Publication Information

{'id': 'https://openalex.org/W2166576789', 'doi': 'https://doi.org/10.1074/jbc.m312439200', 'title': 'Myeloid Elf-1-like Factor, an ETS Transcription Factor, Up-regulates Lysozyme Transcription in Epithelial Cells through Interaction with Promyelocytic Leukemia Protein', 'display_name': 'Myeloid Elf-1-like Factor, an ETS Transcription Factor, Up-regulates Lysozyme Transcription in Epithelial Cells through Interaction with Promyelocytic Leukemia Protein', 'publication_year': 2004, 'publication_date': '2004-04-01', 'ids': {'openalex': 'https://openalex.org/W2166576789', 'doi': 'https://doi.org/10.1074/jbc.m312439200', 'mag': '2166576789', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/14976184'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m312439200', 'pdf_url': 'http://www.jbc.org/article/S0021925819754726/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819754726/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5056023717', 'display_name': 'Mary Ann Suico', 'orcid': 'https://orcid.org/0000-0002-6751-8352'}, 'institutions': [{'id': 'https://openalex.org/I96036126', 'display_name': 'Kumamoto University', 'ror': 'https://ror.org/02cgss904', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I96036126']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Mary Ann Suico', 'raw_affiliation_strings': ['Department of Molecular Medicine, Faculty of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto 862-0973, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Medicine, Faculty of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto 862-0973, Japan', 'institution_ids': ['https://openalex.org/I96036126']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5046136308', 'display_name': 'Hiroki Yoshida', 'orcid': 'https://orcid.org/0000-0003-3447-117X'}, 'institutions': [{'id': 'https://openalex.org/I96036126', 'display_name': 'Kumamoto University', 'ror': 'https://ror.org/02cgss904', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I96036126']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Hiroki Yoshida', 'raw_affiliation_strings': ['Department of Molecular Medicine, Faculty of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto 862-0973, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Medicine, Faculty of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto 862-0973, Japan', 'institution_ids': ['https://openalex.org/I96036126']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5101484280', 'display_name': 'Yoshiyuki Seki', 'orcid': 'https://orcid.org/0000-0001-5745-5549'}, 'institutions': [{'id': 'https://openalex.org/I96036126', 'display_name': 'Kumamoto University', 'ror': 'https://ror.org/02cgss904', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I96036126']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Yoshiyuki Seki', 'raw_affiliation_strings': ['Department of Molecular Medicine, Faculty of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto 862-0973, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Medicine, Faculty of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto 862-0973, Japan', 'institution_ids': ['https://openalex.org/I96036126']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5008801126', 'display_name': 'Tomoko Uchikawa', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I96036126', 'display_name': 'Kumamoto University', 'ror': 'https://ror.org/02cgss904', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I96036126']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Tomoko Uchikawa', 'raw_affiliation_strings': ['Department of Molecular Medicine, Faculty of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto 862-0973, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Medicine, Faculty of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto 862-0973, Japan', 'institution_ids': ['https://openalex.org/I96036126']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5100312013', 'display_name': 'Zhuo Lü', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I96036126', 'display_name': 'Kumamoto University', 'ror': 'https://ror.org/02cgss904', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I96036126']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Zhuo Lu', 'raw_affiliation_strings': ['Department of Molecular Medicine, Faculty of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto 862-0973, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Medicine, Faculty of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto 862-0973, Japan', 'institution_ids': ['https://openalex.org/I96036126']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5059688088', 'display_name': 'Tsuyoshi Shuto', 'orcid': 'https://orcid.org/0000-0003-1275-4988'}, 'institutions': [{'id': 'https://openalex.org/I96036126', 'display_name': 'Kumamoto University', 'ror': 'https://ror.org/02cgss904', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I96036126']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Tsuyoshi Shuto', 'raw_affiliation_strings': ['Department of Molecular Medicine, Faculty of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto 862-0973, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Medicine, Faculty of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto 862-0973, Japan', 'institution_ids': ['https://openalex.org/I96036126']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5101023340', 'display_name': 'Kazuhito Matsuzaki', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I96036126', 'display_name': 'Kumamoto University', 'ror': 'https://ror.org/02cgss904', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I96036126']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Kazuhito Matsuzaki', 'raw_affiliation_strings': ['Department of Regeneration Medicine, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto 860-0811, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Regeneration Medicine, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto 860-0811, Japan', 'institution_ids': ['https://openalex.org/I96036126']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5036405854', 'display_name': 'Mitsuyoshi Nakao', 'orcid': 'https://orcid.org/0000-0002-2196-8673'}, 'institutions': [{'id': 'https://openalex.org/I96036126', 'display_name': 'Kumamoto University', 'ror': 'https://ror.org/02cgss904', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I96036126']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Mitsuyoshi Nakao', 'raw_affiliation_strings': ['Department of Regeneration Medicine, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto 860-0811, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Regeneration Medicine, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto 860-0811, Japan', 'institution_ids': ['https://openalex.org/I96036126']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5064765788', 'display_name': 'Jian‐Dong Li', 'orcid': 'https://orcid.org/0000-0002-5593-050X'}, 'institutions': [{'id': 'https://openalex.org/I1174212', 'display_name': 'University of Southern California', 'ror': 'https://ror.org/03taz7m60', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I1174212']}, {'id': 'https://openalex.org/I1310293346', 'display_name': 'House Clinic', 'ror': 'https://ror.org/02bsaqx63', 'country_code': 'US', 'type': 'nonprofit', 'lineage': ['https://openalex.org/I1310293346']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Jian-Dong Li', 'raw_affiliation_strings': ['Gonda Department of Cell and Molecular Biology, House Ear Institute, University of Southern California, Los Angeles, California 90057'], 'affiliations': [{'raw_affiliation_string': 'Gonda Department of Cell and Molecular Biology, House Ear Institute, University of Southern California, Los Angeles, California 90057', 'institution_ids': ['https://openalex.org/I1174212', 'https://openalex.org/I1310293346']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5053776224', 'display_name': 'Hirofumi Kai', 'orcid': 'https://orcid.org/0000-0001-9335-2424'}, 'institutions': [{'id': 'https://openalex.org/I96036126', 'display_name': 'Kumamoto University', 'ror': 'https://ror.org/02cgss904', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I96036126']}], 'countries': ['JP'], 'is_corresponding': True, 'raw_author_name': 'Hirofumi Kai', 'raw_affiliation_strings': ['Department of Molecular Medicine, Faculty of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto 862-0973, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Medicine, Faculty of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto 862-0973, Japan', 'institution_ids': ['https://openalex.org/I96036126']}]}], 'institution_assertions': [], 'countries_distinct_count': 2, 'institutions_distinct_count': 3, 'corresponding_author_ids': ['https://openalex.org/A5053776224'], 'corresponding_institution_ids': ['https://openalex.org/I96036126'], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 1.069, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 28, 'citation_normalized_percentile': {'value': 0.746102, 'is_in_top_1_percent': False, 'is_in_top_10_percent': False}, 'cited_by_percentile_year': {'min': 88, 'max': 89}, 'biblio': {'volume': '279', 'issue': '18', 'first_page': '19091', 'last_page': '19098'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T11559', 'display_name': 'Retinoids in leukemia and cellular processes', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T11559', 'display_name': 'Retinoids in leukemia and cellular processes', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10309', 'display_name': 'Acute Myeloid Leukemia Research', 'score': 0.9969, 'subfield': {'id': 'https://openalex.org/subfields/2720', 'display_name': 'Hematology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T10756', 'display_name': 'Estrogen and related hormone effects', 'score': 0.9858, 'subfield': {'id': 'https://openalex.org/subfields/1311', 'display_name': 'Genetics'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/promyelocytic-leukemia-protein', 'display_name': 'Promyelocytic leukemia protein', 'score': 0.8259187}, {'id': 'https://openalex.org/keywords/death-associated-protein-6', 'display_name': 'Death-associated protein 6', 'score': 0.585094}, {'id': 'https://openalex.org/keywords/transcription', 'display_name': 'Transcription', 'score': 0.5165345}, {'id': 'https://openalex.org/keywords/nuclear-export-signal', 'display_name': 'Nuclear export signal', 'score': 0.42244253}], 'concepts': [{'id': 'https://openalex.org/C1292079', 'wikidata': 'https://www.wikidata.org/wiki/Q3817769', 'display_name': 'Transactivation', 'level': 4, 'score': 0.90557325}, {'id': 'https://openalex.org/C111441629', 'wikidata': 'https://www.wikidata.org/wiki/Q18030615', 'display_name': 'Promyelocytic leukemia protein', 'level': 5, 'score': 0.8259187}, {'id': 'https://openalex.org/C86339819', 'wikidata': 'https://www.wikidata.org/wiki/Q407384', 'display_name': 'Transcription factor', 'level': 3, 'score': 0.79212856}, {'id': 'https://openalex.org/C81350143', 'wikidata': 'https://www.wikidata.org/wiki/Q5324485', 'display_name': 'ETS transcription factor family', 'level': 4, 'score': 0.6851985}, {'id': 'https://openalex.org/C29512474', 'wikidata': 'https://www.wikidata.org/wiki/Q16860021', 'display_name': 'Nuclear protein', 'level': 4, 'score': 0.6315253}, {'id': 'https://openalex.org/C89380225', 'wikidata': 'https://www.wikidata.org/wiki/Q14908178', 'display_name': 'Death-associated protein 6', 'level': 5, 'score': 0.585094}, {'id': 'https://openalex.org/C2780114586', 'wikidata': 'https://www.wikidata.org/wiki/Q40260', 'display_name': 'Cell nucleus', 'level': 3, 'score': 0.5392789}, {'id': 'https://openalex.org/C49805395', 'wikidata': 'https://www.wikidata.org/wiki/Q910966', 'display_name': 'Nuclear localization sequence', 'level': 3, 'score': 0.5380471}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.53102696}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.530964}, {'id': 'https://openalex.org/C179926584', 'wikidata': 'https://www.wikidata.org/wiki/Q207714', 'display_name': 'Transcription (linguistics)', 'level': 2, 'score': 0.5165345}, {'id': 'https://openalex.org/C2776601000', 'wikidata': 'https://www.wikidata.org/wiki/Q612108', 'display_name': 'Acute promyelocytic leukemia', 'level': 4, 'score': 0.43207836}, {'id': 'https://openalex.org/C2778729363', 'wikidata': 'https://www.wikidata.org/wiki/Q11688946', 'display_name': 'Myeloid leukemia', 'level': 2, 'score': 0.42969322}, {'id': 'https://openalex.org/C54757728', 'wikidata': 'https://www.wikidata.org/wiki/Q3511067', 'display_name': 'Nuclear export signal', 'level': 4, 'score': 0.42244253}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.36722308}, {'id': 'https://openalex.org/C502942594', 'wikidata': 'https://www.wikidata.org/wiki/Q3421914', 'display_name': 'Cancer research', 'level': 1, 'score': 0.30048472}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.2951805}, {'id': 'https://openalex.org/C2780723820', 'wikidata': 'https://www.wikidata.org/wiki/Q1934178', 'display_name': 'Nucleus', 'level': 2, 'score': 0.27892706}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.16756663}, {'id': 'https://openalex.org/C2781121885', 'wikidata': 'https://www.wikidata.org/wiki/Q425517', 'display_name': 'Retinoic acid', 'level': 3, 'score': 0.07172194}, {'id': 'https://openalex.org/C41895202', 'wikidata': 'https://www.wikidata.org/wiki/Q8162', 'display_name': 'Linguistics', 'level': 1, 'score': 0.0}, {'id': 'https://openalex.org/C138885662', 'wikidata': 'https://www.wikidata.org/wiki/Q5891', 'display_name': 'Philosophy', 'level': 0, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D004847', 'descriptor_name': 'Epithelial Cells', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D009113', 'descriptor_name': 'Muramidase', 'qualifier_ui': 'Q000096', 'qualifier_name': 'biosynthesis', 'is_major_topic': True}, {'descriptor_ui': 'D014157', 'descriptor_name': 'Transcription Factors', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D014158', 'descriptor_name': 'Transcription, Genetic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D000595', 'descriptor_name': 'Amino Acid Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001665', 'descriptor_name': 'Binding Sites', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002467', 'descriptor_name': 'Cell Nucleus', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D002467', 'descriptor_name': 'Cell Nucleus', 'qualifier_ui': 'Q000648', 'qualifier_name': 'ultrastructure', 'is_major_topic': False}, {'descriptor_ui': 'D002467', 'descriptor_name': 'Cell Nucleus', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004847', 'descriptor_name': 'Epithelial Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006367', 'descriptor_name': 'HeLa Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009113', 'descriptor_name': 'Muramidase', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D009113', 'descriptor_name': 'Muramidase', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011485', 'descriptor_name': 'Protein Binding', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D021381', 'descriptor_name': 'Protein Transport', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014157', 'descriptor_name': 'Transcription Factors', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D014157', 'descriptor_name': 'Transcription Factors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015854', 'descriptor_name': 'Up-Regulation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m312439200', 'pdf_url': 'http://www.jbc.org/article/S0021925819754726/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/14976184', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m312439200', 'pdf_url': 'http://www.jbc.org/article/S0021925819754726/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'score': 0.5, 'id': 'https://metadata.un.org/sdg/3', 'display_name': 'Good health and well-being'}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 42, 'referenced_works': ['https://openalex.org/W1488915620', 'https://openalex.org/W1513261706', 'https://openalex.org/W1556421650', 'https://openalex.org/W1606273823', 'https://openalex.org/W1624238039', 'https://openalex.org/W1913862483', 'https://openalex.org/W1915306616', 'https://openalex.org/W1965388358', 'https://openalex.org/W1969499006', 'https://openalex.org/W1983043326', 'https://openalex.org/W1985534425', 'https://openalex.org/W1998475589', 'https://openalex.org/W2003525122', 'https://openalex.org/W2011340042', 'https://openalex.org/W2016344207', 'https://openalex.org/W2027048658', 'https://openalex.org/W2047119203', 'https://openalex.org/W2053742216', 'https://openalex.org/W2054311839', 'https://openalex.org/W2063822655', 'https://openalex.org/W2067200597', 'https://openalex.org/W2077389876', 'https://openalex.org/W2082214219', 'https://openalex.org/W2117568376', 'https://openalex.org/W2120699715', 'https://openalex.org/W2121930828', 'https://openalex.org/W2127707170', 'https://openalex.org/W2131137885', 'https://openalex.org/W2131713324', 'https://openalex.org/W2132979980', 'https://openalex.org/W2136163715', 'https://openalex.org/W2142218652', 'https://openalex.org/W2144563376', 'https://openalex.org/W2154416759', 'https://openalex.org/W2157944306', 'https://openalex.org/W2158385461', 'https://openalex.org/W2164285177', 'https://openalex.org/W2168524285', 'https://openalex.org/W2417616012', 'https://openalex.org/W2466072550', 'https://openalex.org/W4213068446', 'https://openalex.org/W4254120264'], 'related_works': ['https://openalex.org/W2176631207', 'https://openalex.org/W2166576789', 'https://openalex.org/W2121059558', 'https://openalex.org/W2119609890', 'https://openalex.org/W2089963703', 'https://openalex.org/W2089200829', 'https://openalex.org/W2048584065', 'https://openalex.org/W2010050464', 'https://openalex.org/W2003015138', 'https://openalex.org/W1547109494'], 'abstract_inverted_index': {'Myeloid': [0, 221, 1145], 'elf-1-like': [1, 222, 498, 1146], 'factor': [2, 14, 223, 235, 919, 1147, 1180, 1212], '(MEF)': [3, 224, 1148], 'or': [4, 43, 57, 225, 264, 278, 454, 1149, 1358, 1748, 1774, 1840, 1873, 2012, 2992, 3371, 3624, 3850, 4223, 4535, 4577, 5054], 'Elf4,': [5, 226, 1150], 'which': [6, 147, 227, 368, 969, 988, 1234, 1988, 2618, 2794, 2849, 2930, 3207, 3907, 4644, 4656, 4700, 4909], 'is': [7, 27, 37, 61, 68, 148, 228, 248, 258, 282, 289, 369, 536, 970, 989, 1151, 1161, 1214, 1227, 1235, 1270, 1350, 1408, 2699, 2810, 2931, 3644, 4027, 4039, 4094, 4110, 4204, 4554, 4645, 4657, 4734, 4843, 5146, 5198], 'a': [8, 229, 447, 587, 651, 927, 983, 1210, 1607, 1624, 1689, 1734, 1775, 1821, 1970, 2030, 2038, 2130, 2306, 2352, 2403, 2421, 2462, 2493, 2497, 2932, 3049, 3337, 4030, 4102, 4281, 4430, 4478, 4482, 4646, 4658, 5230], 'member': [9, 230, 4766, 5224], 'of': [10, 20, 63, 75, 82, 99, 122, 129, 136, 144, 156, 178, 190, 201, 207, 231, 241, 284, 296, 303, 320, 343, 350, 357, 365, 377, 399, 411, 422, 428, 450, 538, 593, 631, 650, 737, 871, 892, 929, 1034, 1134, 1156, 1177, 1219, 1225, 1276, 1395, 1433, 1692, 1700, 1719, 1736, 1777, 1824, 1865, 1932, 1940, 1947, 1950, 1954, 1959, 1973, 1983, 2068, 2106, 2109, 2113, 2118, 2133, 2269, 2274, 2464, 2496, 2521, 2560, 2576, 2592, 2599, 2609, 2674, 2697, 2717, 2726, 2770, 2784, 2792, 2804, 2822, 2866, 2891, 2902, 2910, 2913, 2935, 2938, 2973, 2978, 2982, 3026, 3035, 3051, 3057, 3072, 3083, 3103, 3107, 3271, 3279, 3299, 3305, 3316, 3325, 3374, 3387, 3399, 3414, 3461, 3481, 3516, 3537, 3550, 3567, 3595, 3621, 3634, 3671, 3703, 3826, 3852, 3954, 3962, 3997, 4005, 4078, 4082, 4267, 4286, 4323, 4336, 4357, 4393, 4429, 4456, 4492, 4521, 4540, 4560, 4579, 4612, 4641, 4714, 4755, 4804, 4881, 4889, 4918, 4988, 4993, 5036, 5042, 5168, 5191, 5203, 5217, 5271, 5280], 'the': [11, 17, 31, 64, 80, 97, 120, 134, 153, 163, 176, 179, 188, 205, 232, 238, 252, 285, 301, 318, 341, 355, 374, 384, 397, 400, 409, 426, 539, 629, 661, 887, 971, 992, 1175, 1217, 1223, 1230, 1273, 1354, 1392, 1411, 1442, 1585, 1592, 1646, 1713, 1769, 1944, 2017, 2052, 2065, 2103, 2162, 2303, 2372, 2485, 2511, 2522, 2538, 2544, 2558, 2565, 2573, 2577, 2606, 2619, 2636, 2640, 2645, 2672, 2694, 2715, 2727, 2761, 2767, 2778, 2782, 2790, 2798, 2807, 2819, 2867, 2888, 2894, 2899, 2907, 2911, 2944, 2951, 2971, 2976, 3007, 3022, 3027, 3033, 3055, 3060, 3070, 3091, 3101, 3108, 3120, 3184, 3200, 3212, 3225, 3268, 3277, 3288, 3302, 3306, 3314, 3317, 3359, 3368, 3384, 3397, 3411, 3459, 3464, 3473, 3479, 3492, 3514, 3546, 3551, 3578, 3592, 3613, 3618, 3635, 3650, 3700, 3823, 3952, 3955, 3966, 3972, 3995, 4022, 4043, 4076, 4079, 4091, 4123, 4166, 4213, 4248, 4264, 4284, 4315, 4320, 4352, 4389, 4420, 4444, 4447, 4457, 4463, 4471, 4489, 4496, 4510, 4517, 4522, 4536, 4557, 4606, 4638, 4652, 4693, 4707, 4711, 4753, 4763, 4826, 4858, 4865, 4887, 4904, 4916, 4967, 4986, 4991, 5034, 5040, 5060, 5110, 5157, 5166, 5169, 5175, 5189, 5201, 5214, 5218, 5269, 5276, 5292], 'ETS': [12, 233, 917, 962, 972, 975, 993, 1035, 1135, 1153, 2740, 4764, 5222], 'transcription': [13, 217, 234, 438, 918, 1211, 1432, 2167, 3504, 4097, 4222, 4287, 4394, 4809], 'family,': [15, 236], 'up-regulates': [16, 237, 1317, 1430], 'basal': [18, 239], 'expression': [19, 240, 1320, 1443, 2002, 2120, 2955, 2996, 3096, 3585, 3630, 3880, 3975, 4340, 5092, 5207], 'lysozyme': [21, 124, 145, 202, 216, 242, 345, 366, 423, 437, 1318, 1434, 2928, 2945, 2953, 2994, 3028, 3043, 3109, 3122, 3474, 3503, 3552, 3956, 3974, 4316, 4338, 4523, 4808, 4866, 5177, 5205], 'gene': [22, 243, 1319, 2001, 2622, 2934, 2954, 2995, 3361, 4339, 4524, 5171, 5178, 5206], 'in': [23, 30, 70, 86, 101, 119, 138, 192, 218, 244, 251, 291, 307, 322, 340, 359, 413, 439, 577, 584, 666, 712, 938, 1164, 1238, 1321, 1353, 1655, 1671, 1688, 1733, 1744, 1780, 1789, 1928, 1997, 2008, 2097, 2322, 2420, 2478, 2492, 2504, 2601, 2617, 2628, 2639, 2671, 2704, 2709, 2719, 2777, 2797, 2893, 2915, 3010, 3042, 3100, 3245, 3292, 3331, 3404, 3430, 3539, 3562, 3673, 3856, 3877, 3932, 3965, 3999, 4012, 4042, 4165, 4221, 4253, 4283, 4345, 4374, 4509, 4572, 4637, 4651, 4752, 4833, 4857, 5015, 5076, 5080, 5099, 5156, 5164, 5208, 5234, 5239, 5275], 'epithelial': [24, 219, 245, 440, 1322, 5209], 'cells': [25, 246, 1279, 1323, 1652, 1743, 1758, 1800, 1925, 2022, 2094, 2144, 2255, 2263, 2281, 2304, 2319, 2548, 2616, 2834, 3141, 3247, 3335, 3574, 3609, 3832, 3964, 3987, 4876, 4893, 5085, 5101], 'and': [26, 67, 73, 105, 108, 142, 171, 197, 247, 288, 294, 326, 329, 363, 392, 418, 473, 530, 586, 623, 732, 751, 883, 890, 926, 949, 1023, 1031, 1166, 1186, 1205, 1222, 1397, 1414, 1441, 1455, 1460, 1470, 1564, 1582, 1584, 1614, 1621, 1630, 1640, 1667, 1695, 1739, 1766, 1783, 1818, 1859, 1898, 1943, 1956, 2021, 2037, 2100, 2115, 2183, 2212, 2221, 2249, 2253, 2261, 2271, 2311, 2340, 2357, 2363, 2382, 2413, 2435, 2447, 2471, 2557, 2570, 2663, 2736, 2772, 2827, 2838, 2841, 2846, 2855, 2872, 2940, 3000, 3075, 3085, 3128, 3136, 3146, 3152, 3162, 3193, 3216, 3223, 3233, 3243, 3261, 3424, 3497, 3565, 3583, 3617, 3628, 3643, 3677, 3697, 3705, 3708, 3828, 3837, 3865, 3873, 3919, 3922, 4003, 4035, 4099, 4114, 4160, 4354, 4359, 4363, 4437, 4468, 4566, 4650, 4740, 4768, 4812, 4815, 4831, 4836, 4863, 4974, 4983, 5069, 5083, 5089, 5116, 5150, 5225, 5287], 'constitutively': [28, 249, 1351, 4040], 'localized': [29, 250, 1352, 2864, 4041, 4387, 5058], 'nucleus.': [32, 253], 'The': [33, 254, 442, 916, 2165, 2230, 2296, 2317, 2344, 2396, 2457, 2526, 2802, 2879, 3039, 3323, 3349, 3434, 4452, 4550, 4596, 4689, 4759], 'mammalian': [34, 180, 255, 401, 443, 589, 1573, 1596, 3289, 4375, 4453], 'cell': [35, 256, 444, 1632, 1642, 3202], 'nucleus': [36, 257, 445, 590, 1355, 2637, 4044, 4249], 'organized': [38, 259], 'into': [39, 260, 1591, 1623, 2614, 2666, 2806, 3059, 3463, 4891, 4903, 5044, 5059], 'distinct': [40, 261], 'nuclear': [41, 55, 58, 65, 84, 103, 140, 195, 211, 262, 276, 279, 286, 305, 324, 361, 416, 432, 452, 457, 494, 523, 527, 540, 595, 633, 739, 759, 878, 1138, 2668, 2721, 2779, 2877, 2895, 3062, 3406, 3432, 3466, 3541, 3859, 3898, 3941, 4001, 4104, 4124, 4167, 4215, 4255, 4269, 4511, 4738, 4859, 4899, 4905, 4970, 5012, 5158, 5194, 5273], 'domains': [42, 66, 263, 287, 453, 541, 1139, 2575, 4635], 'compartments': [44, 265], 'that': [45, 91, 106, 266, 312, 327, 1020, 1213, 1268, 1315, 1348, 1406, 1427, 1995, 2650, 2763, 2862, 2882, 3014, 3069, 3093, 3115, 3160, 3231, 3352, 3383, 3421, 3451, 3505, 3526, 3684, 3994, 4024, 4075, 4207, 4278, 4319, 4333, 4368, 4381, 4435, 4446, 4462, 4480, 4488, 4530, 4630, 4692, 4732, 4798, 4848, 4864, 4875, 4966, 4980, 5050, 5148, 5188], 'are': [46, 267, 625, 734, 2084, 2664, 3004, 3456, 3531, 3558, 3654, 4119, 4162, 4210, 4423, 4425, 4501, 4569, 4748], 'essential': [47, 268, 1215, 1271, 1657, 1746, 3457], 'for': [48, 133, 167, 269, 354, 388, 876, 1216, 1272, 1452, 1465, 1572, 1793, 1804, 1846, 1885, 2175, 2180, 2186, 2196, 2199, 2204, 2209, 2215, 2218, 2224, 2227, 2235, 2241, 2293, 2369, 2379, 2393, 2489, 2515, 3175, 3221, 3282, 3402, 3458, 3484, 3535, 3545, 3560, 3845, 4503, 4516, 4545, 4563, 5200, 5291], 'diverse': [49, 270, 3685], 'physiological': [50, 271, 466, 940, 4265], 'processes.': [51, 272], 'Promyelocytic': [52, 273], 'leukemia': [53, 274, 532, 669, 1241], '(PML)': [54, 275], 'body': [56, 85, 277, 306, 524, 4125, 4168, 4391], 'domain': [59, 280, 458, 528, 976, 4608, 4661, 4900, 4971], '10': [60, 281, 529, 1981, 4972], 'one': [62, 283, 537], 'involved': [69, 290, 3099], 'tumor': [71, 292, 881, 5240, 5277], 'suppression': [72, 293, 882, 5241], 'regulation': [74, 295, 885, 1133, 2673, 2977, 4285, 4754], 'transcription.': [76, 297], 'Here,': [77, 298], 'we': [78, 299, 2611, 2691, 2817, 3198, 3249, 3816, 3903, 4072, 4331, 4361, 4486, 4747, 4821, 5032], 'investigate': [79, 300, 1391, 2605], 'role': [81, 302, 4282, 5231], 'PML': [83, 102, 109, 139, 172, 194, 210, 304, 323, 330, 360, 393, 415, 431, 485, 570, 622, 632, 645, 731, 738, 758, 877, 1412, 1418, 1587, 1955, 2593, 2602, 2647, 2662, 2667, 2702, 2713, 2720, 2728, 2808, 2826, 2868, 2871, 2897, 2916, 2941, 2959, 3061, 3084, 3116, 3137, 3161, 3194, 3234, 3285, 3310, 3364, 3405, 3431, 3445, 3465, 3510, 3540, 3563, 3584, 3597, 3629, 3674, 3704, 3858, 3897, 3920, 3940, 4000, 4109, 4130, 4214, 4254, 4258, 4268, 4328, 4344, 4390, 4418, 4438, 4469, 4508, 4613, 4724, 4737, 4878, 4883, 4890, 4896, 4975, 4982, 4994, 5011, 5046, 5061, 5111, 5120, 5151, 5197, 5272], 'MEF': [87, 100, 107, 115, 130, 137, 157, 170, 191, 199, 208, 308, 321, 328, 336, 351, 358, 378, 391, 412, 420, 429, 1203, 1226, 1269, 1316, 1349, 1396, 1401, 1407, 1421, 2270, 2600, 2621, 2651, 2698, 2718, 2771, 2805, 2892, 2900, 2914, 2920, 2939, 2979, 2985, 2990, 3019, 3024, 3058, 3077, 3094, 3105, 3127, 3135, 3145, 3163, 3192, 3232, 3242, 3280, 3300, 3353, 3375, 3388, 3400, 3423, 3425, 3437, 3452, 3462, 3482, 3496, 3498, 3517, 3527, 3538, 3548, 3568, 3623, 3625, 3672, 3679, 3827, 3854, 3878, 3893, 3910, 3918, 3936, 3998, 4006, 4025, 4034, 4038, 4083, 4092, 4324, 4334, 4358, 4436, 4458, 4467, 4472, 4504, 4519, 4531, 4631, 4642, 4694, 4702, 4726, 4733, 4756, 4805, 4830, 4853, 5043, 5077, 5149, 5192, 5228], 'transactivation.': [88, 309, 1402, 2980], 'We': [89, 310, 1311, 1345, 1388, 1403, 2759, 2831, 2923, 2968, 3240, 3295, 3392, 3408, 3468, 4018, 4433, 4627, 4716, 4796, 4964, 5048, 5282], 'show': [90, 311], 'PML,': [92, 313, 490, 2114, 2837, 4360, 4699, 4914], 'but': [93, 314, 2594, 3248, 3543, 4107, 4250, 4494, 5118, 5237], 'not': [94, 315, 1141, 2004, 2787, 2987, 3017, 3079, 3251, 3265, 3379, 3512, 3533, 4426, 4495, 4718, 4840, 4855, 4911, 5119, 5232], 'Sp100,': [95, 316, 624, 2730, 4908], 'induced': [96, 187, 317, 408, 2714, 4011], 'accumulation': [98, 135, 189, 319, 356, 410, 2716, 2803, 2890, 2912, 3403, 3536, 3561, 3996], 'bodies': [104, 141, 196, 212, 325, 362, 417, 433, 596, 634, 760, 3063, 3542, 3860, 3899, 3942, 4002, 4216, 4256, 4270, 4512, 4739, 4860, 5013, 5062, 5195, 5274], 'physically': [110, 331, 1204, 1415], 'interacted.': [111, 332], 'This': [112, 333, 974, 3168, 3381, 3947, 5071, 5160, 5211], 'interaction': [113, 168, 334, 389, 1022, 1429, 2545, 3169, 3195, 3254, 3324, 4032, 4128, 4356, 4449, 4465, 4547, 4761, 4828, 5219], 'stimulated': [114, 335], 'transcriptional': [116, 337, 884, 1032, 2676, 2921, 4208, 4321, 5078], 'activity,': [117, 338], 'resulting': [118, 339, 659, 2670, 4751], 'up-regulation': [121, 143, 342, 364, 3953, 4520, 5167], 'endogenous': [123, 193, 344, 414, 2620, 2646, 2952, 2993, 3074, 3238, 3260, 3857, 3892, 3935, 3939, 3973, 4337, 4835, 5045, 5053, 5103, 5176], 'expression.': [125, 346], 'Amino': [126, 347], 'acids': [127, 160, 348, 381, 1474, 3355, 3427, 3439, 3454, 3500, 3519, 3529, 3556, 4474, 4533], '348-517': [128, 349, 3455, 3530, 3557, 4491], 'were': [131, 352, 1475, 1653, 1669, 1683, 1703, 1759, 1801, 1853, 1892, 1910, 1926, 2003, 2023, 2095, 2150, 2233, 2256, 2264, 2282, 2320, 2398, 2418, 2440, 2549, 2585, 2829, 2850, 3078, 3098, 3142, 3219, 3575, 3610, 3833, 3915, 4822], 'required': [132, 166, 353, 387, 3401, 3483, 3532, 3559, 5002], 'transcription,': [146, 367, 470], 'enhanced': [149, 198, 370, 419, 501, 3487, 3507, 3869, 4028, 4326], 'by': [150, 371, 1229, 1560, 2006, 2071, 2301, 2350, 2442, 2587, 2701, 2814, 2918, 2958, 2963, 3032, 3081, 3286, 3341, 3488, 3508, 3570, 3591, 3982, 4327, 4343, 4366, 4710, 5196], 'PML.': [151, 372, 2275, 2656, 2815, 3147, 3391, 3489, 3509, 3571, 4036, 4549, 5226], 'Moreover,': [152, 373, 2950, 4330, 4485], 'C-terminal': [154, 375, 3385, 4653, 4695, 4712], 'region': [155, 165, 376, 386, 3398, 3480, 4479, 4498, 4539, 4640, 4654, 4696, 4713], 'spanning': [158, 379], 'amino': [159, 380, 1158, 1458, 1473, 3354, 3426, 3438, 3453, 3499, 3518, 3528, 3555, 4473, 4532, 4551], '477-517': [161, 382], 'was': [162, 383, 646, 706, 1170, 1265, 1529, 1557, 1578, 1589, 1617, 1634, 1644, 1728, 1935, 1964, 1978, 2019, 2027, 2056, 2061, 2124, 2138, 2169, 2190, 2299, 2346, 2374, 2459, 2487, 2513, 2528, 2623, 2956, 3030, 3170, 3180, 3311, 3329, 3506, 3589, 3599, 3637, 3840, 3868, 3881, 4245, 4259, 4325, 4341, 4450, 4851, 5057, 5093], 'putative': [164, 385], 'between': [169, 390, 3126, 3255, 4033, 4466, 4762, 4829, 4969, 4981, 5220], 'as': [173, 394, 469, 648, 709, 744, 991, 1280, 1477, 2086, 2961, 3646, 3980, 4088, 4117, 4158, 4513, 4515, 4744, 5172, 5174], 'determined': [174, 395, 1281, 2818, 3638, 3817, 3981], 'with': [175, 396, 464, 654, 982, 1208, 1242, 1417, 1580, 1610, 1660, 1677, 1705, 1723, 1730, 1753, 1768, 1785, 1810, 1820, 1857, 1862, 1896, 1900, 1937, 1980, 2074, 2079, 2102, 2152, 2266, 2284, 2305, 2376, 2384, 2402, 2461, 2518, 2530, 2551, 2644, 2655, 2661, 2738, 2835, 2844, 2853, 2984, 3006, 3144, 3149, 3156, 3284, 3336, 3363, 3390, 3444, 3491, 3577, 3601, 3612, 3835, 3917, 3924, 4129, 4507, 4548, 4605, 4698, 4794, 4818, 4913], 'use': [177, 398], 'two-hybrid': [181, 402, 1574, 1597, 3290, 4454], 'system.': [182, 403], 'In': [183, 404, 3211, 4240, 5183], 'addition,': [184, 405], 'heat-shock': [185, 406, 3838, 3863, 3884, 3960, 3978, 5037], 'treatment': [186, 407, 2073, 3839, 3885, 3961, 3979, 5038], 'transactivation': [200, 421, 1422, 2991, 3025, 3044, 3106, 3486, 3549, 3569, 3867, 4007, 4026, 4335, 4634, 4648, 4660, 4757], 'gene.': [203, 424, 1435], 'Thus,': [204, 425, 5144], 'recruitment': [206, 427, 4576, 5190], 'to': [209, 430, 462, 575, 581, 627, 754, 757, 935, 978, 1173, 1390, 1410, 1419, 1712, 1741, 1968, 1993, 2076, 2128, 2161, 2348, 2449, 2536, 2734, 2775, 3119, 3132, 3182, 3275, 3301, 3313, 3347, 3395, 3442, 3477, 3896, 3938, 3951, 4014, 4089, 4122, 4212, 4218, 4224, 4388, 4505, 4603, 4736, 4788, 4824, 4845, 4995, 5003, 5073, 5193, 5266], 'may': [213, 434, 4542, 4729, 4976], 'partly': [214, 435, 4251, 4705], 'regulate': [215, 436, 1026], 'cells.': [220, 441, 2706, 3294, 3853, 3913, 4376, 5210], 'contains': [446, 591, 4481], 'large': [448], 'number': [449, 928], 'specialized': [451], 'compartments.': [455], 'Each': [456, 1976], 'has': [459, 873, 921, 1017, 1140, 2731, 4378, 4600, 4632, 4785], 'been': [460, 573, 874, 933, 1018, 1142, 2732, 3048, 4379, 4601, 4873], 'reported': [461, 574, 4602, 4760], 'relate': [463], 'various': [465, 1933, 2561, 3297, 3415], 'processes,': [467, 941], 'such': [468, 743, 4116, 4157, 4743], 'DNA': [471, 966, 980, 1027, 1732, 3303], 'replication': [472], 'pre-mRNA': [474], 'splicing': [475], '(1Spector': [476, 542], 'D.L.': [477, 543, 4406, 4617], 'J.': [478, 544, 565, 639, 724, 1063, 1195, 1251, 1297, 1338, 1494, 2684, 3791, 3808, 4589, 4932, 4957, 5025, 5137], 'Cell': [479, 545, 613, 768, 827, 863, 901, 1628, 1638, 2685, 3719, 3769, 3792, 3809, 4197, 4234, 4295, 4408, 4958, 5026, 5138], 'Sci.': [480, 546, 1124, 2686, 3793, 4180, 5027, 5139], '2001;': [481, 547, 566, 958, 1003, 2687, 3811], '114:': [482, 548, 2688], '2891-2893Google': [483, 549], 'Scholar).': [484, 569, 618, 644, 704, 729, 868, 915, 961, 1015, 1131, 1202, 1262, 1310, 1344, 1387, 1527, 2758, 3814, 4154, 4202, 4239, 4309, 4595, 4626, 4688, 4963, 5143], '1The': [486], 'abbreviations': [487], 'used': [488, 3181, 3199, 3220, 3904], 'are:': [489], 'promyelocytic': [491, 531, 668], 'leukemia;': [492], 'NB,': [493], 'bodies;': [495], 'MEF,': [496, 1951, 2110, 2610, 2793, 4493, 4541, 5051], 'myeloid': [497, 1240], 'factor;': [499], 'EGFP,': [500], 'green': [502, 520], 'fluorescent': [503, 521], 'protein;': [504], 'HEK,': [505], 'human': [506], 'embryonic': [507], 'kidney;': [508], 'PBS,': [509], 'phosphate-buffered': [510, 1790], 'saline;': [511], 'TRITC,': [512], 'tetramethylrhodamine': [513], 'B': [514, 5088], 'isothiocyanate;': [515], 'RT,': [516], 'reverse': [517, 2166], 'transcription;': [518], 'GFP,': [519], 'protein.': [522, 3309, 3322], '(also': [525], 'called': [526], 'protein': [533, 653, 1154, 1571, 2385, 3095, 3879, 4386, 4422, 4599], 'oncogenic': [534], 'domain)': [535, 2569, 4611], 'Scholar,': [550, 559, 605, 692, 773, 782, 809, 832, 906, 1006, 1047, 1067, 1082, 1093, 1110, 1500, 3724, 3751, 3774, 3797, 4187, 4300, 4937], '2Lamond': [551], 'A.I.': [552, 598], 'Earnshaw': [553, 599], 'W.C.': [554, 600], 'Science.': [555, 601], '1998;': [556, 602, 4184], '280:': [557, 603], '547-553Google': [558, 604], '3Dundr': [560], 'M.': [561, 784, 790, 792, 846, 857, 1051, 1538, 1548, 3726, 3732, 3734, 4587], 'Misteli': [562], 'T.': [563, 838, 1059, 1329, 1335, 1364, 1374, 1378, 1485, 1491, 1504, 1514, 1518, 1536, 4048, 4058, 4062, 4396, 4402, 4665, 4675, 4679, 4922, 4928, 4949, 5251], 'Biochem.': [564], '356:': [567], '297-310Google': [568], 'NBs': [571, 1413, 2809, 2917, 3564], 'have': [572, 932, 964, 1312, 3047, 4019, 4276, 4717], 'vary': [576], 'size': [578], 'from': [579, 660, 1282, 1619, 1636, 1645, 2051, 2140, 3204, 3658, 4499], '0.2': [580, 1938], '1.0': [582], 'μm': [583], 'diameter,': [585], 'typical': [588], '10-30': [592], 'these': [594, 930, 2876, 3112, 3256, 3326, 3991, 4369, 4819], '(2Lamond': [597], '4Zhong': [606], 'S.': [607, 636, 762, 794, 800, 844, 848, 861, 895, 1126, 1197, 1247, 1301, 1366, 1506, 1544, 3713, 3736, 3742, 4050, 4132, 4144, 4182, 4228, 4289, 4667], 'Salomoni': [608, 763, 896, 3714, 4229, 4290], 'P.': [609, 764, 775, 897, 908, 2749, 3715, 4230, 4291, 4775], 'Pandolfi': [610, 765, 776, 801, 898, 909, 1302, 3716, 3743, 4147, 4231, 4292], 'P.P.': [611, 766, 777, 802, 899, 910, 1303, 3717, 3744, 4148, 4232, 4293], 'Nat.': [612, 767, 826, 862, 900, 953, 998, 3718, 3768, 4149, 4233, 4294, 4407], 'Biol.': [614, 769, 828, 864, 902, 957, 1002, 1078, 1106, 1258, 1339, 1495, 2754, 3720, 3770, 3810, 4235, 4296, 4305, 4409, 4780, 4959], '2000;': [615, 770, 806, 903, 1012, 1044, 1079, 1089, 3721, 3748, 4236, 4297, 4410, 4590], '2:': [616, 771, 904, 959, 1004, 3722, 4237, 4298, 4411], 'E85-90Google': [617, 772, 905, 3723, 4238, 4299], 'Two': [619], 'major': [620, 2724], 'components,': [621], 'considered': [626], 'build': [628], 'framework': [630], '(5Muller': [635], 'Dejean': [637, 5290], 'A.': [638, 671, 813, 850, 1127, 1291, 1293, 1327, 1331, 1333, 1370, 1483, 1487, 1489, 1510, 1565, 3755, 4054, 4183, 4671, 5247, 5249, 5289], 'Virol.': [640], '1999;': [641, 701, 1064, 1107, 1259, 1341, 1497, 4151, 4623, 4960], '73:': [642], '5137-5143Google': [643], 'identified': [647], 'part': [649, 4220], 'fusion': [652, 1232, 1570, 1605, 3327], 'retinoic': [655], 'acid': [656, 4552], 'receptor': [657], 'α,': [658], 't(15;17)': [662], 'chromosomal': [663, 1244], 'translocation': [664, 1245, 3056, 3460, 4803, 5041], 'expressed': [665, 3645], 'acute': [667, 1239], '(6Kakizuka': [670], 'Miller': [672], 'Jr.,': [673, 678, 1100], 'W.H.': [674], 'Umesono': [675], 'K.': [676, 1534], 'Warrell': [677], 'R.P.': [679], 'Frankel': [680], 'S.R.': [681], 'Murty': [682], 'V.V.': [683], 'Dmitrovsky': [684], 'E.': [685, 798, 859, 1053, 3740], 'Evans': [686, 697, 4175], 'R.M.': [687, 698, 3786, 4176, 5132], 'Cell.': [688, 778, 911, 956, 1001, 1077, 1105, 1257, 2753, 4304, 4779], '1991;': [689], '66:': [690], '663-674Google': [691], '7Lin': [693], 'R.J.': [694], 'Egan': [695], 'D.A.': [696], 'Trends': [699], 'Genet.': [700, 4150], '15:': [702], '179-184Google': [703], 'Sp100': [705, 733, 1609, 1960, 2119, 2596, 2764, 2785, 2828, 2839, 2873, 2883, 2974, 2983, 3015, 3036, 3052, 3086, 3244, 4769, 4791, 4799, 4832, 4850, 4989, 5115], 'first': [707, 3409, 4073, 5215], 'characterized': [708], 'an': [710, 1152, 2153, 2739, 3253, 5074, 5221], 'autoantigen': [711], 'certain': [713], 'autoimmune': [714], 'disorders': [715], '(8Szostecki': [716], 'C.': [717, 788, 1295, 1299, 1337, 1493, 2745, 3730, 4136, 4138, 4771, 4926], 'Guldner': [718, 4923], 'H.H.': [719, 4924], 'Netter': [720], 'H.J.': [721, 1055], 'Will': [722, 822, 3764, 4929], 'H.': [723, 815, 817, 823, 1040, 1193, 1325, 1380, 1481, 1520, 1546, 3757, 3759, 3765, 4064, 4142, 4681, 4930, 5255], 'Immunol.': [725, 4933], '1990;': [726], '145:': [727], '4338-4347Google': [728], 'Although': [730, 4263], 'core': [735, 985], 'components': [736, 5113], 'bodies,': [740, 879, 2669, 4906], 'numerous': [741], 'proteins,': [742], 'p53,': [745], 'SUMO-1,': [746, 5117], 'CBP,': [747], 'HDAC,': [748], 'Daxx,': [749, 5114], 'pRB,': [750], 'HIPK2,': [752], 'seem': [753], 'transiently': [755, 3332], 'localize': [756, 3895, 4856], '(4Zhong': [761, 894, 3712, 4227, 4288], '9Salomoni': [774, 907], '2002;': [779, 829, 865, 912, 1307, 1384, 1524, 2755, 3771, 4068, 4306, 4685, 4781, 5258], '108:': [780, 913], '165-170Google': [781, 914], '10Pearson': [783, 3725], 'Carbone': [785, 3727], 'R.': [786, 1038, 3728], 'Sebastiani': [787, 3729], 'Cioce': [789, 3731], 'Fagioli': [791, 3733], 'Saito': [793, 843, 3735], 'Higashimoto': [795, 841, 3737], 'Y.': [796, 819, 842, 1061, 1189, 1253, 1288, 1372, 1376, 1512, 1516, 1540, 3738, 3761, 4056, 4060, 4673, 4677, 5243, 5253], 'Appella': [797, 858, 3739], 'Minucci': [799, 3741], 'Pelicci': [803, 3745], 'P.G.': [804, 3746], 'Nature.': [805, 3747], '406:': [807, 3749], '207-210Google': [808, 3750], '11Hofmann': [810, 3752], 'T.G.': [811, 3753], 'Moller': [812, 3754], 'Sirma': [814, 3756], 'Zentgraf': [816, 3758], 'Taya': [818, 3760], 'Droge': [820, 3762], 'W.': [821, 3763], 'Schmitz': [824, 3766], 'M.L.': [825, 3767], '4:': [830, 866, 3772], '1-10Google': [831, 3773], "12D'Orazi": [833], 'G.': [834, 853, 855, 1101, 1103, 1116, 4193, 5020], 'Cecchinelli': [835], 'B.': [836, 2751, 4777], 'Bruno': [837], 'Manni': [839], 'I.': [840, 3776, 5122], 'Gostissa': [845], 'Coen': [847], 'Marchetti': [849], 'Del': [851], 'Sal': [852], 'Piaggio': [854], 'Fanciulli': [856], 'Soddu': [860], '11-19Google': [867], 'A': [869, 3872, 5068], 'variety': [870], 'functions': [872, 4266], 'suggested': [875, 4277], 'including': [880, 942, 3688, 4907], 'through': [886, 1137, 4029, 4126], 'titration,': [888], 'modification,': [889], 'compartmentalization': [891], 'proteins': [893, 963, 1036, 1136, 2648, 2659, 3258, 3328, 3707, 4371, 4581, 4902, 4920, 4973], 'family': [920, 2741, 4765, 5223], 'more': [922, 3366, 3909], 'than': [923, 3367, 3911, 4979], '30': [924, 2176, 2294], 'members,': [925], 'factors': [931, 4098, 4209], 'shown': [934, 1019, 2085, 2627, 2708, 2733, 3931, 4874], 'play': [936, 4280], 'roles': [937], 'important': [939, 4544, 5199], 'cellular': [943, 3686, 5008], 'proliferation,': [944], 'differentiation,': [945], 'development,': [946], 'hematopoiesis,': [947, 1221], 'angiogenesis,': [948], 'transformation': [950], '(13Sharrocks': [951, 996], 'A.D.': [952, 997], 'Rev.': [954, 999], 'Mol.': [955, 1000, 1076, 1104, 1256, 2752, 4303, 4778], '827-837Google': [960, 1005], 'conserved': [965], 'binding': [967, 994, 3344], 'domain,': [968, 4649], 'domain.': [973, 4484], 'binds': [977], 'specific': [979], 'sequence': [981], 'variant': [984], 'motif': [986], 'GGA,': [987], 'known': [990], 'site': [995], '14Sementchenko': [1007], 'V.I.': [1008], 'Watson': [1009, 1041], 'D.K.': [1010, 1042], 'Oncogene.': [1011, 1043, 1198, 4622], '19:': [1013, 1045, 1108, 1260], '6533-6548Google': [1014], 'It': [1016, 1160, 1169, 4203, 4377, 4728, 4842, 4871], 'protein-protein': [1021, 4564], 'post-translational': [1024], 'modification': [1025, 4742], 'binding,': [1028], 'subcellular': [1029], 'localization,': [1030], 'activity': [1033, 1224, 2026, 2060, 2069, 2077, 2677, 2947, 3515, 3633, 4093, 4322, 4867, 5079], '(15Li': [1037], 'Pei': [1039], '6514-6523Google': [1046], '16Kim': [1048], 'W.Y.': [1049], 'Sieweke': [1050], 'Ogawa': [1052], 'Wee': [1054], 'Englmeier': [1056], 'U.': [1057, 1125, 4181], 'Graf': [1058], 'Ito': [1060], 'EMBO': [1062], '18:': [1065, 4624], '1609-1620Google': [1066], '17Goetz': [1068], 'T.L.': [1069, 1071], 'Gu': [1070], 'Speck': [1072], 'N.A.': [1073], 'Graves': [1074, 1085], 'B.J.': [1075, 1086, 1114], '20:': [1080], '81-90Google': [1081], '18Cowley': [1083], 'D.O.': [1084], 'Genes': [1087, 1549], 'Dev.': [1088], '14:': [1090, 4591], '366-376Crossref': [1091], 'Google': [1092, 4594], '19Le': [1094], 'Gallic': [1095], 'L.': [1096, 4134, 4191], 'Sgouras': [1097], 'D.': [1098, 2679, 4140, 4943], 'Beal': [1099], 'Mavrothalassitis': [1102], '4121-4133Google': [1109], '20Wood': [1111], 'L.D.': [1112], 'Irvin': [1113], 'Nucifora': [1115], 'Luce': [1117], 'K.S.': [1118], 'Hiebert': [1119], 'S.W.': [1120], 'Proc.': [1121, 4177], 'Natl.': [1122, 4178], 'Acad.': [1123, 4179], '2003;': [1128, 1551, 3794, 5028, 5140], '100:': [1129], '3257-3262Google': [1130], 'However,': [1132, 2781, 3021, 4886], 'studied': [1143], 'extensively.': [1144], 'composed': [1155], '663': [1157], 'acids.': [1159], 'widely': [1162], 'distributed': [1163, 2632, 2796, 4246], 'hematopoietic': [1165, 1178], 'non-hematopoietic': [1167], 'tissues.': [1168], 'initially': [1171], 'found': [1172, 1237, 1267, 1347, 4164, 4571, 4797], 'activate': [1174], 'promoters': [1176], 'growth': [1179], 'genes,': [1181], 'granulocyte': [1182], 'macrophage-colony': [1183], 'stimulating': [1184], 'factor,': [1185], 'interleukin-3': [1187], '(21Miyazaki': [1188], 'Sun': [1190], 'X.': [1191], 'Uchida': [1192], 'Zhang': [1194, 1250, 1296, 4141], 'Nimer': [1196, 1254, 1304], '1996;': [1199, 4199], '13:': [1200], '1721-1729Google': [1201], 'functionally': [1206, 5154], 'interacts': [1207, 1416, 3389, 4697], 'AML1,': [1209], 'development': [1218], 'definitive': [1220], 'repressed': [1228], 'AML1-ETO': [1231], 'protein,': [1233, 1606], 'specifically': [1236, 2812], 't(8;21)': [1243], '(22Mao': [1246], 'Frank': [1248], 'R.C.': [1249], 'Miyazaki': [1252, 1287], 'S.D.': [1255, 1305], '3635-3644Google': [1261], 'Recently,': [1263], 'it': [1264, 2063, 2774, 5145, 5262], 'also': [1266, 1346, 1530, 2969, 3235, 3544, 4163, 5094, 5238], 'proper': [1274], 'function': [1275, 3711, 5279], 'natural': [1277], 'killer': [1278], 'knock-out': [1283], 'mice': [1284], '(23Lacorazza': [1285], 'H.D.': [1286], 'Di': [1289], 'Cristofano': [1290], 'Deblasio': [1292], 'Hedvat': [1294], 'Cordon-Cardo': [1298], 'Mao': [1300], 'Immunity.': [1306], '17:': [1308], '437-449Google': [1309], 'previously': [1313, 1479, 1532, 4628], 'demonstrated': [1314, 2962, 4365], '(24Kai': [1324, 1480], 'Hisatsune': [1326, 1369, 1482, 1509, 4053, 4670, 5248], 'Chihara': [1328, 1484], 'Uto': [1330, 1486, 5246], 'Kokusho': [1332, 1488], 'Miyata': [1334, 1377, 1490, 1517, 4061, 4678], 'Basbaum': [1336, 1492], 'Chem.': [1340, 1496], '274:': [1342, 1498], '20098-20102Google': [1343, 1499], 'under': [1356, 3165, 3259, 5052, 5102], 'normal': [1357], 'stress': [1359, 3821], 'conditions': [1360, 3263, 4838, 5104], '(25Suico': [1361, 4045, 4662], 'M.A.': [1362, 1502, 4046, 4663, 5245], 'Koyanagi': [1363, 1503, 4047, 4664], 'Ise': [1365, 1505, 4049, 4666], 'Lu': [1367, 1507, 4051, 4668], 'Z.': [1368, 1508, 4052, 4615, 4669], 'Seki': [1371, 1511, 4055, 4672], 'Shuto': [1373, 1513, 4057, 4674, 5250], 'Isohama': [1375, 1515, 4059, 4676, 5252], 'Kai': [1379, 1519, 4063, 4680, 5254], 'Biochim.': [1381, 1521, 4065, 4682], 'Biophys.': [1382, 1522, 4066, 4683], 'Acta.': [1383, 1523, 4067, 4684], '1577:': [1385, 1525, 4069, 4686], '113-120Google': [1386, 1526, 4070, 4687], 'attempt': [1389], 'subnuclear': [1393, 2607, 2695, 2768, 2820, 3412, 3701, 3824, 4080, 4802], 'localization': [1394, 2696, 2769, 2791, 2821, 3413, 4081, 4105], 'how': [1398, 4090, 4723], 'this': [1399, 1428, 5005], 'regulates': [1400, 4725], 'report': [1404], 'here': [1405, 4021], 'recruited': [1409, 2665, 4211, 4735, 4894], 'enhance': [1420, 2989, 3513], 'potential.': [1423, 4758], 'Our': [1424, 4310], 'finding': [1425], 'shows': [1426], 'MEF-mediated': [1431, 4807], 'Plasmids—The': [1436], 'luciferase': [1437, 1992, 1999, 2053, 2059, 2589, 2925, 3470, 4311], 'reporter': [1438, 1941, 2000, 2553, 3338, 3360, 3475, 3615, 3967, 4317, 5170], 'plasmid': [1439, 1701, 1942, 2554, 3476, 3616], 'pGL2-lysozyme-luc': [1440, 3614], 'plasmids': [1444, 1934], 'pCB6-MEF;': [1445], 'pEGFP-MEF': [1446, 1770], 'full-length;': [1447], 'pEGFPMEF': [1448], 'deletion': [1449, 1462, 3581, 3626, 4459], 'mutants': [1450, 1463, 4460], 'coding': [1451, 1464], 'GFP-MEF': [1453, 1456, 2613, 2631, 2823, 2863, 3416, 3580, 3587, 4244], '1-517': [1454, 3428, 3501], '1-347': [1457, 3520], 'acids;': [1459], 'pM-MEF': [1461], 'GAL4-MEF': [1466, 1468, 1471], '306-663,': [1467], '292-476,': [1469], '477-663': [1472, 3356], 'cloned': [1476, 1531], 'described': [1478], '25Suico': [1501], 'pcDNA3-Flag-PML': [1528, 1576], '(26Matsuzaki': [1533], 'Minami': [1535], 'Tojo': [1537], 'Honda': [1539], 'Saitoh': [1541], 'N.': [1542, 4195, 4398, 4947], 'Nagahiro': [1543], 'Saya': [1545], 'Nakao': [1547], 'Cells.': [1550], '8:': [1552], '275-286Google': [1553], 'Scholar),': [1554, 2690, 4071, 5031, 5261], 'whereas': [1555, 2870, 3177], 'pSG5-Sp100': [1556, 1620, 5293], 'kindly': [1558], 'provided': [1559], 'Drs.': [1561], 'J.-S.': [1562, 5285], 'Seeler': [1563, 5286], 'Dejean.': [1566], 'To': [1567, 3189, 3889], 'generate': [1568], 'VP16-PML': [1569], 'assays,': [1575], 'vector': [1577, 1594, 1963, 1985, 2081, 2123], 'digested': [1579], 'BamHI': [1581], 'XbaI,': [1583], '2.0-kb': [1586], 'fragment': [1588], 'ligated': [1590, 1622], 'pACT': [1593, 1626], '(CheckMate': [1595], 'system,': [1598], 'Promega': [1599, 2045], 'Corp.,': [1600, 1708, 2454], 'Madison,': [1601, 1709], 'WI).': [1602], 'For': [1603, 2276], 'VP16-Sp100': [1604], 'PCR-generated': [1608], 'flanking': [1611], 'MluI': [1612], '(5′-end)': [1613], 'EcoRV': [1615], '(3′-end)': [1616], 'amplified': [1618], 'linearized': [1625], 'vector.': [1627], 'Culture': [1629, 1649], 'Transfections—HeLa': [1631], 'line': [1633, 1643], 'obtained': [1635], 'RIKEN': [1637], 'Bank': [1639], 'HEK293': [1641, 1668, 2254, 3205, 3246, 3905, 3914, 3963, 3986, 5084, 5100], 'American': [1647], 'Type': [1648], 'Collection.': [1650], 'HeLa': [1651, 2262, 2547, 2615, 2705, 2833, 3140, 3293, 3334, 3573, 3608, 3831, 3912, 5082], 'cultured': [1654], 'minimum': [1656, 1745], 'medium': [1658, 1675, 1747, 1752, 1903, 2018], 'supplemented': [1659, 1676], '10%': [1661, 1678], 'fetal': [1662, 1679, 1754], 'bovine': [1663, 1680, 1755, 1815], 'serum': [1664, 1725, 1816], '(BIOSOURCE': [1665], 'International)': [1666], 'grown': [1670, 1760, 2257], "Dulbecco's": [1672, 1749], 'modified': [1673, 1750, 4226], "Eagle's": [1674, 1751], 'serum.': [1681, 1756], 'Cells': [1682, 1852, 1891], 'maintained': [1684], 'at': [1685, 1796, 1807, 1849, 1888, 2172, 2193, 2290, 2390, 3237, 3842, 5162], '37': [1686], '°C': [1687, 2174, 2179, 2185, 2195, 2203, 2208, 2214, 2223, 2292, 2392, 3844], 'humidified': [1690], 'atmosphere': [1691], '5%': [1693, 2338, 2341, 2472], 'CO2': [1694], '95%': [1696], 'air.': [1697], 'Transient': [1698], 'transfections': [1699], 'DNAs': [1702], 'performed': [1704, 1936, 2151, 2924, 3469, 3841], 'Trans-IT-LT-1': [1706], '(Mirus': [1707], 'WI)': [1710], 'according': [1711, 2160], "manufacturer's": [1714, 2163], 'recommendations.': [1715], 'Specifically,': [1716], '3': [1717], 'μl': [1718], 'TransIT-LT-1': [1720], 'reagent': [1721], 'diluted': [1722, 2347], 'reduced': [1724], 'Opti-MEM': [1726], '(Invitrogen)': [1727], 'mixed': [1729], 'total': [1731], 'ratio': [1735], '1:3': [1737], '(DNA/LT-1)': [1738], 'applied': [1740], 'subconfluent': [1742], 'Immunofluorescence—HeLa': [1757], 'on': [1761, 2258, 2975, 4351, 5039], 'poly-l-lysine-coated': [1762], '35-mm': [1763], 'glass-bottomed': [1764], 'dishes': [1765, 2260], 'transfected': [1767, 2101, 2265, 2550, 2612, 3076, 3143, 3333, 3834], 'constructs': [1771, 2563, 2840, 3582, 3627], 'pcDNA3-Flag-PML,': [1772], 'pSG5-Sp100,': [1773], 'combination': [1776, 2559], 'these,': [1778], 'fixed': [1779], '3.7%': [1781], 'paraformaldehyde,': [1782], 'permeabilized': [1784], '0.5%': [1786, 2336, 2414], 'Triton': [1787], 'X-100': [1788], 'saline': [1791], '(PBS)': [1792], '15': [1794, 2205], 'min': [1795, 1806, 2198, 2226, 2381, 3847], 'room': [1797, 1808, 1850, 1889], 'temperature.': [1798, 1851, 1890], 'Fixed': [1799], 'subsequently': [1802, 2851, 4364], 'blocked': [1803, 2460], '60': [1805, 2207, 2430], 'temperature': [1809], 'PBS': [1811, 1858, 1897, 2465, 2479, 2505], 'containing': [1812, 2466, 2480, 2506], '1': [1813, 1847, 1886, 1957, 2141, 2197, 2200, 2228, 2278, 2490, 2516], 'mg/ml': [1814], 'albumin': [1817], 'incubated': [1819, 2375, 2488, 2514], '1:100': [1822, 1863], 'dilution': [1823, 1864, 2495, 2520], 'primary': [1825, 2498, 4558], 'antibody/rabbit': [1826], 'anti-MEF': [1827, 3157, 3173, 3217], '(Transgenic,': [1828], 'Inc.,': [1829, 1881], 'Kumamoto,': [1830], 'Japan),': [1831], 'mouse': [1832], 'anti-PML': [1833, 2845, 3150, 3178, 3215, 3602], '(Santa': [1834, 1843], 'Cruz': [1835, 1844], 'Biotechnology,': [1836], 'Santa': [1837], 'Cruz,': [1838], 'CA),': [1839], 'goat': [1841], 'anti-Sp100': [1842, 2847], 'Biotechnology)': [1845], 'h': [1848, 1887, 2491, 2517, 3640], 'washed': [1854, 1893, 2399], 'three': [1855, 1894, 2476, 2502], 'times': [1856, 1895, 2401], 'then': [1860, 2364, 2383], 'stained': [1861, 3600, 3916], 'fluorescein': [1866, 3925], 'isothiocyanate-conjugated': [1867], 'anti-rabbit,': [1868], 'TRITC-conjugated': [1869, 1871, 2856, 3927], 'anti-goat,': [1870], 'anti-mouse,': [1872], 'Cy5-conjugated': [1874], 'anti-mouse': [1875], 'secondary': [1876, 2524, 2857, 3928], 'antibody': [1877, 3151, 3158, 3174, 3179], '(Jackson': [1878], 'ImmunoResearch': [1879], 'Laboratories,': [1880, 1905], 'West': [1882], 'Grove,': [1883], 'PA)': [1884], 'mounted': [1899], 'Vectashield': [1901], 'mounting': [1902], '(Vector': [1904], 'Burlingame,': [1906], 'CA).': [1907], 'Immunofluorescence': [1908, 3418], 'analyses': [1909], 'carried': [1911, 2170, 2191], 'out': [1912, 2171, 2192], 'using': [1913, 2029, 2145, 2927, 3172, 3472, 3985, 4314], 'Fluoview': [1914], 'FV-500': [1915], 'confocal': [1916], 'laser': [1917], 'scanning': [1918], 'microscope': [1919], '(Olympus,': [1920], 'Tokyo,': [1921], 'Japan).': [1922], 'Luciferase': [1923, 2025, 3632], 'Assays—HeLa': [1924], 'seeded': [1927, 2096], '12-well': [1929], 'plates.': [1930], 'Co-transfection': [1931, 2937, 2981], 'μg': [1939, 1949, 1953, 1958, 2108, 2112, 2117, 2268, 2273], 'indicated': [1945, 2104, 3579, 3619, 4629], 'combinations': [1946, 2105, 3620], '0.1': [1948], '0.5': [1952], 'plasmids.': [1961, 2121, 3631], 'Empty': [1962, 2122], 'added': [1965, 2125], 'where': [1966, 2126], 'necessary': [1967, 2127, 4502], 'ensure': [1969, 2129], 'constant': [1971, 2131], 'amount': [1972, 2132], 'input': [1974, 2134], 'DNA.': [1975, 2135], 'sample': [1977, 2423], 'co-transfected': [1979, 2832, 3576, 3611], 'ng': [1982], 'phRG-TK': [1984], '(Promega': [1986, 2035, 2555], 'Corp.),': [1987], 'expresses': [1989], 'Renilla': [1990], 'reniformis': [1991], 'verify': [1994], 'differences': [1996, 2007], 'firefly': [1998], 'caused': [2005], 'transfection': [2009, 3642], 'efficiency.': [2010], 'Twenty-four': [2011], 'forty-eight': [2013], 'hours': [2014], 'after': [2015, 3641, 3862, 3883, 3900, 3944, 3959, 3977, 5063, 5096, 5180], 'transfection,': [2016], 'removed': [2020], 'harvested.': [2024], 'measured': [2028], 'Dual-Luciferase': [2031], 'Reporter': [2032], 'Assay': [2033], 'system': [2034], 'Corp.)': [2036, 2556], 'luminometer': [2039], '(Turner': [2040], 'Designs': [2041], 'Luminometer': [2042], 'Model': [2043], 'TD-20/20;': [2044], 'Corp.).': [2046], 'Absolute': [2047], 'light': [2048], 'emission': [2049], 'generated': [2050, 2070], 'enzyme': [2054], 'reaction': [2055, 2168, 2298], 'determined.': [2057], 'Relative': [2058], 'plotted;': [2062], 'represents': [2064], 'fold': [2066, 3647], 'induction': [2067], 'experimental': [2072], 'respect': [2075], 'associated': [2078], 'basic': [2080], 'alone.': [2082], 'Values': [2083, 3653], 'means': [2087, 3655], '±': [2088, 3656], 'S.E.': [2089, 2747, 3657, 4773], '(n': [2090], '=': [2091], '3).': [2092], 'RT-PCR—HeLa': [2093], '6-well': [2098], 'plates': [2099], '0.25': [2107], '1.25': [2111], '2.5': [2116], 'Total': [2136], 'RNA': [2137, 2154], 'extracted': [2139], '×': [2142, 2279], '106': [2143], 'Isogen': [2146], '(Nippongene).': [2147], 'RT-PCR': [2148, 2965, 3984, 4346], 'experiments': [2149, 3419, 4347], 'PCR': [2155, 2189], 'kit': [2156], '(ReverTra': [2157], 'Dash;': [2158], 'TOYOBO)': [2159], 'instructions.': [2164], '42': [2173, 3843], 'min,': [2177, 2182, 2371], '99': [2178], '5': [2181, 2187, 2285, 2333], '4': [2184, 2291, 2391], 'min.': [2188, 2295], '98': [2194, 2202], 'cycle,': [2201], 's,': [2206, 2211], '20': [2210, 2225, 2370, 2470], '74': [2213, 2222], '90': [2216, 2380, 3846], 's': [2217], '15-40': [2219], 'cycles,': [2220], 'cycle.': [2229], 'following': [2231], 'primers': [2232], 'used:': [2234], 'lysozyme:': [2236], '5′-primer,': [2237, 2244], 'CTTCTCGAGCTAGGCACTCTGACCTAGCAGT;': [2238], '3′-primer,': [2239, 2246], 'AAAAATTCTCGAGTTACACTCCACAACCTTG;': [2240], 'glyceraldehyde-3-phosphate': [2242], 'dehydrogenase:': [2243], 'CGGGAAGCTTGTGATCAATGG;': [2245], '(GGCAGTGATGGCATGGACTG.': [2247], 'Immunoprecipitation': [2248, 3148], 'Western': [2250, 3066, 3154], 'Blot': [2251], 'Analysis—HeLa': [2252], '10-cm': [2259], '1.5': [2267], '7.5': [2272], 'immunoprecipitation,': [2277, 3176], '107': [2280], 'treated': [2283, 2318], 'mm': [2286, 2309, 2313, 2326, 2329, 2334, 2355, 2359, 2406, 2409, 2428, 2431], 'dimethyl': [2287], '3,3′-dithiobispropionimidate-2-HCl': [2288], '(Sigma)': [2289], 'cross-linking': [2297], 'terminated': [2300], 'washing': [2302], 'buffer': [2307, 2324, 2353, 2404, 2424], '(150': [2308, 2325, 2354, 2405], 'NaCl': [2310, 2356], '100': [2312, 2427], 'Tris-HCl,': [2314, 2330, 2360, 2410, 2432], 'pH': [2315, 2331, 2361, 2411, 2433], '8.0).': [2316], 'lysed': [2321], 'lysis': [2323], 'NaCl,': [2327, 2407], '50': [2328, 2358, 2408], '8.0,': [2332, 2412], 'EDTA,': [2335], 'SDS,': [2337, 2426], 'deoxycholate,': [2339], 'Nonidet': [2342, 2415], 'P-40).': [2343, 2416], 'lysate': [2345], '1:5': [2349], 'adding': [2351], '8.0)': [2362], 'mildly': [2365], 'sonicated.': [2366], 'After': [2367, 2475, 2500], 'centrifuging': [2368], 'supernatant': [2373], 'appropriate': [2377], 'antibodies': [2378, 3218, 3921], 'G': [2386], 'beads': [2387, 2397], '(Amersham': [2388, 2534], 'Biosciences)': [2389, 2535], '2': [2394], 'h.': [2395], 'five': [2400, 3342], 'Immunoprecipitates': [2417], 'suspended': [2419], 'Laemmli': [2422], '(2%': [2425], 'dithiothreitol,': [2429], '6.8,': [2434], '0.001%': [2436], 'bromphenol': [2437], 'blue).': [2438], 'Samples': [2439], 'separated': [2441], '7.5%': [2443], 'SDS-polyacrylamide': [2444], 'gel': [2445], 'electrophoresis': [2446], 'transferred': [2448], 'polyvinylidene': [2450], 'difluoride': [2451], 'membranes': [2452], '(Millipore': [2453], 'Bedford,': [2455], 'MA).': [2456], 'membrane': [2458, 2486, 2512, 2527], 'solution': [2463], '0.05%': [2467, 2481, 2507], '(v/v)': [2468, 2482, 2508], 'Tween': [2469, 2483, 2509], 'nonfat': [2473], 'milk.': [2474], 'washes': [2477, 2503], '20,': [2484, 2510], '1:200': [2494], 'antibody.': [2499, 2525, 3603], 'another': [2501], '1:10,000': [2519], 'corresponding': [2523], 'reacted': [2529], 'chemiluminescence': [2531], 'regent': [2532], 'ECL': [2533], 'visualize': [2537], 'blots.': [2539], 'Mammalian': [2540], 'Two-hybrid': [2541], 'Assays—For': [2542], 'mapping': [2543], 'region,': [2546], 'pG5-luc': [2552], 'pm-MEF': [2562], '(containing': [2564, 2572], 'yeast': [2566, 3307], 'GAL4': [2567, 3308, 3343], 'DNA-binding': [2568], 'pACT-PML': [2571], 'activation': [2574, 3648, 4708], 'Herpes': [2578, 3318], 'simplex': [2579, 3319], 'virus': [2580, 3320], 'VP16': [2581, 3321], 'protein).': [2582], 'Protein-protein': [2583], 'interactions': [2584, 4415], 'quantified': [2586], 'measuring': [2588], 'activities.': [2590], 'Overexpression': [2591], 'Not': [2595], 'Induces': [2597, 3669], 'Accumulation': [2598, 3670], 'Nuclear': [2603, 3675], 'Bodies—To': [2604], 'distribution': [2608, 3702, 3825], 'minimally': [2624], 'expressed.': [2625], 'As': [2626, 2707, 3930], 'Fig.': [2629, 2710, 2859, 3011, 3228, 3933], '1A,': [2630, 2711], 'itself': [2633], 'diffusely': [2634], 'throughout': [2635, 4247], 'except': [2638], 'nucleoli.': [2641], 'Simultaneous': [2642], 'staining': [2643], 'showed': [2649, 2861, 3068, 3230, 3351, 3420, 3683, 4318, 4461, 4487, 5049], 'only': [2652, 3534, 5233], 'slightly': [2653], 'co-localized': [2654], 'Because': [2657, 4037, 5007, 5227], 'several': [2658, 4580], 'interact': [2660, 2735, 3138, 4373, 4439, 4793, 4912, 5155], 'their': [2675, 3710, 4127], '(27Negorev': [2678], 'Ishov': [2680, 3779, 5125], 'A.M.': [2681, 3780, 4939, 5126], 'Maul': [2682, 3789, 4955, 5135], 'G.G.': [2683, 3790, 4956, 5136], '59-68Google': [2689], 'examined': [2692, 3410], 'whether': [2693, 3134, 3191, 3818, 3891, 4790], 'affected': [2700, 4800], 'overexpression': [2703, 2783, 2884, 3034, 3053, 4987], 'overexpressed': [2712, 3166, 3262, 4260, 4382, 4424], 'bodies.': [2722, 2780, 2878, 2896, 3407, 3433, 3467], 'Another': [2723], 'constituent': [2725], 'NBs,': [2729, 2869], 'co-localize': [2737, 4506], 'member,': [2742], 'ETS-1': [2743, 4767], '(28Wasylyk': [2744, 4770], 'Schlumberger': [2746, 4772], 'Criqui-Filipe': [2748, 4774], 'Wasylyk': [2750, 4776], '22:': [2756, 4307, 4782], '2687-2702Google': [2757, 4783], 'investigated': [2760, 2906, 2970, 5033], 'possibility': [2762, 3092, 4445], 'could': [2765, 3045, 3250, 4009, 4704], 'affect': [2766, 2887, 3018, 3709, 5010], 'induce': [2773], 'accumulate': [2776], 'did': [2786, 2986, 3016, 3511, 4854], 'significantly': [2788, 2988], 'change': [2789, 3876], 'remained': [2795], 'nucleoplasm': [2799], '(Fig.': [2800, 2948, 2966, 2997, 3037, 3064, 3087, 3187, 3376, 3446, 3521, 3870, 3886, 3969, 3988, 4261, 4348, 4441, 4476, 4525, 4861, 4869, 5066, 5086, 5105], '1B).': [2801], 'therefore': [2811, 4205], 'mediated': [2813, 4709], 'Next,': [2816], 'when': [2824, 4257, 4417, 4849], 'both': [2825, 3073, 4834, 5081], 'overexpressed.': [2830], 'GFP-MEF,': [2836, 3836], 'double-stained': [2842], 'them': [2843], 'antibodies,': [2848], 'immunolabeled': [2852, 3923], 'Cy5-': [2854], 'antibodies.': [2858, 3929], '1C': [2860], 'outside': [2865], 'merged': [2874], 'within': [2875], 'data': [2880, 3009, 3378, 3524, 4313, 5186], 'suggest': [2881, 3114, 3450, 3993, 4529, 5187], 'can': [2885, 3894, 3949, 4792, 5152], 'negatively': [2886], 'PML-induced': [2889], 'Enhanced': [2898, 3678], 'Transactivation': [2901], 'Lysozyme': [2903, 5091], 'Gene—We': [2904], 'next': [2905, 3130, 3273, 3393], 'functional': [2908, 4355], 'relevance': [2909], 'examining': [2919], 'activity.': [2922, 3830], 'assay': [2926, 3291, 3471, 3968, 4312], 'promoter,': [2929], 'target': [2933], 'MEF.': [2936, 3210, 4715, 4795, 4997, 5281], 'doubly': [2942], 'up-regulated': [2943, 3358, 3502, 4342, 5095], 'promoter': [2946, 3029, 3957], '2A).': [2949], 'increased': [2957, 3976], 'co-transfection': [2960, 3082], 'semi-quantitative': [2964, 3983], '2B).': [2967], 'involvement': [2972, 5270], '2,': [2998, 3088, 4813], 'C': [2999, 4814], 'D).': [3001, 4816, 5090], 'These': [3002, 3448, 3523, 4527], 'results': [3003, 3113, 3449, 3992, 4528], 'consistent': [3005], 'immunocytochemical': [3008], '1B': [3012, 4811], 'demonstrating': [3013], 'localization.': [3020], 'PML-enhanced': [3023, 3104, 3547, 4518], 'decreased': [3031, 4868], '2E).': [3038, 4870], 'observable': [3040, 4448], 'decrease': [3041], 'possibly': [3046], 'result': [3050, 3350, 3948], 'blocking': [3054], '1C).': [3065], 'blots': [3067], 'levels': [3071, 3097], 'altered': [3080, 3822], 'F-H),': [3089], 'excluding': [3090], 'changes': [3102], 'promoter.': [3110], 'Collectively,': [3111, 3990], 'positively': [3117], 'contributes': [3118], 'MEF-regulated': [3121, 5204], 'activation.': [3123], 'Physical': [3124], 'Interaction': [3125, 3269], 'PML—We': [3129], 'sought': [3131, 3274, 3394], 'determine': [3133, 3190, 3396, 3478, 3890], 'directly.': [3139], 'subsequent': [3153], 'blotting': [3155], 'revealed': [3159], 'interacted': [3164, 3236], 'conditions.': [3167], 'verified': [3171], 'probe': [3183], 'blotted': [3185, 3226], 'precipitates': [3186], '3A).': [3188], 'occurs': [3196], 'endogenously,': [3197], 'whole': [3201], 'extracts': [3203], 'cells,': [3206, 3906], 'highly': [3208], 'express': [3209, 3908], 'same': [3213], 'manner,': [3214], 'immunoprecipitation': [3222, 4367], 'probing': [3224], 'precipitates.': [3227], '3B': [3229], 'levels.': [3239], 'immunoprecipitated': [3241], 'detect': [3252, 4825], 'two': [3257, 4370, 4633], '(data': [3264, 4839], 'shown).': [3266, 3380, 4841], 'Mapping': [3267], 'Domain': [3270], 'MEF—We': [3272], 'map': [3276], 'region(s)': [3278], 'responsible': [3281], 'interacting': [3283], 'performing': [3287], 'fused': [3296, 3312], 'parts': [3298], 'binding-domain': [3304], 'activation-domain': [3315], 'tested': [3330], 'construct': [3339, 3370], 'driven': [3340], 'sites': [3345], 'linked': [3346], 'luciferase.': [3348], 'strongly': [3357], 'together': [3362], 'much': [3365], 'full-length': [3369, 3422, 3495, 3622], 'any': [3372], 'regions': [3373], '4B;': [3377], 'implied': [3382, 3525], 'portion': [3386], 'constructs.': [3417], 'accumulated': [3429, 3855, 4252], 'shorter': [3435], 'construct,': [3436], '1-347,': [3440, 4500], 'failed': [3441], 'colocalize': [3443], '5A).': [3447], 'its': [3485, 3829, 3866, 4546], 'Consistent': [3490, 4817], 'immunofluorescence': [3493, 4242], 'results,': [3494], '5B).': [3522], 'gene.Fig.': [3553], '5MEF': [3554], 'enhancement': [3566, 5202], 'A,': [3572], 'plasmid.': [3586], '(green)': [3588], 'detected': [3590], 'intrinsic': [3593], 'fluorescence': [3594], 'GFP.': [3596], '(red)': [3598], 'Yellow': [3604], 'indicates': [3605], 'co-localization.': [3606], 'B,': [3607], 'lysates': [3636], '48': [3639], 'over': [3649], 'empty': [3651], 'vectors.': [3652], 'triplicate': [3659], 'platings.View': [3660], 'Large': [3661], 'Image': [3662], 'Figure': [3663], 'ViewerDownload': [3664], '(PPT)': [3665], 'Heat': [3666, 5107], 'Shock': [3667], 'Stress': [3668], 'Bodies': [3676], 'Transactivation—Many': [3680], 'previous': [3681], 'studies': [3682, 4275, 4999], 'stresses,': [3687], 'viral': [3689], 'infection,': [3690], 'interferon,': [3691], 'heat': [3692, 3819, 3901, 3945, 4015, 5064, 5097, 5181], 'shock,': [3693, 3902], 'heavy': [3694], 'metals,': [3695], 'ultraviolet,': [3696], 'oncogenes,': [3698], 'alter': [3699], 'PML-associated': [3706], '29Nefkens': [3775], 'Negorev': [3777, 4942, 5123], 'D.G.': [3778, 5124], 'Michaelson': [3781, 5127], 'J.S.': [3782, 5022, 5128], 'Yeh': [3783, 4950, 5129], 'E.T.': [3784, 4951, 5130], 'Tanguay': [3785, 5131], 'Muller': [3787, 5133], 'W.E.': [3788, 5134], '116:': [3795, 5029, 5141], '513-524Google': [3796, 5142], '30Boisvert': [3798], 'F.M.': [3799], 'Kruhlak': [3800], 'M.J.': [3801, 3805], 'Box': [3802], 'A.K.': [3803], 'Hendzel': [3804], 'Bazett-Jones': [3806, 5023], 'D.P.': [3807, 5024], '152:': [3812], '1099-1106Google': [3813], 'Therefore,': [3815], 'shock': [3820, 4016, 5065, 5098, 5108], 'before': [3848], 'fixation': [3849], 'extraction': [3851], 'immediately': [3861, 3943], 'treatment,': [3864], '6,': [3871, 5067, 5087], 'B).': [3874], 'No': [3875], 'observed': [3882, 3958, 4380, 4416, 5179], '6B,': [3887], 'right).': [3888], 'isothiocyanate-and': [3926], '6C,': [3934], 'translocates': [3937], 'shock.': [3946, 5182], 'correlate': [3950], '6D).': [3970], 'Furthermore,': [3971], '6E).': [3989, 5106], 'increase': [4004, 5075], 'potential': [4008], 'be': [4010, 4225, 4543, 4730, 4977, 5001, 5264], 'response': [4013], 'stress.': [4017], 'presented': [4020], 'evidence': [4023], 'direct': [4031, 4827], 'proposed': [4074], 'elucidation': [4077], 'might': [4084], 'provide': [4085], 'valuable': [4086], 'information': [4087, 5216], 'regulated.': [4095], 'Various': [4096], 'co-factors': [4100, 4115], 'display': [4101], 'diffuse': [4103], 'pattern,': [4106], 'if': [4108], 'overexpressed,': [4111, 4852], 'progesterone': [4112], 'receptors': [4113], 'TIF1α': [4118], 'partially': [4120], 'shifted': [4121], '(31Zhong': [4131], 'Delva': [4133], 'Rachez': [4135], 'Cenciarelli': [4137], 'Gandini': [4139], 'Kalantry': [4143], 'Freedman': [4145], 'L.P.': [4146], '23:': [4152], '287-295Google': [4153], 'Transcriptional': [4155], 'regulators': [4156], 'p53': [4159], 'CBP': [4161], '(32LaMorte': [4169], 'V.J.': [4170], 'Dyck': [4171], 'J.A.': [4172], 'Ochs': [4173], 'R.L.': [4174], '95:': [4185], '4991-4996Google': [4186], '33Jiang': [4188], 'W.Q.': [4189], 'Szekely': [4190], 'Klein': [4192], 'Ringertz': [4194], 'Exp.': [4196], 'Res.': [4198, 5257], '229:': [4200], '289-300Google': [4201], 'possible': [4206, 4731], 'either': [4217], 'take': [4219], 'our': [4241, 5185], 'experiments,': [4243], '1A).': [4262], 'remain': [4271], 'largely': [4272], 'unknown,': [4273], 'many': [4274, 4561], 'they': [4279], '34Borden': [4301], 'K.L.': [4302, 4621], '5259-5269Google': [4308], 'overexpression.': [4329], 'confirmed': [4332], '2).': [4349], 'Based': [4350], 'co-localization': [4353], 'hypothesized': [4362], 'directly': [4372], 'bacterial': [4383], 'lac': [4384], 'repressor': [4385], 'independent': [4392], '(35Tsukamoto': [4395], 'Hashiguchi': [4397], 'Janicki': [4399], 'S.M.': [4400], 'Tumbar': [4401], 'Belmont': [4403], 'A.S.': [4404], 'Spector': [4405], '871-878Google': [4412], 'Scholar);': [4413], 'thus,': [4414], 'and/or': [4419], 'partner': [4421], 'always': [4427], 'indicative': [4428], 'real': [4431], 'interaction.': [4432], 'proved': [4434], 'endogenously': [4440], '3B),': [4442], 'precluding': [4443], 'artifactual.': [4451], 'assays': [4455], 'physical': [4464], 'involves': [4470], '447-663': [4475], '4B),': [4477], 'proline-rich': [4483, 4567, 4597], 'residues': [4490], 'N-terminal': [4497, 4639], 'well': [4514, 5173], '5).': [4526], '477-517,': [4534], 'proline': [4537, 4553], 'rich': [4538], 'critical': [4555], 'among': [4556], 'structures': [4559], 'ligands': [4562], 'interactions,': [4565], 'sequences': [4568], 'commonly': [4570], 'situations': [4573], 'requiring': [4574], 'rapid': [4575], 'interchange': [4578], '(36Kay': [4582], 'B.K.': [4583], 'Williamson': [4584], 'M.P.': [4585], 'Sudol': [4586], 'FASEB': [4588], '231-241Scopus': [4592], '(1026)': [4593], 'homeodomain': [4598], 'bind': [4604], 'RING': [4607], '(the': [4609], 'zinc-binding': [4610], '(37Topcu': [4614], 'Mack': [4616], 'Hromas': [4618], 'R.A.': [4619], 'Borden': [4620], '7091-7100Google': [4625], 'located': [4636], '(1-52),': [4643], 'potent': [4647], '(477-663),': [4655], 'weak': [4659], 'present': [4690], 'findings': [4691], 'enhances': [4701], 'transactivity,': [4703], 'explain': [4706], 'yet': [4719], 'determined,': [4720], 'however,': [4721, 4847], 'exactly': [4722], 'transactivity.': [4727], 'undergoes': [4741], 'SUMOylation': [4745], '(which': [4746], 'currently': [4749], 'investigating),': [4750], 'Scholar)': [4784], 'led': [4786], 'us': [4787], 'examine': [4789], 'neither': [4801], 'nor': [4806], '(Figs.': [4810], 'findings,': [4820], 'unable': [4823], 'exogenous': [4837, 5055], 'interesting': [4844, 5265], 'note,': [4846], '1C)': [4862], 'had': [4872], 'lacking': [4877], 'exhibited': [4879], 'dispersion': [4880], 'all': [4882, 4895], 'NB-associated': [4884], 'proteins.': [4885], 'introduction': [4888], 'PML-/-': [4892], 'NB': [4897, 5112], '(or': [4898], '10)': [4901], 'does': [4910], 'suggesting': [4915], 'presence': [4917], 'mediator': [4919], '(38Sternsdorf': [4921], 'Szostecki': [4925], 'Grotzinger': [4927], 'Scand.': [4931], '1995;': [4934], '42:': [4935], '257-268Google': [4936], '39Ishov': [4938], 'Sotnikov': [4940], 'A.G.': [4941], 'Vladimirova': [4944], 'O.V.': [4945], 'Neff': [4946], 'Kamitani': [4948], 'Strauss': [4952], '3rd,': [4953], 'J.F.': [4954], '147:': [4961], '221-234Google': [4962], 'predict': [4965], 'affinity': [4968], 'stronger': [4978], 'MEF;': [4984], 'hence,': [4985], 'disrupted': [4990], 'ability': [4992], 'recruit': [4996], 'Further': [4998], 'will': [5000, 5263], 'resolve': [5004], 'point.': [5006], 'stresses': [5009], '(reviewed': [5014], 'Ref.': [5016], '40Eskiw': [5017], 'C.H.': [5018], 'Dellaire': [5019], 'Mymryk': [5021], '4455-4466Google': [5030], 'effect': [5035], 'NBs.': [5047], 'levels,': [5056], 'C).': [5070], 'correlates': [5072], 'disperses': [5109], '(29Nefkens': [5121], 'likely': [5147], 'still': [5153], 'body.': [5159], 'explains,': [5161], 'least': [5163], 'part,': [5165], 'conclusion,': [5184], 'study': [5212], 'provides': [5213], 'plays': [5229], 'innate': [5235], 'immunity': [5236], '(41Seki': [5242], 'Suico': [5244], 'Cancer': [5256], '62:': [5259], '6579-6586Google': [5260], 'further': [5267], 'elucidate': [5268], 'suppressive': [5278], 'thank': [5283], 'Dr.': [5284, 5288], 'construct.': [5294]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2166576789', 'counts_by_year': [{'year': 2024, 'cited_by_count': 1}, {'year': 2023, 'cited_by_count': 3}, {'year': 2021, 'cited_by_count': 2}, {'year': 2016, 'cited_by_count': 1}, {'year': 2014, 'cited_by_count': 1}, {'year': 2013, 'cited_by_count': 3}, {'year': 2012, 'cited_by_count': 1}], 'updated_date': '2025-01-08T02:40:33.328193', 'created_date': '2016-06-24'}