Title: Liver CPT1A gene therapy reduces diet‐induced hepatic steatosis in mice and highlights potential lipid biomarkers for human NAFLD
Abstract: The FASEB JournalVolume 34, Issue 9 p. 11816-11837 RESEARCH ARTICLEOpen Access Liver CPT1A gene therapy reduces diet-induced hepatic steatosis in mice and highlights potential lipid biomarkers for human NAFLD Minéia Weber, Minéia Weber Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, SpainSearch for more papers by this authorPaula Mera, Paula Mera Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, Spain Centro de Investigación Biomédica en Red de Fisiopatología de la Obesidad y la Nutrición (CIBEROBN), Instituto de Salud Carlos III, Madrid, SpainSearch for more papers by this authorJosefina Casas, Josefina Casas Research Unit on BioActive Molecules, Department of Biological Chemistry, Institute of Advanced Chemistry of Catalonia (IQAC)/CSIC, Barcelona, Spain Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBEREHD), Instituto de Salud Carlos III, Madrid, SpainSearch for more papers by this authorJavier Salvador, Javier Salvador Centro de Investigación Biomédica en Red de Fisiopatología de la Obesidad y la Nutrición (CIBEROBN), Instituto de Salud Carlos III, Madrid, Spain Department of Endocrinology & Nutrition, Clínica Universidad de Navarra, Pamplona, SpainSearch for more papers by this authorAmaia Rodríguez, Amaia Rodríguez Centro de Investigación Biomédica en Red de Fisiopatología de la Obesidad y la Nutrición (CIBEROBN), Instituto de Salud Carlos III, Madrid, Spain Metabolic Research Laboratory, Clínica Universidad de Navarra, IdiSNA, Pamplona, SpainSearch for more papers by this authorSergio Alonso, Sergio Alonso Cancer Genetics and Epigenetics Group, Program of Predictive and Personalized Medicine of Cancer, Germans Trias i Pujol Research Institute (IGTP-PMPPC), Campus Can Ruti, Barcelona, SpainSearch for more papers by this authorDavid Sebastián, David Sebastián Institute for Research in Biomedicine (IRB Barcelona), Barcelona Institute of Science and Technology, Departament de Bioquímica i Biomedicina Molecular, Facultat de Biologia, Universitat de Barcelona, Barcelona, Spain Centro de Investigación Biomédica en Red de Diabetes y Enfermedades Metabólicas Asociadas (CIBERDEM), Instituto de Salud Carlos III, Madrid, SpainSearch for more papers by this authorM. Carmen Soler-Vázquez, M. Carmen Soler-Vázquez Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, SpainSearch for more papers by this authorCarla Montironi, Carla Montironi Pathology Department, Hospital Clinic de Barcelona, Barcelona, Spain Liver Cancer Translational Research Laboratory, Liver Unit, IDIBAPS-Hospital Clínic, Universitat de Barcelona, Barcelona, SpainSearch for more papers by this authorSandra Recalde, Sandra Recalde Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, SpainSearch for more papers by this authorRaquel Fucho, Raquel Fucho Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, SpainSearch for more papers by this authorMaría Calderón-Domínguez, María Calderón-Domínguez Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, SpainSearch for more papers by this authorJoan Francesc Mir, Joan Francesc Mir Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, SpainSearch for more papers by this authorRamon Bartrons, Ramon Bartrons Departament de Ciències Fisiològiques, Facultat de Medicina i Ciències de la Salut, Universitat de Barcelona, SpainSearch for more papers by this authorJoan Carles Escola-Gil, Joan Carles Escola-Gil IIB Sant Pau, Departament de Bioquímica i Biologia Molecular, Universitat Autònoma de Barcelona, Barcelona, Spain Centro de Investigación Biomédica en Red de Diabetes y Enfermedades Metabólicas Asociadas (CIBERDEM), Instituto de Salud Carlos III, Madrid, SpainSearch for more papers by this authorDavid Sánchez-Infantes, David Sánchez-Infantes Germans Trias i Pujol Research Institute (IGTP-PMPPC), Campus Can Ruti, Barcelona, Spain Centro de Investigación Biomédica en Red de Fisiopatología de la Obesidad y la Nutrición (CIBEROBN), Instituto de Salud Carlos III, Madrid, SpainSearch for more papers by this authorAntonio Zorzano, Antonio Zorzano Institute for Research in Biomedicine (IRB Barcelona), Barcelona Institute of Science and Technology, Departament de Bioquímica i Biomedicina Molecular, Facultat de Biologia, Universitat de Barcelona, Barcelona, Spain Centro de Investigación Biomédica en Red de Diabetes y Enfermedades Metabólicas Asociadas (CIBERDEM), Instituto de Salud Carlos III, Madrid, SpainSearch for more papers by this authorVicenta Llorente-Cortes, Vicenta Llorente-Cortes Institute of Biomedical Research of Barcelona (IIBB), Spanish National Research Council (CSIC), Biomedical Research Institute Sant Pau (IIB Sant Pau), Barcelona, Spain CIBERCV, Institute of Health Carlos III, Madrid, Spain Cardiovascular Research Center, CSIC-ICCC, Barcelona, SpainSearch for more papers by this authorNúria Casals, Núria Casals Basic Sciences Department, Faculty of Medicine and Health Sciences, Universitat Internacional de Catalunya, Sant Cugat del Vallès, Spain Centro de Investigación Biomédica en Red de Fisiopatología de la Obesidad y la Nutrición (CIBEROBN), Instituto de Salud Carlos III, Madrid, SpainSearch for more papers by this authorVíctor Valentí, Víctor Valentí Metabolic Research Laboratory, Clínica Universidad de Navarra, IdiSNA, Pamplona, Spain Department of Surgery, Clínica Universidad de Navarra, Pamplona, SpainSearch for more papers by this authorGema Frühbeck, Gema Frühbeck Centro de Investigación Biomédica en Red de Fisiopatología de la Obesidad y la Nutrición (CIBEROBN), Instituto de Salud Carlos III, Madrid, Spain Metabolic Research Laboratory, Clínica Universidad de Navarra, IdiSNA, Pamplona, SpainSearch for more papers by this authorLaura Herrero, Laura Herrero Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, Spain Centro de Investigación Biomédica en Red de Fisiopatología de la Obesidad y la Nutrición (CIBEROBN), Instituto de Salud Carlos III, Madrid, SpainSearch for more papers by this authorDolors Serra, Corresponding Author Dolors Serra [email protected] Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, Spain Centro de Investigación Biomédica en Red de Fisiopatología de la Obesidad y la Nutrición (CIBEROBN), Instituto de Salud Carlos III, Madrid, Spain Correspondence Dolors Serra, Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, University of Barcelona, Av. Joan XXIII, 27-31, E-08028 Barcelona, Spain. Email: [email protected] for more papers by this author Minéia Weber, Minéia Weber Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, SpainSearch for more papers by this authorPaula Mera, Paula Mera Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, Spain Centro de Investigación Biomédica en Red de Fisiopatología de la Obesidad y la Nutrición (CIBEROBN), Instituto de Salud Carlos III, Madrid, SpainSearch for more papers by this authorJosefina Casas, Josefina Casas Research Unit on BioActive Molecules, Department of Biological Chemistry, Institute of Advanced Chemistry of Catalonia (IQAC)/CSIC, Barcelona, Spain Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBEREHD), Instituto de Salud Carlos III, Madrid, SpainSearch for more papers by this authorJavier Salvador, Javier Salvador Centro de Investigación Biomédica en Red de Fisiopatología de la Obesidad y la Nutrición (CIBEROBN), Instituto de Salud Carlos III, Madrid, Spain Department of Endocrinology & Nutrition, Clínica Universidad de Navarra, Pamplona, SpainSearch for more papers by this authorAmaia Rodríguez, Amaia Rodríguez Centro de Investigación Biomédica en Red de Fisiopatología de la Obesidad y la Nutrición (CIBEROBN), Instituto de Salud Carlos III, Madrid, Spain Metabolic Research Laboratory, Clínica Universidad de Navarra, IdiSNA, Pamplona, SpainSearch for more papers by this authorSergio Alonso, Sergio Alonso Cancer Genetics and Epigenetics Group, Program of Predictive and Personalized Medicine of Cancer, Germans Trias i Pujol Research Institute (IGTP-PMPPC), Campus Can Ruti, Barcelona, SpainSearch for more papers by this authorDavid Sebastián, David Sebastián Institute for Research in Biomedicine (IRB Barcelona), Barcelona Institute of Science and Technology, Departament de Bioquímica i Biomedicina Molecular, Facultat de Biologia, Universitat de Barcelona, Barcelona, Spain Centro de Investigación Biomédica en Red de Diabetes y Enfermedades Metabólicas Asociadas (CIBERDEM), Instituto de Salud Carlos III, Madrid, SpainSearch for more papers by this authorM. Carmen Soler-Vázquez, M. Carmen Soler-Vázquez Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, SpainSearch for more papers by this authorCarla Montironi, Carla Montironi Pathology Department, Hospital Clinic de Barcelona, Barcelona, Spain Liver Cancer Translational Research Laboratory, Liver Unit, IDIBAPS-Hospital Clínic, Universitat de Barcelona, Barcelona, SpainSearch for more papers by this authorSandra Recalde, Sandra Recalde Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, SpainSearch for more papers by this authorRaquel Fucho, Raquel Fucho Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, SpainSearch for more papers by this authorMaría Calderón-Domínguez, María Calderón-Domínguez Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, SpainSearch for more papers by this authorJoan Francesc Mir, Joan Francesc Mir Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, SpainSearch for more papers by this authorRamon Bartrons, Ramon Bartrons Departament de Ciències Fisiològiques, Facultat de Medicina i Ciències de la Salut, Universitat de Barcelona, SpainSearch for more papers by this authorJoan Carles Escola-Gil, Joan Carles Escola-Gil IIB Sant Pau, Departament de Bioquímica i Biologia Molecular, Universitat Autònoma de Barcelona, Barcelona, Spain Centro de Investigación Biomédica en Red de Diabetes y Enfermedades Metabólicas Asociadas (CIBERDEM), Instituto de Salud Carlos III, Madrid, SpainSearch for more papers by this authorDavid Sánchez-Infantes, David Sánchez-Infantes Germans Trias i Pujol Research Institute (IGTP-PMPPC), Campus Can Ruti, Barcelona, Spain Centro de Investigación Biomédica en Red de Fisiopatología de la Obesidad y la Nutrición (CIBEROBN), Instituto de Salud Carlos III, Madrid, SpainSearch for more papers by this authorAntonio Zorzano, Antonio Zorzano Institute for Research in Biomedicine (IRB Barcelona), Barcelona Institute of Science and Technology, Departament de Bioquímica i Biomedicina Molecular, Facultat de Biologia, Universitat de Barcelona, Barcelona, Spain Centro de Investigación Biomédica en Red de Diabetes y Enfermedades Metabólicas Asociadas (CIBERDEM), Instituto de Salud Carlos III, Madrid, SpainSearch for more papers by this authorVicenta Llorente-Cortes, Vicenta Llorente-Cortes Institute of Biomedical Research of Barcelona (IIBB), Spanish National Research Council (CSIC), Biomedical Research Institute Sant Pau (IIB Sant Pau), Barcelona, Spain CIBERCV, Institute of Health Carlos III, Madrid, Spain Cardiovascular Research Center, CSIC-ICCC, Barcelona, SpainSearch for more papers by this authorNúria Casals, Núria Casals Basic Sciences Department, Faculty of Medicine and Health Sciences, Universitat Internacional de Catalunya, Sant Cugat del Vallès, Spain Centro de Investigación Biomédica en Red de Fisiopatología de la Obesidad y la Nutrición (CIBEROBN), Instituto de Salud Carlos III, Madrid, SpainSearch for more papers by this authorVíctor Valentí, Víctor Valentí Metabolic Research Laboratory, Clínica Universidad de Navarra, IdiSNA, Pamplona, Spain Department of Surgery, Clínica Universidad de Navarra, Pamplona, SpainSearch for more papers by this authorGema Frühbeck, Gema Frühbeck Centro de Investigación Biomédica en Red de Fisiopatología de la Obesidad y la Nutrición (CIBEROBN), Instituto de Salud Carlos III, Madrid, Spain Metabolic Research Laboratory, Clínica Universidad de Navarra, IdiSNA, Pamplona, SpainSearch for more papers by this authorLaura Herrero, Laura Herrero Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, Spain Centro de Investigación Biomédica en Red de Fisiopatología de la Obesidad y la Nutrición (CIBEROBN), Instituto de Salud Carlos III, Madrid, SpainSearch for more papers by this authorDolors Serra, Corresponding Author Dolors Serra [email protected] Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, Institut de Biomedicina de la Universitat de Barcelona (IBUB), Universitat de Barcelona, Barcelona, Spain Centro de Investigación Biomédica en Red de Fisiopatología de la Obesidad y la Nutrición (CIBEROBN), Instituto de Salud Carlos III, Madrid, Spain Correspondence Dolors Serra, Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences, University of Barcelona, Av. Joan XXIII, 27-31, E-08028 Barcelona, Spain. Email: [email protected] for more papers by this author First published: 15 July 2020 https://doi.org/10.1096/fj.202000678RCitations: 20 Minéia Weber and Paula Mera contributed equally to this study. AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinkedInRedditWechat Abstract The prevalence of nonalcoholic fatty liver disease (NAFLD) has increased drastically due to the global obesity pandemic but at present there are no approved therapies. Here, we aimed to revert high-fat diet (HFD)-induced obesity and NAFLD in mice by enhancing liver fatty acid oxidation (FAO). Moreover, we searched for potential new lipid biomarkers for monitoring liver steatosis in humans. We used adeno-associated virus (AAV) to deliver a permanently active mutant form of human carnitine palmitoyltransferase 1A (hCPT1AM), the key enzyme in FAO, in the liver of a mouse model of HFD-induced obesity and NAFLD. Expression of hCPT1AM enhanced hepatic FAO and autophagy, reduced liver steatosis, and improved glucose homeostasis. Lipidomic analysis in mice and humans before and after therapeutic interventions, such as hepatic AAV9-hCPT1AM administration and RYGB surgery, respectively, led to the identification of specific triacylglyceride (TAG) specie (C50:1) as a potential biomarker to monitor NAFFLD disease. To sum up, here we show for the first time that liver hCPT1AM gene therapy in a mouse model of established obesity, diabetes, and NAFLD can reduce HFD-induced derangements. Moreover, our study highlights TAG (C50:1) as a potential noninvasive biomarker that might be useful to monitor NAFLD in mice and humans. Abbreviations AAV adeno-associated viruses ACC1 acetyl-CoA carboxylase 1 ASP acid-soluble products BHB-CoA β-hydroxybutyryl-CoA CPT1A carnitine palmitoyltransferase 1A DAG diacylglycerides DGAT2 diacylglycerol O-acyltransferase homolog 2 FA fatty acids FFA free fatty acid FAO fatty acid oxidation GFP green fluorescent protein G6Pase glucose-6-phosphatase GTT glucose tolerance test HFD high-fat diet HMGCS2 hydroxymethylglutaryl-CoA synthase 2 IR insulin resistance LPE lysophosphatidylethanolamine MCD malonyl-CoA decarboxylase MTP microsomal triacylglycerol transfer protein NAFLD nonalcoholic fatty liver disease NAS NAFLD activity score qRT-PCR real-time quantitative PCR PC phosphatidylcholine ROS reactive oxygen species RYGB Roux-en-Y gastric bypass TAG triacylglyceride UCP2 uncoupling protein 2 VLDL very-low-density lipoprotein 1 INTRODUCTION Despite enormous efforts by health-care providers and the research community, obesity rates continue to rise. Unfortunately, safe, long-term efficient treatments are currently unavailable. Of great concern is the parallel increase in the prevalence of obesity-associated pathological conditions such as insulin resistance, type 2 diabetes (T2D), nonalcoholic fatty liver disease (NAFLD), cardiovascular disease, and cancer. Hence, it is vital to develop novel therapeutic strategies to combat this epidemic. One of the main causes of obesity is the modern lifestyle, which is characterized by excessive calorie intake and insufficient physical activity. The liver plays an essential role in regulating whole-body energy balance and lipid/glucose homeostasis. In conditions associated with prolonged excess energy intake, the liver can store significant quantities of lipids, which eventually leads to steatosis. Liver steatosis can cause hepatic inflammation and progress to steatohepatitis (NASH),1 which predisposes to hepatic injury and cancer. The design of new therapeutic strategies to enhance fat burning in liver may alleviate these obesity-related disorders. Mitochondrial long-chain fatty acid β-oxidation (FAO) is regulated by carnitine palmitoyltransferase 1 (CPT1). This enzyme is physiologically inhibited by malonyl-CoA, a glucose-derived metabolite that is an intermediate in the de novo synthesis of fatty acids (FA). Increased glucose metabolism raises levels of malonyl-CoA, which inhibits CPT1 and blocks FAO, resulting in lipid partitioning and storage. A significant number of studies in rodents have tried to indirectly promote FAO to reduce systemic obesity and prevent the development of obesity-associated metabolic disorders. These studies targeted the regulation of enzymes and transcription factors involved in FA metabolism, such as acetyl-CoA carboxylase (ACC),2 malonyl-CoA decarboxylase (MCD),3 uncoupling protein 1 (UCP1),4 AMP-activated protein kinase (AMPK),5 peroxisome proliferator-activated receptor (PPAR),6 and long-chain acyl-CoA dehydrogenase (VLCAD).7 Studies that increased short-term CPT1A activity in liver demonstrated a decrease in hepatic triglyceride (TAG) content,8 but did not report any improvement in insulin sensitivity. Furthermore, we and others have shown that a long-term increase in CPT1A and a mutated isoform that is insensitive to malonyl-CoA (CPT1AM)9 prevented steatosis and the development of obesity in mice fed a high-fat diet (HFD).10, 11 Still, these studies could not revert the HFD-induced derangements in an established model of obesity. The aim of the present study was to determine whether AAV-mediated long-term activation of hepatic FAO could be a successful strategy to revert an already established obesity with associated hyperglycemia and NAFLD in mice. We focused on three novel strategies: (1) use of the AAV9 serotype, which is the most effective AAV in gene therapy at targeting liver; (2) use of a mouse model with established obesity, type 2 diabetes, and NAFLD; and (3) use of the human isoform of CPT1AM (hCPT1AM), with the prospect of future clinical therapeutic applications. Our results show that enhanced hepatic FAO through hCPT1AM-mediated gene therapy reduces diet-induced weight gain, and hepatic steatosis and improves hepatic insulin signaling in obese mice. Mechanistically, hCPT1AM-expressing mice showed enhanced autophagy, ketogenesis, and oxidative phosphorylation in the liver. Importantly, hCPT1AM expression also changes the hepatic lipidomic profile. One of the altered lipid species, C50:1 triacylglyceride, was concomitantly lower in the serum of human patients with obesity and NAFLD after bariatric surgery. Thus, we identified a potential biomarker to monitor the progression of hepatic steatosis in humans. 2 MATERIALS AND METHODS 2.1 Human study cohort and biological analysis Serum samples were obtained from obese patients (BMI ≥ 30 kg/m2 and body fat percentage [BF] ≥35% for women and ≥ 25% for men) before and 6 months after Roux-en-Y gastric bypass (RYGB) (n = 15) and from healthy lean volunteers (n = 15) at the Clínica Universidad de Navarra. Inclusion criteria included a complete diagnosis: physical examination, laboratory investigation, ultrasound echography, and a liver biopsy consistent with the diagnosis of nonalcoholic fatty liver disease (NAFLD), according to Brunt criteria.12 Exclusion criteria were: (i) excess alcohol consumption (≥20 g for women and ≥30 g for men); (ii) the presence of hepatitis B virus surface antigen or hepatitis C virus antibodies in the absence of a history of vaccination; (iii) use of drugs linked to NAFLD, including amiodarone, valproate, tamoxifen, methotrexate, corticosteroids, or antiretrovirals; (iv) evidence of other specific liver diseases, such as autoimmune liver disease, hemochromatosis, Wilson's disease, or α-1-antitrypsin deficiency. Patients with type 2 diabetes (T2D) were not on any antidiabetic treatment before or during the study. Obese patients with T2D did not have a long history of diabetes (less than 2-3 years or even de novo diagnosis as evidenced from their anamnesis and biochemical determinations). Glucose, uric acid, ALT, AST, alkaline phosphatase, and γ-glutamyltransferase (γ-GT) were measured by enzymatic tests (Hitachi Modular P800, Roche, Basel, Switzerland). Total cholesterol, HDL-cholesterol, LDL-cholesterol, and triacylglycerol concentrations (Roche) were calculated as previously described.13 High sensitivity C-reactive protein (CRP) was measured using the Tina-quant CRP (Latex) ultrasensitive assay (Roche). Insulin was measured by an enzyme-amplified chemiluminescence assay (IMMULITE; Diagnostics Products Corp., Los Angeles, CA, USA). Intra- and inter-assay coefficients of variation were 4.2% and 5.7%, respectively. Insulin resistance and sensitivity were calculated using the homeostasis model assessment (HOMA) and a quantitative insulin sensitivity check index (QUICKI), respectively. Leptin was quantified by a double-antibody RIA method (Linco Research, Inc, St. Charles, MO, USA).14, 15 Intra- and inter-assay coefficients of variation were 6.7% and 7.8%, respectively. All reported investigations were carried out in accordance with the principles of the Declaration of Helsinki, as revised in 2013, and approved by the Hospital's Ethical Committee for Research (061/2014). Written informed consent was obtained from all participants. 2.2 Adeno-associated vectors AAV vectors, serotype 9, were used to drive the expression of GFP (AAV9-GFP) or hCPT1AM (AAV9-hCPT1AM) in mouse liver. Plasmid vectors carried: (a) the human albumin enhancer element and the human α1-antitrypsin (EalbAATp) liver-specific promoter described by Kramer et al,16 (b) the cDNA sequence of GFP or hCPT1AM, (c) The woodchuck posttranscriptional regulatory element (WPRE, acc #AY468-486),17 (d) The bovine growth hormone polyadenosine transcription termination signal [bGH-poly(A)] (bases 2326-2533 GenBank acc #M57764). The expression cassette was flanked by two-inverted terminal repeats (ITRs) derived from AAV2. The vector preparations used titers of 1.34 × 1013 and 1.16 × 1013 genome copies (gc)/mL for AAV9-GFP and AAV9-hCPT1AM, respectively. 2.3 Animals The animal study was designed as follows: 40 seven-week-old male C57BL/6J mice were purchased from Janvier (SC-C57J-M) and housed in our animal facility for 1 week to acclimatize. Mice were kept at standard laboratory conditions (12 hours light/dark cycle, 20-22ºC). Animals were randomly assigned to one of the following groups: NCD-GFP, HFD-GFP, NCD-hCPT1AM, and HFD-hCPT1AM. Five animals from each group were housed in the same cage. Next, mice were fed with either NCD (manufactured by TestDiet [catalogue number #58Y2], 10% kcal fat) of HFD (manufactured by TestDiet [catalogue number #58Y1], 60% kcal fat) for the entire duration of the experiment. This diet causes steatosis but not severe liver injury (fibrosis). Body weight was measured every week and blood glucose once a month. After 9 weeks of diet, most of the mice already showed an obese phenotype characterized by a significant increase in circulating levels of glucose and insulin and higher body weight than the control NCD-fed group. AAV9-hCPT1AM and AAV9-GFP vectors were administered by tail-vein injection with a single dose (1.5 × 1012 gc/kg). To do that, mice were anesthetized in the morning (~10 AM) using isoflurane, and then, placed in a restrainer for the tail-vein injection. After injection, mice were returned to their home cage and room. Eleven weeks after virus injection, mice were anesthetized using isoflurane, and then, killed by cervical dislocation in fasting conditions (6 hours). The total duration of the HFD feeding paradigm was 20 weeks (9 weeks before AAV9 vector administration and 11 weeks after that). The Animal Experimentation Ethics Committee of the University of Barcelona (CEEA-UB) approved all the procedures with mice. Permits 9611 and 9609 were obtained from the Government of Catalonia, according to European Directive 2010/63/EU. 2.4 Construction of site-directed hCPT1AM hCPT1A wild-type (wt) cDNA (GenBank Access No. HGNC: 2328) was obtained by hCPT1A cDNA amplification from the HepG2 cell line. The primers used were: hCPT1AHindIII.for (5′TCGATAAGCTTATAAAATGGCAGCTCACCAAGC3′) and hCPT1AEcoR1.rev (5′CATCCGGAATTCCTTTTTGGAATTAGAACTG3′). The amplification was cloned in pYES plasmid to obtain the construct pYEShCPT1Awt. Plasmid pYEShCPTIAM593S was constructed using the Quick-Change PCR-based mutagenesis procedure (Stratagene) with the YEShCPT1Awt plasmid as template. Appropriate substitutions and the absence of unwanted mutations were confirmed by sequencing the inserts in both directions using Applied Biosystems 373 automated DNA sequences. To check hCPT1AM insensitivity to malonyl-CoA, we expressed the constructs containing hCPT1A wt and mutant (hCPT1AM) in yeast cells, and then, prepared cell extracts as described in Ref. (9) for the assay of CPT1 activity. S cerevisiae was chosen as an expression system for hCPT1A wt and hCPT1AM because it does not have endogenous CPT1 activity. The cDNA of the hCPT1AM gene used in our study contains the NH2-terminal sequence that direct the protein to the mitochondria and two more sequences that codify for two α-helix fragments that insert this protein into the mitochondrial outer membrane.18-20 2.5 Isolation of primary mouse hepatocytes The collagenase method was used to isolate primary mouse hepatocytes.21 Livers were perfused with Hank's balanced salt solution (HBSS, pH 7.4, 37°C, gassed with 95% O2 and 5% CO2: 5.4 mM KCl, 0.44 mM KH2PO4, 138 mM NaCl, 4.17 mM NaHCO3, 0.338 mM Na2HPO4, 5.56 mM glucose, 50 mM HEPES, and 0.5 mM EGTA) through the portal vein for 5 minutes at a rate of 5 mL/min. Then, livers were perfused with HBSS (without EGTA) containing 5 mM of CaCl2 and 0.25% (w/v) collagenase IV (Sigma) for 15 minutes approximately. The liver was then removed and gently teased apart in HBSS, and the cell suspension was washed three times in HBSS. Cell viability as assessed by the trypan blue exclusion test was always higher than 80%. Hepatocytes were seeded at a density of 3.5 × 106 cells in 0.1% (w/v) gelatin-treated 25-cm2 flasks in DMEM medium (Gibco #11966), supplemented with 10% of FBS, 10 mM of glucose, 10 μg/mL of streptomycin, 100 units/mL of penicillin, 100 nM of dexamethasone (Sigma), and 100 nM of insulin (Sigma). 2.6 Fatty acid oxidation Fatty acid oxidation (FAO) to CO2 and acid-soluble products (ASPs), essentially consisting of acyl-carnitine, Krebs-cycle intermediates, and acetyl-CoA, was measured in isolated primary mouse hepatocytes cultured in 25-cm2 flasks. Following cell attachment after isolation (approximately 5 hours), the medium was replaced for 16 hours by fresh FAO medium (DMEM medium containing 0.1% FA-free BSA,