Publication Information

{'id': 'https://openalex.org/W2559828741', 'doi': 'https://doi.org/10.1094/pdis-08-16-1218-pdn', 'title': 'First Report of <i>Citrus leaf blotch virus</i> in Peony in the U.S.A.', 'display_name': 'First Report of <i>Citrus leaf blotch virus</i> in Peony in the U.S.A.', 'publication_year': 2016, 'publication_date': '2016-12-05', 'ids': {'openalex': 'https://openalex.org/W2559828741', 'doi': 'https://doi.org/10.1094/pdis-08-16-1218-pdn', 'mag': '2559828741'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1094/pdis-08-16-1218-pdn', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S135458494', 'display_name': 'Plant Disease', 'issn_l': '0191-2917', 'issn': ['0191-2917', '1943-7692'], 'is_oa': False, 'is_in_doaj': False, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320276', 'host_organization_name': 'American Phytopathological Society', 'host_organization_lineage': ['https://openalex.org/P4310320276'], 'host_organization_lineage_names': ['American Phytopathological Society'], 'type': 'journal'}, 'license': 'other-oa', 'license_id': 'https://openalex.org/licenses/other-oa', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'https://doi.org/10.1094/pdis-08-16-1218-pdn', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5091756128', 'display_name': 'Joanna C. Gress', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I78715868', 'display_name': 'University of Arkansas at Fayetteville', 'ror': 'https://ror.org/05jbt9m15', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I78715868']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'J. C. Gress', 'raw_affiliation_strings': ['Dept. of Plant Pathology, Division of Agriculture, University of Arkansas, Fayetteville, AR 72701.'], 'affiliations': [{'raw_affiliation_string': 'Dept. of Plant Pathology, Division of Agriculture, University of Arkansas, Fayetteville, AR 72701.', 'institution_ids': ['https://openalex.org/I78715868']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5026649947', 'display_name': 'S. Faye Smith', 'orcid': 'https://orcid.org/0000-0001-5559-6751'}, 'institutions': [{'id': 'https://openalex.org/I78715868', 'display_name': 'University of Arkansas at Fayetteville', 'ror': 'https://ror.org/05jbt9m15', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I78715868']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'S. Smith', 'raw_affiliation_strings': ['Dept. of Plant Pathology, Division of Agriculture, University of Arkansas, Fayetteville, AR 72701.'], 'affiliations': [{'raw_affiliation_string': 'Dept. of Plant Pathology, Division of Agriculture, University of Arkansas, Fayetteville, AR 72701.', 'institution_ids': ['https://openalex.org/I78715868']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5040781126', 'display_name': 'Ioannis E. Tzanetakis', 'orcid': 'https://orcid.org/0000-0002-5970-1763'}, 'institutions': [{'id': 'https://openalex.org/I78715868', 'display_name': 'University of Arkansas at Fayetteville', 'ror': 'https://ror.org/05jbt9m15', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I78715868']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'I. E. Tzanetakis', 'raw_affiliation_strings': ['Dept. of Plant Pathology, Division of Agriculture, University of Arkansas, Fayetteville, AR 72701.'], 'affiliations': [{'raw_affiliation_string': 'Dept. of Plant Pathology, Division of Agriculture, University of Arkansas, Fayetteville, AR 72701.', 'institution_ids': ['https://openalex.org/I78715868']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': None, 'apc_paid': None, 'fwci': 1.331, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 19, 'citation_normalized_percentile': {'value': 0.836827, 'is_in_top_1_percent': False, 'is_in_top_10_percent': False}, 'cited_by_percentile_year': {'min': 90, 'max': 91}, 'biblio': {'volume': '101', 'issue': '4', 'first_page': '637', 'last_page': '637'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10494', 'display_name': 'Plant Virus Research Studies', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1110', 'display_name': 'Plant Science'}, 'field': {'id': 'https://openalex.org/fields/11', 'display_name': 'Agricultural and Biological Sciences'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10494', 'display_name': 'Plant Virus Research Studies', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1110', 'display_name': 'Plant Science'}, 'field': {'id': 'https://openalex.org/fields/11', 'display_name': 'Agricultural and Biological Sciences'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T13220', 'display_name': 'Plant and Fungal Interactions Research', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1310', 'display_name': 'Endocrinology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T12858', 'display_name': 'Plant Disease Resistance and Genetics', 'score': 0.9978, 'subfield': {'id': 'https://openalex.org/subfields/1110', 'display_name': 'Plant Science'}, 'field': {'id': 'https://openalex.org/fields/11', 'display_name': 'Agricultural and Biological Sciences'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/paeonia-lactiflora', 'display_name': 'Paeonia lactiflora', 'score': 0.54971427}], 'concepts': [{'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.85995495}, {'id': 'https://openalex.org/C2522874641', 'wikidata': 'https://www.wikidata.org/wiki/Q808', 'display_name': 'Virus', 'level': 2, 'score': 0.56915754}, {'id': 'https://openalex.org/C2778913362', 'wikidata': 'https://www.wikidata.org/wiki/Q163076', 'display_name': 'Paeonia lactiflora', 'level': 3, 'score': 0.54971427}, {'id': 'https://openalex.org/C109110057', 'wikidata': 'https://www.wikidata.org/wiki/Q1495434', 'display_name': 'Plant virus', 'level': 3, 'score': 0.5163528}, {'id': 'https://openalex.org/C182076605', 'wikidata': 'https://www.wikidata.org/wiki/Q4273292', 'display_name': 'Blight', 'level': 2, 'score': 0.5105053}, {'id': 'https://openalex.org/C144027150', 'wikidata': 'https://www.wikidata.org/wiki/Q48803', 'display_name': 'Horticulture', 'level': 1, 'score': 0.38618502}, {'id': 'https://openalex.org/C59822182', 'wikidata': 'https://www.wikidata.org/wiki/Q441', 'display_name': 'Botany', 'level': 1, 'score': 0.3733982}, {'id': 'https://openalex.org/C159047783', 'wikidata': 'https://www.wikidata.org/wiki/Q7215', 'display_name': 'Virology', 'level': 1, 'score': 0.33075047}, {'id': 'https://openalex.org/C71924100', 'wikidata': 'https://www.wikidata.org/wiki/Q11190', 'display_name': 'Medicine', 'level': 0, 'score': 0.0}, {'id': 'https://openalex.org/C204787440', 'wikidata': 'https://www.wikidata.org/wiki/Q188504', 'display_name': 'Alternative medicine', 'level': 2, 'score': 0.0}, {'id': 'https://openalex.org/C142724271', 'wikidata': 'https://www.wikidata.org/wiki/Q7208', 'display_name': 'Pathology', 'level': 1, 'score': 0.0}], 'mesh': [], 'locations_count': 1, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1094/pdis-08-16-1218-pdn', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S135458494', 'display_name': 'Plant Disease', 'issn_l': '0191-2917', 'issn': ['0191-2917', '1943-7692'], 'is_oa': False, 'is_in_doaj': False, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320276', 'host_organization_name': 'American Phytopathological Society', 'host_organization_lineage': ['https://openalex.org/P4310320276'], 'host_organization_lineage_names': ['American Phytopathological Society'], 'type': 'journal'}, 'license': 'other-oa', 'license_id': 'https://openalex.org/licenses/other-oa', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1094/pdis-08-16-1218-pdn', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S135458494', 'display_name': 'Plant Disease', 'issn_l': '0191-2917', 'issn': ['0191-2917', '1943-7692'], 'is_oa': False, 'is_in_doaj': False, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320276', 'host_organization_name': 'American Phytopathological Society', 'host_organization_lineage': ['https://openalex.org/P4310320276'], 'host_organization_lineage_names': ['American Phytopathological Society'], 'type': 'journal'}, 'license': 'other-oa', 'license_id': 'https://openalex.org/licenses/other-oa', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'display_name': 'Zero hunger', 'id': 'https://metadata.un.org/sdg/2', 'score': 0.76}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 3, 'referenced_works': ['https://openalex.org/W1981890336', 'https://openalex.org/W2135220030', 'https://openalex.org/W316782648'], 'related_works': ['https://openalex.org/W753368623', 'https://openalex.org/W2406041780', 'https://openalex.org/W2393321001', 'https://openalex.org/W2386211158', 'https://openalex.org/W2382339572', 'https://openalex.org/W2382287760', 'https://openalex.org/W2380783314', 'https://openalex.org/W2373560119', 'https://openalex.org/W2366708898', 'https://openalex.org/W2166997546'], 'abstract_inverted_index': {'HomePlant': [0], 'DiseaseVol.': [1], '101,': [2, 501], 'No.': [3, 502, 552, 575, 597, 644, 671, 692, 721, 750, 783, 807, 828], '4First': [4], 'Report': [5, 22, 694, 752], 'of': [6, 23, 61, 65, 68, 130, 146, 160, 184, 209, 334, 367, 382, 437, 446, 457, 537, 555, 568, 579, 593, 610, 648, 651, 661, 677, 688, 695, 729, 745, 753, 790, 803, 811, 814, 823], 'Citrus': [7, 24, 730, 815], 'leaf': [8, 25, 133, 599, 653, 731, 816], 'blotch': [9, 26, 134, 600, 654, 732, 817], 'virus': [10, 27, 135, 148, 161, 211, 301, 369, 655, 733, 818], 'in': [11, 13, 28, 30, 151, 175, 192, 304, 343, 359, 370, 562, 586, 656, 658, 701, 703, 736, 762, 764, 821], 'Peony': [12, 29, 164, 395, 613, 702, 763], 'the': [14, 31, 131, 147, 182, 189, 210, 228, 257, 265, 300, 310, 335, 353, 368, 380, 406, 413, 444, 454, 704, 765], 'U.S.A.': [15], 'PreviousNext': [16], 'DISEASE': [17], 'NOTES': [18], 'OPENOpen': [19], 'Access': [20], 'licenseFirst': [21], 'U.S.A.J.': [32], 'C.': [33, 41, 52, 770], 'Gress,': [34, 42, 771], 'S.': [35, 43, 54], 'Smith,': [36, 44], 'and': [37, 45, 49, 99, 155, 162, 172, 177, 197, 221, 260, 286, 299, 322, 346, 362, 399, 534, 571, 607, 634, 674, 710, 724, 726, 758, 772], 'I.': [38, 46, 56, 773], 'E.': [39, 47, 57, 712, 774], 'TzanetakisJ.': [40], 'TzanetakisAffiliationsAuthors': [48], 'Affiliations': [50], 'J.': [51, 769], 'Gress': [53], 'Smith': [55], 'Tzanetakis': [58], ',': [59], 'Dept.': [60], 'Plant': [62, 478, 491, 569, 614, 640, 667, 717, 746, 779], 'Pathology,': [63, 668, 747], 'Division': [64], 'Agriculture,': [66, 825], 'University': [67], 'Arkansas,': [69], 'Fayetteville,': [70], 'AR': [71], '72701.': [72], 'Published': [73], 'Online:2': [74], 'Feb': [75, 515], '2017https://doi.org/10.1094/PDIS-08-16-1218-PDNAboutSections': [76], 'ToolsAdd': [77], 'to': [78, 126, 157, 235, 245, 252, 262, 264, 429, 442], 'favoritesDownload': [79], 'CitationsTrack': [80], 'Citations': [81], 'ShareShare': [82], 'onFacebookTwitterLinked': [83], 'InRedditEmailWechat': [84], 'Double': [85], 'stranded': [86], 'RNA-enriched': [87], 'nucleic': [88], 'acids': [89], 'were': [90, 142, 179, 233, 272, 290], 'extracted': [91], 'from': [92, 153, 170, 219, 223, 268, 283, 405, 542, 681, 734, 794, 819], 'a': [93, 206, 293, 314, 538, 583, 611, 678, 791], 'peony': [94, 258, 371, 560, 580], '(Paeonia': [95], 'lactiflora)': [96], 'showing': [97], 'stunting': [98], 'gnarled': [100], 'irregularities,': [101], 'symptoms': [102], 'typically': [103, 402], 'associated': [104, 351], 'with': [105, 352, 415, 426, 618], "Lemoine's": [106], 'disease.': [107, 163], 'The': [108, 144, 365, 528], 'material': [109, 152, 307], 'was': [110, 149, 302, 341, 357], 'used': [111], 'as': [112, 355], 'template': [113], 'for': [114, 181, 227], 'next': [115], 'generation': [116], 'sequence': [117, 578], 'analysis': [118, 249, 647], '(Ho': [119], 'et': [120, 194, 433, 463, 475, 488], 'al.': [121, 195, 434, 464, 476, 489], '2015).': [122], 'Several': [123], 'fragments,': [124], 'corresponding': [125], 'all': [127, 305], 'three': [128], 'genes': [129], 'citrus': [132, 269, 652, 795, 820], '(CLBV)': [136], 'genome': [137, 533, 577, 646, 809], '(genus': [138], 'Citrivirus,': [139], 'family': [140], 'Betaflexiviridae),': [141], 'identified.': [143], 'presence': [145, 183], 'assessed': [150], 'Arkansas': [154, 220, 345], 'Oregon': [156], 'determine': [158], 'association': [159], 'samples': [165, 217, 289], '(n': [166], '=': [167], '109),': [168], 'collected': [169], 'nursery': [171], 'garden': [173], 'settings': [174], '2015': [176], '2016,': [178], 'screened': [180], 'CLBV': [185, 336, 340, 422, 458], 'by': [186, 275, 331], 'RT-PCR': [187, 332], 'using': [188, 313, 796], 'protocols': [190], 'described': [191], 'Poudel': [193], '(2013)': [196], 'primers': [198], 'CLBVF': [199], '(5′:': [200, 202], 'CACAAAGTACGGCAGGGTCT)/CLBVR': [201], 'GCCCTGCTGTTTTAGCATTC)': [203], 'that': [204, 387], 'amplify': [205], '281-bp': [207], 'fragment': [208], 'coat': [212], 'protein': [213], '(CP)': [214], 'gene.': [215, 338], 'Eleven': [216], '(two': [218], 'nine': [222], 'Oregon)': [224], 'tested': [225], 'positive': [226], 'virus.': [229], 'Three': [230], 'PCR': [231], 'products': [232], 'sequenced': [234], 'verify': [236], 'their': [237], 'nucleotide': [238, 254], '(nt)': [239], 'identity': [240, 255], '(GenBank': [241], 'accession': [242], 'nos.': [243], 'KX529651': [244], 'KX52953).': [246], 'Nucleotide': [247], 'BLAST': [248], 'revealed': [250], '92': [251], '97%': [253], 'between': [256, 392, 408], 'isolates': [259, 650, 813], '83': [261], '84%': [263], 'type': [266], 'isolate': [267], '(NC_003877).': [270], 'Results': [271], 'further': [273], 'verified': [274], 'RNA': [276, 280, 606], 'blot': [277], 'hybridization.': [278], 'Total': [279], '(2': [281], 'μg)': [282], 'five': [284], 'CLBV-positive': [285], 'two': [287, 649], 'CLBV-negative': [288], 'blotted': [291], 'on': [292, 559], 'positively': [294], 'charged': [295], 'membrane': [296], '(GE': [297], 'Healthcare)': [298], 'detected': [303, 358], 'CLBV-infected': [306], 'but': [308, 379], 'not': [309, 350, 403], 'negative': [311], 'controls': [312], 'digoxygenin-labeled': [315], 'probe': [316], '(DIG': [317], 'High': [318], 'Prime': [319], 'DNA': [320], 'Labeling': [321], 'Detection': [323], 'Starter': [324], 'Kit': [325], 'II,': [326], 'Roche': [327], 'Life': [328], 'Science)': [329], 'generated': [330], 'amplification': [333], 'CP': [337], 'Although': [339], 'found': [342], 'both': [344, 360], 'Oregon,': [347], 'it': [348, 356, 388], 'is': [349, 374, 396, 412, 439, 453], 'disease': [354, 431], 'symptomatic': [361], 'asymptomatic': [363], 'material.': [364, 448], 'role': [366], 'health': [372], 'at-large': [373], 'unknown': [375], 'at': [376], 'this': [377, 452], 'point,': [378], 'mode': [381], 'transmission': [383], '(mechanical,': [384], 'seed)': [385], 'indicate': [386], 'may': [389], 'easily': [390], 'move': [391], 'propagation': [393, 409, 419], 'cycles.': [394, 410], 'clonally': [397, 418], 'propagated': [398], 'viruses': [400, 428, 723], 'are': [401], 'eliminated': [404], 'germplasm': [407], 'As': [411], 'case': [414], 'several': [416], 'other': [417], 'floricultural': [420], 'species,': [421], 'could': [423], 'act': [424], 'synergistically': [425], 'co-infecting': [427], 'cause': [430], '(Valverde': [432], '2012).': [435], 'Documentation': [436], 'infection': [438], 'especially': [440], 'important': [441], 'minimize': [443], 'distribution': [445], 'virus-infected': [447], 'To': [449], 'our': [450], 'knowledge,': [451], 'first': [455], 'report': [456, 554], 'infecting': [459], 'Paeonia': [460], 'spp.References:Ho,': [461], 'T.,': [462], '2015.': [465], 'Methods': [466], 'Mol.': [467], 'Biol.': [468], '1302:301.': [469], 'https://doi.org/10.1007/978-1-4939-2620-6_22': [470], 'Crossref,': [471], 'Google': [472, 484, 497], 'ScholarPoudel,': [473], 'B.,': [474], '2013.': [477], 'Dis.': [479, 492], '97:1352.': [480], 'https://doi.org/10.1094/PDIS-01-13-0018-RE': [481], 'Link,': [482, 495], 'ISI,': [483, 496], 'ScholarValverde,': [485], 'R.': [486], 'A.,': [487], '2012.': [490], '96:600.': [493], 'https://doi.org/10.1094/PDIS-11-11-0928-FE': [494], 'ScholarDetailsFiguresLiterature': [498], 'CitedRelated': [499], 'Vol.': [500, 550, 573, 595, 603, 642, 669, 690, 719, 748, 781, 805, 826], '4': [503], 'April': [504], '2017SubscribeISSN:0191-2917e-ISSN:1943-7692': [505], 'Metrics': [506], 'Article': [507], 'History': [508], 'Issue': [509], 'Date:': [510], '20': [511], 'Mar': [512], '2017Published:': [513], '2': [514], '2017First': [516], 'Look:': [517], '5': [518], 'Dec': [519], '2016Accepted:': [520], '23': [521], 'Nov': [522], '2016': [523], 'Pages:': [524], '637-637': [525], 'Information©': [526], '2017': [527], 'American': [529], 'Phytopathological': [530], 'SocietyCited': [531], 'byComplete': [532], 'molecular': [535, 675, 727], 'characterization': [536, 676, 728, 789], 'putative': [539], 'novel': [540, 584, 679, 792], 'citrivirus': [541, 680, 793], 'Rudbeckia': [543], 'sp.8': [544], 'October': [545, 714], '2022': [546, 565, 590], '|': [547, 566, 591, 639, 665, 686, 716, 742, 778, 801], 'Virus': [548, 700, 757, 761], 'Genes,': [549], '59,': [551], '1First': [553], 'grapevine': [556], 'leafroll-associated': [557, 581], 'virus-3': [558], 'plants': [561], 'Ukraine9': [563], 'September': [564, 663, 799], 'Journal': [567, 744], 'Diseases': [570], 'Protection,': [572], '130,': [574], '1Complete': [576], 'virus,': [582], 'ampelovirus': [585], 'subgroup': [587], 'I8': [588], 'February': [589, 684], 'Archives': [592, 687, 802], 'Virology,': [594, 689, 804], '167,': [596], '3Citrus': [598], 'virusCABI': [601], 'Compendium,': [602], 'CABI': [604], 'CompendiumSmall': [605], 'Transcriptome': [608], 'Sequencing': [609], 'Symptomatic': [612], 'Reveals': [615], 'Mixed': [616], 'Infections': [617], 'Novel': [619], 'VirusesAnning': [620], 'Jia,': [621], 'Chenge': [622], 'Yan,': [623], 'Hang': [624], 'Yin,': [625], 'Rui': [626], 'Sun,': [627], 'Fei': [628], 'Xia,': [629], 'Lan': [630], 'Gao,': [631], 'Yongjiang': [632], 'Zhang,': [633], 'Yongqiang': [635], 'Li5': [636], 'December': [637], '2021': [638, 664, 685], 'Disease,': [641, 718, 780], '105,': [643, 720], '12Complete': [645, 808], 'apple': [657], 'Henan': [659], 'province': [660], 'China7': [662], 'Tropical': [666], '46,': [670], '6Partial': [672], 'biological': [673], 'Nandina': [682], 'domestica23': [683], '166,': [691], '5First': [693], 'Amazon': [696], 'Lily': [697], 'Mild': [698], 'Mottle': [699, 760], 'United': [705, 766], 'StatesCullen': [706], 'Shaffer,': [707, 768], 'Mišaela': [708], 'Vakić,': [709], 'Ioannis': [711], 'Tzanetakis29': [713], '2020': [715], '1Citrus': [722], 'viroidsDistribution': [725], 'Actinidia': [735], 'Shaanxi': [737], 'province,': [738], 'China15': [739], 'January': [740], '2019': [741, 777], 'European': [743], '154,': [749], '3First': [751], 'Cycas': [754], 'Necrotic': [755], 'Stunt': [756], 'Lychnis': [759], 'StatesC.': [767], 'Tzanetakis6': [775], 'March': [776], '103,': [782], '5Paeonia': [784], 'spp.': [785], '(Peony)6': [786], 'June': [787], '2020Molecular': [788], 'next-generation': [797], 'sequencing17': [798], '2018': [800], '163,': [806], 'sequences': [810], 'four': [812], 'ChinaJournal': [822], 'Integrative': [824], '17,': [827], '3': [829]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2559828741', 'counts_by_year': [{'year': 2024, 'cited_by_count': 3}, {'year': 2023, 'cited_by_count': 1}, {'year': 2022, 'cited_by_count': 4}, {'year': 2021, 'cited_by_count': 4}, {'year': 2020, 'cited_by_count': 2}, {'year': 2019, 'cited_by_count': 2}, {'year': 2018, 'cited_by_count': 3}], 'updated_date': '2024-12-17T18:02:35.603902', 'created_date': '2016-12-16'}