Title: MLL-AF4 binds directly to a BCL-2 specific enhancer and modulates H3K27 acetylation
Abstract: •Mixed lineage leukemia (MLL)-AF4 directly controls the active transcription of both BCL-2 and MCL-1.•MLL-AF4 represses BIM via recruitment of the polycomb group repressor 1 member CBX8.•Capture-C and chromatin immunoprecipitation sequencing are used to identify a BCL-2-specific enhancer.•The BCL-2 enhancer consists of two clusters of H3K27Ac at the 3′ end of the gene.•MLL-AF4 controls H3K79me3 in the BCL-2 gene body and H3K27Ac at the enhancer. Survival rates for children and adults carrying mutations in the Mixed Lineage Leukemia (MLL) gene continue to have a very poor prognosis. The most common MLL mutation in acute lymphoblastic leukemia is the t(4;11)(q21;q23) chromosome translocation that fuses MLL in-frame with the AF4 gene producing MLL-AF4 and AF4-MLL fusion proteins. Previously, we found that MLL-AF4 binds to the BCL-2 gene and directly activates it through DOT1L recruitment and increased H3K79me2/3 levels. In the study described here, we performed a detailed analysis of MLL-AF4 regulation of the entire BCL-2 family. By measuring nascent RNA production in MLL-AF4 knockdowns, we found that of all the BCL-2 family genes, MLL-AF4 directly controls the active transcription of both BCL-2 and MCL-1 and also represses BIM via binding of the polycomb group repressor 1 (PRC1) complex component CBX8. We further analyzed MLL-AF4 activation of the BCL-2 gene using Capture-C and identified a BCL-2-specific enhancer, consisting of two clusters of H3K27Ac at the 3′ end of the gene. Loss of MLL-AF4 activity results in a reduction of H3K79me3 levels in the gene body and H3K27Ac levels at the 3′ BCL-2 enhancer, revealing a novel regulatory link between these two histone marks and MLL-AF4-mediated activation of BCL-2. Survival rates for children and adults carrying mutations in the Mixed Lineage Leukemia (MLL) gene continue to have a very poor prognosis. The most common MLL mutation in acute lymphoblastic leukemia is the t(4;11)(q21;q23) chromosome translocation that fuses MLL in-frame with the AF4 gene producing MLL-AF4 and AF4-MLL fusion proteins. Previously, we found that MLL-AF4 binds to the BCL-2 gene and directly activates it through DOT1L recruitment and increased H3K79me2/3 levels. In the study described here, we performed a detailed analysis of MLL-AF4 regulation of the entire BCL-2 family. By measuring nascent RNA production in MLL-AF4 knockdowns, we found that of all the BCL-2 family genes, MLL-AF4 directly controls the active transcription of both BCL-2 and MCL-1 and also represses BIM via binding of the polycomb group repressor 1 (PRC1) complex component CBX8. We further analyzed MLL-AF4 activation of the BCL-2 gene using Capture-C and identified a BCL-2-specific enhancer, consisting of two clusters of H3K27Ac at the 3′ end of the gene. Loss of MLL-AF4 activity results in a reduction of H3K79me3 levels in the gene body and H3K27Ac levels at the 3′ BCL-2 enhancer, revealing a novel regulatory link between these two histone marks and MLL-AF4-mediated activation of BCL-2. Survival rates for children diagnosed with acute lymphoblastic leukemia (ALL) have drastically improved and, in some cases, are now approaching 90% [1Smith M.A. Altekruse S.F. Adamson P.C. Reaman G.H. Seibel N.L. Declining childhood and adolescent cancer mortality.Cancer. 2014; 120: 2497-2506Crossref PubMed Scopus (330) Google Scholar, 2Pui C.H. Evans W.E. A 50-year journey to cure childhood acute lymphoblastic leukemia.Semin Hematol. 2013; 50: 185-196Abstract Full Text Full Text PDF PubMed Scopus (216) Google Scholar]. However, even with this progress, adults with ALL still have a very poor prognosis [3Oriol A. Vives S. Hernandez-Rivas J.M. et al.Outcome after relapse of acute lymphoblastic leukemia in adult patients included in four consecutive risk-adapted trials by the PETHEMA Study Group.Haematologica. 2010; 95: 589-596Crossref PubMed Scopus (208) Google Scholar], and childhood ALL cases that relapse often exhibit drug resistance and remain difficult to treat [4Ko R.H. Ji L. Barnette P. et al.Outcome of patients treated for relapsed or refractory acute lymphoblastic leukemia: A Therapeutic Advances in Childhood Leukemia Consortium study.J Clin Oncol. 2010; 28: 648-654Crossref PubMed Scopus (199) Google Scholar]. In addition, specific subgroups of ALL patients, especially those carrying rearrangements of the mixed lineage leukemia (MLL) gene [5Schultz K.R. Pullen D.J. Sather H.N. et al.Risk- and response-based classification of childhood B-precursor acute lymphoblastic leukemia: A combined analysis of prognostic markers from the Pediatric Oncology Group (POG) and Children's Cancer Group (CCG).Blood. 2007; 109: 926-935Crossref PubMed Scopus (333) Google Scholar, 6Pui C.H. Carroll W.L. Meshinchi S. Arceci R.J. Biology, risk stratification, and therapy of pediatric acute leukemias: An update.J Clin Oncol. 2011; 29: 551-565Crossref PubMed Scopus (642) Google Scholar], still have very poor survival outcomes [5Schultz K.R. Pullen D.J. Sather H.N. et al.Risk- and response-based classification of childhood B-precursor acute lymphoblastic leukemia: A combined analysis of prognostic markers from the Pediatric Oncology Group (POG) and Children's Cancer Group (CCG).Blood. 2007; 109: 926-935Crossref PubMed Scopus (333) Google Scholar]. Even with the advent of novel therapeutic approaches such as CAR T-cell therapy, MLL ALLs often rapidly relapse as acute myeloid leukemia (AML) [7Gardner R. Wu D. Cherian S. et al.Acquisition of a CD19-negative myeloid phenotype allows immune escape of MLL-rearranged B-ALL from CD19 CAR-T-cell therapy.Blood. 2016; 127: 2406-2410Crossref PubMed Scopus (479) Google Scholar], and thus, treatment of MLL ALL patients remains an unmet need. The most common MLL rearrangement (MLLr) in ALL is the t(4;11)(q21;q23) chromosome translocation that fuses MLL in-frame with the AF4 gene, producing MLL-AF4 and AF4-MLL fusion proteins [8Meyer C. Hofmann J. Burmeister T. et al.The MLL recombinome of acute leukemias in 2013.Leukemia. 2013; 27: 2165-2176Crossref PubMed Scopus (346) Google Scholar]. The role of AF4-MLL in leukemogenesis is controversial, as AF4-MLL has transformation capabilities [9Bursen A. Schwabe K. Ruster B. et al.The AF4.MLL fusion protein is capable of inducing ALL in mice without requirement of MLL.AF4.Blood. 2010; 115: 3570-3579Crossref PubMed Scopus (120) Google Scholar], but is expressed in only 50% to 80% of patients [10Andersson A.K. Ma J. Wang J. et al.The landscape of somatic mutations in infant MLL-rearranged acute lymphoblastic leukemias.Nat Genet. 2015; 47: 330-337Crossref PubMed Scopus (325) Google Scholar, 11Kowarz E. Burmeister T. Lo Nigro L. et al.Complex MLL rearrangements in t(4;11) leukemia patients with absent AF4.MLL fusion allele.Leukemia. 2007; 21: 1232-1238Crossref PubMed Scopus (39) Google Scholar] and thus may not be necessary for leukemic maintenance. MLL-AF4, however, is essential for leukemic maintenance [12Thomas M. Gessner A. Vornlocher H.P. Hadwiger P. Greil J. Heidenreich O. Targeting MLL-AF4 with short interfering RNAs inhibits clonogenicity and engraftment of t(4;11)-positive human leukemic cells.Blood. 2005; 106: 3559-3566Crossref PubMed Scopus (71) Google Scholar] and this, combined with the fact that t(4;11) leukemias have very few cooperating mutations [10Andersson A.K. Ma J. Wang J. et al.The landscape of somatic mutations in infant MLL-rearranged acute lymphoblastic leukemias.Nat Genet. 2015; 47: 330-337Crossref PubMed Scopus (325) Google Scholar], suggests that a detailed understanding of the function of MLL-AF4 may aid in the design of targeted therapies. The MLL-AF4 fusion protein binds to gene targets and is proposed to cause inappropriate gene activation through multiple transcription elongation and epigenetic mechanisms [13Ballabio E. Milne T.A. Molecular and Epigenetic Mechanisms of MLL in human leukemogenesis.Cancers. 2012; 4: 904-944Crossref PubMed Scopus (30) Google Scholar, 14Garcia-Cuellar M.P. Buttner C. Bartenhagen C. Dugas M. Slany R.K. Leukemogenic MLL-ENL fusions induce alternative chromatin states to drive a functionally dichotomous group of target genes.Cell Rep. 2016; 15: 310-322Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar, 15Okuda H. Kanai A. Ito S. Matsui H. Yokoyama A. AF4 uses the SL1 components of RNAP1 machinery to initiate MLL fusion- and AEP-dependent transcription.Nat Commun. 2015; 6: 8869Crossref PubMed Scopus (34) Google Scholar, 16Cheung N. Fung T.K. Zeisig B.B. et al.Targeting aberrant epigenetic networks mediated by PRMT1 and KDM4C in acute myeloid leukemia.Cancer Cell. 2016; 29: 32-48Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar]. We recently reported that MLL-AF4 activates important gene targets such as RUNX1, HOXA9, and BCL-2 [17Wilkinson A.C. Ballabio E. Geng H. et al.RUNX1 Is a key target in t(4;11) leukemias that contributes to gene activation through an AF4-MLL complex interaction.Cell Rep. 2013; 3: 116-127Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar, 18Benito J.M. Godfrey L. Kojima K. et al.MLL-rearranged acute lymphoblastic leukemias activate BCL-2 through H3K79 methylation and are sensitive to the BCL-2-specific antagonist ABT-199.Cell Rep. 2015; 13: 2715-2727Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar], mainly through recruitment of the disruptor of telomeric silencing 1-like (DOT1L) protein (the only known histone 3 lysine 79 methylation methyltransferase [19Jones B. Su H. Bhat A. et al.The histone H3K79 methyltransferase Dot1L is essential for mammalian development and heterochromatin structure.PLoS Genet. 2008; 4: e1000190Crossref PubMed Scopus (271) Google Scholar]) and increased H3K79me2/3 levels [18Benito J.M. Godfrey L. Kojima K. et al.MLL-rearranged acute lymphoblastic leukemias activate BCL-2 through H3K79 methylation and are sensitive to the BCL-2-specific antagonist ABT-199.Cell Rep. 2015; 13: 2715-2727Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar]. Past work has suggested that MLL-AF4 leukemias are particularly sensitive to loss of BCL-2 activity [20Robinson B.W. Behling K.C. Gupta M. et al.Abundant anti-apoptotic BCL-2 is a molecular target in leukaemias with t(4;11) translocation.Br J Haematol. 2008; 141: 827-839Crossref PubMed Scopus (42) Google Scholar], and we were able to extend this observation by illustrating that BCL-2 is a key therapeutic target in MLL-AF4 leukemias [18Benito J.M. Godfrey L. Kojima K. et al.MLL-rearranged acute lymphoblastic leukemias activate BCL-2 through H3K79 methylation and are sensitive to the BCL-2-specific antagonist ABT-199.Cell Rep. 2015; 13: 2715-2727Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar]. BCL-2 is part of a family of proteins that controls apoptosis, and perturbed expression of BCL-2 family members is associated with tumorigenesis and resistance to cancer treatments [21Bogenberger J.M. Kornblau S.M. Pierceall W.E. et al.BCL-2 family proteins as 5-azacytidine-sensitizing targets and determinants of response in myeloid malignancies.Leukemia. 2014; 28: 1657-1665Crossref PubMed Scopus (143) Google Scholar, 22Czabotar P.E. Lessene G. Strasser A. Adams J.M. Control of apoptosis by the BCL-2 protein family: Implications for physiology and therapy.Nat Rev Mol Cell Biol. 2014; 15: 49-63Crossref PubMed Scopus (2158) Google Scholar, 23Davids M.S. Letai A. Targeting the B-cell lymphoma/leukemia 2 family in cancer.J Clin Oncol. 2012; 30: 3127-3135Crossref PubMed Scopus (221) Google Scholar]. The BCL-2 family is divided into antiapoptotic factors (e.g., BCL-2, MCL-1, BCL-XL, BCL-w, BCL2-A1), pore-forming proapoptotic factors (BAX and BAK), and BH3-only proteins (e.g., BIM, BID, and BAD). Recent work suggests that the primary role of the BH3-only proteins is to sequester the antiapoptotic factors (e.g., BCL-2), allowing the initiation of mitochondrial outer membrane permeabilization (MOMP), the first irreversible step of apoptosis [24O'Neill K.L. Huang K. Zhang J. Chen Y. Luo X. Inactivation of prosurvival Bcl-2 proteins activates Bax/Bak through the outer mitochondrial membrane.Genes Dev. 2016; 30: 973-988Crossref PubMed Scopus (211) Google Scholar]. Therefore, maintaining normal cellular homeostasis requires maintenance of a precise balance between antiapoptotic and BH3-only protein levels for the control of cell survival. The MLL-AF4 protein disrupts this balance by directly binding to the BCL-2 gene [17Wilkinson A.C. Ballabio E. Geng H. et al.RUNX1 Is a key target in t(4;11) leukemias that contributes to gene activation through an AF4-MLL complex interaction.Cell Rep. 2013; 3: 116-127Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar, 18Benito J.M. Godfrey L. Kojima K. et al.MLL-rearranged acute lymphoblastic leukemias activate BCL-2 through H3K79 methylation and are sensitive to the BCL-2-specific antagonist ABT-199.Cell Rep. 2015; 13: 2715-2727Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 25Guenther M.G. Lawton L.N. Rozovskaia T. et al.Aberrant chromatin at genes encoding stem cell regulators in human mixed-lineage leukemia.Genes Dev. 2008; 22: 3403-3408Crossref PubMed Scopus (217) Google Scholar, 26Geng H. Brennan S. Milne T.A.M. et al.Integrative epigenomic analysis identifies biomarkers and therapeutic targets in adult B-acute lymphoblastic leukemia.Cancer Discov. 2012; 2: 1004-1023Crossref PubMed Scopus (73) Google Scholar], causing increased gene expression and elevated BCL-2 protein levels [18Benito J.M. Godfrey L. Kojima K. et al.MLL-rearranged acute lymphoblastic leukemias activate BCL-2 through H3K79 methylation and are sensitive to the BCL-2-specific antagonist ABT-199.Cell Rep. 2015; 13: 2715-2727Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar]. ABT-199 (also known as venetoclax) is a highly specific BH3 mimetic that can preferentially target BCL-2 activity [27Souers A.J. Leverson J.D. Boghaert E.R. et al.ABT-199, a potent and selective BCL-2 inhibitor, achieves antitumor activity while sparing platelets.Nat Med. 2013; 19: 202-208Crossref PubMed Scopus (2038) Google Scholar]. In ALL, MLL-AF4 leukemias are distinctly sensitive to treatment with venetoclax alone [18Benito J.M. Godfrey L. Kojima K. et al.MLL-rearranged acute lymphoblastic leukemias activate BCL-2 through H3K79 methylation and are sensitive to the BCL-2-specific antagonist ABT-199.Cell Rep. 2015; 13: 2715-2727Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 28Khaw S.L. Suryani S. Evans K. et al.Venetoclax responses of pediatric ALL xenografts reveal MLLr ALL sensitivity, but overall requirement to target both BCL2 and BCLXL.Blood. 2016; 128: 1382-1395Crossref PubMed Scopus (113) Google Scholar]. However, even among MLLr samples, a subset either is resistant to venetoclax [28Khaw S.L. Suryani S. Evans K. et al.Venetoclax responses of pediatric ALL xenografts reveal MLLr ALL sensitivity, but overall requirement to target both BCL2 and BCLXL.Blood. 2016; 128: 1382-1395Crossref PubMed Scopus (113) Google Scholar] or relapses after an early initial response [18Benito J.M. Godfrey L. Kojima K. et al.MLL-rearranged acute lymphoblastic leukemias activate BCL-2 through H3K79 methylation and are sensitive to the BCL-2-specific antagonist ABT-199.Cell Rep. 2015; 13: 2715-2727Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar]. Resistance to BH3 mimetic monotherapy usually occurs via upregulation of alternative antiapoptotic factors such as MCL-1 and BCL-XL [29Pan R. Ruvolo V.R. Wei J. et al.Inhibition of Mcl-1 with the pan-Bcl-2 family inhibitor (–)BI97D6 overcomes ABT-737 resistance in acute myeloid leukemia.Blood. 2015; 126: 363-372Crossref PubMed Scopus (97) Google Scholar, 30Konopleva M. Milella M. Ruvolo P. et al.MEK inhibition enhances ABT-737-induced leukemia cell apoptosis via prevention of ERK-activated MCL-1 induction and modulation of MCL-1/BIM complex.Leukemia. 2012; 26: 778-787Crossref PubMed Scopus (113) Google Scholar, 31Zhang C. Cai T.Y. Zhu H. et al.Synergistic antitumor activity of gemcitabine and ABT-737 in vitro and in vivo through disrupting the interaction of USP9X and Mcl-1.Mol Cancer Ther. 2011; 10: 1264-1275Crossref PubMed Scopus (50) Google Scholar, 32Al-Harbi S. Hill B.T. Mazumder S. et al.An antiapoptotic BCL-2 family expression index predicts the response of chronic lymphocytic leukemia to ABT-737.Blood. 2011; 118: 3579-3590Crossref PubMed Scopus (72) Google Scholar, 33Choudhary G.S. Al-Harbi S. Mazumder S. et al.MCL-1 and BCL-xL-dependent resistance to the BCL-2 inhibitor ABT-199 can be overcome by preventing PI3K/AKT/mTOR activation in lymphoid malignancies.Cell Death Dis. 2015; 6: e1593Crossref PubMed Scopus (252) Google Scholar]. Notably, high-level MCL-1 gene expression is also known to be associated with resistance to treatment in MLLr samples [34Stam R.W. Den Boer M.L. Schneider P. et al.Association of high-level MCL-1 expression with in vitro and in vivo prednisone resistance in MLL-rearranged infant acute lymphoblastic leukemia.Blood. 2010; 115: 1018-1025Crossref PubMed Scopus (63) Google Scholar]. We found that the venetoclax treatment strongly synergized with standard chemotherapeutic agents, likely in part because of the treatment-induced reduction of MCL-1 and BCL-XL protein levels [18Benito J.M. Godfrey L. Kojima K. et al.MLL-rearranged acute lymphoblastic leukemias activate BCL-2 through H3K79 methylation and are sensitive to the BCL-2-specific antagonist ABT-199.Cell Rep. 2015; 13: 2715-2727Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar]. More interestingly, we also found that venetoclax treatment synergized with DOT1L inhibitors (also confirmed in a more recent study [35Pal D. Blair H.J. Elder A. et al.Long-term in vitro maintenance of clonal abundance and leukaemia-initiating potential in acute lymphoblastic leukaemia.Leukemia. 2016; 30: 1691-1700Crossref PubMed Scopus (32) Google Scholar]), although it is unclear if the mechanism of synergy is through downregulation of other BCL-2 family proteins. In our past work, other BCL-2 family genes such as MCL-1, BIM, BAX, and BCL-XL did not appear to be regulated by MLL-AF4 or DOT1L [18Benito J.M. Godfrey L. Kojima K. et al.MLL-rearranged acute lymphoblastic leukemias activate BCL-2 through H3K79 methylation and are sensitive to the BCL-2-specific antagonist ABT-199.Cell Rep. 2015; 13: 2715-2727Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar], but admittedly this could have been due to the sensitivity of the assays used for the analysis. To more carefully analyze MLL-AF4- and DOT1L-mediated regulation of BCL-2 family genes, here we use nascent RNA sequencing (RNA-seq) coupled with MLL-AF4 siRNA knockdowns and DOT1L inhibitor treatments to illustrate that MLL-AF4 directly activates both BCL-2 and MCL-1. Interestingly, we also find that MLL-AF4 represses the BIM gene through the polycomb group repressor 1 (PRC1) component CBX8, although this has little overall effect on BIM protein levels. We further analyze MLL-AF4 activation of the BCL-2 gene using Capture-C and identify a BCL-2 enhancer. Loss of MLL-AF4 results in a concurrent reduction of H3K27Ac at the enhancer as well as H3K79me3 in the gene body, revealing a novel interplay between these two histone marks in MLL-AF4-mediated activation of BCL-2. SEM cells [36Greil J. Gramatzki M. Burger R. et al.The acute lymphoblastic leukaemia cell line SEM with t(4;11) chromosomal rearrangement is biphenotypic and responsive to interleukin-7.Br J Haematol. 1994; 86: 275-283Crossref PubMed Scopus (95) Google Scholar] were purchased from DSMZ (www.cell-lines.de) and cultured in Iscove's modified Dulbecco's medium (IMDM) supplemented with 10% fetal calf serum. For treatment studies, SEM cells were treated with the DOT1L inhibitor EPZ5676 (Epizyme) for 7 days, with medium and inhibitor changes on days 0, 3, and 6. SEM cells were seeded at a concentration of 0.3 × 106 cell/mL on days 0 and 3 and at a concentration of 0.7 × 106 cell/mL on day 6 prior to harvesting on day 7. MLL-AF4 siRNA was performed as described [18Benito J.M. Godfrey L. Kojima K. et al.MLL-rearranged acute lymphoblastic leukemias activate BCL-2 through H3K79 methylation and are sensitive to the BCL-2-specific antagonist ABT-199.Cell Rep. 2015; 13: 2715-2727Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar], and sequences were obtained from Thomas et al. [12Thomas M. Gessner A. Vornlocher H.P. Hadwiger P. Greil J. Heidenreich O. Targeting MLL-AF4 with short interfering RNAs inhibits clonogenicity and engraftment of t(4;11)-positive human leukemic cells.Blood. 2005; 106: 3559-3566Crossref PubMed Scopus (71) Google Scholar]. Reverse transcription polymerase chain reaction (RT-PCR) SYBR green primers and Taqman primer/probe sets are as previously described [17Wilkinson A.C. Ballabio E. Geng H. et al.RUNX1 Is a key target in t(4;11) leukemias that contributes to gene activation through an AF4-MLL complex interaction.Cell Rep. 2013; 3: 116-127Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar, 18Benito J.M. Godfrey L. Kojima K. et al.MLL-rearranged acute lymphoblastic leukemias activate BCL-2 through H3K79 methylation and are sensitive to the BCL-2-specific antagonist ABT-199.Cell Rep. 2015; 13: 2715-2727Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar] except for the following SYBR green primer sets used in this study:β2M forward: TGCTGTCTCCATGTTTGATGTATCTβ2M reverse: TCTCTGCTCCCCACCTCTAAGTYWHAZ forward: ACTTTTGGTACATTGTGGCTTCAAYWHAZ reverse: CCGCCAGGACAAACCAGTATBCL-2 (no2) forward: GTGGATGACTGAGTACCTGAACBCL-2 (no2) reverse: GAGACAGCCAGGAGAAATCAAMCL1 (no2) forward: TGCTTCGGAAACTGGACATCMCL1 (no2) reverse: GTTACGCCGTCGCTGAAAMCL1 (no3) forward: AAACGGGACTGGCTAGTTAAAMCL1 (no3) reverse: CATTCCTGATGCCACCTTCTAMCL1 (no4) forward: GCATCGAACCATTAGCAGAAAGMCL1 (no4) reverse: CTCTACATGGAAGAACTCCACAA We analyzed a microarray gene expression data set from a St. Jude ALL cohort [37Figueroa M.E. Chen S.C. Andersson A.K. et al.Integrated genetic and epigenetic analysis of childhood acute lymphoblastic leukemia.J Clin Invest. 2013; 123: 3099-3111Crossref PubMed Scopus (100) Google Scholar] (n = 154) that includes these patient subsets: 18 BCR-ABL1, 8 E2A-PBX1, 15 MLLr, 24 TEL-AML1, 26 hyperdiploid, 11 CRLF2, 11 ERG, and 7 other. Western blot analysis was performed as previously described [18Benito J.M. Godfrey L. Kojima K. et al.MLL-rearranged acute lymphoblastic leukemias activate BCL-2 through H3K79 methylation and are sensitive to the BCL-2-specific antagonist ABT-199.Cell Rep. 2015; 13: 2715-2727Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar]. Chromatin immunoprecipitation (ChIP) and ChIP-seq experiments were performed as previously described [17Wilkinson A.C. Ballabio E. Geng H. et al.RUNX1 Is a key target in t(4;11) leukemias that contributes to gene activation through an AF4-MLL complex interaction.Cell Rep. 2013; 3: 116-127Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar, 18Benito J.M. Godfrey L. Kojima K. et al.MLL-rearranged acute lymphoblastic leukemias activate BCL-2 through H3K79 methylation and are sensitive to the BCL-2-specific antagonist ABT-199.Cell Rep. 2015; 13: 2715-2727Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 38Milne T.A. Zhao K. Hess J.L. Chromatin immunoprecipitation (ChIP) for analysis of histone modifications and chromatin-associated proteins.Methods Mol Biol. 2009; 538: 409-423Crossref PubMed Scopus (56) Google Scholar], and BCL family and control gene primer sequences are as previously described [18Benito J.M. Godfrey L. Kojima K. et al.MLL-rearranged acute lymphoblastic leukemias activate BCL-2 through H3K79 methylation and are sensitive to the BCL-2-specific antagonist ABT-199.Cell Rep. 2015; 13: 2715-2727Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar]. All antibodies used for Western blot, ChIP and ChIP-seq are as previously described [18Benito J.M. Godfrey L. Kojima K. et al.MLL-rearranged acute lymphoblastic leukemias activate BCL-2 through H3K79 methylation and are sensitive to the BCL-2-specific antagonist ABT-199.Cell Rep. 2015; 13: 2715-2727Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar] except for P300 (Bethyl, A300-358A, lot 3), E2A (Cell Signaling 12258, lot 1), PBX1/2/3 (Santa Cruz, sc888 lot J0212), cleaved PARP (Cell Signaling 5625), and β-TrCP (Cell Signaling 11984). Cells (108) were treated with 500 μmol/L 4-thiouridine (4-SU) for 1 hour. Cells were lysed using trizol, and RNA was precipitated with ethanol. 4-SU-Incorporated RNA was biotinylated by labeling with 1 mg/mL Biotin-HPDP for 90 min at room temperature. Following chloroform extraction, labeled RNA was separated using magnetic streptavidin beads. Beads were washed using a magnetic μMACS stand before RNA was eluted in two rounds of elution with 100 μL 100 mmol/L dithiothreitol. RNA was purified using a Qiagen RNeasy MinElute kit. Samples were sequenced on a NextSeq 500 using a high 75 v2 sequencing kit. Nascent RNA-seq experiments were carried out in triplicate. Next-generation Capture-C was performed as previously described [39Davies J.O. Telenius J.M. McGowan S.J. et al.Multiplexed analysis of chromosome conformation at vastly improved sensitivity.Nat Methods. 2016; 13: 74-80Crossref PubMed Scopus (153) Google Scholar]. A biotinylated DNA oligonucleotide was designed for the promoter of the BCL2 gene (Integrated DNA Technologies) with the following sequence (5′ to 3′): Biotin-GATCTCAAGAGCTCGAGAAAAAAAAAAGGCAGCGGCGGCGGCAGATGAATTACAATTTTCAGTCCGGTATTCGCAGAAGTCCTGTGATGTTTTCCCCTTCTCGGCAATTTACACGCGCGC SEM cells (2 × 107) were used in the assay to generate a standard 3C library. Very briefly, the cells were fixed with 2% formaldehyde for 10 min coupled with DpnII digestion and sonication of fragments to 200 bp (see Davies et al. [39Davies J.O. Telenius J.M. McGowan S.J. et al.Multiplexed analysis of chromosome conformation at vastly improved sensitivity.Nat Methods. 2016; 13: 74-80Crossref PubMed Scopus (153) Google Scholar] for more details). The biotinylated probe was hybridized to the 3C library (see Davies et al. [39Davies J.O. Telenius J.M. McGowan S.J. et al.Multiplexed analysis of chromosome conformation at vastly improved sensitivity.Nat Methods. 2016; 13: 74-80Crossref PubMed Scopus (153) Google Scholar]) for 72 hours, and streptavidin beads (Invitrogen) were used to enrich for fragments hybridized to the BCL-2 promoter oligo. A double-capture step approach was taken, also described in Davies et al. [39Davies J.O. Telenius J.M. McGowan S.J. et al.Multiplexed analysis of chromosome conformation at vastly improved sensitivity.Nat Methods. 2016; 13: 74-80Crossref PubMed Scopus (153) Google Scholar]. DNA libraries were prepared using the NEBNext DNA library kit according to the manufacturer's instructions (New England BioLabs, E6040, E7335, and E7500). Libraries were sequenced using the Illumina MiSeq platform with 150-bp paired-end reads. Capture-C analysis was performed using an in-house pipeline to analyze purified BCL-2 promoter fragments for the presence of additional interacting sequences. Following quality control (QC) analysis with the fastQC package (http://www.bioinformatics.babraham.ac.uk/projects/fastqc), reads were aligned using STAR [40Dobin A. Davis C.A. Schlesinger F. et al.STAR: ultrafast universal RNA-seq aligner.Bioinformatics. 2013; 29: 15-21Crossref PubMed Scopus (19417) Google Scholar] against the human genome assembly (NCBI build36 [hg18] UCSC transcripts). Reads that were identified as PCR duplicates using Samtools [41Li H. Handsaker B. Wysoker A. et al.Genome Project Data Processing: The Sequence Alignment/Map format and SAMtools.Bioinformatics. 2009; 25: 2078-2079Crossref PubMed Scopus (31812) Google Scholar] were discarded. Gene expression levels were quantified as read counts using the featureCounts function [42Liao Y. Smyth G.K. Shi W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features.Bioinformatics. 2014; 30: 923-930Crossref PubMed Scopus (9042) Google Scholar] from the Subread package [42Liao Y. Smyth G.K. Shi W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features.Bioinformatics. 2014; 30: 923-930Crossref PubMed Scopus (9042) Google Scholar] with default parameters. The read counts were used for the identification of global differential gene expression between specified populations using the edgeR package [43Robinson M.D. McCarthy D.J. Smyth G.K. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data.Bioinformatics. 2010; 26: 139-140Crossref PubMed Scopus (21051) Google Scholar]. RPKM values were also generated using the edgeR package. Genes were considered differentially expressed between populations if they had an adjusted p value (FDR) < 0.05. NanoString experiments (NanoString Technologies) were performed using nascent RNA samples and a custom-designed array according to the recommendations of the manufacturer. The data were analyzed using NanoStriDE software [44Brumbaugh C.D. Kim H.J. Giovacchini M. Pourmand N. NanoStriDE: Normalization and differential expression analysis of NanoString nCounter data.BMC Bioinformatics. 2011; 12: 479Crossref PubMed Scopus (44) Google Scholar]. The Gene Expression Omnibus (GEO) accession number for the data discussed in this article is GSE85988 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE85988). A survey of MLL-AF4 ChIP-seq data [17Wilkinson A.C. Ballabio E. Geng H. et al.RUNX1 Is a key target in t(4;11) leukemias that contributes to gene activation through an AF4-MLL complex interaction.Cell Rep. 2013; 3: 116-127Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar, 18Benito J.M. Godfrey L. Kojima K. et al.MLL-