The human ABCG1 gene: identification of LXR response elements that modulate expression in macrophages and liver

Name: Work Video:
Duration: 3 min 30 s
Steven L. Sabol; H. Bryan Brewer; Silvia Santamarina-Fojo
{'id': 'https://openalex.org/W2166536336', 'doi': 'https://doi.org/10.1194/jlr.m500080-jlr200', 'title': 'The human ABCG1 gene: identification of LXR response elements that modulate expression in macrophages and liver', 'display_name': 'The human ABCG1 gene: identification of LXR response elements that modulate expression in macrophages and liver', 'publication_year': 2005, 'publication_date': '2005-07-17', 'ids': {'openalex': 'https://openalex.org/W2166536336', 'doi': 'https://doi.org/10.1194/jlr.m500080-jlr200', 'mag': '2166536336', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/16024918'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1194/jlr.m500080-jlr200', 'pdf_url': 'http://www.jlr.org/article/S0022227520329060/pdf', 'source': {'id': 'https://openalex.org/S11400418', 'display_name': 'Journal of Lipid Research', 'issn_l': '0022-2275', 'issn': ['0022-2275', '1539-7262'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'doaj', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jlr.org/article/S0022227520329060/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5046608898', 'display_name': 'Steven L. Sabol', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I4210106489', 'display_name': 'National Heart Lung and Blood Institute', 'ror': 'https://ror.org/012pb6c26', 'country_code': 'US', 'type': 'facility', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238', 'https://openalex.org/I4210106489']}, {'id': 'https://openalex.org/I1299303238', 'display_name': 'National Institutes of Health', 'ror': 'https://ror.org/01cwqze88', 'country_code': 'US', 'type': 'government', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238']}], 'countries': ['US'], 'is_corresponding': True, 'raw_author_name': 'Steven L. Sabol', 'raw_affiliation_strings': ['Molecular Disease Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892'], 'affiliations': [{'raw_affiliation_string': 'Molecular Disease Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892', 'institution_ids': ['https://openalex.org/I4210106489', 'https://openalex.org/I1299303238']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5109912272', 'display_name': 'H. Bryan Brewer', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I4210106489', 'display_name': 'National Heart Lung and Blood Institute', 'ror': 'https://ror.org/012pb6c26', 'country_code': 'US', 'type': 'facility', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238', 'https://openalex.org/I4210106489']}, {'id': 'https://openalex.org/I1299303238', 'display_name': 'National Institutes of Health', 'ror': 'https://ror.org/01cwqze88', 'country_code': 'US', 'type': 'government', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'H. Bryan Brewer', 'raw_affiliation_strings': ['Molecular Disease Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892'], 'affiliations': [{'raw_affiliation_string': 'Molecular Disease Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892', 'institution_ids': ['https://openalex.org/I4210106489', 'https://openalex.org/I1299303238']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5044695894', 'display_name': 'Silvia Santamarina-Fojo', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I4210106489', 'display_name': 'National Heart Lung and Blood Institute', 'ror': 'https://ror.org/012pb6c26', 'country_code': 'US', 'type': 'facility', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238', 'https://openalex.org/I4210106489']}, {'id': 'https://openalex.org/I1299303238', 'display_name': 'National Institutes of Health', 'ror': 'https://ror.org/01cwqze88', 'country_code': 'US', 'type': 'government', 'lineage': ['https://openalex.org/I1299022934', 'https://openalex.org/I1299303238']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Silvia Santamarina-Fojo', 'raw_affiliation_strings': ['Molecular Disease Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892'], 'affiliations': [{'raw_affiliation_string': 'Molecular Disease Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892', 'institution_ids': ['https://openalex.org/I4210106489', 'https://openalex.org/I1299303238']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 2, 'corresponding_author_ids': ['https://openalex.org/A5046608898'], 'corresponding_institution_ids': ['https://openalex.org/I4210106489', 'https://openalex.org/I1299303238'], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 10.659, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 157, 'citation_normalized_percentile': {'value': 0.999972, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 97, 'max': 98}, 'biblio': {'volume': '46', 'issue': '10', 'first_page': '2151', 'last_page': '2167'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T11618', 'display_name': 'Cholesterol and Lipid Metabolism', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2746', 'display_name': 'Surgery'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T11618', 'display_name': 'Cholesterol and Lipid Metabolism', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2746', 'display_name': 'Surgery'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T10570', 'display_name': 'Drug Transport and Resistance Mechanisms', 'score': 0.9987, 'subfield': {'id': 'https://openalex.org/subfields/2730', 'display_name': 'Oncology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T11072', 'display_name': 'Peroxisome Proliferator-Activated Receptors', 'score': 0.9726, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/abcg1', 'display_name': 'ABCG1', 'score': 0.9844017}, {'id': 'https://openalex.org/keywords/liver-x-receptor', 'display_name': 'Liver X receptor', 'score': 0.9184163}, {'id': 'https://openalex.org/keywords/chromatin-immunoprecipitation', 'display_name': 'Chromatin immunoprecipitation', 'score': 0.6901301}, {'id': 'https://openalex.org/keywords/retinoid-x-receptor', 'display_name': 'Retinoid X receptor', 'score': 0.67933285}], 'concepts': [{'id': 'https://openalex.org/C2776330080', 'wikidata': 'https://www.wikidata.org/wiki/Q21113668', 'display_name': 'ABCG1', 'level': 5, 'score': 0.9844017}, {'id': 'https://openalex.org/C167400880', 'wikidata': 'https://www.wikidata.org/wiki/Q3454539', 'display_name': 'Liver X receptor', 'level': 5, 'score': 0.9184163}, {'id': 'https://openalex.org/C2777704780', 'wikidata': 'https://www.wikidata.org/wiki/Q21115210', 'display_name': 'ABCA1', 'level': 4, 'score': 0.80611587}, {'id': 'https://openalex.org/C134320426', 'wikidata': 'https://www.wikidata.org/wiki/Q901026', 'display_name': 'Chromatin immunoprecipitation', 'level': 5, 'score': 0.6901301}, {'id': 'https://openalex.org/C128821507', 'wikidata': 'https://www.wikidata.org/wiki/Q3454518', 'display_name': 'Retinoid X receptor', 'level': 5, 'score': 0.67933285}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.5866771}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.4582121}, {'id': 'https://openalex.org/C150194340', 'wikidata': 'https://www.wikidata.org/wiki/Q26972', 'display_name': 'Gene expression', 'level': 3, 'score': 0.45388892}, {'id': 'https://openalex.org/C165864922', 'wikidata': 'https://www.wikidata.org/wiki/Q411391', 'display_name': 'Regulation of gene expression', 'level': 3, 'score': 0.41721863}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.34444}, {'id': 'https://openalex.org/C101762097', 'wikidata': 'https://www.wikidata.org/wiki/Q224093', 'display_name': 'Promoter', 'level': 4, 'score': 0.31647736}, {'id': 'https://openalex.org/C63932345', 'wikidata': 'https://www.wikidata.org/wiki/Q422500', 'display_name': 'Nuclear receptor', 'level': 4, 'score': 0.31499863}, {'id': 'https://openalex.org/C149011108', 'wikidata': 'https://www.wikidata.org/wiki/Q652985', 'display_name': 'Transporter', 'level': 3, 'score': 0.30822483}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.28019553}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.20525125}, {'id': 'https://openalex.org/C86339819', 'wikidata': 'https://www.wikidata.org/wiki/Q407384', 'display_name': 'Transcription factor', 'level': 3, 'score': 0.19399849}], 'mesh': [{'descriptor_ui': 'D018528', 'descriptor_name': 'ATP-Binding Cassette Transporters', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D022781', 'descriptor_name': 'Hepatocytes', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D008264', 'descriptor_name': 'Macrophages', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D018160', 'descriptor_name': 'Receptors, Cytoplasmic and Nuclear', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D020218', 'descriptor_name': 'Response Elements', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D000070998', 'descriptor_name': 'ATP Binding Cassette Transporter, Subfamily G, Member 1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018528', 'descriptor_name': 'ATP-Binding Cassette Transporters', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000077556', 'descriptor_name': 'Alitretinoin', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001483', 'descriptor_name': 'Base Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002460', 'descriptor_name': 'Cell Line', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D045744', 'descriptor_name': 'Cell Line, Tumor', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': 'Q000819', 'qualifier_name': 'agonists', 'is_major_topic': False}, {'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D024202', 'descriptor_name': 'Electrophoretic Mobility Shift Assay', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D022781', 'descriptor_name': 'Hepatocytes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006845', 'descriptor_name': 'Hydrocarbons, Fluorinated', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000071518', 'descriptor_name': 'Liver X Receptors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008264', 'descriptor_name': 'Macrophages', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008297', 'descriptor_name': 'Male', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051379', 'descriptor_name': 'Mice', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008810', 'descriptor_name': 'Mice, Inbred C57BL', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008969', 'descriptor_name': 'Molecular Sequence Data', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D057093', 'descriptor_name': 'Orphan Nuclear Receptors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018160', 'descriptor_name': 'Receptors, Cytoplasmic and Nuclear', 'qualifier_ui': 'Q000819', 'qualifier_name': 'agonists', 'is_major_topic': False}, {'descriptor_ui': 'D018160', 'descriptor_name': 'Receptors, Cytoplasmic and Nuclear', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D020218', 'descriptor_name': 'Response Elements', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D047488', 'descriptor_name': 'Retinoid X Receptors', 'qualifier_ui': 'Q000819', 'qualifier_name': 'agonists', 'is_major_topic': False}, {'descriptor_ui': 'D047488', 'descriptor_name': 'Retinoid X Receptors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016415', 'descriptor_name': 'Sequence Alignment', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013449', 'descriptor_name': 'Sulfonamides', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D013449', 'descriptor_name': 'Sulfonamides', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D024363', 'descriptor_name': 'Transcription Initiation Site', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014212', 'descriptor_name': 'Tretinoin', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D014212', 'descriptor_name': 'Tretinoin', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015854', 'descriptor_name': 'Up-Regulation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 3, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1194/jlr.m500080-jlr200', 'pdf_url': 'http://www.jlr.org/article/S0022227520329060/pdf', 'source': {'id': 'https://openalex.org/S11400418', 'display_name': 'Journal of Lipid Research', 'issn_l': '0022-2275', 'issn': ['0022-2275', '1539-7262'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://doaj.org/article/0daf62c596894e06ae1b59125ac2afb3', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306401280', 'display_name': 'DOAJ (DOAJ: Directory of Open Access Journals)', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': None, 'host_organization_name': None, 'host_organization_lineage': [], 'host_organization_lineage_names': [], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/16024918', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1194/jlr.m500080-jlr200', 'pdf_url': 'http://www.jlr.org/article/S0022227520329060/pdf', 'source': {'id': 'https://openalex.org/S11400418', 'display_name': 'Journal of Lipid Research', 'issn_l': '0022-2275', 'issn': ['0022-2275', '1539-7262'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 63, 'referenced_works': ['https://openalex.org/W1528016198', 'https://openalex.org/W1570388980', 'https://openalex.org/W1607230014', 'https://openalex.org/W1854805603', 'https://openalex.org/W1908587496', 'https://openalex.org/W1962935964', 'https://openalex.org/W1968370020', 'https://openalex.org/W1971274721', 'https://openalex.org/W1986755882', 'https://openalex.org/W1988981743', 'https://openalex.org/W1993243592', 'https://openalex.org/W1995754186', 'https://openalex.org/W1996168740', 'https://openalex.org/W2000577172', 'https://openalex.org/W2003798182', 'https://openalex.org/W2003840075', 'https://openalex.org/W2006074076', 'https://openalex.org/W2012533363', 'https://openalex.org/W2015389151', 'https://openalex.org/W2023345325', 'https://openalex.org/W2024679015', 'https://openalex.org/W2026315272', 'https://openalex.org/W2032546021', 'https://openalex.org/W2039664177', 'https://openalex.org/W2046583732', 'https://openalex.org/W2047732042', 'https://openalex.org/W2048397414', 'https://openalex.org/W2050767064', 'https://openalex.org/W2052232844', 'https://openalex.org/W2057829817', 'https://openalex.org/W2064879068', 'https://openalex.org/W2064912476', 'https://openalex.org/W2072269555', 'https://openalex.org/W2083436346', 'https://openalex.org/W2085909854', 'https://openalex.org/W2086317930', 'https://openalex.org/W2093296161', 'https://openalex.org/W2097040991', 'https://openalex.org/W2098001104', 'https://openalex.org/W2102848212', 'https://openalex.org/W2105647248', 'https://openalex.org/W2106882534', 'https://openalex.org/W2112555162', 'https://openalex.org/W2112632255', 'https://openalex.org/W2127992082', 'https://openalex.org/W2128016314', 'https://openalex.org/W2128660079', 'https://openalex.org/W2144322830', 'https://openalex.org/W2151464048', 'https://openalex.org/W2153673003', 'https://openalex.org/W2159263105', 'https://openalex.org/W2159425655', 'https://openalex.org/W2163581659', 'https://openalex.org/W2165104851', 'https://openalex.org/W2167662593', 'https://openalex.org/W2168148721', 'https://openalex.org/W2168783124', 'https://openalex.org/W2169873114', 'https://openalex.org/W2170677539', 'https://openalex.org/W2183826207', 'https://openalex.org/W2612812586', 'https://openalex.org/W2614575602', 'https://openalex.org/W4292239814'], 'related_works': ['https://openalex.org/W4236404449', 'https://openalex.org/W3048895920', 'https://openalex.org/W2405007220', 'https://openalex.org/W2331166879', 'https://openalex.org/W2160015677', 'https://openalex.org/W2094753712', 'https://openalex.org/W2038314830', 'https://openalex.org/W1990488222', 'https://openalex.org/W1984008992', 'https://openalex.org/W1980848916'], 'abstract_inverted_index': {'The': [0, 28, 202, 230, 405, 459, 477, 1699, 1911, 2012, 2046, 2061, 2726, 2851, 3740, 3895, 4048, 4121, 4223, 4276], 'ABC': [1, 203, 439, 511, 715, 810], 'transporter': [2, 7, 204, 209, 409, 464, 482, 512, 716, 850, 1053, 1081, 2383, 2472, 3220], 'ABCG1': [3, 29, 62, 103, 112, 127, 182, 194, 205, 231, 264, 305, 314, 329, 385, 397, 657, 671, 899, 973, 1076, 1099, 1122, 1158, 1183, 1205, 1307, 1315, 1512, 1569, 2178, 2300, 2336, 2351, 2728, 2796, 2824, 2933, 2946, 2982, 3031, 3084, 3193, 3254, 3382, 3420, 3473, 3570, 3596, 3608, 3823, 3873, 4206, 4228, 4293], '(ATP': [4, 206], 'binding': [5, 207, 407, 2013], 'cassette': [6, 208, 408, 462, 480, 605, 849, 875, 1009, 1052, 1287, 1542, 2382, 2763, 2886, 3064, 3219, 3453], 'G1),': [8, 210], 'expressed': [9, 211, 674], 'in': [10, 19, 69, 94, 117, 129, 186, 212, 221, 271, 296, 319, 331, 389, 451, 680, 694, 852, 881, 900, 976, 1083, 1100, 1123, 1128, 1153, 1160, 1185, 1193, 1206, 1252, 1289, 1318, 1404, 1444, 1514, 1548, 1572, 1577, 1583, 1589, 1691, 1753, 1771, 1850, 1890, 1936, 2073, 2134, 2160, 2181, 2203, 2280, 2307, 2322, 2354, 2419, 2630, 2679, 2924, 2952, 3013, 3025, 3098, 3188, 3247, 3358, 3377, 3400, 3414, 3487, 3576, 3598, 3607, 3646, 3678, 3714, 3731, 3770, 3826, 3875, 3916, 3971, 4030, 4056, 4127, 4139, 4294, 4305], 'macrophages,': [11, 213, 681, 1573, 2359, 3604], 'liver,': [12, 189, 214, 392, 1268, 1584, 2358], 'and': [13, 37, 44, 76, 91, 97, 119, 150, 158, 164, 188, 200, 215, 239, 246, 278, 293, 299, 321, 352, 360, 366, 391, 403, 494, 550, 581, 606, 610, 652, 658, 687, 690, 754, 785, 877, 886, 904, 908, 951, 981, 1012, 1029, 1046, 1110, 1196, 1232, 1269, 1293, 1321, 1373, 1453, 1495, 1544, 1553, 1636, 1704, 1714, 1726, 1845, 1847, 1859, 1914, 1939, 2139, 2360, 2376, 2504, 2559, 2608, 2658, 2736, 2754, 2791, 2877, 2902, 2927, 2947, 3020, 3033, 3055, 3081, 3091, 3166, 3191, 3213, 3271, 3289, 3374, 3378, 3393, 3398, 3403, 3409, 3422, 3444, 3470, 3480, 3555, 3572, 3579, 3603, 3610, 3619, 3666, 3684, 3689, 3700, 3751, 3808, 3850, 3897, 3903, 3926, 3942, 3969, 3992, 4022, 4054, 4060, 4146, 4201, 4209, 4237, 4245, 4249, 4300], 'other': [14, 216, 696, 2609, 2948], 'tissues,': [15, 217, 689, 697, 2356, 3601], 'has': [16, 218, 2345], 'been': [17, 55, 219, 257, 449, 2346, 2914, 2936], 'implicated': [18, 220, 450, 898], 'the': [20, 95, 101, 126, 130, 175, 181, 222, 297, 303, 328, 332, 378, 384, 434, 539, 546, 588, 655, 743, 750, 792, 845, 901, 937, 941, 1078, 1124, 1197, 1256, 1267, 1281, 1284, 1359, 1363, 1481, 1485, 1507, 1578, 1585, 1603, 1606, 1668, 1823, 1841, 1902, 1937, 1986, 2003, 2024, 2074, 2135, 2161, 2297, 2314, 2335, 2412, 2449, 2466, 2469, 2536, 2585, 2589, 2602, 2605, 2611, 2617, 2625, 2757, 2760, 2794, 2822, 2843, 2880, 2883, 2908, 2925, 2931, 2980, 3001, 3014, 3037, 3058, 3061, 3078, 3095, 3115, 3125, 3134, 3155, 3162, 3179, 3189, 3248, 3252, 3359, 3380, 3386, 3401, 3426, 3447, 3450, 3467, 3484, 3504, 3514, 3523, 3544, 3551, 3568, 3589, 3752, 3786, 3821, 3860, 3989, 4061, 4109, 4176, 4184, 4204, 4212, 4226, 4269, 4288], 'efflux': [21, 223, 905, 978, 1017, 1060, 1090, 1213, 1638, 1666, 2390, 2476, 2506, 2534, 2562, 2660, 3227, 3613], 'of': [22, 39, 100, 123, 132, 167, 169, 177, 180, 224, 241, 302, 325, 334, 369, 371, 380, 383, 415, 419, 428, 433, 508, 538, 545, 583, 587, 654, 712, 742, 749, 787, 791, 808, 844, 873, 906, 940, 948, 966, 979, 988, 1048, 1075, 1126, 1171, 1234, 1283, 1362, 1370, 1484, 1492, 1511, 1540, 1568, 1580, 1605, 1634, 1639, 1663, 1843, 1888, 1892, 1941, 2002, 2014, 2051, 2078, 2137, 2156, 2163, 2240, 2247, 2299, 2313, 2341, 2378, 2411, 2417, 2448, 2465, 2502, 2507, 2531, 2584, 2604, 2619, 2627, 2656, 2661, 2709, 2716, 2756, 2759, 2793, 2821, 2842, 2862, 2879, 2882, 2930, 2945, 2979, 3000, 3039, 3057, 3060, 3077, 3108, 3119, 3124, 3127, 3136, 3154, 3161, 3178, 3215, 3245, 3251, 3264, 3291, 3388, 3428, 3446, 3449, 3466, 3497, 3508, 3513, 3516, 3525, 3543, 3550, 3567, 3588, 3644, 3648, 3820, 3854, 3882, 3929, 3939, 3981, 3999, 4009, 4136, 4194, 4225, 4262, 4268, 4287, 4291], 'cholesterol': [23, 35, 198, 225, 237, 401, 907, 950, 980, 1016, 1059, 1089, 1112, 1127, 1254, 1260, 1295, 1372, 1494, 1590, 1600, 1640, 1665, 1719, 2389, 2508, 2533, 2561, 2620, 2628, 2662, 3226, 3612, 3617], 'to': [24, 111, 143, 147, 226, 313, 345, 349, 514, 552, 613, 624, 718, 756, 983, 1018, 1061, 1091, 1190, 1266, 2027, 2067, 2097, 2348, 2391, 2477, 2616, 2633, 2738, 2919, 3021, 3036, 3168, 3228, 3261, 3410, 3425, 3557, 3744, 3817, 3852, 4104, 4116, 4183, 4239, 4247, 4284, 4301], 'high': [25, 227, 676, 989, 1062, 2392, 3229], 'density': [26, 228, 990, 1063, 1333, 2393, 3230, 4135], 'lipoprotein.': [27, 229], 'gene': [30, 115, 183, 232, 317, 386, 549, 753, 871, 1308, 1538, 1570, 2099, 2141, 2414, 2467, 2557, 2729, 2934, 3165, 3275, 3346, 3554, 3571], 'is': [31, 64, 233, 266, 412, 596, 611, 673, 945, 1261, 1310, 1367, 1436, 1489, 1745, 2064, 2614, 2733, 2854, 2899, 4282], 'transcriptionally': [32, 234], 'activated': [33, 125, 235, 327], 'by': [34, 66, 184, 236, 268, 387, 812, 1313, 1327, 1455, 1522, 1641, 1667, 1822, 1985, 2303, 2443, 2509, 2535, 2565, 2588, 2663, 3114, 3503, 3591, 3785, 3880, 3949, 4006, 4052, 4086, 4095, 4113, 4259], 'loading': [36, 238, 1329, 1593], 'activators': [38, 240], 'liver': [40, 242, 699, 883, 1129, 1441, 1516, 1550, 1607, 1750, 2004, 2130, 2164, 2242, 2450, 2590, 2711, 2826, 2984, 3602, 3690, 4049, 4083], 'X': [41, 46, 243, 248, 1442, 1608, 1687, 1711, 1751, 1767, 2005, 2092, 2131, 2165, 2243, 2451, 2591, 2593, 2675, 2712, 2827, 2985], 'receptors': [42, 47, 244, 249, 880, 1547, 1702, 1712, 1900, 2034, 2093, 2244, 2713], '(LXRs)': [43, 245], 'retinoid': [45, 247, 1710, 1799, 1967], '(RXRs)': [48, 250, 1713], 'through': [49, 251, 1602, 3988, 4065, 4266], 'genomic': [50, 252, 3682], 'sequences': [51, 253, 3184, 3327], 'that': [52, 61, 254, 263, 424, 964, 1056, 1072, 1097, 1795, 1963, 2296, 2328, 2386, 2833, 2991, 3223, 3273], 'have': [53, 255, 448, 897, 1095, 2912, 2935, 3363], 'not': [54, 146, 256, 348, 2913, 3186], 'fully': [56, 258], 'characterized.': [57, 259], 'Here': [58, 260], 'we': [59, 261, 3028, 3362, 3417], 'show': [60, 262], 'mRNA': [63, 265, 672, 974, 1316, 1399, 1513, 2179, 2198, 2275, 2301, 2352, 3085, 3474, 3726, 3874, 4229, 4242], 'induced': [65, 267, 1326, 1403, 2202, 2279], 'LXR': [67, 86, 157, 269, 288, 359, 1672, 1700, 1826, 1844, 1925, 2019, 2174, 2316, 2459, 2540, 2612], 'agonists': [68, 270], 'RAW264.7': [70, 118, 272, 320, 3697, 3790], 'macrophage': [71, 273, 949, 1371, 1493, 2241, 2710, 3578, 3699], 'cells,': [72, 75, 274, 277, 1264], 'HepG2': [73, 120, 275, 322, 3701, 3876], 'hepatoma': [74, 276, 3703], 'primary': [77, 279], 'mouse': [78, 280, 1101, 1320, 2420, 3190, 3253, 3698, 3822, 3866, 4205, 4213], 'hepatocytes.': [79, 281, 4120], 'We': [80, 282, 3384], 'identify': [81, 283], 'two': [82, 190, 284, 393, 2315, 3010, 3109, 3128, 3389, 3498, 3517, 3599], 'evolutionarily': [83, 285, 420, 3265, 3394], 'highly': [84, 286, 1311, 1325, 1402, 2201, 2278, 2900], 'conserved': [85, 287, 421, 3187, 3266, 3293, 3326, 3395], 'response': [87, 289, 1800, 1926, 1968], 'elements': [88, 290], '(LXREs),': [89, 291], 'LXRE-A': [90, 133, 149, 163, 292, 335, 351, 365], 'LXRE-B,': [92, 294], 'located': [93, 295], 'first': [96, 298, 962, 3402], 'second': [98, 300, 3015, 3249, 3404], 'introns': [99, 301, 1940, 3034, 3405, 3423], 'human': [102, 170, 304, 372, 438, 460, 478, 543, 656, 747, 847, 938, 967, 1084, 1157, 1182, 1235, 1322, 1360, 1482, 2727, 2761, 2795, 2823, 2884, 2932, 2981, 3030, 3062, 3159, 3180, 3329, 3345, 3381, 3419, 3451, 3548, 3569, 3595, 3702, 4292], 'gene.': [104, 306, 2337, 3255, 3383], 'Each': [105, 307], 'element': [106, 308, 1927], 'conferred': [107, 309], 'robust': [108, 310], 'LXR-agonist': [109, 311], 'responsiveness': [110, 312], 'promoter-directed': [113, 315], 'luciferase': [114, 316], 'constructs': [116, 318], 'cells.': [121, 323], 'Overexpression': [122, 324], 'LXR/RXR': [124, 140, 326, 342, 1921, 2062, 3757], 'promoter': [128, 330, 2587, 2758, 2832, 2881, 2897, 2926, 2990, 3059, 3096, 3105, 3448, 3485, 3494], 'presence': [131, 333, 2077, 3116, 3126, 3505, 3515], 'or': [134, 336, 616, 621, 677, 1077, 1594, 2020, 2070, 2076, 2331, 3117, 3506, 3760, 4162], 'LXRE-B': [135, 151, 337, 353], 'sequences.': [136, 152, 338, 354], 'In': [137, 153, 339, 355], 'gel-shift': [138, 340], 'assays,': [139, 156, 341, 358], 'heterodimers': [141, 343, 1708, 1913, 1922], 'bound': [142, 344, 2066], 'wild-type': [144, 346], 'but': [145, 347, 2319, 3324], 'mutated': [148, 350], 'chromatin': [154, 356], 'immunoprecipitation': [155, 357], 'RXR': [159, 361, 1642, 1899, 1912, 2021, 2510, 2664], 'were': [160, 362, 1324, 3668, 3676, 3691, 3712, 3729, 3754, 3768, 3793, 3838, 3901, 3933, 3957, 3986, 4079, 4111, 4125, 4152, 4199, 4231, 4257], 'detected': [161, 363, 3879], 'at': [162, 364, 675, 691, 3094, 3103, 3133, 3483, 3492, 3522, 3936, 4046, 4097, 4133], '-B': [165, 367], 'regions': [166, 368, 3263], 'DNA': [168, 370, 3683, 3815], 'THP-1': [171, 373], 'macrophages.These': [172], 'studies': [173, 376, 896, 1094, 3584], 'clarify': [174, 377], 'mechanism': [176, 379], 'transcriptional': [178, 381, 1408, 1611, 1983, 2207, 2284], 'upregulation': [179, 382], 'oxysterols': [185, 388, 2304, 3593], 'macrophages': [187, 390, 968, 1323, 2182, 2308, 2631], 'key': [191, 394, 3600], 'tissues': [192, 395], 'where': [193, 396, 3605], 'expression': [195, 398, 651, 842, 872, 1074, 1150, 1309, 1539, 1571, 2558, 3609], 'may': [196, 399, 3614], 'affect': [197, 400], 'balance': [199, 402, 3618], 'atherogenesis.': [201, 404, 3620], 'macrophages.': [374, 1406, 2205, 2282], 'These': [375, 1241, 1562, 3583], 'ATP': [406, 603], 'G1': [410, 1011, 1054, 2384, 3221], '(ABCG1)': [411, 2765, 2888, 3066, 3455], 'a': [413, 416, 426, 509, 542, 584, 597, 626, 713, 746, 788, 946, 985, 1119, 1202, 1245, 1368, 1490, 1524, 1595, 1792, 1797, 1931, 1960, 1965, 2015, 2048, 2068, 2444, 2835, 2860, 2904, 2921, 2993, 3158, 3242, 3368, 3547, 3796, 3811, 3842, 3863, 3907, 3960, 3972, 4010, 4057, 4066, 4134], 'member': [414], 'large': [417, 3278], 'superfamily': [418, 851], 'transmembrane': [422, 608], 'proteins': [423], 'transport': [425, 903, 1125, 1601], 'variety': [427], 'molecules': [429], 'across': [430], 'membranes.': [431], 'Many': [432], 'approximately': [435, 4191], '48': [436], 'known': [437, 3260], 'transporters,': [440], 'which': [441, 1574, 2474, 3074, 3463, 3592, 3905, 4108, 4281], 'are': [442, 1401, 1575, 2035, 2200, 2277, 2563, 3185, 3258], 'divided': [443], 'into': [444, 1114, 1271, 1280], 'seven': [445], 'families': [446], '(A–G),': [447], 'disease': [452], '(1Dean': [453], 'M.': [454, 472, 501, 503, 705, 707, 834, 861, 865, 923, 927, 933, 1136, 1345, 1349, 1355, 1467, 1471, 1477, 1528, 1532, 1883, 2117, 2745, 2868, 3046, 3283, 3435, 3639], 'Rzhetsky': [455], 'A.': [456, 530, 532, 648, 734, 736, 830, 1038, 1385, 1391, 1649, 1871, 2184, 2190, 2261, 2267, 2368, 2517, 2809, 2967, 3146, 3148, 3205, 3303, 3535, 3537, 3627], 'Allikmets': [457], 'R.': [458, 828, 2227, 2696, 3305], 'ATP-binding': [461, 479, 848, 874, 1008, 1051, 1541, 2381, 2762, 2885, 3063, 3218, 3452], '(ABC)': [463, 481], 'superfamily.Genome': [465], 'Res.': [466, 485, 665, 820, 1854, 2424, 2454, 2568, 2800, 2956, 3295], '2001;': [467, 486, 1237, 1449, 1758, 2802, 2847, 2957, 3005], '11:': [468, 1992], '1156-1166Google': [469], 'Scholar,': [470, 522, 561, 726, 765, 799, 824, 859, 1166, 1383, 1418, 1647, 1681, 1761, 1778, 1806, 1831, 1974, 1994, 2105, 2148, 2217, 2400, 2428, 2515, 2549, 2573, 2669, 2686, 2772, 2805, 3299, 3335], '2Dean': [471], 'Hamon': [473], 'Y.': [474, 1424, 1733, 2577], 'Chimini': [475, 504, 708], 'G.': [476, 505, 534, 640, 709, 738, 838, 925, 1347, 1426, 1469, 1735, 2111, 2751, 2786, 2874, 2939, 3052, 3150, 3441, 3539], 'superfamily.J.': [483], 'Lipid': [484, 819, 1592, 1853, 2423, 2453, 2955], '42:': [487, 2958], '1007-1017Google': [488], 'Scholar).': [489, 670, 894, 1178, 1240, 1302, 1505, 1561, 1698, 1898, 1920, 2011, 2060, 2173, 2256, 2458, 2600, 2725, 2850, 2895, 2960, 3177, 3354, 3566], 'ABCG1,': [490, 1248, 2607], 'originally': [491, 3079, 3468], 'termed': [492], '"White"': [493], '"ABC8"': [495], '(3Savary': [496, 700], 'S.': [497, 577, 701, 781, 805, 1144, 1146, 1217, 1227, 1277, 1879, 1881, 2084, 2774, 2776, 2943, 3311, 3635, 3637], 'Denizot': [498, 702], 'F.': [499, 703, 1005], 'Luciani': [500, 704], 'Mattei': [502, 706], 'Molecular': [506, 710, 3846], 'cloning': [507, 711], 'mammalian': [510, 585, 714, 789], 'homologous': [513, 717], 'Drosophila': [515, 547, 589, 719, 751, 793, 942, 1364, 1486, 3163, 3552], 'white': [516, 548, 590, 720, 752, 794, 943, 1365, 1487, 3164, 3553], 'gene.Mamm.': [517, 721], 'Genome.': [518, 722], '1996;': [519, 558, 723, 762, 1828, 3174, 3563], '7:': [520, 724], '673-676Google': [521, 725], '4Chen': [523, 727], 'H.': [524, 642, 728, 1869, 3140, 3529, 3625], 'Rossier': [525, 729, 3141, 3530], 'C.': [526, 636, 730, 832, 917, 1138, 1140, 1339, 1461, 2088, 3142, 3309, 3531], 'Lalioti': [527, 731, 3143, 3532], 'M.D.': [528, 732, 3144, 3533], 'Lynn': [529, 733, 3145, 3534], 'Chakravarti': [531, 735, 3147, 3536], 'Perrin': [533, 737, 3149, 3538], 'Antonarakis': [535, 739, 3151, 3540], 'S.E.': [536, 740, 3152, 3541], 'Cloning': [537, 741, 3153, 3542], 'cDNA': [540, 744, 3156, 3545, 3824, 3884, 3930, 4207, 4263, 4272], 'for': [541, 662, 745, 1121, 1156, 1204, 1247, 1410, 1440, 1749, 1981, 2017, 2032, 2037, 2129, 2209, 2286, 2468, 3157, 3241, 3348, 3370, 3546, 3762, 3833, 3865, 3944, 3951, 4100, 4168, 4220], 'homologue': [544, 748, 3160, 3549], 'mapping': [551, 755, 3167, 3556], 'chromosome': [553, 757, 2731, 3169, 3330, 3558], '21q22.3.Am.': [554, 758, 3170, 3559], 'J.': [555, 630, 759, 915, 1225, 1297, 1337, 1459, 1620, 2086, 2150, 2488, 2642, 2749, 2815, 2872, 2973, 3050, 3171, 3439, 3560], 'Hum.': [556, 760, 3172, 3561], 'Genet.': [557, 761, 2055, 3173, 3562], '59:': [559, 763, 3175, 3564], '66-75Google': [560, 764, 3176, 3565], '5Croop': [562, 766], 'J.M.': [563, 767, 1389, 1630, 2188, 2265, 2498, 2652], 'Tiller': [564, 768], 'G.E.': [565, 769], 'Fletcher': [566, 770], 'J.A.': [567, 771, 1618, 1998, 2406, 2486, 2640], 'Lux': [568, 772], 'M.L.': [569, 773], 'Raab': [570, 774], 'E.': [571, 775, 919, 1341, 1463, 2780], 'Goldenson': [572, 776], 'D.': [573, 575, 777, 779, 1001, 2233, 2702, 3285], 'Son': [574, 778], 'Arciniegas': [576, 780], 'Wu': [578, 782, 2085], 'R.L.': [579, 783], 'Isolation': [580, 784], 'characterization': [582, 653, 786, 2755, 2878, 3056, 3290, 3387, 3445], 'homolog': [586, 790, 939, 1361, 1483], 'gene.Gene.': [591, 795], '1997;': [592, 796, 1991], '185:': [593, 797], '77-85Google': [594, 798], 'Scholar),': [595, 3073, 3462], 'half-transporter': [598, 623], '(74–76': [599], 'kDa)': [600], 'possessing': [601], 'one': [602, 607], 'binding/hydrolysis': [604], 'domain': [609], 'presumed': [612], 'form': [614, 1706, 2841, 2999], 'dimers': [615], 'multimers': [617], 'with': [618, 969, 1118, 1201, 1330, 1709, 2095, 2343, 3756, 3810, 3862, 3996, 4038, 4088, 4144, 4154, 4203, 4211, 4233], 'either': [619, 2018, 2312, 2329], 'itself': [620], 'another': [622], 'assemble': [625], 'functional': [627, 2922, 3323, 3373], 'complex': [628, 2159], '(6Cserepes': [629], 'Szentpetery': [631], 'Z.': [632], 'Seres': [633], 'L.': [634, 646, 1622, 1877, 2436, 2490, 2644, 3633], 'Ozvegy-Laczka': [635], 'Langmann': [637, 2940, 3040, 3429], 'T.': [638, 826, 1132, 1168, 1221, 2743, 2778, 2866, 2941, 3044, 3433], 'Schmitz': [639, 837, 2750, 2873, 3051, 3440], 'Glavinas': [641], 'Klein': [643], 'I.': [644, 2813, 2971, 3339], 'Homolya': [645], 'Varadi': [647], 'et': [649, 912, 934, 996, 1031, 1356, 1478, 1886, 2126, 2238, 2258, 2707, 2962, 3041, 3198, 3320, 3430, 3642], 'al.Functional': [650], 'ABCG4': [659, 1082], 'proteins:': [660], 'indications': [661], 'heterodimerization.Biochem.': [663], 'Biophys.': [664, 2567, 2767, 2799, 2890, 3068, 3457], 'Commun.': [666, 2569, 2801], '2004;': [667, 1025, 1067, 2008, 2170, 2397, 2425, 2455, 3234], '320:': [668], '860-867Google': [669], 'moderate': [678], 'levels': [679, 693, 1109, 1317, 1400, 2180, 2199, 2276, 2302, 2353], 'spleen,': [682], 'lung,': [683], 'thymus,': [684], 'placenta,': [685], 'brain,': [686], 'fetal': [688, 3722, 4148], 'lower': [692], 'most': [695], 'including': [698, 2357], '7Su': [800], 'Y.R.': [801], 'Linton': [802], 'M.F.': [803], 'Fazio': [804], 'Rapid': [806], 'quantification': [807], 'murine': [809, 1050, 2380, 3217], 'mRNAs': [811, 3856], 'real': [813], 'time': [814], 'reverse': [815, 840, 1253, 1294, 1599, 3892, 3898], 'transcriptase-polymerase': [816], 'chain': [817], 'reaction.J.': [818], '2002;': [821, 1855, 2253, 2722, 3332], '43:': [822, 1856], '2180-2187Google': [823], '8Langmann': [825], 'Mauerer': [827], 'Zahn': [829], 'Moehle': [831], 'Probst': [833], 'Stremmel': [835], 'W.': [836, 929, 931, 1003, 1351, 1353, 1473, 1475], 'Real-time': [839], 'transcription-PCR': [841], 'profiling': [843], 'complete': [846], 'various': [853], 'tissues.Clin.': [854], 'Chem.': [855, 890, 1066, 1414, 1448, 1557, 1757, 2213, 2290, 2396, 2596, 2846, 3004, 3233], '2003;': [856, 891, 1175, 1299, 1558, 1695, 1775, 2102, 2145, 2683, 3296, 3351], '49:': [857], '230-238Google': [858], '9Hoekstra': [860], 'Kruijt': [862, 1529], 'J.K.': [863, 1530], 'Eck': [864, 1531], 'Van': [866, 867, 1533, 1534], 'Berkel': [868, 1535], 'T.J.': [869, 1536], 'Specific': [870, 1537], 'transporters': [876, 1010, 1288, 1543], 'nuclear': [878, 1545, 1669, 1701, 1793, 1824, 1961, 2537], 'hormone': [879, 1546], 'rat': [882, 1515, 1549, 3192], 'parenchymal,': [884, 1551], 'endothelial,': [885, 1552], 'Kupffer': [887, 1554], 'cells.J.': [888, 1446, 1555, 1755], 'Biol.': [889, 1065, 1413, 1447, 1556, 1756, 2144, 2169, 2212, 2289, 2395, 2595, 2845, 3003, 3232], '278:': [892, 1559], '25448-25453Google': [893, 1560], 'Recent': [895], 'cellular': [902, 1015, 1058, 1664, 2388, 2532, 3225, 3611], 'possibly': [909], 'phospholipids.': [910], 'Klucken': [911, 2748, 2871, 3049, 3438], 'al.': [913, 997, 1032, 2259, 2963, 3042, 3199, 3431], '(10Klucken': [914, 1336, 1458], 'Buchler': [916, 1338, 1460], 'Orso': [918, 1340, 1462], 'Kaminski': [920, 1342, 1464], 'W.E.': [921, 1343, 1465], 'Porsch-Ozcurumez': [922, 1344, 1466, 2744, 2867, 3045, 3434], 'Liebisch': [924, 1346, 1468], 'Kapinsky': [926, 1348, 1470], 'Diederich': [928, 1350, 1472], 'Drobnik': [930, 1352, 1474], 'Dean': [932, 1354, 1476], 'al.ABCG1': [935, 1357, 1479], '(ABC8),': [936, 1358, 1480], 'gene,': [944, 1366, 1488], 'regulator': [947, 1369, 1491], 'phospholipid': [952, 1374, 1496], 'transport.Proc.': [953, 1375, 1497], 'Natl.': [954, 1021, 1376, 1498, 1674, 2249, 2542, 2718], 'Acad.': [955, 1022, 1377, 1499, 1675, 2250, 2543, 2719], 'Sci.': [956, 1023, 1378, 1500, 1676, 2251, 2544, 2720], 'USA.': [957, 1024, 1379, 1501, 1677, 2252, 2545, 2721], '2000;': [958, 1163, 1380, 1415, 1502, 1644, 1678, 1895, 2214, 2291, 2512, 2546, 2570, 2597, 2666, 2769, 2892, 3070, 3459, 3651], '97:': [959, 1381, 1503, 1679, 2547], '817-822Google': [960, 1382, 1504], 'Scholar)': [961, 1028, 1070, 1452, 1858, 2294, 3008, 3237, 3654], 'demonstrated': [963, 2295], 'treatment': [965, 2340], 'antisense': [970], 'oligonucleotides': [971], 'targeting': [972], 'resulted': [975], 'decreased': [977], 'phospholipids': [982], 'HDL3,': [984], 'major': [986, 1586, 2852, 3083, 3472, 4227], 'fraction': [987], 'lipoprotein': [991, 1161, 1291, 1334], '(HDL).': [992], 'More': [993, 2338], 'recently,': [994, 2339, 3196], 'Wang': [995, 1880, 2578, 3636], '(11Wang': [998], 'N.': [999, 2579, 2817, 2975, 3307], 'Lan': [1000], 'Chen': [1002, 1423, 1732, 2435], 'Matsuura': [1004], 'Tall': [1006, 2580], 'A.R.': [1007, 2434, 2581], 'G4': [1013], 'mediate': [1014], 'high-density': [1019, 1290], 'lipoproteins.Proc.': [1020], '101:': [1026], '9774-9779Google': [1027], 'Nakamura': [1030, 3197], '(12Nakamura': [1033, 2363, 3200], 'K.': [1034, 1042, 1624, 1782, 1950, 2119, 2364, 2372, 2492, 2551, 2646, 2782, 3201, 3209], 'Kennedy': [1035, 2365, 2961, 3202], 'M.A.': [1036, 2366, 2807, 2965, 3203, 3337], 'Baldan': [1037, 2367, 3204], 'Bojanic': [1039, 2369, 3206], 'D.D.': [1040, 2370, 3207], 'Lyons': [1041, 2371, 3208], 'Edwards': [1043, 1394, 1658, 2193, 2270, 2373, 2526, 2818, 2976, 3210], 'P.A.': [1044, 1395, 1655, 1659, 1833, 2194, 2271, 2374, 2523, 2527, 2819, 2977, 3211], 'Expression': [1045, 2375, 3212], 'regulation': [1047, 1567, 2136, 2377, 2618, 3214], 'multiple': [1049, 2379, 3216], 'mRNAs/isoforms': [1055, 2385, 3222], 'stimulate': [1057, 2028, 2387, 3224], 'lipoprotein.J.': [1064, 2394, 3231], '279:': [1068, 2398, 3235], '45980-45989Google': [1069, 2399, 3236], 'reported': [1071, 3009], 'increased': [1073, 1088, 1111, 1520], 'closely': [1079], 'related': [1080], 'embryonic': [1085], 'kidney': [1086], 'cells': [1087, 1130, 1187, 1518, 3704, 3728, 3753, 3877, 4110], 'HDL.': [1092], 'Other': [1093], 'shown': [1096, 2347, 3097, 3486], 'overexpressing': [1098], 'hepatocytes': [1102, 4124], 'via': [1103], 'adenovirus': [1104], 'infection': [1105], 'reduced': [1106, 1454], 'plasma': [1107, 1198], 'HDL': [1108], 'secretion': [1113], 'bile,': [1115], 'findings': [1116, 1243], 'consistent': [1117, 1200], 'role': [1120, 1155, 1203, 1246, 1282, 1409, 2208, 2285], '(13Ito': [1131], 'Sabol': [1133, 1216], 'S.L.': [1134], 'Amar': [1135], 'Knapper': [1137], 'Duarte': [1139], 'Shamburek': [1141], 'R.D.': [1142], 'Meyn': [1143], 'Santamarina-Fojo': [1145, 1226, 1276], 'Brewer': [1147, 1228], 'H.B.': [1148, 1229, 1275], 'Adenovirus-mediated': [1149], 'establishes': [1151], 'an': [1152, 1437, 1746, 1924, 2830, 2839, 2988, 2997], 'vivo': [1154], '(ABC8)': [1159, 2797], 'metabolism.Circulation.': [1162], '102:': [1164], '1525Google': [1165], '14Ito': [1167], 'Physiological': [1169], 'function': [1170], 'ABCG1.Drug': [1172], 'News': [1173], 'Perspect.': [1174], '16:': [1176], '490-492Google': [1177], 'Furthermore,': [1179, 1506], 'green-fluorescent': [1180], 'protein-tagged': [1181], 'protein': [1184, 2072], 'HeLa': [1186], 'was': [1188, 1519, 2305, 2320, 3655, 3738, 3742, 3775, 3878, 4050, 4063, 4173, 4279], 'found': [1189], 'be': [1191, 1305, 4117], 'localized': [1192], 'endocytic': [1194], 'compartments': [1195], 'membrane,': [1199], 'intracellular': [1207], 'sterol': [1208], 'trafficking': [1209, 1233], 'as': [1210, 1212, 1249, 1722, 1864, 2245, 2622, 2624, 2714, 3367, 3783, 4217], 'well': [1211, 2623], '(15Neufeld': [1214], 'E.B.': [1215], 'Remaley': [1218], 'A.T.': [1219], 'Ito': [1220], 'Demosky': [1222], 'S.J.': [1223], 'Stonik': [1224], 'Cellular': [1230], 'localization': [1231], 'ABCG1.Circulation.': [1236], '104:': [1238], '708Google': [1239], 'combined': [1242, 1563], 'suggest': [1244, 1565], 'yet': [1250], 'undefined,': [1251], 'transport,': [1255], 'process': [1257], 'whereby': [1258], 'excess': [1259], 'removed': [1262], 'from': [1263, 2309, 2856, 3269, 3657, 3669, 3687, 3692, 3886, 4081], 'transported': [1265], 'excreted': [1270], 'bile': [1272, 3994], '(16Brewer': [1273], 'Jr.,': [1274], 'New': [1278], 'insights': [1279], 'adenosine': [1285], 'triphosphate-binding': [1286], 'metabolism': [1292, 1946], 'transport.Am.': [1296], 'Cardiol.': [1298], '91:': [1300], '3E-11EGoogle': [1301], 'As': [1303], 'might': [1304], 'anticipated,': [1306], 'regulated': [1312, 2564], 'cholesterol.': [1314], 'cultured': [1319, 3577], 'lipid': [1328, 1456, 1851, 1945, 2953], 'acetyl': [1331], 'low': [1332, 1509], '(Ac-LDL)': [1335], '17Venkateswaran': [1384], 'Repa': [1386, 1872, 2185, 2262, 3628], 'J.J.': [1387, 1614, 1873, 2186, 2263, 2482, 2636, 3629], 'Lobaccaro': [1388, 1617, 2187, 2264, 2485, 2639], 'Bronson': [1390, 2189, 2266], 'Mangelsdorf': [1392, 1631, 1684, 1764, 1789, 1815, 1884, 1957, 1977, 2044, 2191, 2236, 2268, 2499, 2653, 2672, 2705, 3640], 'D.J.': [1393, 1632, 1685, 1765, 1790, 1816, 1885, 1908, 1958, 1978, 2041, 2045, 2192, 2237, 2269, 2500, 2654, 2673, 2706, 3641], 'Human': [1396, 2195, 2272, 3681], 'white/murine': [1397, 2196, 2273], 'ABC8': [1398, 2197, 2274], 'lipid-loaded': [1405, 2204, 2281], 'A': [1407, 2206, 2283, 3868, 4215, 4241], 'specific': [1411, 2210, 2287], 'oxysterols.J.': [1412, 2211, 2288], '275:': [1416, 2215, 2292, 2598], '14700-14707Google': [1417, 2216, 2293], '18Fu': [1419], 'X.': [1420, 1729, 2082], 'Menke': [1421, 1730], 'J.G.': [1422, 1731], 'Zhou': [1425, 1734], 'MacNaul': [1427, 1736], 'K.L.': [1428, 1737], 'Wright': [1429, 1738], 'S.D.': [1430, 1616, 1739, 2484, 2638], 'Sparrow': [1431, 1740], 'C.P.': [1432, 1741, 2438], 'Lund': [1433, 1742], 'E.G.': [1434, 1743], '27-Hydroxycholesterol': [1435, 1744], 'endogenous': [1438, 1747], 'ligand': [1439, 1748, 2016, 2447], 'receptor': [1443, 1609, 1671, 1688, 1752, 1768, 1794, 1825, 1962, 1988, 2006, 2317, 2539, 2676, 2828, 2986], 'cholesterol-loaded': [1445, 1754], '276:': [1450, 1759, 2848, 3006], '38378-38387Google': [1451, 1760], 'depletion': [1457], 'normally': [1508, 2065], 'level': [1510], 'parenchymal': [1517], '4-fold': [1521], 'feeding': [1523], 'high-cholesterol': [1525, 1596], 'diet': [1526, 1597], '(9Hoekstra': [1527], 'data': [1564], 'sterol-mediated': [1566], 'important': [1576, 2470, 3375], 'initiation': [1579], 'atherosclerosis': [1581, 2634], 'and,': [1582], 'tissue': [1587, 2362], 'involved': [1588], 'homeostasis.': [1591], 'stimulates': [1598, 2475], 'activation': [1604, 1984, 2039, 2162, 2175, 2460, 2603], '(LXR)': [1610], 'pathway': [1612, 1820, 2613], '(19Repa': [1613, 2481, 2635], 'Turley': [1615, 2483, 2637], 'Medina': [1619, 1874, 2487, 2641, 3630], 'Li': [1621, 1876, 2083, 2489, 2643, 3632], 'Lustig': [1623, 2491, 2645], 'Shan': [1625, 2493, 2647], 'B.': [1626, 2494, 2648], 'Heyman': [1627, 1787, 1955, 2122, 2234, 2495, 2649, 2703], 'R.A.': [1628, 1788, 1956, 2123, 2235, 2496, 2650, 2704], 'Dietschy': [1629, 2497, 2651], 'Regulation': [1633, 2501, 2655], 'absorption': [1635, 2503, 2657], 'ABC1-mediated': [1637, 2505, 2659], 'heterodimers.Science.': [1643, 2511, 2665], '289:': [1645, 2513, 2667], '1524-1529Google': [1646, 2514, 2668], '20Venkateswaran': [1648, 2516], 'Laffitte': [1650, 2228, 2518, 2697], 'B.A.': [1651, 1808, 2043, 2229, 2519, 2698], 'Joseph': [1652, 2222, 2520, 2691], 'S.B.': [1653, 2223, 2521, 2692], 'Mak': [1654, 2522], 'Wilpitz': [1656, 2524], 'D.C.': [1657, 2525], 'Tontonoz': [1660, 2528], 'P.': [1661, 1683, 1763, 2440, 2529, 2575, 2671, 2788, 3317], 'Control': [1662, 2530], 'oxysterol': [1670, 1818, 2052, 2446, 2538], 'alpha.Proc.': [1673, 2541], '12097-12102Google': [1680, 2548], '21Tontonoz': [1682, 1762, 2670], 'Liver': [1686, 1766, 2091, 2674, 4000], 'signaling': [1689, 1769, 2677], 'pathways': [1690, 1770, 2678], 'cardiovascular': [1692, 1772, 2680], 'disease.Mol.': [1693, 1773, 2681], 'Endocrinol.': [1694, 1774, 2101, 2682], '17:': [1696, 1776, 2103, 2684], '985-993Google': [1697, 1777, 2685], 'LXRα': [1703, 2330], 'LXRβ': [1705, 2332], 'obligate': [1707], 'bind': [1715, 1901], 'naturally': [1716], 'occurring': [1717], 'oxidized': [1718], 'derivatives': [1720], 'such': [1721, 1863], '24(S),25-epoxycholesterol,': [1723], '22(R)-,': [1724], '24(S)-,': [1725], '27-hydroxycholesterol': [1727], '(18Fu': [1728], '22Willy': [1779], 'P.J.': [1780, 1810, 1948, 1976], 'Umesono': [1781, 1949], 'Ong': [1783, 1951], 'E.S.': [1784, 1952], 'Evans': [1785, 1909, 1953], 'R.M.': [1786, 1910, 1954, 2553], 'LXR,': [1791, 1959], 'defines': [1796, 1964], 'distinct': [1798, 1966], 'pathway.Genes': [1801, 1969], 'Dev.': [1802, 1894, 1970, 1990, 2056, 3650], '1995;': [1803, 1917, 1971], '9:': [1804, 1972], '1033-1045Google': [1805, 1973], '23Janowski': [1807], 'Willy': [1809], 'Devi': [1811], 'T.R.': [1812], 'Falck': [1813], 'J.R.': [1814, 1867, 3623], 'An': [1817], 'signalling': [1819], 'mediated': [1821], 'alpha.Nature.': [1827], '383:': [1829], '728-731Google': [1830], '24Edwards': [1832], 'Kast': [1834], 'H.R.': [1835], 'Anisfeld': [1836], 'A.M.': [1837], 'BAREing': [1838], 'it': [1839], 'all:': [1840], 'adoption': [1842], 'FXR': [1846], 'their': [1848, 3574], 'roles': [1849, 2128], 'homeostasis.J.': [1852], '2-12Google': [1857], 'synthetic': [1860, 2445], 'nonsteroidal': [1861], 'compounds': [1862], 'T-0901317': [1865, 2344, 3621, 4157], '(25Schultz': [1866, 3622], 'Tu': [1868, 3624], 'Luk': [1870, 3626], 'J.C.': [1875, 3631], 'Schwendner': [1878, 3634], 'Thoolen': [1882, 3638], 'al.Role': [1887, 3643], 'LXRs': [1889, 3645], 'control': [1891, 3647], 'lipogenesis.Genes': [1893, 3649], '14:': [1896, 3652], '2831-2838Google': [1897, 3653], 'agonist': [1903, 3758], '9-cis-retinoic': [1904], 'acid': [1905], '(9cRA)': [1906], '(26Mangelsdorf': [1907], 'orphan': [1915, 1987], 'receptors.Cell.': [1916], '83:': [1918], '841-850Google': [1919], 'recognize': [1923], '(LXRE)': [1928], 'sequence': [1929, 2790, 3267, 3825, 3910, 4290], 'containing': [1930, 3720, 3747, 3923, 3964, 4012], 'variant': [1932], 'direct-repeat-4': [1933], '(DR4)': [1934], 'motif': [1935], 'promoters': [1938, 3272], 'several': [1942, 2355], 'genes': [1943, 2318], 'affecting': [1944], '(22Willy': [1947], '27Willy': [1975], 'Unique': [1979], 'requirements': [1980], 'retinoid-dependent': [1982], 'LXR.Genes': [1989], '289-298Google': [1993], '28Steffensen': [1995], 'K.R.': [1996], 'Gustafsson': [1997, 2405], 'Putative': [1999], 'metabolic': [2000], 'effects': [2001], '(LXR).Diabetes.': [2007], '53:': [2009], '36-42Google': [2010], 'can': [2022, 2333], 'activate': [2023, 2334], 'heterodimer': [2025, 2063], 'submaximally': [2026], 'transcription,': [2029], 'whereas': [2030], 'ligands': [2031], 'both': [2033, 2325], 'required': [2036], 'maximal': [2038], '(29Peet': [2040], 'Janowski': [2042], 'LXRs:': [2047], 'new': [2049], 'class': [2050], 'receptors.Curr.': [2053], 'Opin.': [2054], '1998;': [2057], '8:': [2058], '571-575Google': [2059], 'corepressor': [2069], 'coactivator': [2071, 2158], 'absence': [2075, 3118, 3507], 'agonists,': [2079], 'respectively': [2080], '(30Hu': [2081], 'Xia': [2087], 'Lala': [2089], 'D.S.': [2090], 'interact': [2094], 'corepressors': [2096], 'regulate': [2098, 3274], 'expression.Mol.': [2100, 2142], '1019-1026Google': [2104], '31Wagner': [2106], 'B.L.': [2107, 2225, 2694], 'Valledor': [2108], 'A.F.': [2109], 'Shao': [2110], 'Daige': [2112, 2230, 2699], 'C.L.': [2113, 2231, 2700], 'Bischoff': [2114, 2220, 2689], 'E.D.': [2115, 2221, 2690, 3287], 'Petrowski': [2116], 'Jepsen': [2118], 'Baek': [2120], 'S.H.': [2121], 'Rosenfeld': [2124], 'M.G.': [2125], 'al.Promoter-specific': [2127], 'receptor/corepressor': [2132], 'complexes': [2133], 'ABCA1': [2138], 'SREBP1': [2140], 'Cell.': [2143], '23:': [2146], '5780-5789Google': [2147], '32Huuskonen': [2149], 'Fielding': [2151, 2153], 'P.E.': [2152], 'C.J.': [2154], 'Role': [2155, 2944], 'p160': [2157], 'receptor.Arterioscler.': [2166], 'Thromb.': [2167], 'Vasc.': [2168], '24:': [2171], '703-708Google': [2172], 'dramatically': [2176], 'increases': [2177], '(17Venkateswaran': [2183, 2260], '33Tangirala': [2218, 2687], 'R.K.': [2219, 2688], 'Wagner': [2224, 2693], 'Walczak': [2226, 2695], 'Thomas': [2232, 2701], 'al.Identification': [2239, 2708], 'inhibitors': [2246, 2715], 'atherosclerosis.Proc.': [2248, 2717], '99:': [2254, 2723], '11896-11901Google': [2255, 2724], 'Venkateswaran': [2257, 2808, 2966], 'inducibility': [2298], 'retained': [2306], 'mice': [2310, 2323, 2342, 3985], 'lacking': [2311, 2324], 'lost': [2321], 'genes,': [2326, 2610], 'indicating': [2327], 'elevate': [2349], 'markedly': [2350, 3615], 'adipose': [2361, 2421], '34Ulven': [2401], 'S.M.': [2402], 'Dalen': [2403], 'K.T.': [2404], 'Nebb': [2407], 'H.I.': [2408], 'Tissue-specific': [2409], 'autoregulation': [2410], 'LXRalpha': [2413], 'facilitates': [2415], 'induction': [2416], 'apoE': [2418], 'tissue.J.': [2422], '45:': [2426, 2456], '2052-2062Google': [2427], '35Quinet': [2429], 'E.M.': [2430, 3343], 'Savio': [2431], 'D.A.': [2432], 'Halpern': [2433], 'Miller': [2437], 'Nambi': [2439], 'Gene-selective': [2441], 'modulation': [2442], 'receptor.J.': [2452, 2594], '1929-1942Google': [2457], 'also': [2461], 'strongly': [2462], 'activates': [2463, 2829, 2987], 'transcription': [2464, 2909, 3276, 3597], 'cholesterol/phospholipid': [2471], 'ABCA1,': [2473, 2606], 'circulating': [2478], 'apolipoprotein': [2479], 'A-I': [2480], '36Schwartz': [2550], 'Lawn': [2552], 'Wade': [2554], 'D.P.': [2555], 'ABC1': [2556, 2586], 'ApoA-I-mediated': [2560], 'LXR.Biochem.': [2566], '274:': [2571], '794-802Google': [2572], '37Costet': [2574], 'Luo': [2576], 'Sterol-dependent': [2582], 'transactivation': [2583], 'receptor/retinoid': [2592], '28240-28245Google': [2599], 'By': [2601], 'critical': [2615], 'homeostasis,': [2621], 'prevention': [2626], 'accumulation': [2629], 'leading': [2632], 'on': [2730, 3328, 3795, 3841, 3959], '21q22.3': [2732], 'relatively': [2734], 'expansive': [2735], 'subject': [2737], 'alternative': [2739, 2840, 2998], 'RNA': [2740, 3686, 3774, 3888, 4172, 4196], 'splicing': [2741], '(38Langmann': [2742, 2865, 3043, 3432], 'Unkelbach': [2746, 2869, 3047, 3436], 'U.': [2747, 2870, 3048, 3437], 'Genomic': [2752, 2789, 2875, 3053, 3442], 'organization': [2753, 2876, 3054, 3443], 'transporter-G1': [2764, 2887, 3065, 3454], 'gene.Biochim.': [2766, 2889, 3067, 3456], 'Acta.': [2768, 2891, 3069, 3458], '1494:': [2770, 2893, 3071, 3460], '175-180Google': [2771, 2894, 3072, 3461], '39Lorkowski': [2773], 'Rust': [2775], 'Engel': [2777], 'Jung': [2779], 'Tegelkamp': [2781], 'Galinski': [2783], 'E.A.': [2784], 'Assmann': [2785], 'Cullen': [2787], 'structure': [2792], 'gene.Biochem.': [2798], '280:': [2803], '121-131Google': [2804], '40Kennedy': [2806], 'Tarr': [2810, 2968], 'P.T.': [2811, 2969], 'Xenarios': [2812, 2970], 'Kudoh': [2814, 2972], 'Shimizu': [2816, 2974], 'Characterization': [2820, 2978], 'gene:': [2825, 2983], 'internal': [2831, 2989], 'produces': [2834, 2992], 'novel': [2836, 2994], 'transcript': [2837, 2853, 2995, 3086, 3475], 'encoding': [2838, 2996], 'protein.J.': [2844, 3002], '39438-39447Google': [2849, 3007], 'derived': [2855], '15': [2857], 'exons': [2858, 3032, 3076, 3270, 3421, 3465, 3912], 'spanning': [2859], 'region': [2861, 2898, 2929], '78.1': [2863], 'kb': [2864], 'Its': [2896], 'GC-rich': [2901], 'lacks': [2903], 'TATA': [2905], 'box;': [2906], 'furthermore,': [2907], 'start': [2910, 4255], 'site(s)': [2911], 'adequately': [2915], 'determined': [2916, 4258], 'previously.': [2917], 'Efforts': [2918], 'find': [2920], 'LXRE': [2923], 'upstream': [2928], 'unsuccessful': [2937], '(41Schmitz': [2938], 'Heimerl': [2942], 'ABCG': [2949], 'family': [2950], 'members': [2951], 'metabolism.J.': [2954], '1513-1520Google': [2959], '(40Kennedy': [2964], 'putative': [3011], 'LXREs': [3012, 3246, 3376, 3396], 'intron': [3016, 3250], '2To': [3017, 3406, 4297], 'prevent': [3018, 3407, 4298], 'confusion': [3019, 3408, 4299], 'facilitate': [3022, 3411, 4302], 'cross-species': [3023, 3412, 4303], 'comparison,': [3024, 3413, 4304], 'this': [3026, 3104, 3356, 3415, 3493, 4306], 'study,': [3027, 3361, 3416, 4307], 'number': [3029, 3418], 'according': [3035, 3424, 4182], 'table': [3038, 3427], 'lists': [3075, 3464], 'described': [3080, 3469, 4218], 'apparently': [3082, 3471], '(GenBank': [3087, 3476], 'accessions': [3088, 3477], 'BC029158,': [3089, 3478], 'NM_004915,': [3090, 3479], 'NM_016818)': [3092, 3481], 'initiated': [3093, 3482], 'Fig.': [3099, 3488], '2.': [3100, 3489], 'Transcripts': [3101, 3490], 'initiating': [3102, 3491], 'actually': [3106, 3495], 'consist': [3107, 3496], 'alternatively': [3110, 3499], 'spliced': [3111, 3500], 'isoforms': [3112, 3501], 'differing': [3113, 3502], '36': [3120, 3509], 'coding': [3121, 3510, 4289], 'bases,': [3122, 3511], 'because': [3123, 3512], 'alternate': [3129, 3518], 'splice': [3130, 3519], 'donor': [3131, 3520], 'sites': [3132, 3521, 4256], 'end': [3135, 3524], 'exon': [3137, 3526, 4295], '9': [3138, 3527], '(4Chen': [3139, 3528], 'gene;': [3181], 'however,': [3182], 'these': [3183], 'genes.': [3194], 'Very': [3195], 'published': [3238], 'preliminary': [3239], 'evidence': [3240], 'different': [3243], 'set': [3244], 'Vertebrate': [3256], 'genomes': [3257], 'now': [3259], 'contain': [3262], 'far': [3268], 'over': [3277], 'distances': [3279], '(42Margulies': [3280], 'E.H.': [3281], 'Blanchette': [3282], 'Haussler': [3284], 'Green': [3286], 'Identification': [3288], 'multi-species': [3292], 'sequences.Genome': [3294], '13:': [3297], '2507-2518Google': [3298], '43Dermitzakis': [3300], 'E.T.': [3301], 'Reymond': [3302], 'Lyle': [3304], 'Scamuffa': [3306], 'Ucla': [3308], 'Deutsch': [3310], 'Stevenson': [3312], 'B.J.': [3313], 'Flegel': [3314], 'V.': [3315, 3341], 'Bucher': [3316], 'Jongeneel': [3318], 'C.V.': [3319], 'al.Numerous': [3321], 'potentially': [3322, 3372], 'non-genic': [3325], '21.Nature.': [3331], '420:': [3333], '578-582Google': [3334], '44Nobrega': [3336], 'Ovcharenko': [3338], 'Afzal': [3340], 'Rubin': [3342], 'Scanning': [3344], 'deserts': [3347], 'long-range': [3349], 'enhancers.Science.': [3350], '302:': [3352], '413Google': [3353], 'Adopting': [3355], 'perspective': [3357], 'present': [3360], 'employed': [3364], 'evolutionary': [3365], 'conservation': [3366], 'criterion': [3369], 'identifying': [3371], 'near': [3379], 'report': [3385], 'novel,': [3390], 'robustly': [3391], 'active,': [3392], '(LXRE-A': [3397], 'LXRE-B)': [3399], 'demonstrate': [3573], 'functionality': [3575], 'hepatic': [3580], 'cell': [3581, 4068, 4084, 4221], 'lines.': [3582, 4222], 'enhance': [3585], 'our': [3586], 'understanding': [3587], 'mechanisms': [3590], 'upregulate': [3594], 'changes': [3606], 'alter': [3616], 'purchased': [3656], 'Cayman': [3658], 'Chemical': [3659], 'Co.': [3660], '(Ann': [3661], 'Arbor,': [3662], 'MI).': [3663], '22(R)-hydroxycholesterol': [3664], '(22-OH-cholesterol)': [3665], '9cRA': [3667], 'Sigma': [3670], '(St.': [3671], 'Louis,': [3672], 'MO).': [3673], 'Stock': [3674], 'solutions': [3675], 'dissolved': [3677], '95%': [3679], 'ethanol.': [3680], 'total': [3685, 3791, 3887, 4195], 'placenta': [3688], 'Clontech': [3693], '(Palo': [3694], 'Alto,': [3695], 'CA).': [3696, 3979], '[American': [3705], 'Type': [3706, 4016], 'Culture': [3707], 'Collection': [3708], '(ATCC);': [3709], 'Manassas,': [3710], 'VA]': [3711], 'maintained': [3713], "Dulbecco's": [3715], 'modified': [3716], "Eagle's": [3717], 'medium': [3718, 3741], '(DMEM)': [3719], '10%': [3721, 4147], 'bovine': [3723, 4149], 'serum.': [3724, 4150], 'For': [3725, 4187], 'studies,': [3727], 'grown': [3730], '75': [3732], 'cm2': [3733], 'flasks': [3734], 'until': [3735], '60–70%': [3736], 'confluency': [3737], 'reached.': [3739], 'changed': [3743], 'serum-free': [3745], 'DMEM': [3746], '1': [3748, 3927, 4017, 4155], 'mg/ml': [3749, 4014], 'BSA,': [3750], 'treated': [3755, 4153], 'drug(s)': [3759], 'vehicle': [3761], '12': [3763], 'h.': [3764, 4170], 'All': [3765], 'experimental': [3766], 'conditions': [3767], 'tested': [3769], 'triplicate': [3771], 'flasks.': [3772], 'Total': [3773, 4171], 'isolated': [3776, 4174], 'using': [3777, 3830, 3889, 4175], 'Trizol': [3778], 'reagent': [3779, 4178], '(Invitrogen;': [3780], 'Carlsbad,': [3781], 'CA)': [3782], 'instructed': [3784], 'manufacturer.': [3787], 'Ten': [3788], 'micrograms': [3789], 'RNA/lane': [3792], 'electrophoresed': [3794, 4200], '1%': [3797], 'agarose': [3798, 3962], 'gel,': [3799], 'blotted': [3800], 'onto': [3801], 'ZetaProbe': [3802], 'GT': [3803], 'membranes': [3804], '(Bio-Rad;': [3805], 'Hercules,': [3806], 'CA),': [3807, 3849], 'probed': [3809], '32P-labeled': [3812], '252': [3813], 'bp': [3814, 3909], 'corresponding': [3816], 'bases': [3818, 4285], '1,052–1,303': [3819], 'GenBank': [3827, 3917], 'accession': [3828, 3918], 'NM_009593,': [3829], 'standard': [3831], 'methods': [3832], 'Northern': [3834, 4188], 'blotting.': [3835], 'Radioactive': [3836], 'bands': [3837], 'visualized,': [3839], 'quantitated': [3840, 4232], 'phosphorimager': [3843], '(model': [3844], '445SI;': [3845], 'Dynamics,': [3847], 'Sunnyvale,': [3848], 'normalized': [3851, 4238], 'intensities': [3853], 'cyclophilin': [3855, 3867, 4214, 4240], 'obtained': [3857], 'after': [3858, 4107], 'rehybridizing': [3859], 'blot': [3861, 4189], 'probe': [3864], '(Ambion;': [3869], 'Austin,': [3870], 'TX,': [3871], '#7375).': [3872], 'RT-PCR': [3881], 'first-strand': [3883], 'prepared': [3885], 'SuperScript': [3890], 'II': [3891], 'transcriptase': [3893], '(Invitrogen).': [3894], 'forward': [3896], 'PCR': [3899, 3921], 'primers': [3900], 'GCCACTTTCGTGGGCCCAGTGA': [3902], 'TCTCATCACCAGCTGTGTTGCA,': [3904], 'amplifies': [3906], '658': [3908], 'within': [3911], '14–15': [3913], '(bases': [3914], '1,763–2,420': [3915], 'BC029158).': [3919], 'Touchdown': [3920], 'reactions': [3922], 'Taq': [3924], 'polymerase': [3925], 'μl': [3928], 'synthesis': [3931], 'reaction': [3932], 'carried': [3934], 'out': [3935], 'annealing': [3937], 'temperatures': [3938], '63°C,': [3940], '61°C,': [3941], '59°C': [3943], '5': [3945, 4101, 4192], 'cycles': [3946], 'each,': [3947], 'followed': [3948, 4005, 4094], '57°C': [3950], '25': [3952], 'cycles.': [3953], 'Aliquots': [3954], '(12.5': [3955], 'μl)': [3956], 'analyzed': [3958], '1.2%': [3961], 'gel': [3963], '0.5': [3965], 'μg/ml': [3966], 'ethidium': [3967], 'bromide': [3968], 'photographed': [3970], 'ChemiImager': [3973, 4234], '5500': [3974, 4235], '(Alpha': [3975], 'Innotech;': [3976], 'San': [3977], 'Leandro,': [3978], 'Livers': [3980], '3-month-old': [3982], 'C57Bl/6': [3983], 'male': [3984], 'perfused': [3987], 'vena': [3990], 'cava': [3991], 'common': [3993], 'duct': [3995], '3–4': [3997], 'ml': [3998, 4008], 'Perfusion': [4001], 'Medium': [4002, 4091], '(Invitrogen/Gibco,': [4003], '#17701)': [4004], '4–8': [4007], 'solution': [4011, 4034], '7.5': [4013], 'collagenase': [4015], '(Worthington;': [4018], 'Lakewood,': [4019], 'NJ,': [4020], '#LS004196)': [4021], '10': [4023, 4039, 4159], 'μl/ml': [4024], 'protease': [4025], 'inhibitor': [4026], 'cocktail': [4027], '(Sigma,': [4028], '#P8340)': [4029], 'Hanks': [4031], 'balanced': [4032], 'saline': [4033], '(Gibco,': [4035, 4092, 4141], '#14175)': [4036], 'supplemented': [4037, 4143], 'mM': [4040, 4042], 'CaCl2/10': [4041], 'Hepes': [4043], '(Gibco': [4044], '#15630)': [4045], '37°C.': [4047], 'dispersed': [4051], 'mincing': [4053], 'trituration': [4055], 'large-bore': [4058], 'pipette,': [4059], 'suspension': [4062], 'passed': [4064], 'nylon': [4067], 'strainer': [4069], '(100': [4070], 'μm': [4071], 'pore;': [4072], 'BD-Falcon': [4073], '#352360,': [4074], 'BD-Bioscience,': [4075], 'Bedford,': [4076], 'MA).': [4077], 'Hepatocytes': [4078], 'separated': [4080], 'smaller': [4082], 'types': [4085], 'washing': [4087], 'Hepatocyte': [4089], 'Wash': [4090], '#17704)': [4093], 'centrifugations': [4096], '50': [4098], 'g': [4099], 'min': [4102], 'five': [4103], 'six': [4105], 'times,': [4106], 'judged': [4112], 'light': [4114], 'microscopy': [4115], 'entirely': [4118], '(>99.5%)': [4119], 'isolated,': [4122], 'washed': [4123], 'plated': [4126], '6-well': [4128], 'poly-lysine-coated': [4129], 'plates': [4130], '(BD-BioCoat,': [4131], '#354413)': [4132], '106': [4137], 'cells/well': [4138], 'DMEM/F12': [4140], '#11039)': [4142], 'penicillin-streptomycin-glutamine': [4145], 'Cells': [4151], 'μM': [4156, 4160], 'and/or': [4158], '9cRA,': [4161], 'solvent': [4163], 'alone': [4164], '(ethanol,': [4165], 'final': [4166], '0.2%)': [4167], '16': [4169], 'Ultraspec-RNA': [4177], '(Biotecx;': [4179], 'Houston,': [4180], 'TX)': [4181], "manufacturer's": [4185], 'instructions.': [4186], 'analysis,': [4190], 'μg': [4193], 'per': [4197], 'lane': [4198], 'hybridized': [4202], 'probe,': [4208, 4216], 'subsequently': [4210], 'above': [4219], 'densities': [4224], 'band': [4230, 4243, 4252], 'software': [4236], 'intensities,': [4244], 'independently': [4246], '18S': [4248], '28S': [4250], 'rRNA': [4251], 'intensities.': [4253], 'Transcription': [4254], '5′-rapid': [4260], 'amplification': [4261], 'ends': [4264], '(RACE)': [4265], 'use': [4267], 'Smart': [4270], 'RACE': [4271], 'Amplification': [4273], 'Kit': [4274], '(Clontech).': [4275], 'gene-specific': [4277], 'primer': [4278], 'TGGAGTGCCTTCGGGTCGCGAAGAGGAG,': [4280], 'complementary': [4283], '176–203': [4286], '2,': [4296]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2166536336', 'counts_by_year': [{'year': 2024, 'cited_by_count': 3}, {'year': 2023, 'cited_by_count': 6}, {'year': 2022, 'cited_by_count': 3}, {'year': 2021, 'cited_by_count': 7}, {'year': 2020, 'cited_by_count': 5}, {'year': 2019, 'cited_by_count': 7}, {'year': 2018, 'cited_by_count': 3}, {'year': 2017, 'cited_by_count': 6}, {'year': 2016, 'cited_by_count': 4}, {'year': 2015, 'cited_by_count': 3}, {'year': 2014, 'cited_by_count': 7}, {'year': 2013, 'cited_by_count': 11}, {'year': 2012, 'cited_by_count': 14}], 'updated_date': '2024-12-10T01:04:47.886076', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
