Title: CGI-58 facilitates lipolysis on lipid droplets but is not involved in the vesiculation of lipid droplets caused by hormonal stimulation
Abstract: A lipid droplet (LD)-associated protein, perilipin, is a critical regulator of lipolysis in adipocytes. We previously showed that Comparative Gene Identification-58 (CGI-58), a product of the causal gene of Chanarin-Dorfman syndrome, interacts with perilipin on LDs. In this study, we investigated the function of CGI-58 using RNA interference. Notably, CGI-58 knockdown caused an abnormal accumulation of LDs in both 3T3-L1 preadipocytes and Hepa1 hepatoma cells. CGI-58 knockdown did not influence the differentiation of 3T3-L1 adipocytes but reduced the activity of both basal and cAMP-dependent protein kinase-stimulated lipolysis. In vitro studies showed that CGI-58 itself does not have lipase/esterase activity, but it enhanced the activity of adipose triglyceride lipase. Upon lipolytic stimulation, endogenous CGI-58 was rapidly dispersed from LDs into the cytosol along with small particulate structures. This shift in localization depends on the phosphorylation of perilipin, because phosphorylated perilipin lost the ability to bind CGI-58. During lipolytic activation, LDs in adipocytes vesiculate into micro-LDs. Using coherent anti-Stokes Raman scattering microscopy, we pursued the formation of micro-LDs in single cells, which seemed to occur in cytoplasmic regions distant from the large central LDs. CGI-58 is not required for this process. Thus, CGI-58 facilitates lipolysis in cooperation with perilipin and other factors, including lipases. A lipid droplet (LD)-associated protein, perilipin, is a critical regulator of lipolysis in adipocytes. We previously showed that Comparative Gene Identification-58 (CGI-58), a product of the causal gene of Chanarin-Dorfman syndrome, interacts with perilipin on LDs. In this study, we investigated the function of CGI-58 using RNA interference. Notably, CGI-58 knockdown caused an abnormal accumulation of LDs in both 3T3-L1 preadipocytes and Hepa1 hepatoma cells. CGI-58 knockdown did not influence the differentiation of 3T3-L1 adipocytes but reduced the activity of both basal and cAMP-dependent protein kinase-stimulated lipolysis. In vitro studies showed that CGI-58 itself does not have lipase/esterase activity, but it enhanced the activity of adipose triglyceride lipase. Upon lipolytic stimulation, endogenous CGI-58 was rapidly dispersed from LDs into the cytosol along with small particulate structures. This shift in localization depends on the phosphorylation of perilipin, because phosphorylated perilipin lost the ability to bind CGI-58. During lipolytic activation, LDs in adipocytes vesiculate into micro-LDs. Using coherent anti-Stokes Raman scattering microscopy, we pursued the formation of micro-LDs in single cells, which seemed to occur in cytoplasmic regions distant from the large central LDs. CGI-58 is not required for this process. Thus, CGI-58 facilitates lipolysis in cooperation with perilipin and other factors, including lipases. In mammals, excessive energy is stored as triglyceride (TG) in lipid droplets (LDs) of the adipose tissue and supplied to various tissues as fatty acids on demand. Lipolysis in adipocytes, an intimately controlled process whereby TG is hydrolyzed, releasing fatty acids into the circulation, is crucial to the maintenance of the body's energy balance. Stimulation by catecholamines activates the lipolytic response in adipocytes through the increased activity of cAMP-dependent protein kinase (PKA). PKA phosphorylates two key proteins involved in lipolysis: hormone-sensitive lipase (HSL), an enzyme responsible for the hydrolysis of TG and diacylglycerol, and perilipin, a LD-associated protein (1Greenberg A.S. Egan J.J. Wek S.A. Garty N.B. Blanchette-Mackie E.J. Londos C. Perilipin, a major hormonally regulated adipocyte-specific phosphoprotein associated with the periphery of lipid storage droplets..J. Biol. Chem. 1991; 266: 11341-11346Abstract Full Text PDF PubMed Google Scholar, 2Fredrikson G. Stralfors P. Nilsson N.O. Belfrage P. Hormone-sensitive lipase of rat adipose tissue. Purification and some properties..J. Biol. Chem. 1981; 256: 6311-6320Abstract Full Text PDF PubMed Google Scholar, 3Holm C. Molecular mechanisms regulating hormone-sensitive lipase and lipolysis..Biochem. Soc. Trans. 2003; 31: 1120-1124Crossref PubMed Scopus (392) Google Scholar, 4Tansey J.T. Sztalryd C. Hlavin E.M. Kimmel A.R. Londos C. The central role of perilipin A in lipid metabolism and adipocyte lipolysis..IUBMB Life. 2004; 56: 379-385Crossref PubMed Scopus (194) Google Scholar). Perilipin blocks the access of HSL to LDs in quiescent adipocytes and thus restricts the lipolytic activity. On the other hand, upon lipolytic activation, multiphosphorylated perilipin facilitates the access of HSL to LDs, thereby promoting lipolysis (5Egan J.J. Greenberg A.S. Chang M.K. Wek S.A. Moos Jr., M.C. Londos C. Mechanism of hormone-stimulated lipolysis in adipocytes: translocation of hormone-sensitive lipase to the lipid storage droplet..Proc. Natl. Acad. Sci. USA. 1992; 89: 8537-8541Crossref PubMed Scopus (349) Google Scholar, 6Brasaemle D.L. Levin D.M. Adler-Wailes D.C. Londos C. The lipolytic stimulation of 3T3-L1 adipocytes promotes the translocation of hormone-sensitive lipase to the surfaces of lipid storage droplets..Biochim. Biophys. Acta. 2000; 1483: 251-262Crossref PubMed Scopus (186) Google Scholar, 7Sztalryd C. Xu G. Dorward H. Tansey J.T. Contreras J.A. Kimmel A.R. Londos C. Perilipin A is essential for the translocation of hormone-sensitive lipase during lipolytic activation..J. Cell Biol. 2003; 161: 1093-1103Crossref PubMed Scopus (420) Google Scholar). Although HSL has been recognized as the principal rate-limiting factor of TG degradation, recent studies using HSL- and perilipin-null mice revealed that perilipin is a major regulator of lipolysis in adipocytes (8Martinez-Botas J. Anderson J.B. Tessier D. Lapillonne A. Chang B.H. Quast M.J. Gorenstein D. Chen K.H. Chan L. Absence of perilipin results in leanness and reverses obesity in Lepr(db/db) mice..Nat. Genet. 2000; 26: 474-479Crossref PubMed Scopus (493) Google Scholar, 9Tansey J.T. Sztalryd C. Gruia-Gray J. Roush D.L. Zee J.V. Gavrilova O. Reitman M.L. Deng C.X. Li C. Kimmel A.R. et al.Perilipin ablation results in a lean mouse with aberrant adipocyte lipolysis, enhanced leptin production, and resistance to diet-induced obesity..Proc. Natl. Acad. Sci. USA. 2001; 98: 6494-6499Crossref PubMed Scopus (606) Google Scholar, 10Osuga J. Ishibashi S. Oka T. Yagyu H. Tozawa R. Fujimoto A. Shionoiri F. Yahagi N. Kraemer F.B. Tsutsumi O. et al.Targeted disruption of hormone-sensitive lipase results in male sterility and adipocyte hypertrophy, but not in obesity..Proc. Natl. Acad. Sci. USA. 2000; 97: 787-792Crossref PubMed Scopus (504) Google Scholar, 11Roduit R. Masiello P. Wang S.P. Li H. Mitchell G.A. Prentki M. A role for hormone-sensitive lipase in glucose-stimulated insulin secretion: a study in hormone-sensitive lipase-deficient mice..Diabetes. 2001; 50: 1970-1975Crossref PubMed Scopus (102) Google Scholar, 12Haemmerle G. Zimmermann R. Hayn M. Theussl C. Waeg G. Wagner E. Sattler W. Magin T.M. Wagner E.F. Zechner R. Hormone-sensitive lipase deficiency in mice causes diglyceride accumulation in adipose tissue, muscle, and testis..J. Biol. Chem. 2002; 277: 4806-4815Abstract Full Text Full Text PDF PubMed Scopus (487) Google Scholar). Because perilipin does not have an intrinsic enzyme activity, it seems to serve as a scaffold for the assembly of other proteins in the lipolytic event. Against this background, we previously searched for a binding partner of perilipin and identified Comparative Gene Identification-58 (CGI-58; also called ABHD5) (13Yamaguchi T. Omatsu N. Matsushita S. Osumi T. CGI-58 interacts with perilipin and is localized to lipid droplets. Possible involvement of CGI-58 mislocalization in Chanarin-Dorfman syndrome..J. Biol. Chem. 2004; 279: 30490-30497Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar). CGI-58, the product of the causal gene of Chanarin-Dorfman syndrome (CDS), interacts with perilipin on the surface of LDs. CDS is a rare autosomal recessive form of nonbullous congenital ichthyosiform erythroderma, characterized by the abnormal intracellular accumulation of LDs in many tissues (14Lefèvre C. Jobard F. Caux F. Bouadjar B. Karaduman A. Heilig R. Lakhdar H. Wollenberg A. Verret J.L. Weissenbach J. et al.Mutations in CGI-58, the gene encoding a new protein of the esterase/lipase/thioesterase subfamily, in Chanarin-Dorfman syndrome..Am. J. Hum. Genet. 2001; 69: 1002-1012Abstract Full Text Full Text PDF PubMed Scopus (393) Google Scholar). We showed that endogenous CGI-58 is distributed predominantly on the surface of LDs in 3T3-L1 cells and that its expression is increased during adipocyte differentiation. CGI-58 mutants carrying amino acid substitutions identical to those found in CDS patients were not recruited to LDs, but at the same time they lost the ability to bind to perilipin (13Yamaguchi T. Omatsu N. Matsushita S. Osumi T. CGI-58 interacts with perilipin and is localized to lipid droplets. Possible involvement of CGI-58 mislocalization in Chanarin-Dorfman syndrome..J. Biol. Chem. 2004; 279: 30490-30497Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar). This observation indicates that the loss of interaction with perilipin is linked to the pathogenesis of CDS. Another research group also demonstrated the interaction of CGI-58 with perilipin (15Subramanian V. Rothenberg A. Gomez C. Cohen A.W. Garcia A. Bhattacharyya S. Shapiro L. Dolios G. Wang R. Lisanti M.P. et al.Perilipin A mediates the reversible binding of CGI-58 to lipid droplets in 3T3-L1 adipocytes..J. Biol. Chem. 2004; 279: 42062-42071Abstract Full Text Full Text PDF PubMed Scopus (253) Google Scholar). They further showed that activation of PKA dispersed CGI-58-green fluorescent protein (GFP) from the surface of LDs to the cytosol, suggesting the involvement of CGI-58 in the lipolytic process. On the other hand, several groups recently showed that adipose triglyceride lipase (ATGL; also called desnutrin or iPLA2ζ) is an additional TG lipase that catabolizes TG, cooperating with HSL in the adipocytes (16Zimmermann R. Strauss J.G. Haemmerle G. Schoiswohl G. Birner-Gruenberger R. Riederer M. Lass A. Neuberger G. Eisenhaber F. Hermetter A. et al.Fat mobilization in adipose tissue is promoted by adipose triglyceride lipase..Science. 2004; 306: 1383-1386Crossref PubMed Scopus (1518) Google Scholar, 17Villena J.A. Roy S. Sarkadi-Nagy E. Kim K.H. Sul H.S. Desnutrin, an adipocyte gene encoding a novel patatin domain-containing protein, is induced by fasting and glucocorticoids: ectopic expression of desnutrin increases triglyceride hydrolysis..J. Biol. Chem. 2004; 279: 47066-47075Abstract Full Text Full Text PDF PubMed Scopus (507) Google Scholar, 18Jenkins C.M. Mancuso D.J. Yan W. Sims H.F. Gibson B. Gross R.W. Identification, cloning, expression, and purification of three novel human calcium-independent phospholipase A2 family members possessing triacylglycerol lipase and acylglycerol transacylase activities..J. Biol. Chem. 2004; 279: 48968-48975Abstract Full Text Full Text PDF PubMed Scopus (681) Google Scholar). ATGL is expressed in many tissues but at a particularly high level in the adipose tissue. Similar to CGI-58, ATGL is associated with LDs and is believed to be involved in TG turnover on LDs (19Smirnova E. Goldberg E.B. Makarova K.S. Lin L. Brown W.J. Jackson C.L. ATGL has a key role in lipid droplet/adiposome degradation in mammalian cells..EMBO Rep. 2006; 7: 106-113Crossref PubMed Scopus (244) Google Scholar). Very recently, CGI-58 was shown to activate ATGL in vitro (20Lass A. Zimmermann R. Haemmerle G. Riederer M. Schoiswohl G. Schweiger M. Kienesberger P. Strauss J.G. Gorkiewicz G. Zechner R. Adipose triglyceride lipase-mediated lipolysis of cellular fat stores is activated by CGI-58 and defective in Chanarin-Dorfman syndrome..Cell Metab. 2006; 3: 309-319Abstract Full Text Full Text PDF PubMed Scopus (678) Google Scholar). To elucidate the regulatory mechanism of lipolysis, it is important to solve the physiological functions of LD proteins involved in this process. In this study, we independently investigated the function of CGI-58 using the RNA interference (RNAi) strategy. We revealed the lipid-catabolizing function of CGI-58 in adipocytes as well as the dynamic behavior of CGI-58 and LDs themselves during lipolytic activation. cDNA of rat CGI-58 was obtained as described previously (13Yamaguchi T. Omatsu N. Matsushita S. Osumi T. CGI-58 interacts with perilipin and is localized to lipid droplets. Possible involvement of CGI-58 mislocalization in Chanarin-Dorfman syndrome..J. Biol. Chem. 2004; 279: 30490-30497Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar). cDNAs of rat HSL and mouse ATGL were obtained by RT-PCR from the total RNA of rat adipose tissue and mouse liver, respectively. cDNAs were subcloned into a mammalian expression vector, pCMV5-myc, using appropriate restriction sites. Point mutations of CGI-58 and HSL were generated by PCR and verified by DNA sequencing. 3T3-L1 cells were maintained in DMEM/10% FBS. For differentiation, confluent cells (day 0) were treated with a hormone mixture containing 1 μM dexamethasone, 0.5 mM 3-isobutyl-1-methylxanthine (IBMX), and 5 μg/ml insulin in DMEM/10% FBS. After 48 h (day 2), the hormone mixture was removed and cells were further cultured in DMEM/10% FBS supplemented with 5 μg/ml insulin. The mouse hepatoma cell line Hepa1 was maintained in DMEM/10% FBS. HeLa cells were maintained in F-12/10% FBS. DNA transfection was carried out by the calcium phosphate method (21Sambrook T. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989: 16.32-16.36Google Scholar) for HeLa cells and with Lipofectamine 2000 (Invitrogen) for 293FT cells, according to the manufacturer's directions. Lentivirus expressing short hairpin RNA (shRNA) against mouse CGI-58 was prepared as follows. Pairs of oligonucleotides specifying the shRNA sequences corresponding to the target sequences (AAGAAGTAGTAGACCTAGGTT for CGI-58 RNAi and AAGAAGTAGACATCCTAGGTT for the mismatch control) were designed. A spacer sequence with a loop structure and an extra sequence to facilitate the cloning were also included. The two strands of oligonucleotide were annealed and cloned into pENTER/U6 plasmid (Invitrogen) downstream of the U6 promoter. The cassette containing the U6 promoter and shRNA-coding sequence was then transferred to a self-inactivating lentivirus vector (CS-RfA-EG), generating CS-U6-shRNA-EG. 293FT cells (3.5 × 106) were seeded in 10 cm dishes and cultured for 24 h before transfection. Cells were transfected with a mixture of three plasmids: 7 μg of CSII-U6-shRNA-EG, 5 μg of pCAG-HIVgp, and 4 μg of pCMV-VSV-G-RSV-Rev. The recombinant virus was expected to direct the synthesis of shRNA against CGI-58 under the control of the U6 promoter and GFP under the control of the human elongation factor 1α subunit gene promoter. The culture supernatant containing the recombinant lentivirus was collected 48 h after transfection, passed through a 0.45 μm filter, and used for infection. The titer of lentivirus was estimated by counting the cells expressing GFP after infecting HeLa cells with serially diluted vector stocks. 3T3-L1 preadipocytes or Hepa1 cells were infected with viral stocks at a multiplicity of infection of 50. The transduced cells were grown and used for subsequent experiments. An antibody was raised in a rabbit against recombinant CGI-58 that was produced by trypsin digestion of glutathione S-transferase (GST)-fused CGI-58 expressed in Escherichia coli. Guinea pig polyclonal anti-perilipin and anti-adipocyte differentiation-related protein (ADRP) antibodies were purchased from Progen. Total RNA was prepared from 3T3-L1 and Hepa1 cells using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. cDNA was synthesized from 1 μg of total RNA in a reaction mixture containing Moloney murine leukemia virus reverse transcriptase (Invitrogen) using a downstream primer mixture (10 pmol each) in a total volume of 20 μl. PCR was performed with 2 μl of the RT product as a template, 10 pmol each of the upstream and downstream primers, and rTaq DNA polymerase (Takara). The reaction products were separated on 2% agarose gels and detected with a fluorescence imaging analyzer (FLA3000; Fuji). 3T3-L1 and Hepa1 cells were washed with PBS and directly dissolved in the heated SDS-PAGE sample buffer. Aliquots of the extracts were subjected to SDS-PAGE and transferred to a nitrocellulose membrane. Proteins were probed with an antibody to CGI-58, perilipin, or ADRP and detected by the ECL method (Amersham Biosciences). 3T3-L1 cells were grown in 12-well dishes. On day 12 after their differentiation, cells were washed twice with Hank's buffer and incubated with DMEM containing 2% fatty acid-free BSA (Sigma)/20 mM HEPES (pH 7.4) with or without 0.1 mM IBMX at 37°C. After incubation for 3, 6, and 12 h, the medium was collected and assayed for glycerol content using a reagent kit (Wako). Hepa1 cells were treated with a medium containing 0.2 mM oleic acid complexed to albumin for 24 h. Glycerol release was assayed as described above. For TG measurements, Hepa1 cells treated with oleic acid for 48 h were washed and harvested in a lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, and 0.5% cholate). Triacylglycerol was measured using a TG E-test kit (Wako). For immunostaining of CGI-58 and perilipin, 3T3-L1 cells were fixed with PBS containing 4% paraformaldehyde, permeabilized in 0.2% Triton X-100/PBS, and blocked with 2% BSA/PBS. Cells were then incubated with primary polyclonal antibodies for 1 h, washed with PBS, and incubated with Cy3-conjugated (Jackson ImmunoResearch) or Alexa488-conjugated (Molecular Probes) secondary antibody for 1 h. After being washed with PBS, cells were mounted and observed with a confocal microscope (LSM510; Carl Zeiss). For detection of GFP-CGI-58 and ADRP, Hepa1 cells were transfected with the expression vector encoding GFP-fused full-length CGI-58. Transfection was carried out using Lipofectamine 2000 (Invitrogen) according to the manufacturer's directions. After transfection for 20 h, cells were fixed, permeabilized with 0.01% digitonin/PBS, and blocked. Cells were immunostained with a primary polyclonal antibody against ADRP and then a Cy3-conjugated secondary antibody. Cells were observed with a fluorescence microscope (Biozero; Keyence). For Nile Red staining, cells were fixed with 4% paraformaldehyde in PBS for 20 min at room temperature and stained with 100 ng/ml Nile Red in PBS for 10 min at room temperature. After being washed with PBS, cells were mounted and observed with a fluorescence microscope. Recombinant GST-CGI-58 protein was expressed in E. coli BL21(DE3) and affinity-purified with glutathione-agarose. The amount of the recombinant protein was standardized on Coomassie blue-stained SDS-polyacrylamide gels. For the binding experiment with native perilipin and GST-CGI-58, differentiated 3T3-L1 cells (day 8) treated with or without 10 μM isoproterenol and 0.5 mM IBMX for 1 h were washed with Tris-buffered saline (pH 7.4) and harvested in a binding buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 25 mM 2-glycerophosphate, 50 mM NaF, 1 mM sodium vanadate, 1% Triton X-100, 1 mM EDTA, and 1 mM DTT) containing 1 mM PMSF, a proteinase inhibitor mixture, and a phosphatase inhibitor cocktail (Sigma). The lysates were centrifuged at 15,000 rpm for 15 min at 4°C, and the resulting supernatant was mixed with glutathione-agarose beads containing 15 μg of GST-CGI-58. After 90 min at 4°C, the beads were washed four times with the binding buffer and suspended in 100 μl of the SDS-PAGE loading buffer. The samples (10 μl each) were separated by SDS-PAGE and analyzed by Western blotting with an anti-perilipin polyclonal antibody. The transient transfection of HeLa cells by the calcium phosphate method was performed as described (21Sambrook T. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989: 16.32-16.36Google Scholar) using 20 μg of DNA per 10 cm dish. After 24 h, cells overexpressing myc-tagged proteins were harvested and then broken by sonication in 0.25 M sucrose containing 1 mM EDTA, 1 mM DTT, and a proteinase inhibitor mixture. Cell debris was removed by centrifugation, and the supernatant was analyzed for lipase or esterase activity. For the lipase assay, the substrate emulsion was prepared by sonicating the mixture of gum arabic and [14C]triolein. The reaction was performed with 0.2 ml of cell extract and 40 μl of substrate in a buffer (50 mM Tris-HCl, pH 7.4, and 1 mM calcium acetate) for 2 h at 37°C. The reaction was terminated by mixing the solution with 1.5 ml of chloroform and 12 μl of 2.5 N HCl. After centrifugation, the lower layer was collected and dried under a flow of N2 gas. The lipids were subjected to TLC on a silica gel plate using petroleum ether-diethylether-acetic acid (80:30:1, v/v) as a solvent, and the intensity of the signal for free fatty acid was determined in an imaging analyzer (FLA3000; Fuji). Esterase activity was measured as described previously (22Holm C. Davis R.C. Osterlund T. Schotz M.C. Fredrikson G. Identification of the active site serine of hormone-sensitive lipase by site-directed mutagenesis..FEBS Lett. 1994; 344: 234-238Crossref PubMed Scopus (56) Google Scholar), with minor modifications. Aliquots of cell extracts were incubated in 1 ml of PBS containing 1 mM dithiothreitol and 0.5 mM p-nitrophenylbutyrate as a substrate at 37°C for 10 min. The reaction was terminated by adding methanol-chloroform-heptane (10:9:7). The absorbance of the supernatant was measured at 400 nm. The construction and operation of a coherent anti-Stokes Raman scattering (CARS) microscope was totally supported by Olympus Co. (Tokyo, Japan). A schematic diagram of the microscope is shown in Fig. 7 below. The system is essentially based on a previously described construction of the forward-detected CARS (F-CARS) microscope (23Wang H. Fu Y. Zickmund P. Shi R. Cheng J.X. Coherent anti-Stokes Raman scattering imaging of axonal myelin in live spinal tissues..Biophys. J. 2005; 89: 581-591Abstract Full Text Full Text PDF PubMed Scopus (286) Google Scholar). There are some modifications. The pulse width is 3–5 ps. The laser beams are directed into a confocal microscope (FV1000/IX81; Olympus). CARS and two-photon excitation fluorescence (TPEF) signals are detected with different types of photomultiplier tube (R3896 for F-CARS and H7422-20 for TPEF; Hamamatsu Photonics). To investigate the function of CGI-58, we took advantage of the gene-silencing strategy using RNAi. We used a lentivirus-mediated small interfering RNA (siRNA) system in which shRNA corresponding to the target sequence is expressed under the control of the U6 promoter. We initially examined three target sequences in the mRNA of murine CGI-58 for the silencing activity. Among them, the most effective sequence was selected and used throughout the study. As a control, the vector itself or a vector containing a mutant target sequence in which four nucleotides deviated from the wild-type sequence (referred to as a mismatch) was used. 3T3-L1 preadipocytes transduced with each recombinant virus were exposed to the medium containing the adipogenic hormone mixture on the day when the cells reached confluence (day 0) and treated for 2 days. mRNA levels of CGI-58 and markers for adipocyte differentiation [peroxisome proliferator-activated receptor (PPAR)γ and adipocyte lipid binding protein (aP2)] were first examined by RT-PCR (Fig. 1A ). In control cells, the level of CGI-58 mRNA increased in the course of adipocyte differentiation, similar to a previous finding (13Yamaguchi T. Omatsu N. Matsushita S. Osumi T. CGI-58 interacts with perilipin and is localized to lipid droplets. Possible involvement of CGI-58 mislocalization in Chanarin-Dorfman syndrome..J. Biol. Chem. 2004; 279: 30490-30497Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar). The level of CGI-58 mRNA was decreased significantly by RNAi compared with the vector or mismatch control, indicating that effective gene silencing was achieved (∼80% decrease as quantified by densitometry). On the other hand, mRNA levels of PPARγ and aP2 were not affected by CGI-58 RNAi. Western blotting also showed that the CGI-58 protein level was decreased significantly in RNAi-treated cells compared with control cells (Fig. 1B). On day 0, a low level of CGI-58 protein was detected in the control cells after prolonged exposure of the membrane, although it is difficult to see in the figure. We also examined protein levels of perilipin and ADRP, the perilipin/ADRP/tail interacting protein of 47 kDa family (PAT) proteins existing on LDs of adipocytes. Although the protein level of perilipin was slightly reduced by CGI-58 RNAi in the early stages of differentiation (day 4), almost no difference was observed on day 8 (Fig. 1B). ADRP usually coats the surface of LDs of preadipocytes, whereas it is replaced by perilipin during differentiation into adipocytes. A significant increase in the level of ADRP was observed in the CGI-58 RNAi-treated cells at each stage of differentiation compared with the vector and mismatch controls. On day 8, the amount of ADRP in the CGI-58 RNAi-treated cells was decreased, probably because of disposition from the surface of LDs by perilipin. Because ADRP is involved in the accumulation of lipids and its protein level closely parallels the total fat cell mass, we examined whether the population and size of LDs are altered in RNAi-treated cells (Fig. 2 ). 3T3-L1 cells treated with CGI-58 RNAi were stained with Nile Red, which labels LDs, and then observed by phase-contrast and fluorescence microscopy. In undifferentiated 3T3-L1 cells, significant differences in the accumulation of LDs were observed between the CGI-58 RNAi and control cells. That is, very few LDs were detectable by Nile Red staining in control preadipocytes, whereas the CGI-58 RNAi preadipocytes exhibited a marked accumulation of LDs (Fig. 2A). Such an abnormal accumulation of LDs was observed in almost all lentivirus-infected cells, which were able to be distinguished by the expression of GFP (data not shown). These results also indicate that CGI-58 protein indeed exists in preadipocytes, albeit at a low level, although it is hardly detectable by Western blotting under normal conditions (Fig. 1B). As shown in Fig. 2B, preadipocytes treated with CGI-58 RNAi differentiated normally and stored large LDs, similar to control cells. In addition, CGI-58 RNAi did not affect the specific activity of glycerol 3-phosphate dehydrogenase, a marker enzyme of adipocytes (data not shown). Together with the unaltered mRNA levels of PPARγ and aP2 in the RNAi cells (Fig. 1A), we conclude that CGI-58 is not necessary for adipocyte differentiation. We next examined the lipolytic activity of 3T3-L1 adipocytes treated with CGI-58 small interfering RNA in comparison with that of control cells. Lipolytic activity was estimated by measuring the amount of glycerol released into the medium for both cells in the basal state and cells treated with IBMX to increase the intracellular cAMP level and thus activate PKA (stimulated). Figure 3 shows the kinetics of glycerol's efflux from the cells. Notably, knockdown of CGI-58 suppressed lipolysis under basal and stimulated conditions compared with the mismatch control. The inhibitory effect of lipolysis by CGI-58 RNAi was more prominent in the stimulated conditions (∼50% reduction) than in the basal state (∼20%). These results indicate that CGI-58 is involved in lipid turnover on LD surfaces and has a possible function to facilitate lipolysis in 3T3-L1 cells. CGI-58 contains a canonical esterase/lipase motif, although the active serine residue within the GXSXG motif is replaced by asparagine. Because CGI-58 enhances lipolysis at the cellular level, we next examined whether CGI-58 itself has lipase/esterase activity in vitro (Fig. 4 ). The lipase activity of the extract of HeLa cells expressing rat CGI-58 and its mutant in which asparagine-155 was changed to glycine (N155G) was measured, using a lipid emulsion containing radiolabeled triolein as a substrate. HSL was used as a positive control that has lipase/esterase activity, and HSL S423G (with the active site serine changed to glycine) was used as a negative control. As expected, significant lipase activity was detected in the cell extract containing the wild-type HSL but not in the cell extract containing the S423G mutant (Fig. 4A). On the other hand, CGI-58 and its N155G mutant did not exhibit any lipase activity. Similar results were obtained with respect to esterase activity as monitored with a water-soluble substrate, p-nitrophenylbutyrate (Fig. 4C). HSL and ATGL are representative lipases involved in the degradation of TG in adipocytes. When the cell extract containing HSL or ATGL was combined with an extract containing CGI-58, enhancement of lipase activity was detected compared with the lipase alone, particularly for the combination with ATGL (Fig. 4B). These results suggest that CGI-58 per se does not function as a lipase but has an ability to enhance the activities of TG hydrolases in adipocytes, especially ATGL. Lipolytic stimulation by catecholamines causes drastic changes in the protein composition and morphology of LDs in 3T3-L1 cells (24Brasaemle D.L. Dolios G. Shapiro L. Wang R. Proteomic analysis of proteins associated with lipid droplets of basal and lipolytically stimulated 3T3-L1 adipocytes..J. Biol. Chem. 2004; 279: 46835-