Publication Information

{'id': 'https://openalex.org/W1970631193', 'doi': 'https://doi.org/10.1074/jbc.m705053200', 'title': 'Direct Protein Kinase C-dependent Phosphorylation Regulates the Cell Surface Stability and Activity of the Potassium Chloride Cotransporter KCC2', 'display_name': 'Direct Protein Kinase C-dependent Phosphorylation Regulates the Cell Surface Stability and Activity of the Potassium Chloride Cotransporter KCC2', 'publication_year': 2007, 'publication_date': '2007-08-11', 'ids': {'openalex': 'https://openalex.org/W1970631193', 'doi': 'https://doi.org/10.1074/jbc.m705053200', 'mag': '1970631193', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/17693402'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m705053200', 'pdf_url': 'http://www.jbc.org/article/S0021925820717357/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_indexed_in_scopus': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820717357/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5025001480', 'display_name': 'Henry H.C. Lee', 'orcid': 'https://orcid.org/0000-0003-4975-7330'}, 'institutions': [{'id': 'https://openalex.org/I79576946', 'display_name': 'University of Pennsylvania', 'ror': 'https://ror.org/00b30xv10', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I79576946']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Henry H.C. Lee', 'raw_affiliation_strings': ['Department of Neuroscience, School of Medicine, University of Pennsylvania, Pennsylvania 19104'], 'affiliations': [{'raw_affiliation_string': 'Department of Neuroscience, School of Medicine, University of Pennsylvania, Pennsylvania 19104', 'institution_ids': ['https://openalex.org/I79576946']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5061451631', 'display_name': 'Joshua A. Walker', 'orcid': 'https://orcid.org/0000-0003-0787-0298'}, 'institutions': [{'id': 'https://openalex.org/I79576946', 'display_name': 'University of Pennsylvania', 'ror': 'https://ror.org/00b30xv10', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I79576946']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Joshua A. Walker', 'raw_affiliation_strings': ['Department of Neuroscience, School of Medicine, University of Pennsylvania, Pennsylvania 19104'], 'affiliations': [{'raw_affiliation_string': 'Department of Neuroscience, School of Medicine, University of Pennsylvania, Pennsylvania 19104', 'institution_ids': ['https://openalex.org/I79576946']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5083337691', 'display_name': 'Jeffery Williams', 'orcid': 'https://orcid.org/0009-0003-7556-6471'}, 'institutions': [{'id': 'https://openalex.org/I84218800', 'display_name': 'University of California, Davis', 'ror': 'https://ror.org/05rrcem69', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I84218800']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Jeffery R. Williams', 'raw_affiliation_strings': ['Department of Physiology and Membrane Biology, University of California, Davis, California 95616-8644'], 'affiliations': [{'raw_affiliation_string': 'Department of Physiology and Membrane Biology, University of California, Davis, California 95616-8644', 'institution_ids': ['https://openalex.org/I84218800']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5014491227', 'display_name': 'Richard J Goodier', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I84218800', 'display_name': 'University of California, Davis', 'ror': 'https://ror.org/05rrcem69', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I84218800']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Richard J. Goodier', 'raw_affiliation_strings': ['Department of Physiology and Membrane Biology, University of California, Davis, California 95616-8644'], 'affiliations': [{'raw_affiliation_string': 'Department of Physiology and Membrane Biology, University of California, Davis, California 95616-8644', 'institution_ids': ['https://openalex.org/I84218800']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5109158498', 'display_name': 'John A. Payne', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I84218800', 'display_name': 'University of California, Davis', 'ror': 'https://ror.org/05rrcem69', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I84218800']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'John A. Payne', 'raw_affiliation_strings': ['Department of Physiology and Membrane Biology, University of California, Davis, California 95616-8644'], 'affiliations': [{'raw_affiliation_string': 'Department of Physiology and Membrane Biology, University of California, Davis, California 95616-8644', 'institution_ids': ['https://openalex.org/I84218800']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5020338130', 'display_name': 'Stephen J. Moss', 'orcid': 'https://orcid.org/0000-0001-7459-3644'}, 'institutions': [{'id': 'https://openalex.org/I45129253', 'display_name': 'University College London', 'ror': 'https://ror.org/02jx3x895', 'country_code': 'GB', 'type': 'education', 'lineage': ['https://openalex.org/I124357947', 'https://openalex.org/I45129253']}, {'id': 'https://openalex.org/I79576946', 'display_name': 'University of Pennsylvania', 'ror': 'https://ror.org/00b30xv10', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I79576946']}], 'countries': ['GB', 'US'], 'is_corresponding': False, 'raw_author_name': 'Stephen J. Moss', 'raw_affiliation_strings': ['Department of Neuroscience, School of Medicine, University of Pennsylvania, Pennsylvania 19104', 'Department of Pharmacology, University College London, WC1E 6BT, United Kingdom'], 'affiliations': [{'raw_affiliation_string': 'Department of Pharmacology, University College London, WC1E 6BT, United Kingdom', 'institution_ids': ['https://openalex.org/I45129253']}, {'raw_affiliation_string': 'Department of Neuroscience, School of Medicine, University of Pennsylvania, Pennsylvania 19104', 'institution_ids': ['https://openalex.org/I79576946']}]}], 'institution_assertions': [], 'countries_distinct_count': 2, 'institutions_distinct_count': 3, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 4.326, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 281, 'citation_normalized_percentile': {'value': 0.839006, 'is_in_top_1_percent': False, 'is_in_top_10_percent': False}, 'cited_by_percentile_year': {'min': 98, 'max': 99}, 'biblio': {'volume': '282', 'issue': '41', 'first_page': '29777', 'last_page': '29784'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10077', 'display_name': 'Neuroscience and Neuropharmacology Research', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2804', 'display_name': 'Cellular and Molecular Neuroscience'}, 'field': {'id': 'https://openalex.org/fields/28', 'display_name': 'Neuroscience'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10077', 'display_name': 'Neuroscience and Neuropharmacology Research', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2804', 'display_name': 'Cellular and Molecular Neuroscience'}, 'field': {'id': 'https://openalex.org/fields/28', 'display_name': 'Neuroscience'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10493', 'display_name': 'Ion channel regulation and function', 'score': 0.9996, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11178', 'display_name': 'Receptor Mechanisms and Signaling', 'score': 0.9981, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [], 'concepts': [{'id': 'https://openalex.org/C188053792', 'wikidata': 'https://www.wikidata.org/wiki/Q3640664', 'display_name': 'Cotransporter', 'level': 3, 'score': 0.78216875}, {'id': 'https://openalex.org/C11960822', 'wikidata': 'https://www.wikidata.org/wiki/Q242736', 'display_name': 'Phosphorylation', 'level': 2, 'score': 0.6838689}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.63197786}, {'id': 'https://openalex.org/C517785266', 'wikidata': 'https://www.wikidata.org/wiki/Q703', 'display_name': 'Potassium', 'level': 2, 'score': 0.6283288}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.5026314}, {'id': 'https://openalex.org/C184235292', 'wikidata': 'https://www.wikidata.org/wiki/Q421851', 'display_name': 'Kinase', 'level': 2, 'score': 0.48454943}, {'id': 'https://openalex.org/C97029542', 'wikidata': 'https://www.wikidata.org/wiki/Q281417', 'display_name': 'Protein kinase A', 'level': 3, 'score': 0.46380925}, {'id': 'https://openalex.org/C2778695967', 'wikidata': 'https://www.wikidata.org/wiki/Q44791900', 'display_name': 'Chloride', 'level': 2, 'score': 0.46275613}, {'id': 'https://openalex.org/C1491633281', 'wikidata': 'https://www.wikidata.org/wiki/Q7868', 'display_name': 'Cell', 'level': 2, 'score': 0.43782258}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.4090963}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.22004244}, {'id': 'https://openalex.org/C537181965', 'wikidata': 'https://www.wikidata.org/wiki/Q658', 'display_name': 'Sodium', 'level': 2, 'score': 0.1337778}, {'id': 'https://openalex.org/C178790620', 'wikidata': 'https://www.wikidata.org/wiki/Q11351', 'display_name': 'Organic chemistry', 'level': 1, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D002462', 'descriptor_name': 'Cell Membrane', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D011189', 'descriptor_name': 'Potassium Chloride', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': True}, {'descriptor_ui': 'D011493', 'descriptor_name': 'Protein Kinase C', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D027981', 'descriptor_name': 'Symporters', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': True}, {'descriptor_ui': 'D001665', 'descriptor_name': 'Binding Sites', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002460', 'descriptor_name': 'Cell Line', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002462', 'descriptor_name': 'Cell Membrane', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004705', 'descriptor_name': 'Endocytosis', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004926', 'descriptor_name': 'Escherichia coli', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D004926', 'descriptor_name': 'Escherichia coli', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006624', 'descriptor_name': 'Hippocampus', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D006624', 'descriptor_name': 'Hippocampus', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000096922', 'descriptor_name': 'K Cl- Cotransporters', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008954', 'descriptor_name': 'Models, Biological', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009474', 'descriptor_name': 'Neurons', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D009474', 'descriptor_name': 'Neurons', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010766', 'descriptor_name': 'Phosphorylation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011189', 'descriptor_name': 'Potassium Chloride', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011493', 'descriptor_name': 'Protein Kinase C', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017434', 'descriptor_name': 'Protein Structure, Tertiary', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011963', 'descriptor_name': 'Receptors, GABA-A', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D011963', 'descriptor_name': 'Receptors, GABA-A', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D027981', 'descriptor_name': 'Symporters', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m705053200', 'pdf_url': 'http://www.jbc.org/article/S0021925820717357/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_indexed_in_scopus': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/17693402', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_indexed_in_scopus': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m705053200', 'pdf_url': 'http://www.jbc.org/article/S0021925820717357/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_indexed_in_scopus': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 28, 'referenced_works': ['https://openalex.org/W1504478980', 'https://openalex.org/W1588629441', 'https://openalex.org/W1815276265', 'https://openalex.org/W1975768945', 'https://openalex.org/W197906820', 'https://openalex.org/W1982841716', 'https://openalex.org/W1990567359', 'https://openalex.org/W1993323009', 'https://openalex.org/W1997207809', 'https://openalex.org/W2004933593', 'https://openalex.org/W2019909157', 'https://openalex.org/W2031483478', 'https://openalex.org/W2040159202', 'https://openalex.org/W2045535967', 'https://openalex.org/W2051429876', 'https://openalex.org/W2059067548', 'https://openalex.org/W2059895044', 'https://openalex.org/W2075976227', 'https://openalex.org/W2082903545', 'https://openalex.org/W2083308326', 'https://openalex.org/W2089880551', 'https://openalex.org/W2099218390', 'https://openalex.org/W2113500592', 'https://openalex.org/W2124252984', 'https://openalex.org/W2130493951', 'https://openalex.org/W2152632406', 'https://openalex.org/W2267979056', 'https://openalex.org/W2435285487'], 'related_works': ['https://openalex.org/W2790444519', 'https://openalex.org/W2414211301', 'https://openalex.org/W2395684592', 'https://openalex.org/W2264338901', 'https://openalex.org/W2176632303', 'https://openalex.org/W2070882743', 'https://openalex.org/W2059389639', 'https://openalex.org/W2051086962', 'https://openalex.org/W2041386649', 'https://openalex.org/W1965128339'], 'abstract_inverted_index': {'The': [0, 231, 569, 1454, 1652, 1696, 1882, 1897, 2042, 2089, 2218, 2467, 2693, 2728, 3057, 3122, 3285, 3691, 4137, 4853, 4954, 4970, 5731, 5952, 6054], 'potassium': [1, 232, 565, 4955], 'chloride': [2, 14, 233, 245, 528, 566, 4956], 'cotransporter': [3, 234, 485, 4171, 4957], 'KCC2': [4, 20, 70, 118, 134, 168, 192, 206, 235, 251, 301, 349, 365, 399, 423, 437, 689, 773, 784, 860, 927, 1016, 1052, 1085, 1112, 1135, 1158, 1172, 1197, 1216, 1427, 1540, 1551, 1563, 1713, 1719, 1909, 1991, 2533, 2751, 2787, 2833, 2977, 3196, 3213, 3217, 3253, 3273, 3288, 3311, 3348, 3430, 3440, 3448, 3528, 3562, 3599, 3642, 3650, 3720, 3766, 3781, 3795, 3805, 3907, 3931, 3967, 4010, 4015, 4054, 4085, 4132, 4140, 4157, 4175, 4229, 4261, 4279, 4292, 4306, 4337, 4348, 4361, 4373, 4402, 4418, 4432, 4477, 4566, 4581, 4590, 4613, 4650, 4660, 4678, 4775, 4798, 4840, 4895, 4929, 4948, 4958, 4973, 5050, 5110, 5135, 5324, 5347, 5432, 5457, 5485, 5520, 5539, 5593, 5620, 5663, 5672, 5704, 5724, 5737, 5762, 5778, 5852, 5866, 5884, 5927, 6005, 6052, 6065, 6109, 6147, 6239, 6265, 6302], 'plays': [5, 236, 4280, 6303], 'a': [6, 209, 237, 440, 691, 694, 1029, 1207, 1691, 1761, 1868, 1945, 1954, 2095, 2158, 2342, 2347, 2765, 2867, 2903, 3189, 3269, 3341, 3553, 3588, 4027, 4058, 4196, 4219, 4251, 4289, 4571, 4605, 4736, 4753, 4787, 4818, 5125, 5487, 5552, 5769, 5870, 5997, 6044, 6096, 6159], 'major': [7, 111, 238, 342, 1146, 2783, 2817, 2962, 3178, 3300, 3411, 4381, 4439, 4572, 4961, 5337, 5394, 5416, 5494, 5500, 5680], 'role': [8, 211, 239, 442, 1107, 1209, 3811, 4000, 4274, 5113, 5999, 6046, 6301], 'in': [9, 16, 46, 79, 122, 135, 169, 179, 212, 222, 240, 247, 277, 310, 353, 366, 400, 410, 443, 453, 521, 599, 777, 791, 793, 871, 923, 970, 975, 1110, 1174, 1184, 1215, 1217, 1225, 1376, 1423, 1620, 1662, 1702, 1714, 1927, 2015, 2065, 2157, 2289, 2352, 2368, 2399, 2407, 2587, 2591, 2604, 2633, 2735, 2838, 2850, 3044, 3100, 3165, 3199, 3207, 3214, 3234, 3274, 3316, 3327, 3347, 3381, 3403, 3681, 3755, 3815, 3841, 3974, 4003, 4033, 4064, 4100, 4146, 4260, 4281, 4336, 4403, 4419, 4433, 4464, 4478, 4594, 4612, 4662, 4719, 4740, 4758, 4794, 4919, 4930, 4967, 4975, 4991, 5049, 5055, 5118, 5328, 5351, 5358, 5428, 5441, 5477, 5480, 5521, 5532, 5535, 5555, 5587, 5599, 5673, 5708, 5722, 5981, 5990, 6003, 6016, 6050, 6085, 6102, 6133, 6224, 6304], 'the': [10, 30, 47, 58, 66, 98, 110, 129, 145, 153, 189, 194, 215, 223, 226, 241, 261, 278, 289, 297, 329, 341, 360, 376, 384, 420, 425, 446, 454, 457, 524, 561, 564, 600, 780, 801, 865, 924, 939, 1026, 1094, 1106, 1145, 1168, 1194, 1199, 1219, 1226, 1237, 1292, 1519, 1531, 1534, 1593, 1688, 1724, 1731, 1941, 1974, 2182, 2233, 2238, 2267, 2327, 2377, 2425, 2433, 2478, 2541, 2549, 2715, 2759, 2782, 2816, 2857, 2887, 2896, 2900, 2940, 2994, 3060, 3125, 3157, 3177, 3203, 3235, 3391, 3410, 3417, 3436, 3445, 3453, 3532, 3558, 3568, 3585, 3612, 3623, 3631, 3672, 3676, 3682, 3701, 3708, 3712, 3725, 3730, 3763, 3799, 3809, 3842, 3912, 3925, 3945, 3950, 3961, 3975, 3994, 3999, 4005, 4016, 4034, 4049, 4065, 4110, 4121, 4150, 4273, 4284, 4297, 4303, 4319, 4380, 4394, 4407, 4415, 4429, 4473, 4630, 4646, 4711, 4764, 4770, 4795, 4801, 4831, 4837, 4842, 4863, 4870, 4874, 4892, 4898, 4945, 4950, 4960, 4996, 5079, 5086, 5100, 5112, 5132, 5140, 5336, 5363, 5367, 5401, 5415, 5422, 5493, 5499, 5517, 5556, 5572, 5700, 5727, 5756, 5796, 5814, 5819, 5834, 5837, 5846, 5860, 5881, 5898, 5915, 5969, 5986, 6060, 6067, 6103, 6166, 6225, 6248, 6291, 6299, 6317, 6333], 'maintenance': [11, 242, 570, 2384, 2420], 'of': [12, 32, 57, 69, 102, 126, 133, 142, 150, 155, 166, 191, 205, 218, 228, 243, 263, 288, 300, 333, 357, 364, 373, 381, 386, 397, 422, 436, 449, 459, 526, 563, 571, 575, 587, 693, 703, 803, 859, 867, 926, 934, 941, 1015, 1022, 1028, 1031, 1091, 1099, 1108, 1150, 1155, 1191, 1196, 1213, 1222, 1239, 1277, 1521, 1533, 1539, 1550, 1562, 1676, 1679, 1712, 1763, 1766, 1836, 1863, 1919, 1947, 1973, 2085, 2102, 2116, 2134, 2142, 2147, 2184, 2235, 2349, 2419, 2435, 2532, 2540, 2671, 2701, 2706, 2750, 2767, 2786, 2832, 2870, 2886, 2899, 2906, 2908, 2999, 3059, 3076, 3086, 3094, 3098, 3117, 3124, 3142, 3151, 3160, 3195, 3205, 3237, 3244, 3272, 3287, 3302, 3324, 3331, 3350, 3354, 3363, 3377, 3393, 3421, 3427, 3439, 3447, 3456, 3526, 3550, 3561, 3580, 3597, 3617, 3625, 3633, 3641, 3686, 3694, 3703, 3716, 3737, 3765, 3780, 3792, 3804, 3812, 3844, 3850, 3885, 3914, 3930, 3949, 3960, 3966, 3977, 4001, 4007, 4018, 4030, 4038, 4051, 4053, 4069, 4077, 4112, 4123, 4131, 4139, 4153, 4190, 4228, 4244, 4278, 4286, 4291, 4299, 4305, 4311, 4321, 4332, 4347, 4353, 4360, 4367, 4372, 4383, 4400, 4409, 4417, 4431, 4441, 4476, 4574, 4600, 4622, 4629, 4638, 4649, 4656, 4690, 4702, 4708, 4713, 4755, 4766, 4774, 4782, 4797, 4810, 4833, 4839, 4856, 4865, 4876, 4883, 4894, 4900, 4914, 4947, 4963, 4972, 4986, 5053, 5088, 5092, 5103, 5127, 5134, 5142, 5346, 5398, 5409, 5414, 5421, 5436, 5456, 5463, 5472, 5489, 5496, 5503, 5519, 5549, 5558, 5563, 5574, 5619, 5662, 5685, 5689, 5699, 5703, 5729, 5733, 5753, 5761, 5775, 5792, 5798, 5811, 5816, 5821, 5839, 5848, 5865, 5873, 5877, 5883, 5904, 5917, 5926, 5955, 5973, 5988, 6056, 6064, 6083, 6108, 6144, 6171, 6227, 6252, 6259, 6296, 6319, 6338], 'transmembrane': [13, 244, 527, 4965], 'potential': [15, 246, 6177], 'mature': [17, 248], 'neurons;': [18, 249], 'thus': [19, 200, 250, 431, 6157], 'activity': [21, 252, 562, 1027, 1053, 1141, 1163, 1182, 4155, 4176, 4262, 4304, 4326, 4359, 4971, 5051, 5087, 5141, 5611, 5735, 5850, 5925, 6058, 6170], 'is': [22, 109, 173, 253, 340, 404, 579, 690, 774, 785, 798, 1017, 1119, 1136, 3003, 3185, 3424, 4591, 4749, 4934, 4959, 5091, 5325, 5486, 5506, 5594, 5720, 6013, 6127, 6148, 6240], 'critical': [23, 220, 254, 451, 1208, 5998, 6254, 6300], 'for': [24, 113, 116, 255, 344, 347, 581, 595, 1210, 1284, 1287, 1450, 1469, 1518, 1635, 1668, 1735, 1858, 1879, 1906, 2017, 2039, 2050, 2068, 2173, 2295, 2308, 2329, 2601, 2719, 2762, 2996, 3072, 3162, 3180, 3192, 3337, 3413, 3836, 3911, 4385, 4983, 5105, 6000, 6047, 6092, 6316, 6336, 6345], 'hyperpolarizing': [25, 256, 582, 804, 4984], 'membrane': [26, 257, 1097, 1893, 3695, 4844, 4857, 6070], 'currents': [27, 258, 584, 808, 945], 'generated': [28, 259, 1952], 'upon': [29, 260, 585, 3548, 4378, 5461, 5571, 5726, 5801, 5830], 'activation': [31, 262, 586, 1190, 3549, 4040, 4371, 4689, 4707, 4768, 4781, 4835, 5462, 5573, 5684, 5728, 5752, 5810, 5916, 6082], 'γ-aminobutyric': [33, 264, 473], 'acid': [34, 265, 474, 2485, 2600, 2949, 3006, 3135, 4560, 4673, 5382], 'type': [35, 266, 475], 'A': [36, 267, 2226, 2965, 3146, 3299, 4438], 'and': [37, 225, 268, 456, 523, 589, 697, 708, 937, 1044, 1087, 1122, 1162, 1253, 1266, 1271, 1308, 1404, 1410, 1414, 1445, 1506, 1530, 1548, 1560, 1598, 1611, 1638, 1650, 1671, 1704, 1717, 1768, 1839, 1845, 1872, 1963, 2026, 2035, 2077, 2144, 2169, 2179, 2251, 2271, 2278, 2311, 2339, 2364, 2395, 2414, 2441, 2450, 2452, 2463, 2477, 2494, 2557, 2561, 2565, 2569, 2581, 2643, 2668, 2674, 2703, 2717, 2743, 2776, 2823, 2947, 2966, 2972, 3048, 3052, 3078, 3133, 3155, 3246, 3370, 3406, 3449, 3538, 3658, 3671, 3684, 3711, 3744, 3774, 3831, 3896, 3904, 4055, 4067, 4165, 4172, 4253, 4396, 4456, 4561, 4671, 4684, 4687, 4717, 4873, 4939, 4988, 5057, 5111, 5145, 5340, 5354, 5373, 5380, 5411, 5479, 5491, 5545, 5580, 5659, 5745, 5924, 5965, 5975, 5980, 6076, 6098, 6161, 6169, 6256, 6293, 6325, 6342], 'glycine': [38, 269, 1307], '(Gly)': [39, 270], 'receptors': [40, 271, 4990], 'that': [41, 61, 86, 107, 164, 202, 272, 292, 317, 338, 395, 433, 688, 698, 863, 946, 1134, 2547, 2758, 2856, 2952, 3070, 3140, 3156, 3176, 3312, 3355, 3409, 3522, 3596, 3778, 3924, 4120, 4200, 4275, 4370, 4449, 4589, 4688, 4747, 4780, 4814, 4909, 4928, 4940, 4980, 5114, 5129, 5138, 5323, 5362, 5385, 5467, 5484, 5492, 5528, 5564, 5592, 5671, 5718, 5809, 5826, 5890, 5914, 6081, 6088, 6131, 6139, 6204, 6238, 6257, 6276], 'underlie': [42, 273], 'fast': [43, 274, 596, 4992], 'synaptic': [44, 229, 275, 460, 597, 884, 4993, 6320], 'inhibition': [45, 276, 598, 885, 936, 4637, 4913, 4994, 6321], 'adult': [48, 279, 601, 781, 4968], 'central': [49, 210, 280, 441, 602, 1023, 4997, 5059], 'nervous': [50, 281, 603, 4998, 5060], 'system.': [51, 282], 'However,': [52, 283, 1071, 3605, 4099, 5979], 'to': [53, 64, 193, 284, 295, 424, 977, 1020, 1050, 1074, 1464, 1608, 1658, 1939, 2231, 2318, 2324, 2326, 2431, 2460, 2714, 2849, 2866, 2983, 2990, 3055, 3090, 3280, 3383, 3544, 3575, 3838, 3846, 3986, 3997, 4022, 4102, 4126, 4167, 4301, 4323, 4356, 4563, 4618, 4652, 4727, 4751, 4806, 4841, 4936, 4949, 5084, 5098, 5320, 5407, 5510, 5561, 5616, 5766, 5818, 6122, 6129, 6164, 6263], 'date': [54, 285], 'an': [55, 286, 1966, 2408, 3281, 4225, 4624, 4812, 4907, 5465, 5824, 5888], 'understanding': [56, 287], 'cellular': [59, 290, 5080], 'mechanism': [60, 291, 3800, 5835, 6163], 'neurons': [62, 172, 293, 403, 551, 778, 1176, 2334, 2590, 4596, 4601, 4705, 4884, 5082, 5523, 5601, 5675, 6087, 6135, 6341], 'use': [63, 294, 5083], 'modulate': [65, 296, 1093, 4127, 4302], 'functional': [67, 216, 298, 447, 971, 1129, 1220, 3437, 4151, 5121, 5738, 5746, 6006, 6266, 6294, 6310], 'expression': [68, 76, 217, 299, 307, 448, 866, 925, 972, 1221, 1726, 1737, 3218, 3563, 3615, 3639, 3696, 3788, 4430, 4459, 4475, 4858, 5739, 5759, 5783, 5903, 5922, 6007, 6106, 6267, 6295], 'remains': [71, 302, 1073, 5319, 6121], 'rudimentary.': [72, 303], 'Using': [73, 304, 6073], 'Escherichia': [74, 305], 'coli': [75, 306, 1622, 2840, 5353], 'coupled': [77, 308], 'with': [78, 181, 309, 412, 706, 800, 931, 938, 1186, 1259, 1274, 1301, 1630, 1673, 1690, 1760, 1990, 2005, 2012, 2023, 2028, 2046, 2056, 2060, 2074, 2082, 2094, 2139, 2298, 2304, 2382, 2454, 2483, 2596, 2608, 2725, 2739, 3069, 3102, 3115, 3224, 3230, 3240, 3296, 3333, 3401, 3655, 3660, 3707, 3721, 3729, 3829, 3890, 3906, 4013, 4083, 4163, 4204, 4222, 4246, 4446, 4469, 4558, 4565, 4580, 4585, 4602, 4735, 4784, 4869, 4885, 4903, 4921, 5400, 5426, 5451, 5584, 5713, 5886, 5897, 5983, 6175], 'vitro': [80, 311, 792, 2588, 2851, 3208, 3404, 5429, 5478, 5536], 'kinase': [81, 88, 312, 319, 501, 1080, 2153, 2852, 3164, 4387], 'assays,': [82, 313, 3628], 'we': [83, 314, 1113, 2814, 3210, 3442, 3629, 4047, 4413, 4426, 4829, 5095, 5514, 5590, 5665], 'first': [84, 315, 786, 3220, 3443, 4427, 4451], 'established': [85, 316, 1076], 'protein': [87, 318, 494, 500, 869, 1032, 1118, 1654, 1681, 1698, 1864, 1898, 1910, 2136, 2152, 2707, 2729, 2771, 2860, 3326, 3853, 5090, 5107, 5143, 5370], 'C': [89, 320, 2971, 5701], '(PKC)': [90, 321], 'can': [91, 322], 'directly': [92, 323, 1083, 1120, 1137, 5515, 5655, 6242], 'phosphorylate': [93, 324], 'serine': [94, 325, 2958, 2986, 3168, 4683, 5390, 5544], '940': [95, 326], '(Ser940)': [96, 327], 'within': [97, 328, 1144, 2780, 2960, 2988, 3183, 3416, 3934, 3970, 4388, 4995, 5109, 5392, 5498, 5678, 6110, 6150, 6247], 'C-terminal': [99, 330, 709, 1147, 2824, 3418, 5341, 5364, 5402, 6250], 'cytoplasmic': [100, 331, 710, 2830, 2897, 6249], 'domain': [101, 332, 1149, 3420, 5502, 6251], 'KCC2.': [103, 159, 334, 390, 4760, 6172, 6297], 'We': [104, 335, 3992, 4761, 5330, 6328], 'further': [105, 162, 336, 393, 1104, 2282, 2975, 3128, 3797, 4666], 'demonstrated': [106, 337, 687, 1133, 2757, 4927, 5322, 5483, 6203], 'Ser940': [108, 127, 151, 339, 358, 382, 1143, 1156, 1214, 3087, 3099, 3118, 3143, 3187, 3276, 3428, 3783, 3793, 4002, 4124, 4748, 5399, 5719, 5840, 6012, 6246], 'site': [112, 343, 2552, 2761, 3179, 3412, 4382, 4754, 5495], 'PKC-dependent': [114, 176, 186, 203, 345, 407, 417, 434, 1153, 3112, 3149, 3193, 3790, 3802, 4937, 6154], 'phosphorylation': [115, 149, 165, 187, 204, 346, 380, 396, 418, 435, 1086, 1092, 1109, 1154, 1212, 2763, 2998, 3058, 3089, 3113, 3123, 3150, 3161, 3182, 3286, 3323, 3349, 3392, 3415, 3779, 4122, 4277, 4384, 4416, 4614, 4651, 4661, 4695, 4757, 4938, 5104, 5357, 5387, 5406, 5420, 5438, 5455, 5497, 5518, 5560, 5570, 5618, 5707, 5841, 6155, 6229, 6258, 6292], 'full-length': [117, 348, 5431], 'molecules': [119, 350, 5725, 6275], 'when': [120, 351, 3197, 5439], 'expressed': [121, 352, 775, 1173, 1619, 2815, 3212, 3451, 4799, 5440], 'HEK-293': [123, 354, 1715, 3200, 3215, 3328, 3457, 3825, 5442, 5822, 5966], 'cells.': [124, 355, 3216, 3329], 'Phosphorylation': [125, 356, 2752, 3194, 3362, 3426, 3791, 4395], 'increased': [128, 152, 188, 359, 383, 419, 1157, 1193, 3543, 3724, 4888, 5460, 5755, 5813], 'cell': [130, 196, 361, 427, 1159, 1456, 1536, 3454, 3533, 3613, 3637, 3678, 3709, 3731, 3786, 3806, 3887, 3927, 3963, 4128, 4771, 4803, 4871, 4952, 5757, 5781, 5803, 5843, 5862, 5920, 6061, 6104, 6145, 6167, 6273], 'surface': [131, 362, 1160, 1457, 1537, 3455, 3534, 3614, 3638, 3787, 3807, 3888, 3928, 3964, 4129, 4772, 4804, 4872, 5758, 5782, 5804, 5844, 5863, 5921, 6062, 6105, 6146, 6168], 'stability': [132, 363, 1161, 4130, 4773, 6063], 'this': [136, 219, 367, 450, 868, 1100, 1117, 1124, 1151, 1223, 2909, 3138, 3163, 3325, 3371, 3422, 3539, 3576, 3813, 3921, 4019, 4282, 4314, 4365, 4386, 4389, 4663, 4941, 5089, 5386, 5504, 5793, 5905, 6001, 6048, 6176, 6253, 6260, 6308], 'system': [137, 368, 604, 4664, 4999, 5061], 'by': [138, 158, 175, 369, 389, 406, 1139, 1164, 1180, 1297, 1432, 1462, 1686, 1807, 1853, 1874, 1876, 1902, 1913, 1953, 1965, 1980, 2181, 2224, 2337, 2465, 2490, 2496, 2537, 2575, 2745, 2753, 2764, 2863, 2892, 3064, 3222, 3291, 3699, 3733, 4133, 4143, 4179, 4218, 4265, 4309, 4374, 4627, 4817, 4848, 4861, 5136, 5334, 5376, 5470, 5750, 5763, 6208, 6222, 6243, 6268, 6289, 6323], 'decreasing': [139, 370, 1165, 1674], 'its': [140, 371, 4135, 4931, 5120, 5559, 6270], 'rate': [141, 154, 372, 385], 'internalization': [143, 374, 3979], 'from': [144, 375, 560, 877, 1167, 1236, 1250, 1588, 1961, 1970, 1985, 2113, 2125, 2155, 2260, 2266, 2437, 2447, 3249, 3256, 3266, 3307, 3668, 4704, 5959, 6332], 'plasma': [146, 377, 1169, 1201, 3586, 4843, 6069], 'membrane.': [147, 378, 1170, 1202], 'Coincident': [148, 379], 'ion': [156, 387], 'transport': [157, 388], 'It': [160, 391], 'was': [161, 392, 1177, 1234, 1248, 1295, 1459, 1544, 1655, 1682, 1699, 1865, 1911, 1937, 1951, 1977, 2105, 2119, 2137, 2221, 2229, 2322, 2380, 2422, 2534, 2695, 2731, 2861, 2875, 2890, 2937, 2954, 2981, 3066, 3127, 3219, 3278, 3289, 3305, 3313, 3365, 3529, 3582, 3679, 3697, 3819, 3932, 3942, 3968, 3980, 4177, 4212, 4307, 4338, 4376, 4444, 4450, 4577, 4665, 4679, 4815, 4859, 4910, 5371, 5458, 5468, 5540, 5676, 5785, 5827, 5867, 5891, 5992, 6079], 'evident': [163, 394, 929, 2779, 3306, 3356, 4081, 4194, 4729, 5694, 6080], 'endogenous': [167, 398, 4169], 'cultured': [170, 401, 794, 6091, 6339], 'hippocampal': [171, 402, 1175, 1995, 2279, 2333, 2589, 4420, 4595, 5522, 5537, 5588, 5674, 6086, 6134, 6340], 'regulated': [174, 405], 'activity.': [177, 408, 6010, 6215], 'Moreover,': [178, 409, 5454], 'keeping': [180, 411, 5982, 6174], 'our': [182, 413, 1187, 1204, 2812, 3206, 3402, 3626, 4410, 4826, 4922, 5332, 5427, 5475, 5511, 5585, 5657, 5714, 5984], 'recombinant': [183, 414, 1188, 4411, 4923, 5512, 5658, 5715], 'studies,': [184, 415, 4412], 'enhancing': [185, 416], 'targeting': [190, 421, 4838, 4946, 5815], 'neuronal': [195, 426, 949, 1200, 4759, 4802, 4951, 5660, 5723, 6068, 6286], 'surface.': [197, 428, 4953], 'Our': [198, 429, 1131, 6234], 'studies': [199, 430, 685, 1132, 1189, 1205, 2755, 2813, 4471, 4924, 5128, 5661, 5716, 6132, 6235], 'suggest': [201, 432, 1206, 3175, 3408, 4119, 4746, 5717, 6043], 'may': [207, 438, 5957, 6156, 6281, 6312], 'play': [208, 439, 5117], 'modulating': [213, 444], 'both': [214, 445, 2774, 2781, 5743, 6074], 'transporter': [221, 452, 1128, 1224, 3423, 3785, 3817, 4325, 5505, 5802, 5853, 6255], 'brain': [224, 455, 920, 1590], 'strength': [227, 458], 'inhibition.': [230, 461], 'Cation-chloride': [462], 'cotransporters': [463], '(CCC)': [464], '3The': [465], 'abbreviations': [466], 'used': [467, 1938, 2230, 3993, 5666], 'are:': [468], 'CCC,': [469], 'cation-chloride': [470], 'cotransporter;': [471], 'GABAA,': [472], 'A;': [476], 'Cal,': [477], 'calphostin;': [478], 'HEK,': [479], 'human': [480, 1732], 'embryonic': [481, 2246], 'kidney;': [482], 'KCC2,': [483, 3385, 4103, 4187, 6228], 'K+-Cl–': [484], '2;': [486], 'NEM,': [487], 'N-ethylmaleimide;': [488], 'PDBu,': [489, 3656], 'phorbol': [490, 504, 3334, 4247], '12,13-dibutyrate;': [491], 'PKA,': [492, 2777, 2894], 'cAMP-dependent': [493, 2151], 'kinase;': [495], 'PBS,': [496, 507, 2025, 2058, 2076], 'phosphate-buffered': [497, 508], 'saline;': [498, 509], 'PKC,': [499, 1045, 1192, 5464], 'C;': [502], 'PMA,': [503], '12-myristate': [505], '13-acetate;': [506], 'HBSS,': [510], "Hanks'": [511, 2255], 'balanced': [512, 2256], 'salt': [513, 2257], 'solution;': [514], 'TRITC,': [515], 'tetramethylrhodamine': [516], 'isothiocyanate.': [517], 'regulate': [518, 1084, 5085], 'Cl–': [519, 555, 577, 583, 807, 950, 4964, 4978, 6287, 6306], 'homeostasis': [520, 6288], 'cells': [522, 1437, 1988, 2043, 2583, 3250, 3257, 3267, 3308, 3458, 3648, 3717, 3740, 3751, 3757, 3826, 3893, 4160, 4185, 4205, 4245, 4435, 5443, 5967], 'generation': [525], 'gradients': [529, 4966], '(1Price': [530], 'T.J.': [531, 619, 670, 897, 1567, 2791, 6022], 'Cervero': [532], 'F.': [533], 'de': [534], 'Koninck': [535], 'Y.': [536, 4527, 4540, 5249, 5262], 'Curr.': [537], 'Top.': [538], 'Med.': [539, 5067, 5277], 'Chem.': [540, 624, 733, 759, 1358, 1572, 1790, 2195, 2507, 2796, 3014, 3029, 3506, 5157, 5204, 5219, 5938, 6027], '2005;': [541, 849, 1004, 3017, 5040, 5207, 6189], '5:': [542, 2930, 5190], '547-555Crossref': [543], 'PubMed': [544, 613, 633, 660, 679, 720, 742, 768, 831, 852, 907, 963, 989, 1007, 1066, 1337, 1367, 1498, 1581, 1750, 1799, 2202, 2213, 2514, 2525, 2624, 2688, 2805, 2932, 3020, 3036, 3485, 3515, 3878, 4238, 4502, 4521, 4532, 4546, 5022, 5043, 5072, 5166, 5192, 5210, 5226, 5243, 5254, 5268, 5282, 5312, 5649, 5947, 6036, 6197], 'Scopus': [545, 634, 661, 680, 743, 769, 832, 853, 908, 964, 990, 1008, 1067, 1338, 1368, 1499, 1582, 1751, 1800, 2214, 2526, 2625, 2689, 2806, 2933, 3486, 3516, 3879, 4503, 4533, 4547, 5023, 5044, 5073, 5167, 5193, 5255, 5269, 5283, 5313, 5650, 5948, 6037, 6198], '(164)': [546], 'Google': [547, 614, 636, 663, 682, 721, 745, 771, 834, 855, 910, 966, 992, 1010, 1069, 1340, 1370, 1501, 1584, 1753, 1802, 2203, 2216, 2515, 2528, 2627, 2691, 2808, 2935, 3021, 3037, 3488, 3518, 3881, 4239, 4505, 4522, 4535, 4549, 5025, 5046, 5075, 5169, 5195, 5211, 5227, 5244, 5257, 5271, 5285, 5315, 5652, 5950, 6039, 6200], 'Scholar).': [548, 683, 772, 856, 911, 967, 1070, 1371, 1502, 1754, 1803, 2217, 2529, 2628, 2692, 2809, 3519, 3882, 4550, 5047, 5653, 5951], 'Adult': [549], 'mammalian': [550, 1725], 'maintain': [552], 'low': [553, 573, 4976], 'intracellular': [554, 576, 1148, 2784, 2829, 3419, 4977, 5342, 5501], 'concentrations,': [556], 'which': [557, 592, 797, 1729, 3045, 3275, 4722], 'arise': [558], 'principally': [559, 4680], 'cotransporter-2': [567], '(KCC2).': [568], 'such': [572, 915], 'levels': [574, 1090, 1428, 3376, 3560, 3640, 4073, 4189, 4460, 5435, 5760, 5784, 5902, 5923, 6107], 'ions': [578], 'responsible': [580, 594, 4982], 'GABAA': [588, 805, 882, 943, 4987, 6324], 'Gly': [590, 4989, 6326], 'receptors,': [591, 1041], 'are': [593, 701, 928, 973, 2778, 3167, 3399, 4981, 5052, 5124, 6211, 6220], '(2Payne': [605, 712, 4230], 'J.A.': [606, 617, 643, 713, 756, 814, 1345, 1565, 2789, 3493, 4231, 4485, 5005, 6020], 'Am.': [607, 714, 4232, 4515, 5237], 'J.': [608, 622, 641, 673, 715, 731, 757, 812, 847, 984, 1002, 1060, 1356, 1570, 1788, 2193, 2505, 2794, 3013, 3027, 3504, 4233, 4483, 4516, 5003, 5038, 5155, 5203, 5217, 5238, 5306, 5307, 5643, 5644, 5936, 6025], 'Physiol.': [609, 716, 4234, 4517, 5239], '1997;': [610, 717, 2210, 2522, 4235], '273:': [611, 718, 4236], 'C1516-C1525Crossref': [612, 719, 4237], 'Scholar,': [615, 637, 664, 722, 746, 835, 993, 1341, 2204, 2516, 3022, 3489, 4506, 4523, 4536, 5026, 5170, 5196, 5212, 5228, 5245, 5258, 5272, 5286], '3Payne': [616], 'Stevenson': [618, 1566, 2790, 6021], 'Donaldson': [620, 1568, 2792, 6023], 'L.F.': [621, 1569, 2793, 6024], 'Biol.': [623, 732, 758, 1062, 1357, 1571, 1789, 2194, 2506, 2795, 3028, 3505, 5068, 5156, 5218, 5278, 5937, 6026], '1996;': [625, 1573, 2797, 6028], '271:': [626, 1574, 2798, 6029], '16245-16252Abstract': [627, 1575, 2799, 6030], 'Full': [628, 630, 737, 739, 763, 765, 902, 904, 1362, 1364, 1576, 1578, 1794, 1796, 2199, 2511, 2800, 2802, 3033, 3510, 3512, 5161, 5163, 5223, 5942, 5944, 6031, 6033, 6192, 6194], 'Text': [629, 631, 738, 740, 764, 766, 903, 905, 1363, 1365, 1577, 1579, 1795, 1797, 2200, 2512, 2801, 2803, 3034, 3511, 3513, 5162, 5164, 5224, 5943, 5945, 6032, 6034, 6193, 6195], 'PDF': [632, 741, 767, 906, 1366, 1580, 1798, 2201, 2513, 2804, 3035, 3514, 5165, 5225, 5946, 6035, 6196], '(461)': [635, 1583, 2807, 6038], '4Rivera': [638], 'C.': [639, 810, 4481, 4525, 4538, 5001, 5247, 5260], 'Voipio': [640, 811, 4482, 5002], 'Payne': [642, 755, 813, 4484, 5004], 'Ruusuvuori': [644, 815, 4486, 5006], 'E.': [645, 726, 816, 843, 983, 1621, 2839, 4487, 4514, 5007, 5034, 5150, 5236, 5352, 5931], 'Lahtinen': [646, 817, 4488, 5008], 'H.': [647, 818, 837, 4489, 5009, 5028, 5288, 5625, 6183], 'Lamsa': [648, 819, 4490, 5010], 'K.': [649, 655, 820, 826, 845, 895, 4491, 4497, 4508, 5011, 5017, 5036, 5230, 5300, 5302, 5637, 5639], 'Pirvola': [650, 821, 4492, 5012], 'U.': [651, 822, 1331, 1492, 3479, 3872, 4493, 5013], 'Saarma': [652, 823, 4494, 5014], 'M.': [653, 754, 824, 4495, 5015, 5290, 5304, 5627, 5641], 'Kaila': [654, 825, 4496, 5016], 'Nature.': [656, 827, 1746, 2620, 2684, 4498, 5018], '1999;': [657, 760, 828, 1791, 4499, 5019], '397:': [658, 829, 4500, 5020], '251-255Crossref': [659, 830, 4501, 5021], '(1685)': [662, 833, 4504, 5024], '5Stein': [665], 'V.': [666, 889, 1318, 1322, 1479, 1483, 3466, 3470, 3859, 3863], 'Hermans-Borgmeyer': [667, 890], 'I.': [668, 891], 'Jentsch': [669, 896], 'Hubner': [671], 'C.A.': [672, 887], 'Comp.': [674], 'Neurol.': [675], '2004;': [676, 1063, 1334, 1359, 1495, 3482, 3507, 3875, 5069, 5279], '468:': [677], '57-64Crossref': [678], '(246)': [681], 'Molecular': [684], 'have': [686, 1046, 1114, 2756, 5096, 5130, 5612, 5912, 6136, 6202, 6236, 6282, 6313], 'member': [692], 'CCC': [695], 'superfamily': [696], 'these': [699, 878, 1078, 3173, 3669, 3756, 3772, 4045, 4087, 4424, 4434, 4744, 4925, 5115, 5690, 6041, 6114, 6218], 'transporters': [700], 'composed': [702], '12-transmembrane': [704], 'domains': [705, 711, 2785, 2831, 5343], 'N-': [707], '6Bergeron': [723], 'M.J.': [724, 5148, 5929], 'Gagnon': [725, 5149, 5930], 'Caron': [727, 5151, 5932], 'L.': [728, 5152, 5933, 6185], 'Isenring': [729, 5153, 5934], 'P.': [730, 995, 997, 1316, 1477, 1779, 2914, 3008, 3464, 3857, 5154, 5174, 5198, 5935], '2006;': [734, 4529, 5158, 5251, 5939], '281:': [735, 5159, 5940], '15959-15969Abstract': [736, 5160, 5941], '(38)': [744, 1009, 4534, 5168, 5256, 5949], '7Williams': [747], 'J.R.': [748], 'Sharp': [749, 2110], 'J.W.': [750], 'Kumari': [751], 'V.G.': [752], 'Wilson': [753], '274:': [761, 1792], '12656-12664Abstract': [762], '(192)': [770], 'exclusively': [776], 'throughout': [779], 'brain.': [782, 1227], 'Developmentally': [783], 'detected': [787, 1964, 4452], 'around': [788], '10': [789, 1377, 1385, 1400, 1470, 1764, 1811, 1819, 1834, 1859, 2040, 2140, 2166, 2174, 2316, 2330, 2637, 2648, 2669, 3338, 3935, 5874, 6111], 'days': [790, 2430, 2586, 5534], 'rat': [795, 1589, 2243], 'neurons,': [796, 4906, 5538, 5589], 'coincident': [799], 'emergence': [802, 940], 'receptor-mediated': [806, 883, 944], '(4Rivera': [809, 4480, 5000], '8Lee': [836, 5027], 'Chen': [838, 5029], 'C.X.': [839, 5030], 'Liu': [840, 5031], 'Y.J.': [841, 5032], 'Aizenman': [842, 5033], 'Kandler': [844, 5035], 'Eur.': [846, 5037], 'Neurosci.': [848, 2928, 4541, 5039, 5188, 5263, 5308, 5645], '21:': [850, 5041], '2593-2599Crossref': [851, 5042], '(102)': [854, 965, 5045], 'Gene': [857], 'knock-out': [858], 'has': [861, 6230], 'revealed': [862, 2855, 2951, 3139, 3521, 3923, 4369, 4710, 4779, 5361, 5384, 5527, 5670, 5808], 'ablating': [864], 'results': [870, 3174, 3398, 3624, 4117, 4745, 4974, 5711, 6042], 'early': [872], 'postnatal': [873], 'death.': [874], 'Neurons': [875], 'derived': [876], 'animals': [879], 'exhibit': [880], 'compromised': [881], '(9Hubner': [886], 'Stein': [888], 'Meyer': [892], 'T.': [893, 999, 5294, 5631], 'Ballanyi': [894], 'Neuron.': [898, 6188], '2001;': [899, 986], '30:': [900], '515-524Abstract': [901], '(477)': [909], 'Under': [912, 3954, 4568, 4675, 5857], 'pathological': [913], 'conditions': [914, 2880, 2942, 3359, 3570, 3956, 4088, 4570, 4677, 5531, 5859, 6142], 'as': [916, 1442, 1511, 2498, 2553, 2834, 4263, 5348, 5444, 5790], 'epilepsy': [917, 5056], 'or': [918, 1096, 1993, 2150, 2584, 2607, 3105, 3651, 4036, 4334, 4344, 5968], 'ischemic': [919], 'injury,': [921], 'deficits': [922], 'together': [930, 4734, 5712], 'decreased': [932, 948, 4025, 4911], 'efficacy': [933, 6318], 'GABAergic': [935], 'depolarizing': [942], 'reflect': [947], 'extrusion': [951], '(10Bonislawski': [952], 'D.P.': [953], 'Schwarzbach': [954], 'E.P.': [955], 'Cohen': [956], 'A.S.': [957], 'Neurobiol.': [958], 'Dis.': [959], '2007;': [960, 4543, 5265, 5309, 5646], '25:': [961], '163-169Crossref': [962], 'These': [968, 3397, 4116, 5710], 'changes': [969, 6223], 'believed': [974], 'part': [976], 'be': [978, 1021, 1075, 3541, 4023, 5321, 6123], 'transcriptional': [979], '(11Karadsheh': [980], 'M.F.': [981], 'Delpire': [982, 4513, 5235], 'Neurophysiol.': [985], '85:': [987], '995-997Crossref': [988], '(51)': [991], '12Uvarov': [994], 'Pruunsild': [996], 'Timmusk': [998], 'Airaksinen': [1000], 'M.S.': [1001], 'Neurochem.': [1003], '95:': [1005], '1144-1155Crossref': [1006], 'Scholar),': [1011, 2936, 3038, 6040], 'but': [1012, 2895, 3254, 3557, 4313, 4350, 4583, 5365], 'post-translational': [1013], 'modification': [1014, 1126, 4943], 'also': [1018, 1178, 2471, 3264, 4692, 4762, 5693, 5828], 'likely': [1019, 4750], 'importance.': [1024], 'Intriguingly': [1025, 4698], 'number': [1030, 2766, 4290, 5126], 'kinases,': [1033, 1043, 2772], 'including': [1034, 2773], 'WNK3,': [1035], 'WNK4,': [1036], 'brain-type': [1037], 'creatine': [1038], 'kinase,': [1039], 'TrkB': [1040], 'tyrosine': [1042, 4694, 5581, 5622], 'all': [1047], 'been': [1048, 5614, 6090, 6232], 'reported': [1049, 5615], 'influence': [1051], '(13Adragna': [1054], 'N.C.': [1055], 'Fulvio': [1056], 'M.D.': [1057], 'Lauf': [1058], 'P.K.': [1059], 'Membr.': [1061], '201:': [1064], '109-137Crossref': [1065], '(181)': [1068], 'it': [1072, 5318, 6078, 6126], 'whether': [1077, 1088, 1116, 1123], 'varying': [1079, 1451, 5953, 5970], 'activities': [1081], 'actually': [1082, 5326], 'altered': [1089, 3566, 6119], 'function': [1095], 'trafficking': [1098, 5961], 'key': [1101], 'transporter.': [1102], 'To': [1103, 1434, 2810, 2974, 3621, 3645, 3821, 4043, 4271, 4422, 4551, 4824, 5654, 5832], 'address': [1105, 3435], 'regulating': [1111, 1218, 3816, 5119, 6004, 6051, 6290, 6305], 'assessed': [1115, 3630], 'phosphorylated': [1121, 1138, 1179, 2862, 2877, 2891, 2938, 2956, 4593, 4681, 5327, 5375, 5542, 5595, 5677, 5721, 6241], 'covalent': [1125, 4942], 'alters': [1127], 'expression.': [1130, 5122], 'PKC': [1140, 1181, 2149, 2775, 2865, 2997, 3065, 3181, 3332, 3414, 3551, 3635, 4008, 4039, 4144, 4154, 4300, 4343, 4375, 4391, 4631, 4639, 4691, 4709, 4756, 4767, 4783, 4820, 4834, 4915, 5405, 5490, 5550, 5575, 5706, 5734, 5754, 5776, 5800, 5812, 5817, 5849, 5878, 5918, 6009, 6057, 6084, 6214, 6244, 6278], 'on': [1142, 1198, 1419, 1440, 1472, 2000, 2079, 2262, 2276, 2341, 2957, 2993, 3111, 3148, 3452, 3531, 3584, 3636, 3750, 3782, 3902, 4009, 4156, 4288, 4341, 4472, 4682, 4730, 4769, 4800, 4836, 5389, 5419, 5543, 5577, 5596, 5621, 5695, 5736, 5777, 5788, 5842, 5851, 5894, 5994, 6059, 6066, 6213, 6245, 6285], 'protein.': [1152, 4390, 5424], 'endocytosis': [1166, 3818, 4017, 4052, 4079, 4111, 5854, 5882, 6120], 'Endogenous': [1171, 4401], 'and,': [1183], 'common': [1185, 4920], 'accumulation': [1195, 4192], 'Together': [1203, 3172, 3771, 4364, 4743], 'PKC-mediated': [1211], 'Antibodies—Monoclonal': [1228], 'mouse': [1229], 'anti-KCC2': [1230, 1246, 1915, 1942, 2048, 3225, 3661, 4447], 'antibody': [1231, 1247, 1916, 1936, 1943, 2049, 2064, 2702], 'clone': [1232], 'N1/12': [1233], 'purchased': [1235, 1249], 'University': [1238, 1918], 'California': [1240, 1920], 'Davis/NINDS/NIMH': [1241], 'NeuroMab': [1242], 'facility.': [1243], 'Polyclonal': [1244], 'rabbit': [1245], 'Upstate.': [1251], 'Biotinylation': [1252], 'Endocytosis': [1254], 'Assays—Cells': [1255], 'were': [1256, 1373, 1417, 1429, 1438, 1504, 1509, 1515, 1586, 1602, 1618, 1628, 1641, 1721, 1756, 1805, 1851, 1885, 1900, 1998, 2010, 2044, 2092, 2249, 2269, 2281, 2287, 2302, 2335, 2405, 2458, 2470, 2487, 2573, 2594, 2630, 2711, 2846, 3042, 3050, 3263, 3564, 3653, 3665, 3748, 3827, 3894, 3900, 4080, 4161, 4193, 4201, 4294, 4556, 5692, 5740, 5855, 6071, 6116], 'washed': [1257, 1672, 2020, 2053, 2071, 2303, 2451, 2733], 'twice': [1258], '1×': [1260, 1278, 1302, 2024, 2029, 2057, 2075, 2254], 'PBS': [1261, 1703, 2016, 2030], 'containing': [1262, 1280, 1304, 1810, 2031, 2160, 2355, 2386, 2636], '0.5': [1263, 2396, 2417], 'mm': [1264, 1268, 1306, 1378, 1386, 1390, 1393, 1407, 1412, 1466, 1812, 1820, 1824, 1827, 1842, 1847, 2162, 2167, 2361, 2366, 2397, 2638, 2641, 2646, 2649, 2653, 2661, 2741], 'MgCl2': [1265], '1': [1267, 1281, 1392, 1826, 1880, 1907, 1923, 2006, 2069, 2350, 2360, 2660], 'CaCl2': [1269], '(PBS-CM)': [1270], 'then': [1272, 1374, 1430, 1460, 1516, 1545, 1603, 1656, 1683, 1886, 2222, 2488, 2631, 2712, 2732, 2847, 3067, 3666], 'incubated': [1273, 1446, 2045, 2059, 2138, 2718, 3832], '2': [1275, 1465, 2051, 2699, 2720, 4454], 'ml': [1276, 2418], 'PBS-CM': [1279, 1303], 'mg/ml': [1282, 2007, 2456], 'sulfo-NHS-SS-biotin': [1283], '30': [1285, 1669, 2177], 'min': [1286, 1471, 1670, 2175, 2297, 2310, 3339, 3840, 3936, 4032], 'biotin': [1288, 1293, 1458, 3917], 'labeling.': [1289], 'After': [1290, 1613, 3883, 3909], 'labeling,': [1291], 'reaction': [1294, 2219], 'quenched': [1296], 'washing': [1298, 1687], 'three': [1299, 2021, 5679], 'times': [1300, 2022, 2055, 2073, 2307, 2317], '50': [1305, 1861, 1889, 2170], '0.1%': [1309], 'bovine': [1310, 2358, 2393], 'serum': [1311], 'albumin': [1312], '(14Kittler': [1313, 1474, 3461, 3854], 'J.T.': [1314, 1475, 1777, 3462, 3855], 'Thomas': [1315, 1476, 1778, 2913, 3463, 3856, 5173], 'Tretter': [1317, 1478, 3465, 3858], 'Bogdanov': [1319, 1480, 3467, 3860], 'Y.D.': [1320, 1481, 3468, 3861], 'Haucke': [1321, 1482, 3469, 3862], 'Smart': [1323, 1484, 1744, 1784, 2618, 2682, 2923, 3471, 3864, 5183], 'T.G.': [1324, 1485, 1745, 1785, 2619, 2683, 2924, 3472, 3865, 5184], 'Moss': [1325, 1352, 1486, 1786, 2191, 2207, 2503, 2519, 2925, 3473, 3500, 3866, 5185], 'S.J.': [1326, 1353, 1487, 1739, 1787, 2192, 2208, 2504, 2520, 2613, 2677, 2926, 3474, 3501, 3867, 5186], 'Proc.': [1327, 1488, 3475, 3868], 'Natl.': [1328, 1489, 3476, 3869], 'Acad.': [1329, 1490, 3477, 3870], 'Sci.': [1330, 1491, 3478, 3871], 'S.': [1332, 1493, 3480, 3873, 5296, 5633], 'A.': [1333, 1355, 1494, 1743, 2617, 2681, 2912, 3481, 3503, 3874, 5172], '101:': [1335, 1496, 3483, 3876], '12736-12741Crossref': [1336, 1497, 3484, 3877], '(196)': [1339, 1500, 3487, 3880], '15Fairfax': [1342, 3490], 'B.P.': [1343, 3491], 'Pitcher': [1344, 3492], 'Scott': [1346, 3494], 'M.G.': [1347, 3495], 'Calver': [1348, 2915, 3496, 5175], 'A.R.': [1349, 2916, 3010, 3497, 5176, 5200], 'Pangalos': [1350, 2919, 3498, 5179], 'M.N.': [1351, 2920, 3499, 5180], 'Couve': [1354, 3502], '279:': [1360, 3508, 4519, 5241], '12565-12573Abstract': [1361, 3509], '(95)': [1369, 3517], 'Cells': [1372, 1503, 1755, 2009], 'lysed': [1375, 1642, 1806, 2632], 'NaPO4,': [1379, 2639], '2%': [1380, 1814, 2387, 2391, 2655], 'Triton': [1381, 1815, 2037, 2656], 'X-100,': [1382, 1816, 2657], '0.5%': [1383, 1817, 2658], 'deoxycholate,': [1384, 1818, 2659], 'sodium': [1387, 1394, 1821, 1828, 2362, 2650, 2662], 'pyrophosphate,': [1388, 1822, 2651], '25': [1389, 1823, 2365, 2652], 'NaF,': [1391, 1825, 2654], 'orthovanadate,': [1395, 1829, 2663], '100': [1396, 1411, 1631, 1830, 1846, 2645, 2664], 'μm': [1397, 1632, 1831, 2171, 2665], 'phenylmethylsulfonyl': [1398, 1832, 2666], 'fluoride,': [1399, 1833, 2667], 'μgof': [1401], 'aprotinin,': [1402, 1837, 2672], 'leupeptin,': [1403, 1838, 2673], 'pepstatin,': [1405, 1840], '5': [1406, 1841, 2309, 2640, 3971], 'EDTA,': [1408, 1843], 'EGTA,': [1409, 1844, 2644], 'NaCl,': [1413, 2647], 'biotinylated': [1415, 1507, 3898], 'proteins': [1416, 1508, 1617, 1850, 1884, 2837, 2845, 2889, 3041, 3063, 3899, 5350], 'purified': [1418, 1510, 2148, 2864, 2893, 3062], 'immobilized': [1420], 'avidin': [1421, 3903], 'eluted': [1422, 1697], 'SDS-PAGE': [1424, 2186], 'sample': [1425, 2187], 'buffer.': [1426, 1677], 'measured': [1431, 3680, 4178, 4264, 4830, 5445, 5749], 'immunoblotting.': [1433, 4437], 'measure': [1435, 4149], 'endocytosis,': [1436], 'labeled': [1439, 2595, 2964, 3828, 4557], 'ice': [1441, 1473], 'described': [1443], 'above': [1444], 'at': [1447, 1527, 1693, 1706, 1855, 1888, 1922, 1944, 2176, 2245, 2292, 2346, 2411, 2722, 3535, 3833, 3918, 4061, 4453, 4897], '37': [1448, 2293, 2412, 3834, 4062, 5976], '°C': [1449, 1708, 2178, 2294, 2413, 2724, 3835, 4063], 'time': [1452, 1528, 1543, 3555, 4028, 4198, 5771, 5871], 'periods.': [1453], 'remaining': [1455, 1526, 3158, 3886], 'cleaved': [1461], 'exposure': [1463], 'reduced': [1467, 3088, 3891, 3982, 4626, 4642, 5404], 'glutathione': [1468, 1522], 'lysed,': [1505, 3895], 'detailed': [1512, 2499], 'above.': [1513], 'Data': [1514], 'correct': [1517], 'efficiency': [1520, 3913], 'S-transferase': [1523], 'cleavage': [1524, 3884, 3915], '(biotin': [1525], '0),': [1529], 'proportion': [1532, 3446, 4796], 'total': [1535, 1762, 3559, 3962], 'population': [1538, 3929, 3965, 5864], 'internalized': [1541, 3852, 3897, 3969, 5868], 'over': [1542, 1894, 3552, 3944, 4026, 4195, 5768, 5869], 'calculated.': [1546], 'Expression': [1547, 1711, 3433], 'Purification': [1549], 'Fusion': [1552], 'Proteins—The': [1553], 'respective': [1554], 'nucleotides': [1555], 'encoding': [1556], 'amino': [1557, 3005], 'acids': [1558, 2481, 2820, 2826], '1–102': [1559], '645–1116': [1561], '(3Payne': [1564, 2788, 6019], 'Scholar)': [1585, 4240, 6201], 'amplified': [1587], 'cDNA': [1591], 'using': [1592, 1643, 1758, 2108, 2122, 2473, 2544, 3130, 3367, 3459, 3643, 4668, 4776, 4845, 5524, 5742, 5909], 'following': [1594], 'primer': [1595, 2545], 'pairs:': [1596], 'AAGTCGACCATGCTCAACAACCTGACGGACTGCGAG/AAGCGGCCGCTCAGGAGTAGATGGTGATGACCTCTCGGC': [1597], 'CAAGGATCCGATCCGAGGCCTGTCTCTCAGTGCAGC/CAACTCGAGTCAGGAGTAGATGGTGATGACCTCTCG,': [1599], 'respectively.': [1600, 4174, 5978], 'They': [1601], 'cloned': [1604, 1722], 'into': [1605, 1723, 1867, 2237, 2253, 2273, 2424], 'pTrcHis2C': [1606], '(Invitrogen)': [1607, 1661], 'yield': [1609], 'His-N·KCC2': [1610, 2874], 'His-C·KCC2.': [1612, 3073], 'DNA': [1614, 1767, 2576], 'sequencing': [1615], 'fusion': [1616, 1653, 1680, 2135, 2836, 2844, 2859, 2888, 3040, 5349, 5369, 5403], 'strain': [1623], 'BL21.': [1624], 'Exponentially': [1625], 'growing': [1626], 'cultures': [1627, 1997, 2404, 4555], 'treated': [1629, 3654, 4162], 'isopropyl': [1633], '1-thio-β-d-galactopyranoside': [1634], '3': [1636, 2083, 2429], 'h,': [1637, 2052, 2070], 'bacterial': [1639], 'pellets': [1640], '6': [1644, 2474], 'm': [1645, 1664], 'guanidine': [1646], 'hydrochloride': [1647], '(pH': [1648, 1666, 2164], '7.8)': [1649, 1667], 'sonication.': [1651], 'bound': [1657], 'ProBond™': [1659], 'resin': [1660, 1689], '8': [1663], 'urea': [1665], 'pH': [1675, 1694], 'Elution': [1678], 'carried': [1684, 1978, 2106, 2120, 2535], 'out': [1685, 1979, 2107, 2121, 2536], 'buffer': [1692, 1809, 2067, 2159, 2188, 2635, 2737], '4.0.': [1695], 'dialyzed': [1700], 'extensively': [1701, 2734], 'stored': [1705], '–80': [1707], 'before': [1709], 'use.': [1710], 'Cells—Wild-type': [1716], 'mutant': [1718, 3039, 3270, 3372, 3996, 4020], 'cDNAs': [1720], 'vector': [1727, 3319, 4208], 'PRK5,': [1728], 'utilizes': [1730], 'cytomegalovirus': [1733], 'promoter': [1734], 'transgene': [1736], '(16Moss': [1738, 2612, 2676], 'Gorrie': [1740, 2614, 2678], 'G.H.': [1741, 2615, 2679], 'Amato': [1742, 2616, 2680], '1995;': [1747, 2621, 2685], '377:': [1748, 2622, 2686], '344-348Crossref': [1749, 2623, 2687], '(199)': [1752, 2626, 2690], 'transfected': [1757, 1989, 3824], 'electroporation': [1759], 'μg': [1765, 1835, 1862, 2133, 2670, 2700], 'utilized': [1769, 2982], '24–48': [1770], 'h': [1771, 2374, 2603, 2721], 'after': [1772, 2098, 2375, 2697, 3227, 3293, 4057, 4706, 5448, 5683, 5705], 'transfection': [1773], '(17Connolly': [1774], 'C.N.': [1775], 'Kittler': [1776], 'Uren': [1780], 'J.M.': [1781], 'Brandon': [1782], 'N.J.': [1783], '36565-36572Abstract': [1793], '(163)': [1801], 'Immunoblotting—Cells': [1804], 'lysis': [1808, 2634, 2736], 'Na2HPO4,': [1813], 'NaCl.': [1848], 'Insoluble': [1849], 'removed': [1852, 2250, 2270], 'centrifugation': [1854], '13,200': [1856], 'rpm': [1857], 'min.': [1860, 2041, 2331, 5875, 6112, 6152], 'loaded': [1866], '6%': [1869], 'acrylamide': [1870], 'gel': [1871], 'resolved': [1873, 1883], 'electrophoresis': [1875], '160': [1877], 'V': [1878], 'h.': [1881, 1896, 1908, 2100], 'electrotransferred': [1887], 'mA': [1890], 'onto': [1891], 'nitrocellulose': [1892], '16': [1895], 'blots': [1899], 'blocked': [1901, 2027, 4308, 4816], '5%': [1903, 1928, 2032, 2415], 'skim': [1904, 1929, 2033], 'milk': [1905, 2034], 'recognized': [1912], 'monoclonal': [1914, 2047], '(from': [1917], 'Davis)': [1921], 'μg/ml': [1924], 'concentration': [1925, 1946], 'diluted': [1926], 'milk.': [1930], 'horseradish': [1931, 1956], 'peroxidase-conjugated': [1932], 'donkey': [1933], 'anti-mouse': [1934, 2063], 'secondary': [1935], 'recognize': [1940], '0.2': [1948], 'μg/ml.': [1949], 'Chemiluminescence': [1950], 'Visiglo™': [1955], 'peroxidase': [1957], 'plus': [1958], 'substrate': [1959, 2907, 5488], 'kit': [1960], 'Amresco': [1962], 'LAS-3000': [1967], 'image': [1968], 'reader': [1969], 'Fujifilm.': [1971, 1986], 'Quantification': [1972, 2115], 'chemiluminescence': [1975], 'signal': [1976, 3705], 'Multi': [1981], 'Gauge': [1982], 'version': [1983], '3.0': [1984], 'Immunofluorescence—HEK-293': [1987], 'plasmids': [1992], '4-week-old': [1994], 'neuron': [1996], 'grown': [1999], '1-cm-diameter': [2001], 'glass': [2002, 2080], 'coverslips': [2003], 'coated': [2004], 'poly-l-lysine.': [2008], 'fixed': [2011], '4%': [2013], 'paraformaldehyde': [2014], '15': [2018, 2296], 'min,': [2019, 3972], '0.2%': [2036], 'X-100': [2038], 'five': [2054, 2072], 'TRITC-conjugated': [2061], 'polyclonal': [2062], 'blocking': [2066], 'mounted': [2078], 'slides': [2081, 2091], 'μl': [2084, 2705], 'Vectashield®': [2086], 'mounting': [2087], 'medium.': [2088], 'prepared': [2090], 'imaged': [2093], 'confocal': [2096, 2103, 4849], 'microscope': [2097], '24': [2099], 'Acquisition': [2101], 'images': [2104, 2118, 3664], 'Laser': [2109], '2000': [2111], 'software': [2112, 2124], 'Bio-Rad.': [2114], 'fluorescence': [2117, 3704, 3727, 4866], 'MetaMorph': [2123], 'Universal': [2126], 'Imaging': [2127], 'Corp.': [2128], 'In': [2129, 2747, 2883, 3573, 4184, 4329, 4635, 5508, 5604, 6173], 'Vitro': [2130, 2748], 'Kinase': [2131], 'Assay—0.5': [2132], 'μCi': [2141], '[γ-32P]ATP': [2143], '1–50': [2145], 'ng': [2146], '(PKA)': [2154], 'Calbiochem': [2156], '20': [2161, 3839, 4031, 6151], 'HEPES': [2163], '7.5),': [2165], 'MgCl2,': [2168], 'ATP': [2172], 'terminated': [2180], 'addition': [2183, 5509], '2×': [2185], '(18McDonald': [2189, 2501], 'B.J.': [2190, 2206, 2502, 2518], '1994;': [2196, 2508], '269:': [2197, 2509], '18111-18117Abstract': [2198, 2510], '19McDonald': [2205, 2517], 'Neuropharmacology.': [2209, 2521], '36:': [2211, 2523], '1377-1385Crossref': [2212, 2524], '(87)': [2215, 2527], 'mixture': [2220], 'analyzed': [2223, 2744, 3129, 3221, 3366, 5131, 5355, 5516], 'SDS-PAGE.': [2225, 2746], 'phosphorimaging': [2227], 'device': [2228], 'quantify': [2232, 4044], 'incorporation': [2234], '32P': [2236], 'proteins.': [2239], 'Neuronal': [2240], 'Cultures—In': [2241], 'brief,': [2242], 'embryos': [2244, 2268], 'day': [2247], '18': [2248, 5974], 'decapitated': [2252], 'solution': [2258], '(HBSS;': [2259], 'Invitrogen)': [2261], 'ice.': [2263], 'Brain': [2264], 'tissues': [2265], 'transferred': [2272], 'fresh': [2274], 'HBSS': [2275, 2305], 'ice,': [2277], 'regions': [2280], 'dissected': [2283], 'out.': [2284], 'Dissected': [2285], 'hippocampi': [2286], 'placed': [2288], '0.25%': [2290], 'trypsin': [2291, 2457], 'gentle': [2299], 'shaking.': [2300], 'Hippocampi': [2301], 'two': [2306, 2961, 3238, 4714, 5393, 5688], 'passed': [2312], 'through': [2313], 'Pasteur': [2314], 'pipettes': [2315], 'dissociate.': [2319], 'Nondissociated': [2320], 'debris': [2321], 'allowed': [2323], 'settle': [2325], 'bottom': [2328], 'Dissociated': [2332], 'counted': [2336], 'hemocytometer': [2338], 'plated': [2340], '60-mm': [2343, 2592], 'culture': [2344, 2426, 4465, 4479], 'dish': [2345, 2427], 'density': [2348], 'million/dish': [2351], 'attachment': [2353, 2378], 'medium': [2354, 2371, 2379, 2385, 2401, 2421, 2436], '10%': [2356], 'fetal': [2357, 2392], 'serum,': [2359, 2394], 'pyruvate,': [2363], 'glucose': [2367], 'minimum': [2369], "Eagle's": [2370], '(Invitrogen).': [2372, 2402], '4': [2373, 2602, 2723], 'plating,': [2376], 'replaced': [2381], 'warm': [2383], 'B-27': [2388], 'neural': [2389], 'supplement,': [2390], 'glutamine': [2398], 'Neurobasal': [2400], 'Hippocampal': [2403], 'kept': [2406], 'incubator': [2409], 'conditioned': [2410], 'CO2.': [2416], 'added': [2423, 2713], 'every': [2428], 'replenish': [2432], 'loss': [2434], 'evaporation.': [2438], 'Peptide': [2439, 2945, 5378], 'Mapping': [2440], 'Phosphoamino': [2442], 'Acid': [2443], 'Analysis—Gel': [2444], 'slices': [2445], 'excised': [2446], 'SDS-polyacrylamide': [2448], 'gels': [2449], 'digested': [2453], '0.1': [2455], 'subjected': [2459, 2848, 4562, 4935], 'two-dimensional': [2461], 'mapping': [2462, 2946, 3132, 4670, 4731, 5379, 5698], 'visualized': [2464, 2495], 'autoradiography.': [2466], 'resulting': [2468, 2479, 3061], 'phosphopeptides': [2469, 2963, 4715], 'hydrolyzed': [2472], 'n': [2475], 'HCl,': [2476], 'phosphoamino': [2480, 2484, 2948, 3134, 4672, 5381], 'along': [2482], 'standards': [2486], 'separated': [2489], 'thin': [2491], 'layer': [2492], 'chromatography': [2493], 'autoradiography': [2497], 'previously': [2500, 2904, 6137], 'Site-directed': [2530], 'Mutagenesis—Mutation': [2531], 'PCR': [2538], 'amplification': [2539], 'whole': [2542], 'plasmid': [2543], 'pairs': [2546], 'harbor': [2548], 'desired': [2550], 'mutation': [2551, 3075, 3085, 3097, 3116, 3141, 4310, 4331, 4352, 5471, 5791], 'follows:': [2554], 'S728A,': [2555], 'GAGGCTATCCGGCGCCTGATGGAGGC': [2556], 'CTCTGCCCGCTGAGCCTGAGG;': [2558], 'T787A,': [2559], 'AGGAACTTCATCGAACTCGTCCGGGAAACTAC': [2560], 'CCAAGCCTGATGATCCTCCTTCTGTCGCCAGTTGC;': [2562], 'S940A,': [2563], 'GAATCTCGGGGCGCTATTCGGAGGAAGA': [2564], 'ATCTGTGATGCTCTGGATCTCCCGTTCC;': [2566], 'S1034A,': [2567], 'GAAAACTTGAACCAGTCCAACGTGCG': [2568], 'CCACTCCGGCTTCATAGCGAAGAAGTCCTTG.': [2570], 'All': [2571], 'mutations': [2572], 'verified': [2574], 'sequencing.': [2577], 'Whole-cell': [2578], 'Metabolic': [2579], 'Labeling': [2580], 'Immunoprecipitation—HEK-293': [2582], '28–35': [2585, 5533], 'dishes': [2593], '0.5–1.0': [2597], 'mCi/ml': [2598, 2610], '[32P]orthophosphoric': [2599, 3297, 4559, 5452], 'phosphate-free': [2605], 'media': [2606], '200': [2609], '[35S]methionine': [2611], 'Cell': [2629, 3431, 4397], 'EDTA': [2642], 'pepstatin': [2675], 'supernatant': [2694, 2716], 'collected': [2696], 'centrifugation.': [2698], '40': [2704], 'A-Sepharose': [2708, 2730], '(1:1': [2709], 'slurry)': [2710], 'constant': [2726], 'agitation.': [2727], 'supplemented': [2738], '500': [2740], 'NaCl': [2742], 'Analysis': [2749], 'PKC—Molecular': [2754], 'consensus': [2760, 2995], 'classical': [2768], 'second': [2769], 'messenger-dependent': [2770], 'commence': [2811], 'N-terminal': [2818, 5368], '(amino': [2819, 2825], '1–102;': [2821], 'His-N·KCC2)': [2822], '645–1116;': [2827], 'His-C·KCC2)': [2828], 'His-tagged': [2835], '(Fig.': [2841, 2881, 2943, 2969, 3120, 3153, 3170, 3283, 3360, 3395, 3571, 3619, 3689, 3741, 3768, 3952, 3990, 4041, 4114, 4209, 4241, 4269, 4327, 4362, 4466, 4597, 4658, 4696, 4822, 4851, 4880, 4916], '1A).': [2842], 'Purified': [2843], 'assays.': [2853], 'This': [2854, 3232, 3520, 3940, 4778, 5360, 5526, 5669, 5773], 'His-C·KCC2': [2858, 2953, 2989, 3152, 3184], 'final': [2868], 'stoichiometry': [2869, 5557], '∼0.6': [2871], 'mol/mol,': [2872], 'whereas': [2873, 3973], 'not': [2876, 3081, 3255, 3314, 3388, 3565, 3609, 3760, 4107, 4202, 4317, 4584, 5366, 6014, 6231], 'under': [2878, 2939, 3357, 3567, 3937, 4086, 5529, 5566, 6140], 'similar': [2879, 3109, 3368, 4725], '1B).': [2882, 2944], 'contrast,': [2884], 'neither': [2885], 'tail': [2898], 'GABABR2': [2901], 'subunit,': [2902], 'identified': [2905], 'enzyme': [2910, 3814], '(20Couve': [2911], 'Hirst': [2917, 5177], 'W.D.': [2918, 5178], 'Walsh': [2921, 5181], 'F.S.': [2922, 5182], 'Nat.': [2927, 5187], '2002;': [2929, 5189], '415-424Crossref': [2931, 5191], '(106)': [2934, 5194], 'same': [2941, 3569], 'analysis': [2950, 4701, 5333, 5383, 5482], 'primarily': [2955], 'residues': [2959, 2987, 3169, 5116, 5391, 5598, 5623], 'B,': [2967], 'respectively': [2968], '1,': [2970], 'D).': [2973], 'analyze': [2976, 3202, 5833], 'phosphorylation,': [2978, 3084, 3441, 4553, 5664], 'site-directed': [2979], 'mutagenesis': [2980, 5397], 'convert': [2984], 'candidate': [2985], 'alanines.': [2991, 3056], 'Based': [2992], '(R/K)X(1–4)(S/T)X(1–3)(R/K)': [3000], 'where': [3001], 'X': [3002], 'any': [3004, 3851], '(21Senawongse': [3007], 'Dalby': [3009, 5199], 'Yang': [3011, 5201], 'Z.R.': [3012, 5202], 'Inf.': [3015, 5205], 'Model.': [3016, 5206], '45:': [3018, 5208], '1147-1152Crossref': [3019, 5209], '22Kennelly': [3023, 5213], 'P.J.': [3024, 5214], 'Krebs': [3025, 5215], 'E.G.': [3026, 5216], '1991;': [3030, 5220], '266:': [3031, 5221], '15555-15558Abstract': [3032, 5222], 'produced': [3043, 3340, 4250, 4604, 4786, 5551, 6095], 'Ser728,': [3046], 'Ser940,': [3047, 4312, 4379, 5789, 5895, 5995], 'Ser1034': [3049, 3079, 3106, 4335], 'individually': [3051], 'sequentially': [3053], 'mutated': [3054, 3279], 'compared': [3068, 3114, 3444, 4048, 4082, 4902, 5885], 'seen': [3071, 3147, 3315, 4203, 4445, 4578, 5418, 5565], 'Although': [3074], 'Ser728': [3077, 3104, 4333, 4354], 'did': [3080, 3387, 3608, 3759, 4106, 4316], 'significantly': [3082, 3389, 3542, 3590, 3610, 3723, 3761, 3981, 4024, 4108, 4213, 4641, 4887], 'alter': [3083, 3762, 4109, 4318], '32.5': [3091], '±': [3092, 3352, 3524, 3546, 3578, 3601, 3735, 3958, 3988, 4090, 4094, 4620, 4654, 4808], '2.5%': [3093], 'control.': [3095], 'Moreover': [3096], 'combination': [3101], 'either': [3103, 4342], 'had': [3107, 6089], 'very': [3108, 4724], 'effects': [3110, 3632, 4006, 4152, 4285, 4765, 4832, 5732, 5838, 5847, 5954, 5987, 6055, 6115, 6219, 6284], 'alone': [3119, 4640], '1E).': [3121], '32P-His-CS940A/KCC2': [3126], 'peptide': [3131, 3145, 4669, 4699, 4738, 5667, 5697], 'analysis.': [3136, 4674], 'Significantly,': [3137, 4296, 5687], 'ablated': [3144, 5412, 5469], '1D)': [3154], 'sites': [3159, 5102], 'His-CS940A/KCC2': [3166], '1C).': [3171], 'Ser940.': [3186, 3425, 5473, 5507, 5831], 'Is': [3188, 4141], 'Major': [3190], 'Site': [3191], 'Expressed': [3198], 'Cells—To': [3201, 4148], 'relevance': [3204, 4408], 'observations,': [3209], 'transiently': [3211], 'immunoprecipitation': [3223, 3292, 4564, 5447], 'antibodies': [3226, 4448, 4582], 'metabolic': [3228, 3294, 5449, 5610], 'labeling': [3229, 3295, 5450], '[35S]methionine.': [3231], 'resulted': [3233], 'isolation': [3236], 'bands': [3239, 3262], 'approximate': [3241], 'molecular': [3242, 5101], 'masses': [3243], '125': [3245], '130': [3247, 3303, 4575], 'kDa': [3248, 3304, 4443, 4576], 'expressing': [3251, 3258, 3268, 3309, 3318, 3649, 3718, 3752, 4159, 4186, 4206, 5335], 'wild-type': [3252, 3310, 3384, 3527, 3598, 3719, 4014, 4084, 5423], 'empty': [3259, 4207], 'vector.': [3260], 'Similar': [3261, 3746], 'immunoprecipitated': [3265], 'form': [3271], '(KCC2S940A)': [3277], 'alanine': [3282], '2A).': [3284], 'examined': [3290, 4414, 4428, 4763], 'acid.': [3298, 5453], 'band': [3301, 4440], 'those': [3317, 4728], 'alone,': [3320], 'demonstrating': [3321, 4588], 'basal': [3322, 3358, 3378, 3938, 4180, 4647, 4676, 5437, 5530, 5567, 5858, 6141], 'Activation': [3330, 4145, 5548, 5876], 'dibutyrate': [3335], '(PDBu)': [3336], 'significant': [3342, 4188, 4255, 4607, 4789, 6100, 6314], 'increase': [3343, 3611, 4256, 4357, 4608, 4790, 5554, 6101, 6264], '(p': [3344, 3592, 3983, 4074, 4215, 4257, 4609, 4615, 4643, 4791, 4889], '<': [3345, 3593, 3984, 4075, 4216, 4258, 4610, 4616, 4644, 4792, 4890], '0.01)': [3346, 3594, 3985, 4076, 4217, 4259, 4611, 4617, 4645, 4793, 4891], '195.7': [3351], '5.6%': [3353], '2B).': [3361, 3396], 'KCC2S940A': [3364, 3394, 3450, 3581, 3618, 3652, 3995, 4056, 4078, 4113], 'methodology,': [3369], 'construct': [3373], 'exhibited': [3374, 5433], 'robust': [3375], 'phosphorylation.': [3379], 'However': [3380, 6216], 'contrast': [3382, 3574, 4101, 4330], 'PDBu': [3386, 3606, 3758, 3978, 4104, 4603, 4785, 4886], 'enhance': [3390, 6165], 'consistent': [3400, 4468, 5896], 'experiments': [3405, 3747, 3776, 4368, 5908], 'strongly': [3407, 4118], 'Enhances': [3429], 'Surface': [3432, 4398], 'Levels—To': [3434], 'consequences': [3438, 6315], 'biotinylation': [3460, 3627, 4827, 6075], '22.9': [3523], '4.5%': [3525, 3989], 'present': [3530, 3583], 'steady': [3536, 5779, 5900], 'state,': [3537], 'could': [3540], '40.6': [3545], '5.4%': [3547], '10-min': [3554, 5770], 'period,': [3556], '2C).': [3572, 3604, 3620], '38.7': [3577], '4.6%': [3579], 'membrane,': [3587], 'level': [3589, 3616, 3693, 4050, 4648, 4855, 4893], 'higher': [3591, 5899], 'than': [3595], '(22.9': [3600], '4.5%;': [3602], 'Fig.': [3603, 4097, 4720, 4741], 'treatment': [3607, 3688, 3715, 4105, 4315], 'confirm': [3622, 4825], 'activating': [3634, 5799], 'immunohistochemistry.': [3644], 'do': [3646, 3822], 'so': [3647, 3823], 'permeabilized,': [3657], 'stained': [3659], 'antibodies.': [3662, 3908], 'Confocal': [3663], 'recorded': [3667], 'cells,': [3670, 5823], 'pixel': [3673], 'intensity': [3674], 'across': [3675], 'entire': [3677, 3926, 5861], 'presence': [3683, 3843, 3976, 4035, 4066, 4712], 'absence': [3685, 4037, 4068], 'PBDU': [3687, 3722], '3A).': [3690], 'relative': [3692, 4854, 5765], 'determined': [3698, 4860], 'calculating': [3700], 'ratio': [3702, 3726, 4864], 'associated': [3706, 3728, 4868], 'periphery': [3710, 3732, 4899, 5820], 'cytoplasm.': [3713], 'Notably': [3714], '182': [3734], '7.2%': [3736], 'control': [3738, 3955, 4569, 4586, 4657, 4904, 5410, 5767], 'untreated': [3739, 4905], '3,': [3742, 3769], 'B': [3743, 4718], 'C).': [3745], 'performed': [3749], 'KCC2S940A;': [3753], 'however,': [3754, 5317, 6125], 'distribution': [3764], 'immunoreactivity': [3767, 4896], 'A–C).': [3770], 'biochemical': [3773, 5744], 'imaging': [3775], 'indicate': [3777], 'increases': [3784, 4944], 'levels.': [3789], 'Decreases': [3794], 'Endocytosis—To': [3796], 'evaluate': [3798], 'underlying': [3801, 5836], 'modulation': [3803, 6311], 'stability,': [3808, 5845], 'possible': [3810], 'evaluated.': [3820], 'NHS-SS-biotin': [3830, 3889], 'up': [3837], 'leupeptin': [3845], 'prevent': [3847], 'lysozomal': [3848], 'degradation': [3849], 'glutathione,': [3892], 'isolated': [3901], 'immunoblotted': [3905], 'controlling': [3910], '(remaining': [3916], '0': [3919], 'min)': [3920], 'approach': [3922], 'endocytosed': [3933], 'conditions.': [3939, 5568], 'process': [3941], 'linear': [3943], 'initial': [3946], '5-min': [3947, 4059], 'period': [3948], 'assay': [3951], '4A).': [3953, 4042], '80.7': [3957, 4093], '8.2%': [3959], '30.5': [3987], '4B).': [3991, 4098, 4115], 'assess': [3998], 'mediating': [4004], 'endocytosis.': [4011, 4136, 6271], 'Compared': [4012], 'appeared': [4021, 4355], 'course': [4029, 4199, 5872], 'results,': [4046, 5985], 'incubation': [4060, 5971], 'PDBu.': [4070], 'Significantly': [4071], 'lower': [4072], '(15.6': [4089], '3.2': [4091], 'versus': [4092], '8.2%,': [4095], 'respectively;': [4096], 'acts': [4125, 6262], 'slowing': [4134, 6269], 'Activity': [4138, 4392], 'Increased': [4142], 'Cultured': [4147, 4404], 'function,': [4158], 'bumetanide': [4164], 'ouabain': [4166], 'inhibit': [4168], 'Na+-K+-2Cl–': [4170], 'Na+-K+-ATPase,': [4173], 'furosemide-sensitive': [4181, 4266], '86Rb+': [4182, 4191, 4267], 'influx.': [4183], '3–5-min': [4197], '5).': [4210, 4242, 4270, 4328, 4363], 'Influx': [4211], 'enhanced': [4214], '15-min': [4220], 'preincubation': [4221], 'N-ethylmaleimide': [4223], '(NEM),': [4224], 'accepted': [4226], 'activator': [4227], 'Pretreatment': [4243], '12-myristate-13-acetate': [4248], '(PMA)': [4249], 'large': [4252, 6097], 'highly': [4254, 4606, 4788, 6099], 'influx': [4268], 'test': [4272], 'direct': [4276], 'modulation,': [4283], 'PMA': [4287, 5956, 5989], 'mutants': [4293], 'analyzed.': [4295], 'ability': [4298, 4320], 'NEM': [4322], 'stimulate': [4324], 'without': [4339], 'effect': [4340, 4625, 4813, 4908, 5466, 5774, 5797, 5825, 5889], 'NEM-dependent': [4345], 'stimulation': [4346], 'activity,': [4349], 'interestingly': [4351], 'constitutive': [4358], 'series': [4366], 'dependent': [4377, 5787, 5829, 5893, 5993, 6212], 'Modulates': [4393], 'Stability': [4399], 'Neurons—To': [4405], 'examine': [4406, 4552, 5099], 'neurons.': [4421, 4969, 5329], 'initiate': [4423], 'experiments,': [4425, 4828, 5513], 'via': [4436, 4912, 5446, 6008, 6118], '∼130': [4442], 'weeks': [4455, 4463, 6094], 'reached': [4457], 'maximal': [4458], 'between': [4461, 5963], '4–5': [4462, 6093], '6A)': [4467], 'other': [4470, 5058, 6017], 'developmental': [4474], '23Strange': [4507, 5229], 'Singer': [4509, 5231], 'T.D.': [4510, 5232], 'Morrison': [4511, 5233], 'R.': [4512, 5234], '2000;': [4518, 5240], 'C860-C867Crossref': [4520, 5242], '24Takayama': [4524, 5246], 'Inoue': [4526, 4539, 5248, 5261], 'Neuroscience.': [4528, 5250], '143:': [4530, 5252], '757-767Crossref': [4531, 5253], '25Takayama': [4537, 5259], 'Res.': [4542, 5264], '57:': [4544, 5266], '322-325Crossref': [4545, 5267], '(16)': [4548, 5270], '4–5-week': [4554], 'antibody.': [4567], 'phosphoprotein': [4573], 'immunoprecipitating': [4579], 'IgG,': [4587], 'basally': [4592, 5541], '6B).': [4598, 4659], 'Treatment': [4599, 4882], '295.5': [4619], '22.3%': [4621], 'control,': [4623, 4811, 5887], 'co-application': [4628], 'inhibitor': [4632, 4821], 'calphostin': [4633], '(Cal).': [4634], 'addition,': [4636, 5605], '15.5': [4653], '3.5%': [4655], 'evaluated': [4667, 5741], 'threonine': [4685, 5546], 'residues,': [4686], 'induced': [4693], '6C).': [4697], 'map': [4700], '32P-KCC2': [4703], '(A': [4716], '1D),': [4721], 'showed': [4723], 'migration': [4726], 'PKC-phosphorylation': [4732], '32P-His-C·KCC2': [4733], 'neutral': [4737], '(C': [4739], '1D).': [4742], 'represent': [4752], 'biotinylation.': [4777], '(CS)': [4805], '295.6': [4807], '9.8%': [4809], 'specific': [4819], '6D).': [4823], 'immunohistochemistry': [4846, 5807], 'followed': [4847], 'microscopy': [4850], '7A).': [4852], 'measuring': [4862], 'signals': [4867], 'cytoplasm': [4875], 'individual': [4877, 5106], 'proximal': [4878], 'dendrites': [4879, 4901], '7B).': [4881], '7C).': [4917], 'Therefore': [4918, 5474], 'observations': [4926], 'native': [4932], 'environment': [4933], 'determinant': [4962], 'concentrations': [4979], 'responses': [4985], 'Deficits': [5048], 'importance': [5054], 'pathologies': [5062], '(26Staley': [5063], 'K.J.': [5064, 5274], 'Adv.': [5065, 5275], 'Exp.': [5066, 5276], '548:': [5070, 5280], '104-109Crossref': [5071, 5281], '(22)': [5074, 5284], 'Scholar);': [5076, 5316], 'therefore': [5077], 'comprehending': [5078], 'mechanisms': [5081], 'significance.': [5093], 'Here': [5094], 'begun': [5097], 'kinases': [5108, 5144], 'There': [5123], 'regulation': [5133], 'agents': [5137], 'modify': [5139], 'phosphatases': [5146], '(6Bergeron': [5147, 5928], '20Couve': [5171], '21Senawongse': [5197], '26Staley': [5273], '27Wake': [5287], 'Watanabe': [5289, 5626], 'Moorhouse': [5291, 5628], 'A.J.': [5292, 5629], 'Kanematsu': [5293, 5630], 'Horibe': [5295, 5632], 'Matsukawa': [5297, 5634], 'N.': [5298, 5635], 'Asai': [5299, 5636], 'Ojika': [5301, 5638], 'Hirata': [5303, 5640], 'Nabekura': [5305, 5642], '27:': [5310, 5647], '1642-1650Crossref': [5311, 5648], '(150)': [5314, 5651], 'commenced': [5331], 'N-(residues': [5338], '1–102)': [5339], '(residues': [5344], '645–1116)': [5345], 'their': [5356], 'vitro.': [5359, 5709], 'selectively': [5372], 'stochiometrically': [5374], 'PKC.': [5377, 5686, 5730], 'occurred': [5388, 5576], 'phosphopeptides.': [5395], 'Site-specific': [5396], '∼25%': [5408], 'one': [5413], 'peptides': [5417, 5682, 5691], 'Consistent': [5425, 5583], 'analysis,': [5430], 'high': [5434, 5609], 'robustly': [5459], 'combined': [5476], 'vivo': [5481], 'immunoprecipitation.': [5525], 'residues.': [5547, 5582], 'dramatic': [5553], '∼400%': [5562], 'Enhanced': [5569], 'serine,': [5578], 'threonine,': [5579], 'result': [5586, 5958], 'found': [5591], 'serine/threonine': [5597], 'cortical': [5600], '(not': [5602], 'shown).': [5603], 'oxidative': [5606], 'stress': [5607], 'and/or': [5608], 'recently': [5613], 'induce': [5617], '(27Wake': [5624], 'compare': [5656], 'mapping.': [5668], 'tryptic': [5681, 5696], 'terminus': [5702], 'approaches.': [5747], 'As': [5748, 6011], 'biotinylation,': [5751], '∼200%': [5764], 'period.': [5772], 'state': [5780, 5901], 'critically': [5786, 5892], 'residue': [5794, 6002, 6049, 6261], 'abrogated': [5795], 'stability.': [5805], 'Likewise': [5806], 'measured.': [5856], 'dramatically': [5879], 'slowed': [5880], 'mutant.': [5906], 'Previous': [5907], 'Xenopus': [5910], 'oocytes': [5911, 5964, 5991], 'illustrated': [5913], 'decreases': [5919], 'differing': [5960], 'itineraries': [5962], 'temperatures': [5972], '°C,': [5977], 'suggesting': [5996], 'conserved': [6015], 'CCCs': [6018], 'unique': [6045], 'function.': [6053], 'examined.': [6072], 'imaging,': [6077], 'Whether': [6113], 'mediated': [6117, 6221, 6322], 'ascertained;': [6124], 'interesting': [6128], 'note': [6130], 'shown': [6138, 6237], '50%': [6143], 'degraded': [6149], 'Enhancing': [6153], 'provide': [6158], 'rapid': [6160], 'dynamic': [6162], 'mechanism,': [6178], 'Fiumelli': [6179], 'et': [6180], 'al.': [6181], '(28Fiumelli': [6182], 'Cancedda': [6184], 'Poo': [6186], 'M.M.': [6187], '48:': [6190], '773-786Abstract': [6191], '(178)': [6199], 'ECl': [6205], 'shifts': [6206], 'caused': [6207], 'changing': [6209], '[Ca2+]i': [6210], 'if': [6217], 'stochiometry': [6226], 'demonstrated.': [6233], 'Therefore,': [6272], 'signaling': [6274, 6279], 'activate': [6277], 'pathways': [6280], 'profound': [6283], 'Given': [6298], 'homeostasis,': [6307], 'phospho-dependent': [6309], 'receptors.': [6327], 'thank': [6329], 'Margie': [6330], 'Maronski': [6331], 'Dichter': [6334], 'laboratory': [6335], 'preparation': [6337], 'Yolande': [6343], 'Haydon': [6344], 'manuscript': [6346], 'preparation.': [6347]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W1970631193', 'counts_by_year': [{'year': 2024, 'cited_by_count': 11}, {'year': 2023, 'cited_by_count': 16}, {'year': 2022, 'cited_by_count': 16}, {'year': 2021, 'cited_by_count': 20}, {'year': 2020, 'cited_by_count': 34}, {'year': 2019, 'cited_by_count': 25}, {'year': 2018, 'cited_by_count': 13}, {'year': 2017, 'cited_by_count': 19}, {'year': 2016, 'cited_by_count': 15}, {'year': 2015, 'cited_by_count': 18}, {'year': 2014, 'cited_by_count': 21}, {'year': 2013, 'cited_by_count': 8}, {'year': 2012, 'cited_by_count': 16}], 'updated_date': '2025-01-19T23:57:48.116307', 'created_date': '2016-06-24'}