2315], '(Amst.).': [2316], '1989;': [2317], '79:': [2318], '375-380Crossref': [2319], '(49)': [2322], 'β1A': [2326, 2533], 'cDNA': [2328, 2342, 2404, 2444], 'kindly': [2330], 'Erkki': [2333], '(Burnham': [2335], 'Institute).': [2336], 'Point': [2337], 'mutations': [2338, 2376, 4136], 'introduced': [2344, 2384], 'QuikChangeTM': [2347], 'site-directed': [2348], '(Stratagene)': [2351], 'according': [2352, 2666, 3503, 3656, 3755], "manufacturer's": [2355, 2669, 3506, 3659], 'protocol': [2356], 'using': [2357, 3019, 3097, 3164, 3205, 3357, 3494, 3633, 3949, 3984], 'primers': [2359, 2388], 'listed': [2360], 'Table': [2362], 'resulting': [2365], 'constructs': [2366], 'sequenced': [2368], 'confirm': [2370], 'presence': [2372], 'desired': [2375], 'absence': [2379, 3237, 3295], 'alterations': [2383], 'during': [2385], 'manipulation.Table': [2386], 'IOligonucleotide': [2387], 'used': [2389, 2623, 3270, 3367, 3671], 'mutantsMutantOligonucleotide': [2394], 'sequencePositions1-aThe': [2395], 'numbers': [2396, 2436, 3577], 'correspond': [2397, 2437], '(91).L754AFW:': [2405], 'GCATTACTGCTGATATGGAAGCTTGCAATGATAATTCATGACAGAAG2339–2385RV:': [2406], 'CTTCTGTCATGAATTATCATTGCAAGCTTCCATATCAGCAGTAATGC2385–2339D759AFW:': [2407], 'GAAGCTTTTAATGATAATTCATGCCAGAAGGGAGTTTGC2356–2394RV:': [2408], 'GCAAACTCCCTTCTGGCATGAATTATCATTAAAAGCTTC2394–2356R760AFW:': [2409], 'CTTTTAATGATAATTCATGACGCAAGGGAGTTTGCTAAATTTG2360–2402RV:': [2410], 'CAAATTTAGCAAACTCCCTTGCGTCATGAATTATCATTAAAAG2402–2360E762AFW:': [2411], 'GATAATTCATGACAGAAGGGCGTTTGCTAAATTTGAAAAGGAG2368–2410RV:': [2412], 'CTCCTTTTCAAATTTAGCAAACGCCCTTCTGTCATGAATTATC2410–2368F766AFW:': [2413], 'CATGACAGAAGGGAGTTTGCTAAAGCTGAAAAGGAGAAAATG2375–2416RV:': [2414], 'CATTTTCTCCTTTTCAGCTTTAGCAAACTCCCTTCTGTCATG2416–2375E767AFW:': [2415], 'GACAGAAGGGAGTTTGCTAAATTTGCAAAGGAGAAAATGAATGCC2378–2422RV:': [2416], 'GGCATTCATTTTCTCCTTTGCAAATTTAGCAAACTCCCTTCTGTC2422–2378E769AFW:': [2417], 'GAGTTTGCTAAATTTGAAAAGGCGAAAATGAATGCCAAATGG2387–2428RV:': [2418], 'CCATTTGGCATTCATTTTCGCCTTTTCAAATTTAGCAAACTC2428–2387W775AFW:': [2419], 'GAGAAAATGAATGCCAAAGCGGACACGGGTGAAAATCC2408–2445RV:': [2420], 'GGATTTTCACCCGTGTCCGCTTTGGCATTCATTTTCTC2445–2408T789AFW:': [2421], 'CCTATTTATAAGAGTGCCGTAACAGCTGTGGTCAATCCGAAGTATGAG2444–2491RV:': [2422], 'CTCATACTTCGGATTGACCACAGCTGTTACGGCACTCTTATAAATAGG2491–2444Mismatches': [2423], 'template': [2426, 2477], 'underlined.': [2428, 2479], 'FW,': [2429, 2480], 'forward': [2430, 2481], 'primer;': [2431, 2482], 'RV,': [2432, 2483], 'reverse': [2433, 2484], 'primer.1-a': [2434], '(91Argraves': [2445], 'W.S.': [2446], 'Suzuki': [2447], 'Arai': [2449], 'Thompson': [2451], 'Pierschbacher': [2453], '1987;': [2460], '105:': [2461], '1183-1190Crossref': [2462], '(386)': [2465], 'Open': [2468], 'table': [2469], 'new': [2472], 'tab': [2473], 'Mismatches': [2474], 'primer.': [2485], 'fibroblast': [2489], 'line': [2491], 'generous': [2494], 'gift': [2495], 'Reinhard': [2497], 'Fässler': [2498], '(Lund': [2499], 'University).': [2500], 'Cells': [2501, 2617, 3213, 3393], 'cultured': [2503, 3233, 3292, 3395, 3421, 3510], '(DMEM)': [2509], 'containing': [2510, 2595, 2859, 2871, 2907, 2994, 3249, 3328, 3426, 3529, 3935], '10%': [2511, 2980], 'fetal': [2512], 'bovine': [2513, 2688, 2953, 3136, 3405, 3570, 3594], 'serum,': [2514], '100': [2515, 2518], 'units/ml': [2516], 'penicillin,': [2517], 'μg/ml': [2519, 2523, 2597, 3273, 3587], 'streptomycin,': [2520], 'fungizone.': [2524], 'Plasmid': [2525], 'DNAs': [2526], 'encoding': [2527], 'co-transfected': [2536], 'together': [2537], 'selection': [2541, 2592], 'vector': [2542], 'electroporation': [2545], 'Pools': [2569], 'mixed': [2571, 2698, 2764], 'populations': [2572], 'stable': [2574], 'transfectant': [2575], 'comparable': [2578], 'levels': [2579, 3619], 'each': [2581, 3380, 3621, 3711, 3999, 4061], 'established': [2590], '10': [2596, 2627, 2850, 2878, 3272, 3947], 'four': [2601], 'consecutive': [2602], 'sortings': [2605], 'anti-human': [2607, 3186], 'performed': [2612], 'over': [2613], '3-month': [2615], 'period.': [2616], 'W775A': [2620, 2676, 2940], 'up': [2624], 'passage': [2626], 'establishing': [2629], 'pool': [2631], 'cells.': [2634], 'Due': [2635], 'transfectant,': [2642], 'β1integrin-negative': [2644], 'subpopulation': [2645], 'detectable': [2647], 'passage.': [2650], 'IgG': [2653], 'beads': [2655, 2701, 2725, 2766, 2802, 3035], 'μm;': [2657], 'Dynal)': [2658], 'coated': [2660, 2769], 'instructions.': [2670], 'β1WT': [2674], 'trypsinized': [2679, 3174], 'serum-starved': [2681, 2761, 3764, 3835], 'suspension': [2683, 3601], 'DMEM': [2685, 2950, 3844], '1%': [2687, 2952, 2977, 3404, 3569, 3592], 'calf': [2689], '3': [2692, 2829, 3265], 'h.': [2693, 3300, 3855], 'serum-deprived': [2695], 'TS2/16-coated': [2700], '(5': [2702, 2947, 3221, 3400], 'beads/cell),': [2703], 'clustering': [2705], 'allowed': [2711], 'continue': [2713], 'h': [2716], '37': [2718, 3574], '°C': [2719, 3909], 'rotation.': [2721], 'bound': [2727, 2804, 3033], 'collected': [2730, 3436], 'particle': [2734], 'concentrator': [2735, 2812], '(Dynal)': [2736], 'washed': [2738, 2815, 2897, 3115, 3160, 3177, 3196, 3558, 3841], 'once': [2739], 'phosphate-buffered': [2741, 3247, 3262], 'saline,': [2742, 3134], 'then': [2744, 3409], 'lysed': [2748], 'prepared': [2750, 2910, 2930, 3447], 'Western': [2752, 2912, 3449, 3605, 3716, 3757], 'blot': [2753, 2913, 3450], 'analysis.': [2754], 'For': [2755, 3107, 3171, 3283, 3544, 3832], 'isolation': [2757, 3701], 'integrin-based': [2759, 2927, 3695], '(five': [2767], 'beads/cell)': [2768], 'processed': [2774], 'Briefly,': [2798, 3508], 'isolated': [2807], 'Dynal': [2810], 'ml': [2818, 2866, 2902], 'cold': [2820, 2868, 2904], 'CSK': [2821, 2869, 2905, 2924], 'buffer': [2822, 2870, 2906, 2925, 2968, 3042, 3132, 3154], '(50': [2823], 'mm': [2824, 2827, 2830, 2839, 2843, 2851, 2970, 2975, 2983, 2988, 2992, 2999, 3066, 3069], 'NaCl,': [2825, 2971, 3067], '300': [2826], 'sucrose,': [2828], 'MgCl2,': [2831, 2976], 'protease': [2832, 2995], 'inhibitor': [2833, 3431, 3482], 'mixture': [2834, 3786], '(Roche': [2835], 'Applied': [2836], 'Science),': [2837], 'sodium': [2840, 2989], 'vanadate,': [2841, 2990], '50': [2842, 2887, 2991, 3068], 'NaF,': [2844], 'mmphenylmethylsulfonyl': [2847], 'fluoride': [2848], 'PIPES,': [2852], 'pH': [2853, 2985, 3075], '6.8)': [2854], 'detergent.': [2856], 'pellet': [2858], 'cell-bead': [2860], 'extracted': [2863, 3858], '0.5': [2865, 3848], '0.5%': [2872, 3135, 3258], 'Triton': [2873, 3259], 'X-100': [2874, 3260], 'sonicated': [2876], 's': [2879], '50-watt': [2882], 'ultrasonic': [2883], 'processor': [2884], '(model': [2885], 'GE': [2886], 'set': [2888], 'amplitude': [2890], '20;': [2891], 'Aldrich).': [2892], 'bead-protein': [2894], 'five': [2898], 'detergent': [2908], 'analysis': [2914, 3216, 3451], 'assay.': [2917], 'Phosphatase': [2918], 'inhibitors': [2919, 2996], 'omitted': [2921, 4072], 'assaying': [2932, 3284, 3545], 'WT': [2938], 'plated': [2943, 3218, 3581, 3837], 'fibronectin-coated': [2945, 3398], 'dishes': [2946, 3399, 3583], 'μg/ml)': [2948, 3222, 3401], 'albumin.': [2955, 3596], 'After': [2956, 3050, 3301, 3707, 3818], 'overnight': [2957, 3234, 3396, 3767], 'incubation,': [2958], 'solubilized': [2962, 3037], 'ice': [2964, 3129], 'Nonidet': [2966, 2978], 'P-40': [2967], '(137': [2969], 'mmCaCl2,': [2973], 'P-40,': [2979], 'glycerol,': [2981], '20': [2982, 3253, 3412], 'Tris-HCl,': [2984], '8.0,': [2986], 'NaF)': [2993], 'phenylmethylsulfonyl': [3000], 'fluoride.': [3001], 'Homogenates': [3002, 3597], 'clarified': [3004], 'centrifugation': [3006], '20,000': [3008], '×g': [3009], '15': [3011, 3417, 3464], 'min': [3012, 3127, 3193, 3254, 3465, 3566], '4': [3014, 3020], '°C.': [3015, 3575], 'Immunoprecipitates': [3016], 'obtained': [3018, 3339, 3356, 3388, 3632, 3762], 'μg': [3021], 'indicated': [3024, 3081, 3123, 3439, 3614], 'GammaBindTMPlus': [3027], 'SepharoseTM': [3028], '(Amersham': [3029, 3105, 3851], 'Biosciences).': [3030, 3106, 3170, 3212], 'Protein': [3031], 'reducing': [3039], 'SDS-PAGE': [3040], 'sample': [3041, 3712], 'resolved': [3044], '4–12%': [3046], 'gradient': [3047, 3953], 'gels': [3048], '(Novex).': [3049], 'electrotransfer': [3051], 'nitrocellulose': [3053], 'membranes': [3054], '(Novex),': [3055], 'filters': [3057], 'blocked': [3059, 3590], '(5%': [3060], 'nonfat': [3061], 'dry': [3062], 'milk': [3063], '150': [3065], 'Tris': [3070], 'HCl,': [3071], '0.1%': [3072], 'Tween': [3073], '20,': [3074], '7.4)': [3076], 'probed': [3078], 'phosphospecific': [3082, 3538], 'general': [3084], 'antibodies,': [3085], 'followed': [3086], 'appropriate': [3089], 'horseradish': [3091], 'peroxidase-conjugated': [3092], 'antibodies.': [3093, 3643, 3794], 'Immunoblots': [3094], 'visualized': [3096, 3275], 'ECL': [3099], 'system': [3100], 'Hyperfilm': [3102], 'x-ray': [3103], 'film': [3104], 'flow': [3108, 3167, 3959], 'cytometry,': [3109], 'detached': [3112], 'trypsin-EDTA,': [3114], 'culture': [3117], 'medium,': [3118], 'incubated': [3120, 3145, 3906], '30': [3126, 3158, 3192, 3427, 3565], 'PBA': [3131], '(phosphate-buffered': [3133], 'albumin,': [3138], '0.02%': [3139], 'NaN3).': [3140], 'Stained': [3141, 3320], 'washed,': [3144, 3419], 'same': [3153, 3364, 3424, 3477], 'additional': [3157], 'min,': [3159, 3418], 'again,': [3161], 'analyzed': [3163, 3603, 3714, 3940], 'FACSCalibur': [3166], 'cytometer': [3168], '(BD': [3169, 3211], 'sorting,': [3173], 'stained': [3179, 3309], 'complete': [3181, 3198], '(Immunotech)': [3190], 'ice,': [3195], 'phenol': [3201], 'red,': [3202], 'sorted': [3204], 'FACStar': [3207], 'plus': [3208], 'sorter': [3210], 'immunofluorescence': [3215], 'precoated': [3223, 3584], 'glass': [3224], 'coverslips': [3225], '(12': [3226], 'mm;': [3227], 'Carolina': [3228], 'Biological': [3229], 'Supply': [3230], 'Co.)': [3231], 'serum.': [3239], 'Samples': [3240, 3434, 3893], 'fixed': [3242, 3307], '4%': [3244], 'paraformaldehyde': [3245], 'saline': [3248, 3263], '5%': [3250], 'sucrose': [3251], 'permeabilized': [3256], 'min.': [3266, 3319], 'Primary': [3267], 'CY3-': [3278], 'antibody.': [3282, 3455], 'induced': [3286], 'starvation,': [3289], '72': [3299], 'period,': [3303], 'permeabilization': [3311], '2': [3313], 'μmHoechst': [3314], '33342': [3315], 'fluorochrome': [3316], '5': [3318, 3586], 'samples': [3321, 3387], 'mounted': [3323], 'GEL/MOUNTTM': [3325], '(Biomeda': [3326], 'Corp.)': [3327], 'mg/ml': [3330], '1,4-phenylenediamine': [3331], '(Fluka)': [3332], 'reduce': [3334], 'photobleaching.': [3335], 'Immunofluorescent': [3336], 'images': [3337, 3354], 'Zeiss': [3342], 'Axiophot': [3343], 'microscope': [3344], 'equipped': [3345], 'Photometrics': [3348], 'CH350': [3349], 'cooled': [3350], 'CCD': [3351], 'camera.': [3352], 'Digital': [3353], 'MetaMorph': [3358], '3.5': [3359], 'software': [3360, 3365], '(Universal': [3361], 'Imaging).': [3362], 'score': [3369], 'number': [3371], 'apoptotic': [3373], '(bright)': [3374], 'nonapoptotic': [3376], '(dark)': [3377], 'nuclei': [3378], 'two': [3382, 3929], 'randomly': [3383], 'chosen': [3384], 'fields': [3385], 'three': [3390], 'separate': [3391], 'experiments.': [3392], 'DMEM,': [3403, 3568], 'albumin': [3407, 3572], 'stimulated': [3410], 'ng/ml': [3413], 'PDGF': [3414, 3429, 3443], 'BB': [3415], 'μm': [3428, 3468], 'AG': [3432], '1433.': [3433], 'time': [3440, 3622], 'points': [3441], 'stimulation': [3444, 3472], 'anti-phospho-Akt': [3453, 3610, 3640], '(Ser473)': [3454], 'some': [3457, 3662], 'experiments,': [3458, 3663], 'pretreated': [3462], 'okadaic': [3469], 'before': [3471], 'PDGF,': [3474], 'concentration': [3478], 'throughout': [3485], 'entire': [3487], 'experiment.': [3488], 'evaluated': [3493], 'Signaling': [3502], 'protocol.': [3507, 3660], 'above': [3513], 'lysed,': [3515], 'endogenous': [3516], 'immunoprecipitated,': [3519], 'ability': [3522], 'phosphorylate': [3524], 'recombinant': [3526], 'GSK-3α/β': [3527], 'polypeptide': [3528], 'surrounding': [3531], 'Ser21': [3532], 'Ser9': [3534], 'assessed': [3536], 'serine': [3542], 'residues.': [3543], 'MAPK': [3546, 3637], 'spreading': [3552], 'fibronectin,': [3554], 'trypsinized,': [3557], 'trypsin': [3560], 'inhibitor,': [3561], 'rotated': [3563], 'Equal': [3576], 'heat-denatured': [3593], 'blotting': [3606, 3717], 'anti-phospho-MAPK': [3608, 3634], 'plating': [3615, 3768], 'times.': [3616], 'Relative': [3617], 'point': [3623], 'calculated': [3625, 3730], 'ratio': [3628, 3733], 'densitometry': [3630, 3751], 'readings': [3631], 'anti-actin': [3642], 'measured': [3647, 3679, 3698, 3738], '(Upstate': [3654, 3668], 'Biotechnology)': [3655, 3669], 'phospho-Akt1/PKB': [3666], 'peptide': [3667], 'substrate.': [3674], 'Total': [3675], 'immunoprecipitation': [3681], 'PP2Ac': [3684], 'catalytic': [3685], 'clone': [3690], '1D6.': [3691], 'their': [3700], 'anti-β1': [3703], 'K20.': [3706], 'reaction,': [3710], 'determination': [3722], 'content.': [3726], 'released': [3735], 'free': [3736], 'phosphate': [3737], 'absorbance': [3740], '650': [3742], 'nm': [3743], 'blotting.': [3758], 'lysates': [3760, 3775], 'above.': [3773], 'immunoprecipitated': [3777], 'agarose-conjugated': [3779], '4G10': [3780], 'anti-phosphotyrosine': [3781], 'isoform-specific': [3788], 'anti-p110': [3789], 'PI3K': [3790, 3793], 'anti-p85': [3792], 'PI': [3795], 'assayed': [3798], '(54Gutkind': [3801], 'Lacal': [3803], 'P.M.': [3804], 'Robbins': [3805], '1990;': [3810], '10:': [3811], '3806-3809Crossref': [3812], '(89)': [3815], 'thin': [3819], 'layer': [3820], 'LK6D': [3823], 'plates': [3824], '(Whatman),': [3825], '32P-labeled': [3826], 'phosphoinositides': [3827], 'detected': [3829], 'autoradiography.': [3831], 'measurement,': [3834], 'phosphate-free': [3843], 'labeled': [3846], 'mCi/ml': [3849], 'ortho[32P]phosphate': [3850], 'Biosciences)': [3852], 'Phospholipids': [3856], '(55Honeyman': [3865], 'T.W.': [3866], 'Strohsnitter': [3867], 'W.': [3868], 'Scheid': [3869], 'Schimmel': [3871], 'R.J.': [3872], '1983;': [3875], '212:': [3876], '489-498Crossref': [3877], '(46)': [3880], 'chloroform': [3885, 3930], 'phase': [3886], 'vacuum-dried': [3888], 'subjected': [3890], 'deacylation.': [3892], 'dissolved': [3895, 3919], 'methylamine': [3897, 3900], 'solution': [3898], '(33%': [3899], 'ethanol': [3902], '(Fluka)/water/n-butanol;': [3903], '5/2/1': [3904], '(v/v/v)),': [3905], '53': [3908], 'h,': [3912], 'vacuum-dried.': [3914], 'dried': [3916], 'material': [3917], 'water,': [3921], 'acyl': [3924], 'moieties': [3925], 'removed': [3927], 'extractions.': [3931], 'aqueous': [3933], 'phases': [3934], 'glycerophosphoinositol': [3937, 3980], 'phosphates': [3938, 3981], 'HPLC': [3942], 'Partisil': [3945], 'SAX': [3946], 'column': [3948], '70-min': [3951], 'nonlinear': [3952], '0–1m': [3955], 'NH4H2PO4': [3956], 'rate': [3960], '1.2': [3962], 'ml/min.': [3963], 'Radioactivity': [3964], 'eluate': [3967], 'monitored': [3969], 'on-line': [3972], 'Flow-One': [3973], 'detector': [3974], '(Packard).': [3975], 'Retention': [3976], 'individual': [3979], 'determined': [3983], 'radiolabeled': [3985], 'standards.': [3986], 'Results': [3987], 'expressed': [3989], 'percentage': [3992], 'total': [3994], 'phospholipid': [3995], 'radioactivity': [3996], 'attributed': [3997], 'deacylated': [4000], 'species.': [4002], 'sequence': [4010, 4069], 'selective': [4017], 'integrin-regulated': [4023], '(PKB)': [4025], 'relevant': [4029], 'poorly': [4035], 'understood.': [4036], 'first': [4038], 'six': [4048], 'tails': [4053], 'substituted': [4055], 'sequentially': [4059], 'them': [4063], '(Fig.1A).': [4070], 'well': [4074], 'studied': [4075], 'NPXY': [4077, 4139], 'motifs': [4078], 'known': [4079], 'functions': [4089], 'localization,': [4092], 'organization,': [4095], '(56Reszka': [4099], 'Hayashi': [4101], 'Y.': [4102], 'Horwitz': [4103], '1992;': [4108], '117:': [4109], '1321-1330Crossref': [4110], '(240)': [4113], '57Sakai': [4116], 'Zhang': [4118], '141:': [4128], '527-538Crossref': [4129], '(96)': [4132], 'because': [4135], 'regions': [4140], 'could': [4141], 'transduction': [4144], 'indirectly': [4145], 'complex': [4147], 'ways.': [4148], 'Each': [4149], 'point-mutated': [4152]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W1974001927', 'counts_by_year': [{'year': 2024, 'cited_by_count': 1}, {'year': 2021, 'cited_by_count': 2}, {'year': 2020, 'cited_by_count': 1}, {'year': 2019, 'cited_by_count': 3}, {'year': 2017, 'cited_by_count': 2}, {'year': 2016, 'cited_by_count': 1}, {'year': 2015, 'cited_by_count': 5}, {'year': 2014, 'cited_by_count': 5}, {'year': 2013, 'cited_by_count': 2}, {'year': 2012, 'cited_by_count': 3}], 'updated_date': '2025-01-07T09:06:39.426076', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
