Publication Information

{'id': 'https://openalex.org/W1973985383', 'doi': 'https://doi.org/10.1074/jbc.275.12.8375', 'title': 'Kinetic and Pharmacological Properties of Cloned Human Equilibrative Nucleoside Transporters, ENT1 and ENT2, Stably Expressed in Nucleoside Transporter-deficient PK15 Cells', 'display_name': 'Kinetic and Pharmacological Properties of Cloned Human Equilibrative Nucleoside Transporters, ENT1 and ENT2, Stably Expressed in Nucleoside Transporter-deficient PK15 Cells', 'publication_year': 2000, 'publication_date': '2000-03-01', 'ids': {'openalex': 'https://openalex.org/W1973985383', 'doi': 'https://doi.org/10.1074/jbc.275.12.8375', 'mag': '1973985383', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/10722669'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.275.12.8375', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'https://doi.org/10.1074/jbc.275.12.8375', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5020149913', 'display_name': 'Jeffrey L. Ward', 'orcid': 'https://orcid.org/0000-0003-3780-6780'}, 'institutions': [{'id': 'https://openalex.org/I145311948', 'display_name': 'Johns Hopkins University', 'ror': 'https://ror.org/00za53h95', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I145311948']}, {'id': 'https://openalex.org/I2799853436', 'display_name': 'Johns Hopkins Medicine', 'ror': 'https://ror.org/037zgn354', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I2799853436']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Jeffrey L. Ward', 'raw_affiliation_strings': ['Department of Medicine, Division of Gastroenterology, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205, USA.'], 'affiliations': [{'raw_affiliation_string': 'Department of Medicine, Division of Gastroenterology, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205, USA.', 'institution_ids': ['https://openalex.org/I145311948', 'https://openalex.org/I2799853436']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5002216316', 'display_name': 'Azeem Sherali', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I2799853436', 'display_name': 'Johns Hopkins Medicine', 'ror': 'https://ror.org/037zgn354', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I2799853436']}, {'id': 'https://openalex.org/I145311948', 'display_name': 'Johns Hopkins University', 'ror': 'https://ror.org/00za53h95', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I145311948']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Azeem Sherali', 'raw_affiliation_strings': ['From the Department of Medicine, Division of Gastroenterology, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205'], 'affiliations': [{'raw_affiliation_string': 'From the Department of Medicine, Division of Gastroenterology, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205', 'institution_ids': ['https://openalex.org/I2799853436', 'https://openalex.org/I145311948']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5089219462', 'display_name': 'Zhi-Ping Mo', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I2799853436', 'display_name': 'Johns Hopkins Medicine', 'ror': 'https://ror.org/037zgn354', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I2799853436']}, {'id': 'https://openalex.org/I145311948', 'display_name': 'Johns Hopkins University', 'ror': 'https://ror.org/00za53h95', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I145311948']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Zhi-Ping Mo', 'raw_affiliation_strings': ['From the Department of Medicine, Division of Gastroenterology, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205'], 'affiliations': [{'raw_affiliation_string': 'From the Department of Medicine, Division of Gastroenterology, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205', 'institution_ids': ['https://openalex.org/I2799853436', 'https://openalex.org/I145311948']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5021443559', 'display_name': 'Chung‐Ming Tse', 'orcid': 'https://orcid.org/0000-0002-1873-2029'}, 'institutions': [{'id': 'https://openalex.org/I145311948', 'display_name': 'Johns Hopkins University', 'ror': 'https://ror.org/00za53h95', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I145311948']}, {'id': 'https://openalex.org/I2799853436', 'display_name': 'Johns Hopkins Medicine', 'ror': 'https://ror.org/037zgn354', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I2799853436']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Chung-Ming Tse', 'raw_affiliation_strings': ['From the Department of Medicine, Division of Gastroenterology, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205'], 'affiliations': [{'raw_affiliation_string': 'From the Department of Medicine, Division of Gastroenterology, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205', 'institution_ids': ['https://openalex.org/I145311948', 'https://openalex.org/I2799853436']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 2, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 6.378, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 302, 'citation_normalized_percentile': {'value': 0.999057, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 98, 'max': 99}, 'biblio': {'volume': '275', 'issue': '12', 'first_page': '8375', 'last_page': '8381'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T11193', 'display_name': 'Adenosine and Purinergic Signaling', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1314', 'display_name': 'Physiology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T11193', 'display_name': 'Adenosine and Purinergic Signaling', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1314', 'display_name': 'Physiology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10373', 'display_name': 'Renal Transplantation Outcomes and Treatments', 'score': 0.989, 'subfield': {'id': 'https://openalex.org/subfields/2747', 'display_name': 'Transplantation'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T12770', 'display_name': 'Amino Acid Enzymes and Metabolism', 'score': 0.986, 'subfield': {'id': 'https://openalex.org/subfields/1303', 'display_name': 'Biochemistry'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/nucleoside-transporter', 'display_name': 'Nucleoside transporter', 'score': 0.89351034}, {'id': 'https://openalex.org/keywords/inosine', 'display_name': 'Inosine', 'score': 0.8759854}, {'id': 'https://openalex.org/keywords/hypoxanthine', 'display_name': 'Hypoxanthine', 'score': 0.6955459}, {'id': 'https://openalex.org/keywords/cytidine', 'display_name': 'Cytidine', 'score': 0.6588105}, {'id': 'https://openalex.org/keywords/thymidine', 'display_name': 'Thymidine', 'score': 0.53667}], 'concepts': [{'id': 'https://openalex.org/C2780549722', 'wikidata': 'https://www.wikidata.org/wiki/Q7068260', 'display_name': 'Nucleoside transporter', 'level': 4, 'score': 0.89351034}, {'id': 'https://openalex.org/C2777610669', 'wikidata': 'https://www.wikidata.org/wiki/Q422564', 'display_name': 'Inosine', 'level': 3, 'score': 0.8759854}, {'id': 'https://openalex.org/C2776543447', 'wikidata': 'https://www.wikidata.org/wiki/Q28734', 'display_name': 'Nucleoside', 'level': 2, 'score': 0.84289646}, {'id': 'https://openalex.org/C2781116151', 'wikidata': 'https://www.wikidata.org/wiki/Q410305', 'display_name': 'Hypoxanthine', 'level': 3, 'score': 0.6955459}, {'id': 'https://openalex.org/C2781259782', 'wikidata': 'https://www.wikidata.org/wiki/Q422573', 'display_name': 'Uridine', 'level': 4, 'score': 0.69152665}, {'id': 'https://openalex.org/C2781184954', 'wikidata': 'https://www.wikidata.org/wiki/Q422538', 'display_name': 'Cytidine', 'level': 3, 'score': 0.6588105}, {'id': 'https://openalex.org/C2776991684', 'wikidata': 'https://www.wikidata.org/wiki/Q190012', 'display_name': 'Adenosine', 'level': 2, 'score': 0.6091641}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.5412135}, {'id': 'https://openalex.org/C2777108182', 'wikidata': 'https://www.wikidata.org/wiki/Q422464', 'display_name': 'Thymidine', 'level': 3, 'score': 0.53667}, {'id': 'https://openalex.org/C149011108', 'wikidata': 'https://www.wikidata.org/wiki/Q652985', 'display_name': 'Transporter', 'level': 3, 'score': 0.427611}, {'id': 'https://openalex.org/C2777995097', 'wikidata': 'https://www.wikidata.org/wiki/Q422462', 'display_name': 'Guanosine', 'level': 2, 'score': 0.42339844}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.40796092}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.39714104}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.36939728}, {'id': 'https://openalex.org/C181199279', 'wikidata': 'https://www.wikidata.org/wiki/Q8047', 'display_name': 'Enzyme', 'level': 2, 'score': 0.1394268}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.12324718}, {'id': 'https://openalex.org/C202751555', 'wikidata': 'https://www.wikidata.org/wiki/Q221681', 'display_name': 'In vitro', 'level': 2, 'score': 0.10761425}, {'id': 'https://openalex.org/C67705224', 'wikidata': 'https://www.wikidata.org/wiki/Q11053', 'display_name': 'RNA', 'level': 3, 'score': 0.08849043}], 'mesh': [{'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D033722', 'descriptor_name': 'Equilibrative-Nucleoside Transporter 2', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D009705', 'descriptor_name': 'Nucleosides', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D001692', 'descriptor_name': 'Biological Transport', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': 'Q000037', 'qualifier_name': 'antagonists & inhibitors', 'is_major_topic': False}, {'descriptor_ui': 'D002460', 'descriptor_name': 'Cell Line', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D003562', 'descriptor_name': 'Cytidine', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D003562', 'descriptor_name': 'Cytidine', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D004176', 'descriptor_name': 'Dipyridamole', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004176', 'descriptor_name': 'Dipyridamole', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D033721', 'descriptor_name': 'Equilibrative Nucleoside Transporter 1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005816', 'descriptor_name': 'Genetic Complementation Test', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006151', 'descriptor_name': 'Guanosine', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006151', 'descriptor_name': 'Guanosine', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007288', 'descriptor_name': 'Inosine', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007288', 'descriptor_name': 'Inosine', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D007700', 'descriptor_name': 'Kinetics', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': 'Q000037', 'qualifier_name': 'antagonists & inhibitors', 'is_major_topic': False}, {'descriptor_ui': 'D009705', 'descriptor_name': 'Nucleosides', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013868', 'descriptor_name': 'Thioinosine', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013868', 'descriptor_name': 'Thioinosine', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D013868', 'descriptor_name': 'Thioinosine', 'qualifier_ui': 'Q000031', 'qualifier_name': 'analogs & derivatives', 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.275.12.8375', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/10722669', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.275.12.8375', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 27, 'referenced_works': ['https://openalex.org/W1510363359', 'https://openalex.org/W1554834393', 'https://openalex.org/W1831079403', 'https://openalex.org/W186820520', 'https://openalex.org/W1869396122', 'https://openalex.org/W1869455905', 'https://openalex.org/W1963668502', 'https://openalex.org/W1969125109', 'https://openalex.org/W1976365732', 'https://openalex.org/W1981040381', 'https://openalex.org/W1984017495', 'https://openalex.org/W1995948763', 'https://openalex.org/W2001415405', 'https://openalex.org/W2007023644', 'https://openalex.org/W2014507223', 'https://openalex.org/W2032251891', 'https://openalex.org/W2061177986', 'https://openalex.org/W2078450213', 'https://openalex.org/W2093790579', 'https://openalex.org/W2094099041', 'https://openalex.org/W2125916741', 'https://openalex.org/W2137724705', 'https://openalex.org/W2278230652', 'https://openalex.org/W2341663147', 'https://openalex.org/W2404717499', 'https://openalex.org/W2413378273', 'https://openalex.org/W4248646040'], 'related_works': ['https://openalex.org/W4300869847', 'https://openalex.org/W2412926170', 'https://openalex.org/W2162250764', 'https://openalex.org/W2153042712', 'https://openalex.org/W2105383464', 'https://openalex.org/W2071567974', 'https://openalex.org/W2040448334', 'https://openalex.org/W2039764145', 'https://openalex.org/W2031608471', 'https://openalex.org/W2011350641'], 'abstract_inverted_index': {'We': [0, 222, 1427, 3694], 'stably': [1, 223, 2510], 'transfected': [2, 224, 1897, 2467, 2511, 3695, 3703, 3897, 4017], 'the': [3, 167, 225, 389, 544, 616, 646, 658, 750, 845, 852, 883, 922, 957, 1028, 1042, 1082, 1187, 1400, 1457, 1573, 1614, 1617, 1624, 1736, 1751, 1764, 1797, 2015, 2082, 2090, 2137, 2151, 2160, 2188, 2250, 2297, 2303, 2312, 2328, 2333, 2414, 2420, 2430, 2446, 2455, 2459, 2485, 2492, 2507, 2569, 2615, 2877, 3157, 3177, 3191, 3335, 3521, 3555, 3618, 3661, 3664, 3830, 3844, 3930, 3962, 3998, 4126, 4160], 'cloned': [4, 226, 794, 860, 1099, 1135, 1287, 1429, 1461, 1752, 2418], 'human': [5, 227, 449, 855, 861, 1046, 1246, 1295, 1401, 2190], 'equilibrative': [6, 228, 444, 451, 453, 516, 556, 604], 'nucleoside': [7, 16, 146, 229, 238, 368, 445, 474, 513, 530, 557, 789, 857, 875, 991, 1086, 1213, 1292, 1325, 1642, 1651, 1659, 1729, 1748, 1786, 1865, 1911, 2087, 2093, 3311, 3326, 3337, 3343, 3388, 3469, 3530, 3619, 3812, 3989], 'transporters': [8, 124, 136, 230, 346, 358, 475, 514, 531, 558, 1660, 1912, 3312], '1': [9, 231, 627, 1968, 2890, 2905, 2926, 2969, 3374, 3639, 3953, 4372], 'and': [10, 13, 22, 35, 40, 50, 58, 72, 89, 118, 152, 162, 205, 209, 232, 235, 244, 257, 262, 272, 280, 294, 311, 340, 374, 384, 427, 431, 522, 543, 630, 639, 642, 649, 673, 753, 795, 972, 975, 982, 1045, 1100, 1151, 1197, 1395, 1410, 1432, 1464, 1560, 1586, 1604, 1646, 1656, 1754, 1761, 1767, 1793, 1888, 1893, 1919, 1987, 2089, 2144, 2170, 2183, 2223, 2273, 2284, 2310, 2392, 2407, 2423, 2440, 2449, 2462, 2514, 2520, 2532, 2535, 2540, 2680, 2689, 2700, 2746, 2836, 2855, 2908, 2932, 2981, 3036, 3069, 3162, 3188, 3214, 3222, 3247, 3261, 3279, 3290, 3305, 3455, 3514, 3612, 3642, 3663, 3682, 3697, 3710, 3727, 3757, 3780, 3819, 3833, 3839, 3942, 3959, 3965, 3982, 3986, 3988, 3993, 4031, 4067, 4073, 4122, 4135, 4141, 4153, 4247, 4259, 4298], '2': [11, 233, 3587, 3632, 3774, 3951, 3972], '(hENT1': [12, 234], 'hENT2)': [14, 236], 'into': [15, 237, 562, 2306, 2332, 2419, 2451, 2468, 3699], 'transporter-deficient': [17, 239, 1866, 2094, 3470, 3620], 'PK15NTD': [18, 240, 2469, 2503, 2508, 2530, 3560, 3684, 3700, 4054], 'cells.': [19, 241, 2504, 3701], 'Although': [20, 134, 242, 356, 872, 1557, 3735, 4295], 'hENT1': [21, 30, 54, 64, 157, 243, 252, 276, 286, 379, 917, 966, 987, 1034, 1150, 1431, 1559, 1753, 2182, 2246, 2406, 2513, 3941, 3958, 4020, 4060, 4081, 4116, 4129, 4152, 4246, 4252, 4297], 'hENT2': [23, 36, 59, 140, 170, 185, 198, 245, 258, 281, 362, 392, 407, 420, 1282, 1433, 1561, 1755, 2184, 2408, 2515, 3960, 4068, 4138, 4154, 4248, 4260, 4299], 'are': [24, 137, 246, 359, 523, 532, 559, 633, 643, 739, 1050, 1562, 1732, 1886, 1889, 3129, 3203, 3313, 3890, 3899, 4155], 'predicted': [25, 247, 4158], 'to': [26, 55, 60, 77, 104, 248, 277, 282, 299, 326, 539, 546, 566, 569, 610, 622, 626, 726, 741, 882, 921, 1041, 1081, 1149, 1204, 1330, 1564, 1853, 2018, 2025, 2074, 2150, 2315, 2318, 2425, 2429, 2484, 2961, 2968, 2977, 3055, 3243, 3407, 3754, 3877, 3892, 4085, 4132, 4144, 4256], 'be': [27, 200, 249, 422, 727, 1565, 1821, 2316, 3925, 4301], '50-kDa': [28, 250], 'proteins,': [29, 251, 1048], 'runs': [31, 253], 'as': [32, 38, 214, 254, 260, 436, 663, 747, 1568, 1581, 1600, 1606, 1631, 1637, 2518, 2807, 3131, 3205, 3339, 3457, 3462, 3533, 3554, 3606, 4061, 4069, 4157], '40': [33, 255, 4065, 4131], 'kDa': [34, 42, 57, 256, 264, 279, 4066, 4134, 4143], 'migrates': [37, 259], '50': [39, 261, 1979, 2747, 2764, 3008, 4072, 4140], '47': [41, 263, 4074, 4142], 'on': [43, 190, 265, 412, 1089, 1996, 2014, 3110], 'SDS-polyacrylamide': [44, 266], 'gel': [45, 267, 462], 'electrophoresis.': [46, 268], 'Peptide': [47, 269], 'N-glycosidase': [48, 270], 'F': [49, 271, 465, 2738, 4121], 'endoglycosidase': [51, 273, 466], 'H': [52, 274, 467, 2759, 4124], 'deglycosylate': [53, 275], '37': [56, 278, 1982, 2774, 4133], '45': [61, 283, 2387, 4145], 'kDa.': [62, 284, 4075, 4146], 'With': [63, 285], 'being': [65, 287], 'more': [66, 288], 'sensitive,': [67, 289], 'there': [68, 290, 1607], 'is': [69, 141, 173, 219, 291, 363, 395, 441, 608, 620, 654, 661, 733, 796, 959, 967, 988, 1101, 1146, 1192, 1202, 1210, 1628, 1634, 2330, 3176, 3182, 3185, 3190, 3604, 3730, 3740, 3907, 3997, 4082, 4253, 4261], 'a': [70, 108, 126, 142, 292, 330, 348, 364, 551, 664, 866, 1092, 1139, 1340, 1638, 1741, 1817, 1824, 2029, 2173, 2307, 2321, 2371, 2937, 2950, 2983, 3117, 3256, 3318, 3387, 3409, 3578, 3599, 3653, 3789, 3909, 4062], '7000-fold': [71, 293], '71-fold': [73, 295], 'difference': [74, 296, 3647], 'in': [75, 202, 211, 297, 424, 433, 667, 729, 736, 961, 1038, 1256, 1291, 1469, 1644, 1745, 1756, 1823, 1909, 1953, 2028, 2037, 2096, 2296, 2370, 2502, 2542, 2585, 2624, 2644, 2697, 2742, 2763, 2815, 2868, 2876, 2925, 2963, 3026, 3122, 3323, 3363, 3418, 3518, 3535, 3617, 3648, 3660, 3674, 3725, 3732, 3767, 3961, 4041, 4118], 'sensitivity': [76, 298, 568], 'nitrobenzylthioinosine': [78, 300, 447, 526], '(NBMPR)': [79, 301], '(IC50,': [80, 91, 302, 313], '0.4': [81, 303], '±': [82, 86, 93, 98, 115, 304, 308, 315, 320, 337, 2889, 2895, 3133, 3207, 4000], '0.1': [83, 305, 1963, 3033], 'nm': [84, 95, 306, 317, 611, 3658], 'versus2.8': [85, 307], '0.3': [87, 309], 'μm)': [88, 310, 2143, 2147], 'dipyridamole': [90, 312, 648, 2497, 2898, 4304], '5.0': [92, 314], '0.9': [94, 316], 'versus': [96, 318, 3159], '356': [97, 319], '13': [99, 321, 2631], 'nm),': [100, 322], 'respectively.': [101, 164, 323, 386, 2523, 3225], '[3H]NBMPR': [102, 324, 2975, 3011, 3018, 3053, 3071, 3237, 3306, 3567, 3579, 3644, 3649, 3659], 'binds': [103, 325], 'ENT1': [105, 120, 327, 342, 798, 862, 1153, 1409, 1463, 1603, 2519, 2534, 2688, 2957, 3041, 3726, 3777, 3896, 4030], 'cells': [106, 328, 737, 1297, 1436, 1647, 1867, 1885, 1898, 1907, 1993, 2012, 2023, 2070, 2097, 2167, 2470, 2509, 2531, 2537, 2863, 2959, 3021, 3333, 3369, 3393, 3449, 3471, 3511, 3539, 3561, 3576, 3704, 3729, 3749, 3889, 3898, 4018, 4033], 'with': [107, 125, 148, 329, 347, 370, 1056, 1833, 1899, 1962, 1984, 2010, 2040, 2159, 2217, 2231, 2512, 2656, 2662, 2675, 2733, 2754, 2804, 2915, 2980, 3032, 3049, 3081, 3396, 3453, 3788, 4052], 'high': [109, 331, 3549], 'affinity': [110, 145, 155, 168, 332, 367, 377, 390, 3192, 3550], 'K': [111, 333, 3145, 3245], 'd': [112, 334, 3246], 'of': [113, 129, 169, 335, 351, 391, 472, 520, 613, 749, 868, 979, 1027, 1084, 1095, 1141, 1339, 1456, 1460, 1575, 1577, 1602, 1613, 1616, 1620, 1641, 1770, 1795, 1895, 1903, 1905, 2084, 2092, 2157, 2164, 2175, 2181, 2494, 2496, 2568, 2736, 2757, 2862, 2885, 2928, 2943, 2971, 2974, 3010, 3052, 3138, 3156, 3216, 3236, 3401, 3505, 3508, 3582, 3609, 3656, 3666, 3722, 3792, 3846, 3848, 3911, 3940, 3971, 4002, 4026, 4064, 4071, 4080, 4128, 4137, 4245], '0.377': [114, 336], '0.098': [116, 338], 'nm,': [117, 339, 3057], 'each': [119, 341, 3076], 'cell': [121, 343, 1742, 1759, 1778, 1855, 1941, 2193, 2553, 2691, 3042, 3320, 3390, 3415, 3523, 3545, 3601, 4055], 'has': [122, 187, 344, 409, 791, 877, 918, 1251, 1283, 1327, 1466, 1608, 1789, 1913, 2195, 3403, 3463, 3934], '34,000': [123, 345], 'turnover': [127, 349, 2083], 'number': [128, 350, 2269], '46': [130, 352], 'molecules/s': [131, 353], 'for': [132, 158, 171, 354, 380, 393, 1862, 1891, 2034, 2076, 2081, 2172, 2245, 2279, 2379, 2402, 2491, 2558, 2572, 2705, 2770, 2988, 3015, 3038, 3062, 3135, 3193, 3209, 3220, 3240, 3467, 3638, 3713, 3752, 3957], 'uridine.': [133, 355], 'both': [135, 357, 637, 970, 1195, 1408, 1558, 3748, 4151, 4296], 'broadly': [138, 360, 634, 1566], 'selective,': [139, 361, 635], 'generally': [143, 365], 'low': [144, 366, 977], 'transporter': [147, 369, 446, 790, 876, 886, 992, 1214, 2088], '2.6-,': [149, 371], '2.8-,': [150, 372], '7.7-,': [151, 373], '19.3-fold': [153, 375], 'lower': [154, 376], 'than': [156, 176, 378, 398, 3743], 'thymidine,': [159, 381, 1584, 3978], 'adenosine,': [160, 382, 1582, 3980], 'cytidine,': [161, 383, 1587, 3979], 'guanosine,': [163, 385, 1585, 3981], 'In': [165, 387, 1322, 1735, 1851, 3875, 3913], 'contrast,': [166, 388, 3914], 'inosine': [172, 394, 3797, 3853], '4-fold': [174, 396], 'higher': [175, 397], 'hENT1.': [177, 191, 399, 413], 'The': [178, 400, 511, 528, 554, 603, 651, 786, 859, 1134, 1245, 1773, 1901, 1936, 2069, 2179, 2277, 2552, 2579, 2727, 2795, 2940, 3020, 3105, 3447, 3624, 3719, 3811, 4076], 'nucleobase': [179, 401, 3923, 3984], 'hypoxanthine': [180, 402, 3832, 3915], 'inhibits': [181, 403], '[3H]uridine': [182, 404, 963, 1188, 2177, 2500, 3365, 3378, 3715, 3723, 3736, 3745, 3770, 3850, 3882], 'uptake': [183, 405, 1615, 1991, 2501, 3127, 3199, 3366, 3379, 3611, 3629, 3716, 3724, 3737, 3746, 3771, 3851, 3883, 3948], 'by': [184, 406, 525, 534, 541, 645, 834, 965, 969, 976, 1190, 1194, 1288, 1335, 1393, 1396, 1570, 1827, 1831, 1917, 2399, 2479, 2489, 2538, 2566, 2685, 2703, 2801, 2872, 2904, 2936, 3078, 3116, 3152, 3163, 3255, 3367, 3373, 3707, 3738, 3747, 3761, 3776, 3783, 3885, 3918, 3927, 4088, 4303], 'but': [186, 408], 'minimal': [188, 410, 1955], 'effect': [189, 411, 3936], 'Taken': [192, 414, 3589], 'together,': [193, 415, 3590], 'these': [194, 416, 1621, 1771, 3591], 'results': [195, 417, 3592], 'suggest': [196, 418, 3593], 'that': [197, 419, 738, 841, 986, 1033, 1077, 1145, 1208, 1399, 1857, 2098, 2289, 3107, 3331, 3571, 3594, 3905, 3921, 4016, 4046, 4086, 4136, 4150, 4251], 'might': [199, 421, 3924], 'important': [201, 423, 735], 'transporting': [203, 425, 636], 'adenosine': [204, 426, 1343, 3794, 3859], 'its': [206, 428, 1784, 3340], 'metabolites': [207, 429], '(inosine': [208, 430], 'hypoxanthine)': [210, 432], 'tissues': [212, 434, 1645], 'such': [213, 435, 746, 1580, 1864], 'skeletal': [215, 437, 671], 'muscle': [216, 438], 'where': [217, 439, 3174], 'ENT2': [218, 440, 1411, 1465, 2280, 2521, 2536, 2690, 3728, 3739, 3917, 4032], 'predominantly': [220, 442], 'expressed.': [221, 443, 1734], '(6-[(4-nitrobenzyl)thiol]-9-β-d-ribofuranosylpurine)': [448], 'rat': [450, 1093, 1152], 'NBMPR-sensitive': [452, 605, 787, 874, 990, 1798, 2176, 3336, 3529], 'NBMPR-insensitive': [454], 'cytosine': [455, 2139], 'arabinoside': [456, 2140], 'vesicular': [457], 'stomatitis': [458], 'viral': [459], 'glycoprotein': [460], 'polyacrylamide': [461], 'electrophoresis': [463], 'peptideN-glycosidase': [464], 'azidothymidine': [468], '5-fluorouridine': [469], 'Two': [470], 'classes': [471], 'mammalian': [473, 1462], 'have': [476, 1391, 1588, 1595, 1858, 3564, 3596, 4249], 'been': [477, 793, 1253, 1285, 1328, 1467, 1591, 1598, 1609, 1790, 1860, 1915, 2100, 2196, 3405, 3464], 'described': [478, 1916, 2197, 2808, 3458, 3466], '(1.Griffith': [479, 571, 676, 1661], 'D.A.': [480, 572, 677, 1662], 'Jarvis': [481, 573, 678, 1663], 'S.M.': [482, 574, 679, 906, 1368, 1664], 'Biochim.': [483, 575, 680, 712, 759, 894, 1416, 1441, 1665, 1697, 1805, 1840, 1925, 2107, 2202, 2257, 3350, 3476], 'Biophys.': [484, 576, 681, 713, 760, 895, 1064, 1417, 1442, 1666, 1698, 1806, 1841, 1926, 2108, 2203, 2258, 3094, 3351, 3477], 'Acta.': [485, 577, 682, 714, 761, 896, 1418, 1443, 1667, 1699, 1807, 1842, 1927, 2109, 2204, 2259, 3352, 3478], '1996;': [486, 578, 683, 1355, 1668], '1286:': [487, 579, 684, 1669], '153-181Crossref': [488, 580, 685, 1670], 'PubMed': [489, 506, 581, 598, 686, 703, 718, 765, 781, 826, 900, 912, 951, 1020, 1070, 1129, 1180, 1240, 1277, 1317, 1361, 1384, 1422, 1447, 1498, 1528, 1552, 1671, 1688, 1703, 1725, 1811, 1846, 1881, 1931, 2064, 2113, 2131, 2208, 2263, 2361, 2605, 2722, 2790, 3100, 3356, 3442, 3482, 3499, 4111, 4190, 4214, 4237, 4290, 4332, 4356], 'Scopus': [490, 507, 582, 599, 687, 704, 719, 766, 782, 827, 901, 913, 952, 1021, 1071, 1130, 1181, 1241, 1278, 1318, 1362, 1385, 1423, 1448, 1499, 1529, 1553, 1672, 1689, 1704, 1812, 1847, 1932, 2065, 2114, 2209, 2264, 2362, 2606, 2723, 2791, 3101, 3357, 3443, 3483, 4191, 4215, 4238, 4291, 4333, 4357], '(453)': [491, 583, 688, 1673], 'Google': [492, 509, 584, 601, 689, 706, 721, 768, 784, 829, 903, 915, 954, 1023, 1073, 1132, 1183, 1243, 1280, 1320, 1364, 1387, 1425, 1450, 1501, 1531, 1555, 1674, 1691, 1706, 1726, 1814, 1849, 1882, 1934, 2067, 2116, 2132, 2211, 2266, 2364, 2608, 2725, 2793, 3006, 3103, 3359, 3445, 3485, 3500, 4112, 4193, 4217, 4240, 4293, 4335, 4359], 'Scholar,': [493, 585, 690, 707, 769, 904, 1502, 1532, 1675, 1692, 1707, 2117, 4194, 4336, 4360], '2.Cass': [494, 586, 691, 1676], 'C.E.': [495, 587, 692, 808, 816, 933, 941, 1002, 1010, 1113, 1164, 1224, 1267, 1480, 1488, 1512, 1542, 1677, 4105, 4172, 4180, 4204, 4272, 4280, 4314, 4322, 4346], 'Young': [496, 588, 693, 817, 942, 1011, 1116, 1167, 1227, 1268, 1489, 1515, 1543, 1678, 3091, 4100, 4181, 4205, 4281, 4323, 4347], 'J.D.': [497, 589, 694, 818, 943, 1012, 1117, 1168, 1228, 1269, 1490, 1516, 1544, 1679, 3092, 4101, 4182, 4206, 4282, 4324, 4348], 'Baldwin': [498, 590, 695, 819, 944, 1013, 1114, 1165, 1225, 1270, 1491, 1513, 1545, 1680, 4102, 4183, 4207, 4283, 4325, 4349], 'S.A.': [499, 591, 696, 820, 945, 1014, 1115, 1166, 1226, 1271, 1492, 1514, 1546, 1681, 2594, 2711, 2779, 4103, 4184, 4208, 4284, 4326, 4350], 'Biochem.': [500, 592, 697, 907, 1063, 1272, 1547, 1682, 3093, 4106, 4209, 4351], 'Cell': [501, 593, 698, 1683, 3287], 'Biol.': [502, 594, 699, 1119, 1170, 1230, 1307, 1374, 1518, 1684, 1717, 1873, 2123, 2351, 3491, 4227, 4370], '1998;': [503, 595, 700, 1309, 1685, 3003, 4229], '76:': [504, 596, 701, 1686], '761-770Crossref': [505, 597, 702, 1687], '(168)': [508, 600, 705, 1690], 'Scholar).': [510, 602, 722, 785, 830, 955, 1024, 1074, 1133, 1184, 1244, 1281, 1321, 1388, 1426, 1451, 1556, 1727, 1815, 1850, 1935, 2068, 2133, 2212, 2365, 2609, 2726, 2794, 3007, 3104, 3360, 3446, 3501, 4241, 4294], 'Na+-independent': [512, 555, 788, 1085, 1324, 1728, 1799, 3381, 3779], 'mediate': [515], 'transport': [517, 964, 1189, 1326, 1576, 1626, 1643, 1652, 1730, 1787, 3338, 3344, 3531], '(facilitated': [518], 'diffusion)': [519], 'nucleosides': [521, 548, 743, 974, 1594, 1835, 2138, 3785, 3976], 'inhibited': [524, 644, 968, 1193, 3372, 3760, 3782, 3881, 3916, 4302], '(NBMPR).1': [527], 'Na+-dependent': [529], 'characterized': [533, 1255, 1763, 1792], 'their': [535, 567], 'Na+': [536], 'dependence,': [537], 'resistance': [538, 3709], 'inhibition': [540, 3200, 3837], 'NBMPR,': [542, 614, 980, 2987], 'ability': [545], 'concentrate': [547], 'intracellularly': [549], 'against': [550], 'concentration': [552, 3400, 3655], 'gradient.': [553], 'further': [560, 4015], 'classified': [561], 'two': [563], 'subclasses': [564], 'according': [565, 2428], 'NBMPR': [570, 623, 1205, 2892, 3280, 3551, 3614, 3625, 4257], 'system': [606, 618, 653, 660, 1627, 1788, 1800, 3345], '(es)': [607], 'sensitive': [609, 3900, 4255], 'concentrations': [612, 624, 978, 1338, 2884, 2973, 3051], 'whereas': [615, 657, 3570, 3829, 3895], 'equilibrative-insensitive': [617], '(ei)': [619], 'resistant': [621, 1203, 4262], 'up': [625, 3753], 'μm.': [628], 'Bothes': [629], 'ei': [631, 659, 1212, 1625], 'systems': [632, 724, 1653, 1731], 'purine': [638, 971, 1196], 'pyrimidine': [640, 973, 1198], 'nucleosides,': [641, 731, 1579, 2162], 'vasodilators': [647], 'dilazep.': [650], 'es': [652, 1655, 2086], 'ubiquitously': [655, 1733, 3314], 'expressed,': [656, 3315], 'found': [662, 1636], 'minor': [665, 1639], 'component': [666, 1640], 'intestine,': [668, 1323], 'leukemia': [669, 1296], 'cells,': [670, 1405, 2522, 2958, 3622], 'muscles,': [672], 'cardiovascular': [674], 'tissues/cells': [675], '3.Ward': [708, 1693], 'J.L.': [709, 1372, 1413, 1438, 1694, 2199, 2254], 'Tse': [710, 1414, 1439, 1695, 2200, 2255, 2348], 'C.M.': [711, 1415, 1440, 1696, 2201, 2256, 2592, 2709, 2777, 3090], '1999;': [715, 1419, 1444, 1700, 2205, 2260, 4108], '1419:': [716, 1420, 1445, 1701, 2206, 2261], '15-22Crossref': [717, 1421, 1446, 1702, 2207, 2262], '(51)': [720, 1424, 1449, 1705, 2210, 2265], 'Both': [723], 'appear': [725], 'involved': [728], 'scavenging': [730], 'which': [732, 1049, 1648, 2614, 3603], 'especially': [734], 'unable': [740], 'synthesize': [742], 'de': [744], 'novo,': [745], 'those': [748], 'intestinal': [751], 'epithelium': [752], 'lymphocytes': [754], '(4.Mackinnon': [755], 'A.M.': [756], 'Deller': [757], 'D.J.': [758], '1973;': [762], '319:': [763], '1-4Crossref': [764], '(53)': [767, 2363], '5.He': [770], 'Y.': [771], 'Sanderson': [772], 'I.R.': [773], 'Walker': [774], 'W.A.': [775], 'J.': [776, 908, 1118, 1169, 1229, 1273, 1306, 1373, 1517, 1548, 1716, 1872, 2045, 2122, 2350, 3001, 3423, 3490, 4107, 4210, 4226, 4352, 4369], 'Nutr.': [777], '1994;': [778, 2602, 2719, 2787], '124:': [779], '1942-1949Crossref': [780], '(42)': [783], 'recently': [792], 'termed': [797], '(6.Griffiths': [799, 924, 993, 1471, 4163, 4263, 4305], 'M.': [800, 806, 925, 931, 994, 1000, 1111, 1162, 1222, 1259, 1472, 1478, 1510, 1534, 2347, 2600, 2717, 2785, 4097, 4164, 4170, 4196, 4264, 4270, 4306, 4312, 4338], 'Beaumont': [801, 926, 995, 1473, 4165, 4265, 4307], 'N.': [802, 927, 996, 1474, 4166, 4266, 4308], 'Yao': [803, 928, 997, 1260, 1475, 1535, 4167, 4197, 4267, 4309, 4339], 'S.Y.': [804, 929, 998, 1261, 1476, 1536, 4168, 4198, 4268, 4310, 4340], 'Sundaram': [805, 930, 999, 1477, 4096, 4169, 4269, 4311], 'Boumah': [807, 932, 1001, 1479, 4171, 4271, 4313], 'Davies': [809, 934, 1003, 1481, 4173, 4273, 4315], 'A.': [810, 935, 1004, 1482, 2049, 2060, 3427, 3438, 4174, 4274, 4316], 'Kwong': [811, 936, 1005, 1483, 4175, 4275, 4317], 'F.Y.': [812, 937, 1006, 1484, 4176, 4276, 4318], 'Coe': [813, 938, 1007, 1485, 4177, 4277, 4319], 'I.': [814, 939, 1008, 1486, 4178, 4278, 4320], 'Cass': [815, 940, 1009, 1112, 1163, 1223, 1266, 1487, 1511, 1541, 4104, 4179, 4203, 4279, 4321, 4345], 'Nat.': [821, 946, 1015, 1493, 4185, 4285, 4327], 'Med.': [822, 947, 1016, 1494, 4186, 4286, 4328], '1997;': [823, 948, 1017, 1121, 1172, 1232, 1274, 1495, 1520, 1549, 2353, 4187, 4211, 4287, 4329, 4353], '3:': [824, 949, 1018, 1496, 4188, 4288, 4330], '89-93Crossref': [825, 950, 1019, 1497, 4189, 4289, 4331], '(357)': [828, 953, 1022, 1500, 4192, 4292, 4334], 'This': [831, 984, 1075, 2299, 3377, 3399, 3543, 4057, 4147], 'was': [832, 842, 1097, 1781, 1944, 2215, 2228, 2294, 2555, 2582, 2611, 2672, 2683, 2900, 2934, 2946, 3012, 3108, 3114, 3231, 3238, 3307, 3370, 3380, 3672, 3750, 3758, 3778, 3781, 3852, 3955, 4034], 'achieved': [833], 'library': [835], 'screening': [836], 'using': [837, 2471, 2949, 3195, 4036, 4114], 'an': [838, 989, 1211, 2290], 'oligonucleotide': [839], 'probe': [840], 'designed': [843, 2248], 'from': [844, 851, 1434, 1946, 2187, 2249, 2413, 2445, 2528, 2533, 3075, 3271, 3282, 3293, 3300, 3308, 3559, 3572, 3678, 4029, 4130, 4139, 4159], 'N-terminal': [846], 'amino': [847, 870, 1039, 1143, 1966], 'acid': [848, 2324, 2953], 'sequences': [849, 4162], 'obtained': [850, 1945, 3525], 'highly': [853, 4254], 'purified': [854, 2412, 2527], 'erythrocyte': [856, 884], 'transporter.': [858], 'cDNA': [863, 958, 1137, 2186, 2226], '(hENT1)': [864], 'encodes': [865, 1138], 'protein': [867, 1140, 2941, 3585, 4063], '456': [869, 1142], 'acids.': [871], 'this': [873, 1090, 1453, 1632, 1757, 3922], 'several': [878], 'similar': [879, 4084], 'molecular': [880, 4078], 'properties': [881, 1769], 'glucose': [885, 2857], '(GLUT1)': [887], '(7.Plagemann': [888], 'P.G.': [889, 1804, 1839, 1924, 2106, 3349, 3475], 'Wohlhueter': [890], 'R.M.': [891], 'Woffendin': [892], 'C.': [893, 1303, 2047, 3425, 4223, 4366], '1988;': [897, 909, 1875, 2125, 3493], '947:': [898], '405-443Crossref': [899], '(323)': [902], '8.Jarvis': [905], '249:': [910], '383-389Crossref': [911], '(25)': [914], 'Scholar),': [916, 1883], 'no': [919, 1610], 'homology': [920], 'GLUT1': [923], 'When': [956], 'expressed': [960, 1750, 3130, 3204, 4117], 'oocytes,': [962], 'dilazep,': [981], 'dipyridamole.': [983, 3764], 'confirms': [985], 'Sequence': [1025], 'search': [1026], 'GenBankTM': [1029], 'data': [1030, 3128, 3202], 'base': [1031], 'showed': [1032, 3330, 4045], 'exhibits': [1035], '48%': [1036, 1147], 'identity': [1037], 'acids': [1040, 1144], '38-kDa': [1043], 'mouse': [1044, 2648], 'HNP36': [1047, 1078, 1096], 'delayed-early': [1051], 'proliferative': [1052], 'response': [1053, 3251], 'gene': [1054], 'products': [1055], 'unknown': [1057], 'function': [1058, 1394, 3259], '(9.Williams': [1059], 'J.B.': [1060, 1353, 2999], 'Lanahan': [1061], 'A.A.': [1062], 'Res': [1065], 'Commun.': [1066, 3096], '1995;': [1067, 1376], '213:': [1068], '325-333Crossref': [1069], '(27)': [1072], 'suggests': [1076], 'may': [1079], 'belong': [1080], 'family': [1083], 'transporters.': [1087, 1772, 3327], 'Based': [1088], 'information,': [1091], 'homolog': [1094], 'subsequently': [1098], 'named': [1102, 2517], 'rENT2': [1103, 1136, 1191, 1201, 1209], '(10.Yao': [1104, 1155, 1215], 'S.Y.M.': [1105, 1156, 1216, 1504], 'Ng': [1106, 1157, 1217, 1505, 1710], 'A.M.L.': [1107, 1158, 1218, 1506], 'Muzyka': [1108, 1159, 1219, 1507], 'W.R.': [1109, 1160, 1220, 1508], 'Griffiths': [1110, 1161, 1221, 1509], 'Chem.': [1120, 1171, 1231, 1308, 1375, 1519, 1718, 1874, 2124, 2352, 3492, 4228, 4371], '272:': [1122, 1173, 1233, 1521, 2354], '28423-28430Abstract': [1123, 1174, 1234, 1522], 'Full': [1124, 1126, 1175, 1177, 1235, 1237, 1312, 1314, 1358, 1379, 1381, 1523, 1525, 1722, 1878, 2128, 2356, 2358, 3496, 4232, 4234], 'Text': [1125, 1127, 1176, 1178, 1236, 1238, 1313, 1315, 1359, 1380, 1382, 1524, 1526, 1723, 1879, 2129, 2357, 2359, 3497, 4233, 4235], 'PDF': [1128, 1179, 1239, 1316, 1360, 1383, 1527, 1724, 1880, 2130, 2360, 3498, 4236], '(195)': [1131, 1182, 1242, 1530], 'identical': [1148], '(rENT1)': [1154], 'Like': [1185], 'hENT1,': [1186], 'nucleosides.': [1199, 1622], 'However,': [1200], 'inhibition,': [1206, 4258], 'suggesting': [1207, 3920], 'HNP36,': [1247], 'now': [1248], 're-named': [1249], 'hENT2,': [1250, 4022], 'also': [1252, 1284, 1859, 3547], 'functionally': [1254], 'oocytes': [1257, 1470], '(11.Griffiths': [1258], 'Abidi': [1262, 1537, 4199, 4341], 'F.': [1263, 1538, 4200, 4342], 'Phillips': [1264, 1539, 4201, 4343], 'S.E.': [1265, 1540, 3134, 3208, 4001, 4202, 4344], '328:': [1275, 1550, 4212, 4354], '739-743Crossref': [1276, 1551, 4213, 4355], '(226)': [1279, 1554, 4216, 4358], 'independently': [1286], 'functional': [1289, 1458], 'complementation': [1290], 'transport-deficient': [1293, 1818, 3389], 'CEM': [1294], '(12.Crawford': [1298], 'C.R.': [1299, 1709, 4219, 4362], 'Patel': [1300, 4220, 4363], 'D.H.': [1301, 4221, 4364], 'Naeve': [1302, 4222, 4365], 'Belt': [1304, 1714, 4224, 4367], 'J.A.': [1305, 1349, 1715, 1869, 2119, 3487, 4225, 4368], '273:': [1310, 4230], '5288-5293Abstract': [1311, 4231], '(197)': [1319, 4239], 'shown': [1329, 3362, 3517, 3731, 3766, 4040, 4250], 'indirectly': [1331], 'affect': [1332], 'chloride': [1333], 'secretion': [1334], 'regulating': [1336], 'extracellular': [1337], 'potent': [1341], 'secretagogue,': [1342], '(13.Tally': [1344], 'K.J.': [1345, 2997], 'Hrnjez': [1346], 'B.J.': [1347], 'Smith': [1348], 'Mun': [1350], 'E.C.': [1351, 2995], 'Matthews': [1352, 2998], 'Surgery.': [1354], '120:': [1356], '248-254Abstract': [1357], '(14)': [1363], 'Scholar,14.Strohmeier': [1365], 'G.R.': [1366], 'Reppert': [1367], 'Lencer': [1369], 'W.I.': [1370], 'Madara': [1371], '270:': [1377], '2387-2394Abstract': [1378], '(191)': [1386], 'Recently,': [1389], 'we': [1390, 1739, 3316, 3595], 'demonstrated': [1392, 1569, 3835], 'message': [1397], 'expression': [1398, 2091, 2335, 4243], 'colonic': [1402, 2191], 'secretory': [1403], 'epithelial': [1404, 1777, 1940, 2192], 'T84,': [1406], 'express': [1407, 1649, 4019], '(3.Ward': [1412, 1437, 2198, 2253], 'then': [1428, 2072, 2443, 2556, 2731, 2799, 2901, 3013, 3023, 3073, 3451], 'full-length': [1430, 2185], 'T84': [1435, 2189], 'At': [1452], 'time,': [1454], 'most': [1455], 'characterization': [1459], 'performed': [1468, 4035], '10.Yao': [1503], '11.Griffiths': [1533, 4195, 4337], 'believed': [1563], 'selective': [1567], 'competition': [1571], 'studies,': [1572, 3201], 'kinetics': [1574], 'natural': [1578, 3975], 'inosine,': [1583], 'not': [1589, 1596, 3383, 3527, 3563, 3902, 3908, 4050], 'yet': [1590, 1597], 'characterized.': [1592, 3515], 'These': [1593, 2464], 'established': [1599], '“permeants”': [1601], 'ENT2,': [1605, 3843], 'direct': [1611], 'measurement': [1612], 'radioactive': [1618], 'forms': [1619], 'Physiologically,': [1623], 'poorly': [1629], 'defined': [1630], 'process': [1633], 'normally': [1635], 'multiple': [1650, 3223], 'including': [1654], 'other': [1657, 3077, 3931], 'Na-dependent': [1658], '15.Crawford': [1708], 'C.Y.': [1711], 'Noel': [1712, 1870, 2120, 3488], 'L.D.': [1713, 1871, 2121, 3489], '1990;': [1719], '265:': [1720], '9732-9736Abstract': [1721], 'present': [1737], 'study,': [1738], 'generated': [1740, 3317, 3598], 'line': [1743, 2194, 3321, 3416, 3524, 3546, 3602], 'deficient': [1744, 1908, 3322, 3417], 'all': [1746, 2011, 3324], 'endogenous': [1747, 1785, 1910, 2085, 3325, 3342, 3419], 'transporters,': [1749], 'null': [1758], 'model,': [1760], 'fully': [1762], 'biochemical,': [1765], 'pharmacological,': [1766], 'kinetic': [1768], 'swine': [1774, 1937], 'kidney': [1775, 1938], 'tubular': [1776, 1939], 'line,': [1779, 1942, 3391], 'PK15,': [1780, 1943], 'used': [1782, 1861, 3219, 3406], 'because': [1783], 'well': [1791], 'consists': [1794], 'only': [1796, 3341], '(16.Aran': [1801, 3346], 'J.M.': [1802, 1837, 1922, 2104, 3347, 3473], 'Plagemann': [1803, 1838, 1920, 1923, 2105, 3348, 3474], '1992;': [1808, 1843, 1928, 2110, 3353, 3479], '1108:': [1809, 3354], '67-74Crossref': [1810, 3355], '(8)': [1813, 1848, 1933, 2115, 3358, 3484], 'Thus,': [1816], 'mutant': [1819, 3319, 3410, 3522, 3544, 3621, 3683], 'can': [1820, 4300], 'isolated': [1822], 'single': [1825], 'step': [1826], 'chemical': [1828], 'mutagenesis': [1829], 'followed': [1830, 2398, 2488, 2565, 2871, 2903], 'selection': [1832, 1894, 2158], 'cytotoxic': [1834, 2161], '(17.Aran': [1836, 1921, 2103, 3472], '1110:': [1844, 1929, 2111, 3480], '51-58Crossref': [1845, 1930, 2112, 3481], 'contrast': [1852, 3876], 'lymphoma': [1854], 'lines': [1856], 'generating': [1863, 3468], '(18.Belt': [1868], '263:': [1876, 2126, 3494], '13819-13822Abstract': [1877, 2127, 3495], 'PK15': [1884, 1906, 2022, 2166, 3332, 3368, 3392, 3510, 3538, 3575, 3681], 'adherent': [1887], 'easy': [1890], 'transfection': [1892], 'positively': [1896], 'antibiotics.': [1900], 'success': [1902, 2493], 'isolation': [1904], 'previously': [1914, 3404, 3465], 'Aran': [1918], 'ATCC': [1947], '(Manassas,': [1948], 'VA).': [1949], 'Cells': [1950, 2921], 'were': [1951, 1994, 2005, 2032, 2071, 2148, 2168, 2247, 2281, 2367, 2410, 2442, 2466, 2477, 2516, 2526, 2617, 2642, 2695, 2730, 2798, 2812, 2864, 2910, 2922, 2966, 3022, 3047, 3072, 3150, 3218, 3253, 3264, 3269, 3281, 3292, 3298, 3394, 3450, 3512, 3705, 3711, 3822], 'maintained': [1952, 2317], "Eagle's": [1954], 'essential': [1956], "medium/Earles's": [1957], 'Balanced': [1958], 'Salt': [1959], 'Solutions': [1960], '(1:1),': [1961], 'mm': [1964, 1969, 2544, 2587, 2629, 2632, 2748, 2765], 'non-essential': [1965], 'acids,': [1967], 'sodium': [1970, 2545, 2588, 2749, 2766], 'pyruvate,': [1971], '5%': [1972, 1985, 2637, 2929], 'fetal': [1973], 'bovine': [1974], 'serum,': [1975], 'penicillin/streptomycin': [1976], '(50,000': [1977], 'units/liter,': [1978], 'mg/liter),': [1980], 'at': [1981, 2384, 2389, 2395, 2454, 2561, 2575, 2773, 2991, 3065, 3635, 3652, 3825], '°C': [1983, 2401, 2775], 'CO2': [1986], '95%': [1988], 'air.': [1989], 'For': [1990, 2505, 2956, 3040, 3198, 3842], 'experiments,': [1992], 'grown': [1995, 2024, 2960], 'plastic': [1997], '12-': [1998], 'or': [1999, 2220, 2753, 2894, 3274, 3968, 4021], '24-well': [2000, 2964], 'culture': [2001, 2152, 2486, 3288], 'plates': [2002, 2909, 2965], '(Falcon).': [2003], 'Media': [2004], 'changed': [2006], 'every': [2007], '3–4': [2008], 'days,': [2009], 'fed': [2013], 'day': [2016], 'prior': [2017], 'experiments.': [2019, 3211], 'Active': [2020], 'proliferating': [2021], '50%': [2026], 'confluency': [2027], 'T75': [2030], 'flask': [2031], 'incubated': [2033, 2643, 2661, 2732, 3048], '20': [2035, 2989, 3063], 'h': [2036, 2772], 'complete': [2038], 'media': [2039, 3289], '0.025%': [2041, 3397], '(v/v)': [2042], 'ethylmethanesulfonate': [2043, 3402], '(19.Pouyssegur': [2044, 3422], 'Sardet': [2046, 3424], 'Franchi': [2048, 3426], "L'Allemain": [2050, 3428], 'G.': [2051, 2343, 3429], 'Paris': [2052, 3430], 'S.': [2053, 2059, 2598, 2715, 2783, 3431, 3437], 'Proc.': [2054, 3432], 'Natl.': [2055, 3433], 'Acad.': [2056, 3434], 'Sci.': [2057, 3435], 'U.': [2058, 3436], '1984;': [2061, 3097, 3439], '81:': [2062, 3440], '4833-4837Crossref': [2063, 3441], '(439)': [2066, 3444], 'allowed': [2073], 'proliferate': [2075], '7-days,': [2077], 'allowing': [2078], 'sufficient': [2079], 'time': [2080, 3720], 'phenotype': [2095], 'had': [2099, 3577], 'mutated': [2101], 'successfully': [2102, 3597], '18.Belt': [2118], 'After': [2134, 2622, 3502], '7': [2135], 'days': [2136], '(AraC)': [2141], '(1': [2142, 2146, 3626], 'tubercidin': [2145, 3456], 'added': [2149], 'medium.': [2153], 'Following': [2154], '3': [2155, 2771, 2912, 3503], 'weeks': [2156, 3504], 'clones': [2163, 3507], 'surviving': [2165, 3509], 'expanded': [2169, 3513], 'screened': [2171, 3712], 'lack': [2174], 'uptake.': [2178], 'cloning': [2180], 'Total': [2213], 'RNA': [2214], 'annealed': [2216], 'either': [2218], 'oligo(dT)12–18': [2219], 'random': [2221], 'hexanucleotides,': [2222], 'first': [2224], 'strand': [2225], 'synthesis': [2227], 'carried': [2229, 2368, 2813], 'out': [2230, 2369, 2814], 'Superscript': [2232], 'II': [2233], 'RNase': [2234], 'H−': [2235], 'Reverse': [2236], 'Transcriptase': [2237], '(SuperScript': [2238], 'Preamplification': [2239], 'System,': [2240], 'Life': [2241, 3275, 3294], 'Technologies,': [2242, 2474, 3276, 3295], 'Inc.).': [2243, 2475], 'Primers': [2244], 'published': [2251], 'sequence': [2252, 2329], 'Scholar)': [2267, 4113], '(GenBankTMaccession': [2268], 'U81375)': [2270], 'CCATGACAACCAGTCACCAGC': [2271], '(5′-primer)': [2272, 2283], 'CTCGAG': [2274, 2285], 'ACAATTGCCCGGAACAGG': [2275], '(3′-primer).': [2276, 2287], 'primers': [2278], 'CTTTCACCCCAGGCGCATCC': [2282], 'AGCAGCGCCTTGAAGAGG': [2286], 'Note': [2288], 'XhoI': [2291, 2300], 'site': [2292, 2301], '(underlined)': [2293], 'included': [2295], '3′-primer.': [2298], 'changes': [2302], 'stop': [2304], 'codon': [2305], 'serine': [2308], 'residue': [2309], 'allows': [2311], 'reading': [2313], 'frame': [2314], 'read': [2319], 'through': [2320], 'C-terminal': [2322], '11-amino': [2323], 'VSVG': [2325, 2650, 2805, 4037, 4047], 'tag': [2326], 'when': [2327], 'subcloned': [2331], 'eukaryotic': [2334], 'vector': [2336, 2448], 'PECE/VSVG': [2337, 2421], '(20.Yip': [2338], 'J.W.': [2339], 'Ko': [2340], 'W.H.': [2341], 'Viberti': [2342], 'Huganir': [2344], 'R.L.': [2345], 'Donowitz': [2346, 2599, 2716, 2784], 'C.-M.': [2349], '18473-18480Abstract': [2355], 'Reactions': [2366], 'PE/Applied': [2372], 'Biosystems': [2373, 2434], 'GeneAmp': [2374], '9700': [2375], '(Foster': [2376], 'City,': [2377], 'CA)': [2378], '30': [2380, 2573], 'cycles': [2381], '(45': [2382], 's': [2383, 2388], '94': [2385], '°C,': [2386, 2391], '55': [2390], '1.5': [2393], 'min': [2394, 2560, 2574, 2707, 2874, 2906, 2990, 3064, 3756], '72': [2396, 2400], '°C),': [2397], '10': [2403, 2559, 2706, 2834, 2856, 2873, 2896, 2978, 2984, 3056, 3657, 3667, 3755, 3762], 'min.': [2404], 'Full-length': [2405], 'cDNAs': [2409], 'excised,': [2411], 'gel,': [2415], 'digested': [2416], 'withXhoI,': [2417], 'vector,': [2422], 'subjected': [2424], 'fluorescent': [2426], 'sequencing': [2427], "manufacturer's": [2431], 'protocols': [2432], '(PE/Applied': [2433], '377': [2435], 'Automated': [2436], 'DNA': [2437], 'sequencer).': [2438], 'hENT1/VSVG': [2439], 'hENT2/VSVG': [2441], 'excised': [2444], 'PECE': [2447], 'ligated': [2450], 'pcDNA3': [2452], '(Invitrogen)': [2453], 'HindIII/XbaI': [2456], 'sites,': [2457], 'creating': [2458], 'constructs': [2460, 2465], 'hENT1/VSVG/pcDNA3': [2461, 3696], 'hENT2/VSVG/pcDNA3.': [2463], 'LipofectAMINE': [2472], '(Life': [2473], 'Clones': [2476], 'selected': [2478, 3452, 3706], 'adding': [2480], '0.5': [2481], 'mg/ml': [2482], 'G418': [2483, 3708], 'medium,': [2487], 'evaluation': [2490], 'reconstitution': [2495], '(10': [2498, 3630, 3717, 3772, 3945, 3949], 'μm)-sensitive': [2499, 3627, 3946], 'simplicity,': [2506], 'Crude': [2524], 'membranes': [2525, 2641, 2692, 2729, 2797, 3044, 3557, 3676, 4028], 'untransfected': [2529, 4053], 'lysis': [2539], 'sonication': [2541], '5': [2543, 2586, 2654, 2824, 2837, 2847, 2849], 'phosphate': [2546, 2589], '(pH': [2547, 2634, 2751, 2768, 2839, 2858, 2919], '8)': [2548], 'containing': [2549, 2627, 2647, 2819, 2882], 'protease': [2550], 'inhibitors.': [2551], 'lysate': [2554], 'centrifuged': [2557], '3,000': [2562], '×': [2563, 2577], 'g': [2564], 'centrifugation': [2567], 'resulting': [2570], 'supernatant': [2571], '30,000': [2576], 'g.': [2578], 'final': [2580], 'pellet': [2581], 'fine-needle': [2583], 'homogenized': [2584], 'buffer': [2590, 2646, 2842], '(21.Tse': [2591, 2708, 2776], 'Levine': [2593, 2710, 2778], 'Yun': [2595, 2712, 2780], 'C.H.': [2596, 2713, 2781], 'Khurana': [2597, 2714, 2782], 'Biochemistry.': [2601, 2718, 2786], '33:': [2603, 2720, 2788], '12954-12961Crossref': [2604, 2721, 2789], '(76)': [2607, 2724, 2792], 'SDS-PAGE': [2610], 'performed,': [2612], 'after': [2613, 3120], 'proteins': [2616, 4070], 'transferred': [2618], 'onto': [2619], 'nitrocellulose': [2620], 'membranes.': [2621, 4056], 'blocking': [2623, 2645], 'Tris-buffered': [2625], 'saline': [2626, 2918], '150': [2628], 'NaCl,': [2630, 2823], 'Tris-HCl': [2633], '7.5)': [2635, 2752], '(TBS),': [2636], 'non-fat': [2638], 'dry': [2639], 'milk,': [2640], 'P5D4': [2649], 'monoclonal': [2651], 'antibody,': [2652], 'washed': [2653, 2674, 2865, 2911, 3024], 'times': [2655, 2867, 2913], 'TBS,': [2657, 2676], '0.02%': [2658, 2677], 'Triton': [2659, 2678, 2930], 'X-100,': [2660, 2679, 2931], 'horseradish': [2663], 'peroxidase-conjugated': [2664], 'goat': [2665], 'anti-mouse': [2666], 'secondary': [2667, 2670], 'antibody.': [2668, 4038], 'Excess': [2669], 'antibody': [2671, 2806, 4048, 4058], 'extensively': [2673], 'antigen': [2681], 'reactivity': [2682], 'detected': [2684], 'enhanced': [2686], 'chemiluminescence.': [2687], '(20': [2693], 'μg)': [2694, 3046], 'denatured': [2696, 2728], '0.5%': [2698], 'SDS': [2699], '1%': [2701, 2743], 'β-mercaptoethanol': [2702], 'boiling': [2704], '500': [2734, 2755], 'units': [2735, 2756], 'PNGase': [2737, 4120], '(New': [2739, 2760], 'England': [2740, 2761], 'Biolabs)': [2741], 'Nonidet': [2744], 'P-40': [2745], 'citrate': [2750, 2767], 'Endo': [2758, 4123], 'Biolab)': [2762], '5.5)': [2769], 'endoglycosidase-treated': [2796], 'analyzed': [2800], 'Western': [2802, 4023], 'blotting': [2803], 'above.': [2809], 'All': [2810, 3266], 'experiments': [2811, 3140, 4044], 'HEPES-buffered': [2816, 2869, 2880], "Ringer's": [2817], 'solution': [2818, 2881], '(in': [2820, 2844], 'mm)': [2821, 2845], '135': [2822], 'KCl,': [2825], '3.33': [2826], 'NaH2PO4,': [2827], '0.83': [2828], 'Na2HPO4,': [2829], '1.0': [2830, 2832, 2851, 2853], 'CaCl2,': [2831, 2852], 'MgCl2,': [2833, 2854], 'glucose,': [2835], 'HEPES': [2838], '7.4).': [2840, 2859, 2920], 'Na+-free': [2841], 'contained': [2843], '140N-methyl-d-glucamine,': [2846], 'HEPES,': [2848], 'KH2PO4,': [2850], 'Confluent': [2860], 'monolayers': [2861, 2945], 'three': [2866, 3210], 'solution,': [2870], 'preincubation': [2875], 'same': [2878], 'buffer.': [2879], 'varying': [2883, 2972, 3050], '3H-nucleosides': [2886], '(2': [2887, 3786], 'μCi/ml,': [2888, 3633, 3952], 'μm': [2891, 2897, 2985, 3059, 3375, 3668, 3763], '(ENT1)': [2893], '(ENT2))': [2899], 'added,': [2902], 'incubation,': [2907], 'rapidly': [2914, 3025], 'ice-cold': [2916, 3027], 'phosphate-buffered': [2917, 3029], 'solubilized': [2923, 3031], 'overnight': [2924], 'ml': [2927, 2970], 'radioactivity': [2933, 3106], 'measured': [2935, 3634, 3651, 3956], 'β-scintillation': [2938, 3118], 'counter.': [2939], 'content': [2942], 'representative': [2944], 'determined': [2947, 3673], 'spectrophotometrically': [2948], 'commercial': [2951], 'bicinchoninic': [2952], 'assay': [2954], '(Pierce).': [2955], 'confluence': [2962], 'exposed': [2967], '(0.03': [2976, 3054], 'nm)': [2979], 'without': [2982], 'non-radioactive': [2986, 3784], 'room': [2992, 3066, 3636], 'temperature': [2993, 3637], '(22.Mun': [2994], 'Tally': [2996], 'Am.': [3000], 'Physiol.': [3002], '274:': [3004], 'G261-G269PubMed': [3005], 'μl': [3009], 'removed': [3014], 'determining': [3016], 'free': [3017, 3070], 'concentrations.': [3019], 'isotonic': [3028], 'saline,': [3030], 'm': [3034, 3146], 'NaOH,': [3035], 'counted': [3037, 3115], 'radioactivity.': [3039], 'membranes,': [3043], '(100': [3045], '±10': [3058], 'nonradioactive': [3060, 3669, 3974], 'NBMPR)': [3061, 3670], 'temperature.': [3067], 'Bound': [3068], 'separated': [3074], 'rapid': [3079], 'filtration': [3080], 'Whatman': [3082], 'GF/B': [3083], 'filters': [3084, 3111], '(23.Shi': [3085], 'M.M.': [3086], 'Wu': [3087], 'J.S.': [3088], 'Lee': [3089], 'Res.': [3095], '118:': [3098], '594-600Crossref': [3099], '(24)': [3102], 'retained': [3109], '(bound': [3112], '[3H]NBMPR)': [3113], 'counter': [3119], 'dissolving': [3121], 'Liquiscint': [3123], '(National': [3124], 'Diagnostics).': [3125], 'Nucleoside': [3126], 'means': [3132, 3206], 'triplicate': [3136], 'estimates': [3137], 'individual': [3139], '(n': [3141], '=': [3142, 3799, 3802, 3858, 3870], '3–4).': [3143], 'Apparent': [3144], 'andV': [3147], 'max': [3148], 'values': [3149, 3263], 'calculated': [3151], 'non-linear': [3153], 'regression': [3154], 'analysis': [3155, 3215, 3242, 4025], 'v': [3158, 3175], 'v/s': [3160], 'plots': [3161], 'Hill': [3164, 3186], 'equation': [3165], '(v': [3166], '=V': [3167], 'max·[S]': [3168], 'n': [3169], '/(K′': [3170], '+': [3171], '[S]': [3172, 3181], 'n,': [3173], 'rate': [3178], 'of3H-nucleoside': [3179], 'uptake,': [3180, 3828], 'substrate': [3183, 3910], 'concentration,n': [3184], 'coefficient,': [3187], 'K′': [3189], 'substrate)': [3194], 'Origin®': [3196], 'software.': [3197], "Student'st": [3212], 'test': [3213], 'variance': [3217], 'paired': [3221], 'variates,': [3224], 'An': [3226], 'overall': [3227], 'p': [3228], '<': [3229], '0.05': [3230], 'considered': [3232], 'significant.': [3233], 'Equilibrium': [3234], 'binding': [3235, 3552, 3568, 3580, 3615, 3645, 3650], 'transformed': [3239], 'Scatchard': [3241], 'calculate': [3244], 'B': [3248], 'max.': [3249], 'Concentration': [3250], 'curves': [3252], 'fit': [3254], '4-parameter': [3257], 'logistic': [3258], 'curve,': [3260], 'IC50': [3262], 'determined.': [3265], 'standard': [3267], 'chemicals': [3268], 'purchased': [3270, 3299], 'Sigma,': [3272], 'Fisher,': [3273], 'Inc.': [3277, 3296], 'Dipyridamole': [3278, 3944], 'Research': [3283], 'Biochemicals': [3284], '(Natick,': [3285], 'MA).': [3286], 'supplements': [3291], 'All3H-nucleosides': [3297], 'ICN': [3301], 'Pharmaceuticals': [3302], '(Irvine,': [3303], 'CA),': [3304], 'Moravek.': [3309], 'Since': [3310], 'Previous': [3328, 4242], 'studies': [3329, 4244], 'contain': [3334], 'As': [3361, 3516, 3765, 4039], 'Fig.1,': [3364], 'completely': [3371, 3759], 'NBMPR.': [3376], '(data': [3382, 3901], 'shown).': [3384], 'To': [3385, 4013], 'generate': [3386, 3408], 'mutagenized': [3395, 3448], 'ethylmethanesulfonate.': [3398], 'Chinese': [3411], 'hamster': [3412], 'lung': [3413], 'fibroblast': [3414], 'Na+/H+': [3420], 'exchangers': [3421], 'AraC': [3454, 3817, 3879, 3893, 3906], 'under': [3459], '“Experimental': [3460], 'Procedures,”': [3461], 'Scholar,18.Belt': [3486], 'selection,': [3506], 'Fig.2': [3519], 'A,': [3520], 'did': [3526, 3562, 4049], 'exhibit': [3528], 'activity': [3532, 3553, 3581, 3616], 'seen': [3534], 'wild': [3536, 3573, 3679], 'type': [3537, 3574, 3680], '(28': [3540], 'pmol/mg': [3541, 3584], 'protein/min).': [3542], 'lacked': [3548], 'crude': [3556, 3675, 4027], 'prepared': [3558, 3677], 'any': [3565], 'specific': [3566, 3643], 'activity,': [3569], '0.7': [3583], '(Fig.': [3586], 'B).': [3588], 'nucleosidetransporter-defficient': [3600], 'designated': [3605], 'PK15NTD.Figure': [3607], '2Absence': [3608], 'uridine': [3610, 3628, 3800, 3827, 3856, 3947], '[3H]': [3613], 'PK15NTD.': [3623], 'μm,': [3631, 3950], 'min)': [3640, 3954], '(A)': [3641], '(the': [3646], 'saturating': [3654], 'presence': [3662], 'absence': [3665, 3963], '(B)': [3671], 'cells.View': [3685], 'Large': [3686, 4005], 'Image': [3687, 4006], 'Figure': [3688, 4007], 'ViewerDownload': [3689, 4008], 'Hi-res': [3690, 4009], 'image': [3691, 4010], 'Download': [3692, 4011], '(PPT)': [3693, 4012], 'hENT2/VSVG/pcDNA3': [3698], 'Positively': [3702], 'dipyridamole-sensitive': [3714], 'μm).': [3718], 'course': [3721], 'Fig.': [3733, 3768], '3.': [3734], '2.2-fold': [3741], 'faster': [3742], 'ENT1,': [3744, 3878], 'linear': [3751], '4,': [3769], 'μm;': [3773], 'μCi/ml)': [3775], 'mm),': [3787], 'rank': [3790], 'order': [3791, 3845], 'potency': [3793, 3847], '(97%↓)': [3795], '>': [3796, 3805, 3808, 3855, 3861, 3864, 3867, 3872], '(92%↓)': [3798], '(91%↓)': [3801], 'guanosine': [3803, 3873], '(90%↓)': [3804], 'thymidine': [3806, 3865], '(87%↓)': [3807, 3857], 'cytidine': [3809, 3862], '(81%↓).': [3810], 'analog': [3813], 'drugs': [3814, 3990], 'AZT': [3815, 3868], '(72%↓),': [3816], '(46%↓),': [3818], '5-FdUrd': [3820, 3871], '(61%↓)': [3821], 'less': [3823], 'effective': [3824], 'inhibiting': [3826, 3849], 'nucleobases': [3831], 'uracil': [3834, 3933], 'insignificant': [3836, 3935], '(15': [3838], '10%,': [3840], 'respectively).': [3841], '(94%↓)': [3854], '(84%↓)': [3860], '(76%↓)': [3863], '(70%↓)': [3866], '(53%↓)': [3869], '(35%↓).': [3874], 'minimally': [3880], '(12%↓)': [3884], 'ENT2.': [3886, 3912, 3928], 'Furthermore,': [3887], 'ENT2-transfected': [3888], 'insensitive': [3891], 'cytotoxicity,': [3894], 'shown),': [3903], 'indicating': [3904], '55%,': [3919], 'transported': [3926], 'On': [3929], 'hand,': [3932], '(12%↓).Figure': [3937], '4Substrate': [3938], 'selectivity': [3939], 'hENT2.': [3943], '(Control': [3964], 'No': [3966], 'Na+)': [3967], 'simultaneous': [3969], 'addition': [3970], 'mmcompeting': [3973], '(uridine,': [3977], 'inosine),': [3983], '(hypoxanthine': [3985], 'uracil),': [3987], '(AZT,': [3991], 'AraC,': [3992], '5-FdUrd).': [3994], 'Each': [3995], 'value': [3996], 'mean': [3999], 'four': [4003], 'experiments.View': [4004], 'confirm': [4014], 'blot': [4024], 'Fig.5,': [4042], 'control': [4043], 'cross-react': [4051], 'recognized': [4059], 'apparent': [4077], 'size': [4079], 'very': [4083], 'reported': [4087], 'Vickers': [4089], 'et': [4090], 'al.': [4091], '(24.Vickers': [4092], 'M.F.': [4093], 'Mani': [4094], 'R.S.': [4095], 'Hogue': [4098], 'D.L.': [4099], '339:': [4109], '21-32Crossref': [4110], 'recombinant': [4115], 'yeast.': [4119], 'increased': [4125], 'mobility': [4127], 'result': [4148], 'confirmed': [4149], 'glycoproteins,': [4156], 'primary': [4161], 'Scholar,12.Crawford': [4218], '12.Crawford': [4361]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W1973985383', 'counts_by_year': [{'year': 2024, 'cited_by_count': 11}, {'year': 2023, 'cited_by_count': 8}, {'year': 2022, 'cited_by_count': 11}, {'year': 2021, 'cited_by_count': 10}, {'year': 2020, 'cited_by_count': 15}, {'year': 2019, 'cited_by_count': 8}, {'year': 2018, 'cited_by_count': 8}, {'year': 2017, 'cited_by_count': 11}, {'year': 2016, 'cited_by_count': 10}, {'year': 2015, 'cited_by_count': 15}, {'year': 2014, 'cited_by_count': 7}, {'year': 2013, 'cited_by_count': 13}, {'year': 2012, 'cited_by_count': 12}], 'updated_date': '2024-12-15T22:59:40.780212', 'created_date': '2016-06-24'}