Get quick answers to your questions about the article from our AI researcher chatbot
{'id': 'https://openalex.org/W2221012970', 'doi': 'https://doi.org/10.1094/pdis-10-15-1235-pdn', 'title': 'First Report of <i>Grapevine Pinot gris virus</i> Infecting Grapevine in the United States', 'display_name': 'First Report of <i>Grapevine Pinot gris virus</i> Infecting Grapevine in the United States', 'publication_year': 2015, 'publication_date': '2015-12-20', 'ids': {'openalex': 'https://openalex.org/W2221012970', 'doi': 'https://doi.org/10.1094/pdis-10-15-1235-pdn', 'mag': '2221012970'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1094/pdis-10-15-1235-pdn', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S135458494', 'display_name': 'Plant Disease', 'issn_l': '0191-2917', 'issn': ['0191-2917', '1943-7692'], 'is_oa': False, 'is_in_doaj': False, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320276', 'host_organization_name': 'American Phytopathological Society', 'host_organization_lineage': ['https://openalex.org/P4310320276'], 'host_organization_lineage_names': ['American Phytopathological Society'], 'type': 'journal'}, 'license': 'other-oa', 'license_id': 'https://openalex.org/licenses/other-oa', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'https://doi.org/10.1094/pdis-10-15-1235-pdn', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5000228983', 'display_name': 'Maher Al Rwahnih', 'orcid': 'https://orcid.org/0000-0003-1589-9234'}, 'institutions': [{'id': 'https://openalex.org/I84218800', 'display_name': 'University of California, Davis', 'ror': 'https://ror.org/05rrcem69', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I84218800']}, {'id': 'https://openalex.org/I4210151202', 'display_name': 'Plant (United States)', 'ror': 'https://ror.org/05g223j58', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I4210151202']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'M. Al Rwahnih', 'raw_affiliation_strings': ['Department of Plant Pathology, University of California, Davis 95616.'], 'affiliations': [{'raw_affiliation_string': 'Department of Plant Pathology, University of California, Davis 95616.', 'institution_ids': ['https://openalex.org/I84218800', 'https://openalex.org/I4210151202']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5087712442', 'display_name': 'Deborah Golino', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I84218800', 'display_name': 'University of California, Davis', 'ror': 'https://ror.org/05rrcem69', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I84218800']}, {'id': 'https://openalex.org/I4210151202', 'display_name': 'Plant (United States)', 'ror': 'https://ror.org/05g223j58', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I4210151202']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'D. Golino', 'raw_affiliation_strings': ['Department of Plant Pathology, University of California, Davis 95616.'], 'affiliations': [{'raw_affiliation_string': 'Department of Plant Pathology, University of California, Davis 95616.', 'institution_ids': ['https://openalex.org/I84218800', 'https://openalex.org/I4210151202']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5075793887', 'display_name': 'Adib Rowhani', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I84218800', 'display_name': 'University of California, Davis', 'ror': 'https://ror.org/05rrcem69', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I84218800']}, {'id': 'https://openalex.org/I4210151202', 'display_name': 'Plant (United States)', 'ror': 'https://ror.org/05g223j58', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I4210151202']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'A. Rowhani', 'raw_affiliation_strings': ['Department of Plant Pathology, University of California, Davis 95616.'], 'affiliations': [{'raw_affiliation_string': 'Department of Plant Pathology, University of California, Davis 95616.', 'institution_ids': ['https://openalex.org/I84218800', 'https://openalex.org/I4210151202']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 2, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': None, 'apc_paid': None, 'fwci': 4.317, 'has_fulltext': False, 'cited_by_count': 38, 'citation_normalized_percentile': {'value': 0.999978, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 95, 'max': 96}, 'biblio': {'volume': '100', 'issue': '5', 'first_page': '1030', 'last_page': '1030'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10494', 'display_name': 'Viral RNA Silencing and Plant Immunity', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1110', 'display_name': 'Plant Science'}, 'field': {'id': 'https://openalex.org/fields/11', 'display_name': 'Agricultural and Biological Sciences'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10494', 'display_name': 'Viral RNA Silencing and Plant Immunity', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1110', 'display_name': 'Plant Science'}, 'field': {'id': 'https://openalex.org/fields/11', 'display_name': 'Agricultural and Biological Sciences'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T13220', 'display_name': 'Mycoviruses in Fungal Symbiosis and Pathogenesis', 'score': 0.9997, 'subfield': {'id': 'https://openalex.org/subfields/1310', 'display_name': 'Endocrinology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10135', 'display_name': 'Insect-Plant Interactions in Agricultural Ecosystems', 'score': 0.998, 'subfield': {'id': 'https://openalex.org/subfields/1109', 'display_name': 'Insect Science'}, 'field': {'id': 'https://openalex.org/fields/11', 'display_name': 'Agricultural and Biological Sciences'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/recombination-analysis', 'display_name': 'Recombination Analysis', 'score': 0.436038}], 'concepts': [{'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.8608365}, {'id': 'https://openalex.org/C2992143071', 'wikidata': 'https://www.wikidata.org/wiki/Q30046', 'display_name': 'Vitis vinifera', 'level': 2, 'score': 0.71770394}, {'id': 'https://openalex.org/C159047783', 'wikidata': 'https://www.wikidata.org/wiki/Q7215', 'display_name': 'Virology', 'level': 1, 'score': 0.47049046}, {'id': 'https://openalex.org/C109110057', 'wikidata': 'https://www.wikidata.org/wiki/Q1495434', 'display_name': 'Plant virus', 'level': 3, 'score': 0.426937}, {'id': 'https://openalex.org/C2522874641', 'wikidata': 'https://www.wikidata.org/wiki/Q808', 'display_name': 'Virus', 'level': 2, 'score': 0.40144742}, {'id': 'https://openalex.org/C59822182', 'wikidata': 'https://www.wikidata.org/wiki/Q441', 'display_name': 'Botany', 'level': 1, 'score': 0.3359295}], 'mesh': [], 'locations_count': 1, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1094/pdis-10-15-1235-pdn', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S135458494', 'display_name': 'Plant Disease', 'issn_l': '0191-2917', 'issn': ['0191-2917', '1943-7692'], 'is_oa': False, 'is_in_doaj': False, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320276', 'host_organization_name': 'American Phytopathological Society', 'host_organization_lineage': ['https://openalex.org/P4310320276'], 'host_organization_lineage_names': ['American Phytopathological Society'], 'type': 'journal'}, 'license': 'other-oa', 'license_id': 'https://openalex.org/licenses/other-oa', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1094/pdis-10-15-1235-pdn', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S135458494', 'display_name': 'Plant Disease', 'issn_l': '0191-2917', 'issn': ['0191-2917', '1943-7692'], 'is_oa': False, 'is_in_doaj': False, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320276', 'host_organization_name': 'American Phytopathological Society', 'host_organization_lineage': ['https://openalex.org/P4310320276'], 'host_organization_lineage_names': ['American Phytopathological Society'], 'type': 'journal'}, 'license': 'other-oa', 'license_id': 'https://openalex.org/licenses/other-oa', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'id': 'https://metadata.un.org/sdg/9', 'display_name': 'Industry, innovation and infrastructure', 'score': 0.41}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 2, 'referenced_works': ['https://openalex.org/W2004622311', 'https://openalex.org/W2045782861'], 'related_works': ['https://openalex.org/W4386371748', 'https://openalex.org/W2253391108', 'https://openalex.org/W2188759708', 'https://openalex.org/W2147145791', 'https://openalex.org/W2138564085', 'https://openalex.org/W2123163123', 'https://openalex.org/W2111970140', 'https://openalex.org/W2094230406', 'https://openalex.org/W2016551366', 'https://openalex.org/W1874513932'], 'abstract_inverted_index': {'HomePlant': [0], 'DiseaseVol.': [1], '100,': [2, 638, 1310, 1345], 'No.': [3, 639, 694, 712, 765, 803, 820, 859, 870, 888, 912, 931, 1022, 1033, 1065, 1084, 1111, 1141, 1159, 1186, 1214, 1241, 1259, 1281, 1311, 1346], '5First': [4], 'Report': [5, 23, 1283], 'of': [6, 24, 60, 64, 89, 125, 162, 167, 174, 187, 195, 207, 213, 255, 325, 346, 373, 455, 502, 516, 526, 529, 538, 551, 562, 567, 582, 591, 605, 671, 674, 699, 714, 739, 743, 760, 767, 826, 874, 879, 894, 907, 926, 986, 1035, 1052, 1061, 1068, 1073, 1090, 1106, 1121, 1134, 1145, 1161, 1170, 1179, 1221, 1224, 1236, 1261, 1277, 1284, 1313], 'Grapevine': [7, 12, 25, 30, 80, 503, 700, 715, 768, 828, 947, 955, 987, 992, 1091, 1122, 1146, 1162, 1192, 1226, 1285, 1314], 'Pinot': [8, 26, 81, 105, 140, 188, 676, 701, 769, 829, 948, 988, 1038, 1092, 1123, 1147, 1163, 1216, 1227, 1263, 1286, 1315], 'gris': [9, 27, 82, 106, 141, 677, 770, 830, 989, 1039, 1093, 1124, 1148, 1164, 1217, 1228, 1264, 1287, 1316], 'virus': [10, 28, 83, 98, 205, 296, 531, 678, 747, 771, 990, 1040, 1094, 1125, 1149, 1165, 1229, 1265, 1288, 1317], 'Infecting': [11, 29], 'in': [13, 31, 93, 120, 128, 164, 201, 210, 290, 304, 308, 328, 399, 453, 485, 493, 518, 553, 570, 593, 704, 725, 734, 748, 772, 777, 833, 876, 899, 920, 941, 970, 1095, 1099, 1166, 1173, 1189, 1289, 1318, 1321], 'the': [14, 32, 90, 94, 157, 165, 168, 180, 193, 204, 217, 230, 238, 253, 256, 270, 305, 312, 329, 358, 363, 374, 404, 412, 427, 438, 464, 486, 494, 500, 513, 519, 530, 539, 543, 554, 565, 589, 603, 672, 680, 982, 1050, 1225, 1322], 'United': [15, 33, 520, 1323], 'States': [16], 'PreviousNext': [17], 'DISEASE': [18], 'NOTES': [19], 'OPENOpen': [20], 'Access': [21], 'licenseFirst': [22], 'StatesM.': [34], 'Al': [35, 42, 52, 794, 1196], 'Rwahnih,': [36, 43, 1197], 'D.': [37, 44, 54], 'Golino,': [38, 45, 791], 'and': [39, 46, 49, 122, 136, 142, 151, 160, 203, 301, 331, 337, 379, 388, 422, 610, 684, 696, 722, 792, 806, 823, 849, 872, 891, 958, 962, 978, 991, 1012, 1114, 1137, 1168, 1182, 1202, 1300, 1336], 'A.': [40, 47, 56, 1332, 1337], 'RowhaniM.': [41], 'RowhaniAffiliationsAuthors': [48], 'Affiliations': [50], 'M.': [51, 1296], 'Rwahnih': [53], 'Golino': [55], 'Rowhani': [57], ',': [58], 'Department': [59], 'Plant': [61, 170, 690, 735, 761, 799, 908, 927, 937, 964, 971, 1107, 1135, 1180, 1210, 1237, 1307, 1342], 'Pathology,': [62, 691, 762, 909, 928, 1108, 1238], 'University': [63, 173], 'California,': [65, 175, 202], 'Davis': [66], '95616.': [67], 'Published': [68], 'Online:4': [69], 'Mar': [70, 652], '2016https://doi.org/10.1094/PDIS-10-15-1235-PDNAboutSections': [71], 'ToolsAdd': [72], 'to': [73, 391, 463, 477, 558, 587, 601, 781, 809, 939, 1048, 1271], 'favoritesDownload': [74], 'CitationsTrack': [75], 'Citations': [76], 'ShareShare': [77], 'onFacebookTwitterLinked': [78], 'InRedditEmailWechat': [79], '(GPGV)': [84, 1041], 'is': [85, 192, 212, 512, 523, 585, 914], 'a': [86, 559, 578, 726, 753, 827, 834, 952, 1053], 'new': [87, 1036], 'member': [88], 'genus': [91], 'Trichovirus': [92], 'family': [95], 'Betaflexiviridae.': [96], 'The': [97, 248, 341, 443, 467, 665], 'was': [99, 223, 250, 279, 409, 420], 'first': [100, 514], 'discovered': [101], 'from': [102, 179, 225, 288, 321, 335, 411, 917, 1043, 1126], 'an': [103], 'Italian': [104], 'grapevine': [107, 198, 675, 681, 744, 897, 1037, 1097, 1128, 1262], '(Vitis': [108], 'vinifera)': [109], '(Giampetruzzi': [110], 'et': [111, 132, 354, 614, 626], 'al.': [112, 133, 355, 615, 627], '2012).': [113], 'Since': [114], 'then,': [115], 'GPGV': [116, 153, 163, 257, 395, 465, 469, 482, 517, 552, 568, 592, 606], 'has': [117], 'been': [118, 286], 'reported': [119], 'symptomatic': [121, 150], 'asymptomatic': [123, 152, 275, 1171], 'plants': [124, 199, 360], 'other': [126, 481, 489], 'cultivars': [127], 'many': [129], 'countries': [130], '(Saldarelli': [131], '2015).': [134], 'Biological': [135], 'molecular': [137], 'assays': [138], 'using': [139, 229, 434, 750], 'Traminer': [143], 'grapevines': [144], 'suggested': [145], 'that': [146], 'there': [147], 'may': [148], 'be': [149, 574, 599], 'isolates.': [154], 'To': [155, 310, 401, 508], 'address': [156], 'possible': [158], 'presence': [159, 254, 501], 'prevalence': [161, 550, 590], 'collections': [166], 'Foundation': [169], 'Services': [171], '(FPS,': [172], 'Davis),': [176], '2,014': [177], 'vines': [178, 186, 209, 271, 324, 541], 'collection': [181, 191, 307], 'were': [182, 319, 385, 461, 491], 'screened,': [183], 'including': [184], '23': [185], 'gris.': [189], 'This': [190, 283], 'source': [194], 'all': [196, 269, 322], 'certified': [197, 1075, 1096], 'produced': [200, 369], 'status': [206], 'mother': [208], 'it': [211], 'great': [214], 'importance': [215], 'for': [216, 252, 281], 'U.S.': [218], 'wine': [219, 611], 'industry.': [220], 'Total': [221], 'RNA': [222, 234, 249, 333], 'extracted': [224, 421], 'leaf': [226, 316, 407, 682], 'petiole': [227], 'tissue': [228, 294, 317, 408], 'MagMax': [231, 239], '96': [232, 390], 'Viral': [233, 721], 'isolation': [235], 'kit': [236], 'with': [237, 394, 480, 679], 'Express-96': [240], 'magnetic': [241], 'particle': [242], 'processor': [243], '(Thermo': [244], 'Fisher': [245], 'Scientific,': [246], 'USA).': [247], 'analyzed': [251, 423], 'genome': [258], 'by': [259, 339, 352, 424, 534, 719, 946, 1266], 'real-time': [260], 'qRT-PCR': [261, 313, 536], '(forward': [262], 'ACCACAATGGTGAAGTGTCATGA;': [263], 'probe': [264], 'FAM-TCTTTTAATCCTTCCCTGCCG;': [265], 'reverse': [266], 'ACGAAAAGTCATTAACTTTATGTCA).': [267], 'Among': [268], 'tested,': [272, 361], 'only': [273, 362], 'one': [274, 563], 'vine': [276, 284, 608], "'Touriga": [277], "Nacional'": [278], 'positive': [280, 367, 413], 'GPGV.': [282], 'had': [285], 'imported': [287], 'Portugal': [289], '1981,': [291], 'eventually': [292], 'receiving': [293], 'culture': [295], 'therapy,': [297], 'clearing': [298], 'quarantine': [299], 'tests,': [300], 'being': [302], 'planted': [303], 'FPS': [306, 555], '2001.': [309], 'confirm': [311, 403], 'results,': [314], 'fresh': [315, 406], 'samples': [318], 'collected': [320, 410], '6': [323, 359, 1347], 'this': [326, 511, 547], 'selection': [327], 'collection,': [330, 556], 'total': [332, 417], 'isolated': [334], 'each': [336], 'screened': [338], 'RT-PCR.': [340], 'reaction': [342], 'used': [343], 'two': [344], 'sets': [345], 'GPGV-specific': [347], 'primer': [348], 'pairs': [349], 'as': [350, 532, 752], 'described': [351], 'Saldarelli': [353], '(2015).': [356], 'Of': [357], 'plant': [364, 561], 'which': [365, 456], 'tested': [366], 'previously': [368], 'specific': [370, 535], 'DNA': [371], 'fragments': [372], 'expected': [375], 'sizes': [376], '(588': [377], 'bp': [378], '525': [380], 'bp,': [381], 'respectively).': [382], 'PCR': [383], 'products': [384], 'directly': [386], 'sequenced': [387], 'found': [389, 492], '99%': [392, 478], 'identical': [393], 'sequences': [396], 'currently': [397], 'available': [398, 484], 'GenBank.': [400, 487], 'further': [402], 'result,': [405], 'Touriga': [414], 'Nacional': [415], 'vine,': [416], 'nucleic': [418], 'acid': [419], 'HTS': [425], 'at': [426], 'SeqMatic': [428], 'LLC': [429], '(Fremont,': [430], 'CA)': [431], 'sequencing': [432], 'facility': [433], 'half': [435], 'lane': [436], 'on': [437, 607], 'Illumina': [439, 449], 'NextSEquation': [440], '500': [441], 'platform.': [442], 'analysis': [444, 498, 537], 'generated': [445], 'approximately': [446], '410': [447], 'million': [448], 'reads': [450, 460], '(∼75': [451], 'nt': [452], 'length)': [454], 'more': [457], 'than': [458], '209,000': [459], 'mapped': [462], 'genome.': [466], 'Californian': [468], 'isolate': [470], '"GPGV-TN"': [471], '(7,197': [472], 'nt,': [473], 'KT894101)': [474], 'shared': [475], '93': [476], 'identity': [479], 'isolates': [483, 1042, 1120], 'No': [488], 'viruses': [490, 898, 919], 'sample;': [495], 'however,': [496], 'BLAST': [497], 'showed': [499], 'yellow': [504], 'speckle': [505], 'viroid': [506], '1.': [507], 'our': [509], 'knowledge,': [510], 'report': [515], 'States.': [521], 'There': [522], 'no': [524], 'indication': [525], 'active': [527], 'spread': [528, 569], 'assessed': [533], '20': [540], 'surrounding': [542], 'infected': [544], 'vine.': [545], 'Given': [546], 'very': [548], 'low': [549], 'confined': [557], 'single': [560], 'cultivar,': [564], 'risk': [566], 'commercial': [571, 583, 1069], 'vineyards': [572, 584, 1070], 'could': [573], 'considered': [575], 'low.': [576], 'However,': [577], 'larger': [579], 'scale': [580], 'survey': [581], 'needed': [586], 'determine': [588], 'California.': [594], 'Further': [595], 'research': [596], 'also': [597], 'should': [598], 'conducted': [600], 'evaluate': [602], 'effect': [604], 'performance': [609], 'quality.References:Giampetruzzi,': [612], 'A.,': [613], '2012.': [616], 'Virus': [617, 703, 831, 950, 1155], 'Res.': [618], '163:262.': [619], 'https://doi.org/10.1016/j.virusres.2011.10.010': [620], 'Crossref,': [621], 'ISI,': [622, 633], 'Google': [623, 634], 'ScholarSaldarelli,': [624], 'P.,': [625], '2015.': [628], 'Phytopathology': [629], '105:555.': [630], 'https://doi.org/10.1094/PHYTO-09-14-0241-R': [631], 'Link,': [632], 'ScholarDetailsFiguresLiterature': [635], 'CitedRelated': [636], 'Vol.': [637, 692, 710, 737, 763, 801, 818, 857, 868, 886, 910, 929, 973, 1020, 1031, 1063, 1082, 1109, 1139, 1157, 1184, 1212, 1239, 1257, 1279, 1309, 1344], '5': [640], 'May': [641, 1026, 1077, 1101, 1304], '2016SubscribeISSN:0191-2917e-ISSN:1943-7692': [642], 'Metrics': [643], 'Article': [644], 'History': [645, 985], 'Issue': [646, 861, 1024], 'Date:': [647], '15': [648], 'Apr': [649], '2016Published:': [650], '4': [651], '2016First': [653], 'Look:': [654], '19': [655], 'Dec': [656, 659], '2015Accepted:': [657], '10': [658], '2015': [660], 'Pages:': [661], '1030-1030': [662], 'Information©': [663], '2016': [664, 1232, 1274, 1305, 1340], 'American': [666], 'Phytopathological': [667], 'SocietyCited': [668], 'byThe': [669], 'conundrum': [670], 'connection': [673], 'mottling': [683], 'deformation': [685], 'syndrome19': [686], 'November': [687, 852], '2022': [688, 707], '|': [689, 708, 732, 757, 798, 816, 854, 865, 884, 904, 924, 968, 1017, 1028, 1059, 1079, 1103, 1132, 1154, 1177, 1209, 1233, 1275, 1306, 1341], '72,': [693], '2Occurrence': [695], 'Genetic': [697, 975], 'Characterization': [698], 'Gris': [702, 746, 949], 'Russia13': [705], 'April': [706, 1057, 1207], 'Plants,': [709, 885], '11,': [711], '8Modifications': [713], 'Berry': [716], 'Composition': [717], 'Induced': [718], 'Main': [720], 'Fungal': [723], 'Pathogens': [724], 'Climate': [727], 'Change': [728], 'Scenario8': [729], 'December': [730, 863, 882], '2021': [731, 756, 797, 815, 853, 864], 'Frontiers': [733, 969], 'Science,': [736, 972], '12Evidence': [738], 'differential': [740], 'spreading': [741], 'events': [742], 'pinot': [745], 'Italy': [749, 1045], 'datamining': [751], 'tool26': [754], 'August': [755], 'European': [758, 1104, 1234], 'Journal': [759, 906, 925, 1105, 1133, 1178, 1235], '161,': [764, 1280], '3Identification': [766], 'Free-Living': [773], 'Vitis': [774], 'spp.': [775], 'Located': [776], 'Riparian': [778], 'Areas': [779], 'Adjacent': [780], 'Commercial': [782, 1319], 'VineyardsAlfredo': [783], 'Diaz-Lara,': [784], 'Gerald': [785], 'S.': [786], 'Dangl,': [787], 'Judy': [788], 'Yang,': [789], 'Deborah': [790], 'Maher': [793, 1195], 'Rwahnih6': [795], 'October': [796], 'Disease,': [800, 1211, 1308, 1343], '105,': [802], '9Reliable': [804], 'Methodologies': [805], 'Impactful': [807], 'Tools': [808], 'Control': [810], 'Fruit': [811], 'Tree': [812], 'Viruses19': [813], 'June': [814, 1088, 1152, 1231, 1273], 'Crops,': [817], '1,': [819], '1Biological': [821], 'Evidence': [822], 'Molecular': [824], 'Modeling': [825], 'Outbreak': [832], 'VineyardJean-Michel': [835], 'Hily,': [836, 997], 'Véronique': [837], 'Komar,': [838], 'Nils': [839, 998], 'Poulicard,': [840, 999], 'Emmanuelle': [841, 1002], 'Vigne,': [842, 1003], 'Olivier': [843, 850, 1013], 'Jacquet,': [844], 'Nathalie': [845], 'Protet,': [846], 'Anne-Sophie': [847, 1010], 'Spilmont,': [848, 1011], 'Lemaire23': [851], 'Phytobiomes': [855, 866, 1018, 1029], 'Journal,': [856, 867, 1019, 1030], '5,': [858, 869], '4Full': [860], 'PDF30': [862], '4Predominance': [871], 'Diversity': [873, 976, 1188], 'GLRaV-3': [875], 'Native': [877], 'Vines': [878], 'Mediterranean': [880], 'Croatia24': [881], '2020': [883, 903, 923, 967, 1016, 1027], '10,': [887], '1Disease': [889], 'incidence': [890], 'genetic': [892, 1116], 'variability': [893, 1117], 'economically': [895], 'important': [896], 'Nova': [900], 'Scotia19': [901], 'March': [902, 966, 1015, 1339], 'Canadian': [905], '42,': [911], '4Believing': [913], 'seeing:': [915], 'lessons': [916], 'emerging': [918, 1055], 'grapevine25': [921, 1272], 'January': [922], '102,': [930], '3With': [932], 'or': [933], 'Without': [934], 'You:': [935], 'Altered': [936], 'Response': [938], 'Boron-Deficiency': [940], 'Hydroponically': [942], 'Grown': [943], 'Grapevines': [944], 'Infected': [945], 'Suggests': [951], 'Relation': [953], 'Between': [954], 'Leaf': [956], 'Mottling': [957], 'Deformation': [959], 'Symptom': [960], 'Occurrence': [961], 'Boron': [963], 'Availability3': [965], '11Datamining,': [974], 'Analyses,': [977], 'Phylogeographic': [979], 'Reconstructions': [980], 'Redefine': [981], 'Worldwide': [983], 'Evolutionary': [984], 'berry': [993], 'inner': [994], 'necrosis': [995], 'virusJean-Michel': [996], 'Thierry': [1000], 'Candresse,': [1001], 'Monique': [1004], 'Beuve,': [1005], 'Lauriane': [1006], 'Renault,': [1007], 'Amandine': [1008], 'Velt,': [1009], 'Lemaire19': [1014], '4,': [1021, 1032], '2Full': [1023], 'PDF18': [1025], '2Analysis': [1034], 'Northeast': [1044], 'provides': [1046], 'clues': [1047], 'track': [1049], 'evolution': [1051], 'newly': [1054], 'clade2': [1056], '2019': [1058, 1078], 'Archives': [1060, 1276], 'Virology,': [1062, 1278], '164,': [1064], '6Virus': [1066], 'surveys': [1067], 'show': [1071], 'value': [1072], 'planting': [1074], 'vines1': [1076], 'California': [1080], 'Agriculture,': [1081], '73,': [1083], '2Vitis': [1085], 'vinifera': [1086], '(Grape)6': [1087], '2020Survey': [1089], 'stocks': [1098], 'Ukraine5': [1100], '2018': [1102, 1131], '152,': [1110], '2Incidence,': [1112], 'distribution': [1113], 'limited': [1115], 'among': [1118], 'Turkish': [1119], 'different': [1127], 'cultivars5': [1129], 'July': [1130, 1219], 'Diseases': [1136, 1181], 'Protection,': [1138, 1183], '125,': [1140], '5The': [1142], 'recent': [1143], 'importation': [1144], 'into': [1150], 'Australia13': [1151], '2017': [1153, 1176, 1208], 'Genes,': [1156], '53,': [1158], '6Occurrence': [1160], 'Poland': [1167], 'description': [1169], 'exhibitions': [1172], 'grapevines13': [1174], 'February': [1175], '124,': [1185], '4Viral': [1187], 'Autochthonous': [1190], 'Croatian': [1191], 'CultivarsDarko': [1193], 'Vončina,': [1194], 'Adib': [1198], 'Rowhani,': [1199], 'Mona': [1200], 'Gouran,': [1201], 'Rodrigo': [1203], 'P.': [1204, 1205], 'Almeida27': [1206], '101,': [1213], '7Grapevine': [1215], 'virus6': [1218], '2017Identification': [1220], 'herbaceous': [1222], 'hosts': [1223], '(GPGV)28': [1230], '147,': [1240], '1GRAPEVINE': [1242], 'VIRUS': [1243], 'DISEASES:ECONOMIC': [1244], 'IMPACT': [1245], 'AND': [1246, 1252], 'CURRENT': [1247], 'ADVANCES': [1248], 'IN': [1249], 'VIRAL': [1250], 'PROSPECTION': [1251], 'MANAGEMENTRevista': [1253], 'Brasileira': [1254], 'de': [1255], 'Fruticultura,': [1256], '39,': [1258], '1Transmission': [1260], 'Colomerus': [1267], 'vitis': [1268], '(Acari:': [1269], 'Eriophyidae)': [1270], '9First': [1282], 'British': [1290], 'Columbia,': [1291], 'CanadaS.': [1292], 'Poojari,': [1293], 'T.': [1294], 'Lowery,': [1295], 'Rott,': [1297], 'A-M.': [1298], 'Schmidt,': [1299], 'J.': [1301, 1328, 1334], 'R.': [1302], 'Úrbez-Torres5': [1303], '7Occurrence': [1312], 'Vineyards': [1320], 'StatesE.': [1324], 'Angelini,': [1325], 'N.': [1326], 'Bertazzon,': [1327], 'Montgomery,': [1329], 'X.': [1330], 'Wang,': [1331], 'Zinkl,': [1333], 'Stamp,': [1335], 'Wei23': [1338]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2221012970', 'counts_by_year': [{'year': 2024, 'cited_by_count': 1}, {'year': 2023, 'cited_by_count': 2}, {'year': 2022, 'cited_by_count': 3}, {'year': 2021, 'cited_by_count': 7}, {'year': 2020, 'cited_by_count': 9}, {'year': 2019, 'cited_by_count': 4}, {'year': 2018, 'cited_by_count': 2}, {'year': 2017, 'cited_by_count': 6}, {'year': 2016, 'cited_by_count': 4}], 'updated_date': '2024-09-17T05:37:10.001759', 'created_date': '2016-06-24'}