Localization Versus Function of Rab3 Proteins

Name: Work Video:
Duration: 3 min 30 s
Oliver M. Schlüter; Mikhail Khvotchev; Reinhard Jahn; Thomas C. Südhof
{'id': 'https://openalex.org/W2160125876', 'doi': 'https://doi.org/10.1074/jbc.m203704200', 'title': 'Localization Versus Function of Rab3 Proteins', 'display_name': 'Localization Versus Function of Rab3 Proteins', 'publication_year': 2002, 'publication_date': '2002-10-01', 'ids': {'openalex': 'https://openalex.org/W2160125876', 'doi': 'https://doi.org/10.1074/jbc.m203704200', 'mag': '2160125876', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/12167638'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m203704200', 'pdf_url': 'http://www.jbc.org/article/S0021925819722042/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819722042/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5018800554', 'display_name': 'Oliver M. Schlüter', 'orcid': 'https://orcid.org/0000-0001-8958-5815'}, 'institutions': [{'id': 'https://openalex.org/I4210131661', 'display_name': 'Max Planck Institute for Biophysical Chemistry', 'ror': 'https://ror.org/03e76ya46', 'country_code': 'DE', 'type': 'facility', 'lineage': ['https://openalex.org/I149899117', 'https://openalex.org/I4210131661']}, {'id': 'https://openalex.org/I4210137682', 'display_name': 'Max Planck Institute of Experimental Medicine', 'ror': 'https://ror.org/04a7f6w43', 'country_code': 'DE', 'type': 'facility', 'lineage': ['https://openalex.org/I149899117', 'https://openalex.org/I4210137682']}], 'countries': ['DE'], 'is_corresponding': False, 'raw_author_name': 'Oliver M. Schlüter', 'raw_affiliation_strings': ['Max-Planck-Institut für biophysikalische Chemie, 37075 Göttingen, Germany and the', 'Max-Planck-Institut für experimentelle Medizin and'], 'affiliations': [{'raw_affiliation_string': 'Max-Planck-Institut für biophysikalische Chemie, 37075 Göttingen, Germany and the', 'institution_ids': ['https://openalex.org/I4210131661']}, {'raw_affiliation_string': 'Max-Planck-Institut für experimentelle Medizin and', 'institution_ids': ['https://openalex.org/I4210137682']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5013505487', 'display_name': 'Mikhail Khvotchev', 'orcid': 'https://orcid.org/0000-0001-9328-8549'}, 'institutions': [{'id': 'https://openalex.org/I867280407', 'display_name': 'The University of Texas Southwestern Medical Center', 'ror': 'https://ror.org/05byvp690', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I867280407']}, {'id': 'https://openalex.org/I1344073410', 'display_name': 'Howard Hughes Medical Institute', 'ror': 'https://ror.org/006w34k90', 'country_code': 'US', 'type': 'nonprofit', 'lineage': ['https://openalex.org/I1344073410']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Mikhail Khvotchev', 'raw_affiliation_strings': ['Department of Molecular Genetics, Center for Basic Neuroscience, and Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, Dallas, Texas 75390-9111'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Genetics, Center for Basic Neuroscience, and Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, Dallas, Texas 75390-9111', 'institution_ids': ['https://openalex.org/I867280407', 'https://openalex.org/I1344073410']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5077214003', 'display_name': 'Reinhard Jahn', 'orcid': 'https://orcid.org/0000-0003-1542-3498'}, 'institutions': [{'id': 'https://openalex.org/I4210131661', 'display_name': 'Max Planck Institute for Biophysical Chemistry', 'ror': 'https://ror.org/03e76ya46', 'country_code': 'DE', 'type': 'facility', 'lineage': ['https://openalex.org/I149899117', 'https://openalex.org/I4210131661']}], 'countries': ['DE'], 'is_corresponding': False, 'raw_author_name': 'Reinhard Jahn', 'raw_affiliation_strings': ['Max-Planck-Institut für biophysikalische Chemie, 37075 Göttingen, Germany and the'], 'affiliations': [{'raw_affiliation_string': 'Max-Planck-Institut für biophysikalische Chemie, 37075 Göttingen, Germany and the', 'institution_ids': ['https://openalex.org/I4210131661']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5061921730', 'display_name': 'Thomas C. Südhof', 'orcid': 'https://orcid.org/0000-0003-3361-9275'}, 'institutions': [{'id': 'https://openalex.org/I867280407', 'display_name': 'The University of Texas Southwestern Medical Center', 'ror': 'https://ror.org/05byvp690', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I867280407']}, {'id': 'https://openalex.org/I1344073410', 'display_name': 'Howard Hughes Medical Institute', 'ror': 'https://ror.org/006w34k90', 'country_code': 'US', 'type': 'nonprofit', 'lineage': ['https://openalex.org/I1344073410']}], 'countries': ['US'], 'is_corresponding': True, 'raw_author_name': 'Thomas C. Südhof', 'raw_affiliation_strings': ['Department of Molecular Genetics, Center for Basic Neuroscience, and Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, Dallas, Texas 75390-9111'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Genetics, Center for Basic Neuroscience, and Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, Dallas, Texas 75390-9111', 'institution_ids': ['https://openalex.org/I867280407', 'https://openalex.org/I1344073410']}]}], 'institution_assertions': [], 'countries_distinct_count': 2, 'institutions_distinct_count': 4, 'corresponding_author_ids': ['https://openalex.org/A5061921730'], 'corresponding_institution_ids': ['https://openalex.org/I867280407', 'https://openalex.org/I1344073410'], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 3.149, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 162, 'citation_normalized_percentile': {'value': 0.92558, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 97, 'max': 98}, 'biblio': {'volume': '277', 'issue': '43', 'first_page': '40919', 'last_page': '40929'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10617', 'display_name': 'Cellular transport and secretion', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10617', 'display_name': 'Cellular transport and secretion', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T12009', 'display_name': 'Hedgehog Signaling Pathway Studies', 'score': 0.9961, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T12286', 'display_name': 'Erythrocyte Function and Pathophysiology', 'score': 0.9957, 'subfield': {'id': 'https://openalex.org/subfields/2737', 'display_name': 'Physiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}], 'keywords': [], 'concepts': [{'id': 'https://openalex.org/C14036430', 'wikidata': 'https://www.wikidata.org/wiki/Q3736076', 'display_name': 'Function (biology)', 'level': 2, 'score': 0.59284985}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.37647292}, {'id': 'https://openalex.org/C70721500', 'wikidata': 'https://www.wikidata.org/wiki/Q177005', 'display_name': 'Computational biology', 'level': 1, 'score': 0.35472533}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.35124868}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.3231817}], 'mesh': [], 'locations_count': 1, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m203704200', 'pdf_url': 'http://www.jbc.org/article/S0021925819722042/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m203704200', 'pdf_url': 'http://www.jbc.org/article/S0021925819722042/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'score': 0.47, 'display_name': 'Decent work and economic growth', 'id': 'https://metadata.un.org/sdg/8'}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 51, 'referenced_works': ['https://openalex.org/W11429024', 'https://openalex.org/W1481197108', 'https://openalex.org/W1483422351', 'https://openalex.org/W1505415396', 'https://openalex.org/W1511501308', 'https://openalex.org/W1515271603', 'https://openalex.org/W1535011143', 'https://openalex.org/W162703911', 'https://openalex.org/W1670369629', 'https://openalex.org/W1832730936', 'https://openalex.org/W185955435', 'https://openalex.org/W1949772429', 'https://openalex.org/W1977451474', 'https://openalex.org/W1981226439', 'https://openalex.org/W1981824793', 'https://openalex.org/W1992163176', 'https://openalex.org/W1996462307', 'https://openalex.org/W2007266423', 'https://openalex.org/W2007984489', 'https://openalex.org/W2011593319', 'https://openalex.org/W2014045979', 'https://openalex.org/W2014556138', 'https://openalex.org/W2019770785', 'https://openalex.org/W2026458898', 'https://openalex.org/W2043921136', 'https://openalex.org/W2052394407', 'https://openalex.org/W2055386099', 'https://openalex.org/W2061017589', 'https://openalex.org/W2063835407', 'https://openalex.org/W2063959590', 'https://openalex.org/W2067722891', 'https://openalex.org/W2076358500', 'https://openalex.org/W2079683808', 'https://openalex.org/W2084959064', 'https://openalex.org/W2088387899', 'https://openalex.org/W2093465143', 'https://openalex.org/W2094702456', 'https://openalex.org/W2095144685', 'https://openalex.org/W2097095370', 'https://openalex.org/W2100837269', 'https://openalex.org/W2101108802', 'https://openalex.org/W2106255703', 'https://openalex.org/W2122933205', 'https://openalex.org/W2132373397', 'https://openalex.org/W2145152234', 'https://openalex.org/W2156169441', 'https://openalex.org/W2162754718', 'https://openalex.org/W2233809722', 'https://openalex.org/W249983744', 'https://openalex.org/W2772132150', 'https://openalex.org/W637806715'], 'related_works': ['https://openalex.org/W4387497383', 'https://openalex.org/W4229748205', 'https://openalex.org/W2948807893', 'https://openalex.org/W2778153218', 'https://openalex.org/W2748952813', 'https://openalex.org/W2527526854', 'https://openalex.org/W2062208111', 'https://openalex.org/W1986764834', 'https://openalex.org/W1976181487', 'https://openalex.org/W1531601525'], 'abstract_inverted_index': {'Rab3A,': [0, 120, 152, 322, 442, 474, 654, 1547, 2131, 2637], 'Rab3B,': [1, 121, 153, 323, 443, 475, 655, 2132, 2645, 4170], 'Rab3C,': [2, 324, 656, 2133, 2654], 'and': [3, 19, 27, 112, 122, 127, 154, 160, 222, 236, 250, 305, 325, 341, 349, 434, 444, 449, 476, 482, 544, 558, 572, 627, 657, 700, 737, 740, 791, 1144, 1188, 1318, 1336, 1385, 1428, 1459, 1510, 1666, 1714, 1724, 1752, 1767, 1862, 1885, 1912, 1941, 1973, 1981, 2012, 2077, 2086, 2096, 2134, 2148, 2224, 2226, 2272, 2308, 2322, 2340, 2374, 2488, 2514, 2521, 2528, 2546, 2575, 2586, 2589, 2632, 2641, 2649, 2655, 2658, 2678, 2688, 2705, 2713, 2718, 2723, 2731, 2736, 2741, 2743, 2752, 2757, 2781, 2784, 2815, 2817, 2848, 2884, 2892, 2988, 3011, 3066, 3068, 3089, 3113, 3150, 3203, 3229, 3251, 3269, 3280, 3298, 3332, 3357, 3439, 3460, 3525, 3565, 3590, 3601, 3619, 3668, 3679, 3752, 3806, 3838, 3884, 3890, 3944, 3946, 3963, 3977, 4005, 4017, 4034, 4041, 4061, 4102, 4151, 4203, 4208, 4238, 4282], 'Rab3D': [4, 135, 326, 457, 658, 781, 1717, 2135, 2542, 2806], 'constitute': [5, 327], 'a': [6, 91, 178, 184, 199, 245, 293, 314, 317, 328, 413, 500, 506, 521, 567, 615, 636, 639, 647, 950, 1013, 1134, 1148, 1194, 1262, 1292, 1330, 1351, 1401, 1542, 1576, 1599, 1709, 2099, 2211, 2381, 2553, 2571, 2708, 2727, 2747, 2797, 3042, 3077, 3086, 3131, 3159, 3407, 3843, 4184, 4262], 'family': [7, 329, 648], 'of': [8, 43, 51, 55, 59, 68, 77, 89, 232, 247, 262, 271, 280, 316, 330, 365, 373, 377, 381, 390, 399, 411, 554, 569, 584, 593, 602, 638, 649, 876, 937, 953, 1127, 1147, 1151, 1183, 1203, 1286, 1338, 1353, 1372, 1404, 1412, 1423, 1426, 1450, 1461, 1538, 1544, 1546, 1579, 1583, 1591, 1602, 1608, 1741, 1749, 1758, 1977, 1990, 2153, 2158, 2185, 2220, 2274, 2282, 2298, 2312, 2344, 2504, 2556, 2603, 2873, 2876, 2880, 2895, 3014, 3106, 3111, 3116, 3133, 3161, 3277, 3292, 3343, 3370, 3436, 3473, 3528, 3535, 3538, 3598, 3613, 3634, 3659, 3735, 3737, 3742, 3786, 3803, 3821, 3863, 3871, 3876, 3879, 3904, 3912, 3917, 3941, 3952, 3993, 4039, 4050, 4070, 4118, 4154, 4158, 4165, 4183, 4186, 4219, 4264], 'GTP-binding': [9, 331, 651], 'proteins': [10, 80, 107, 171, 332, 402, 429, 493, 645, 652, 923, 1044, 1454, 1475, 1489, 2157, 2860, 4120, 4215, 4237, 4257], 'that': [11, 41, 103, 180, 205, 257, 269, 301, 310, 333, 363, 425, 502, 527, 579, 591, 623, 632, 659, 1042, 1138, 1345, 1369, 1484, 1521, 1555, 1571], 'are': [12, 334, 1386, 1490], 'implicated': [13, 335], 'in': [14, 45, 49, 61, 81, 110, 142, 157, 161, 201, 241, 253, 273, 284, 320, 336, 367, 371, 383, 403, 432, 464, 479, 483, 523, 563, 575, 595, 606, 642, 661, 706, 788, 792, 942, 956, 1063, 1129, 1198, 1294, 1321, 1395, 1417, 1478, 1493, 1528, 1604, 1702, 2167, 2182, 2329, 2369, 2410, 2483, 2486, 2490, 2612, 2796, 2823, 2835, 2862, 2900, 3019, 3041, 3053, 3076, 3211, 3236, 3263, 3300, 3346, 3376, 3433, 3502, 3530, 3543, 3584, 3621, 3783, 3800, 3887, 3919, 3973, 4065, 4073], 'regulated': [15, 263, 289, 337, 585, 611, 662, 2887], 'exocytosis.': [16, 70, 175, 265, 321, 338, 392, 497, 587, 643, 663, 1562, 1584, 1609], 'Various': [17, 339], 'localizations': [18, 340], 'distinct': [20, 342, 1383], 'functions': [21, 312, 343, 634, 1048, 1071, 1337, 1508], 'have': [22, 72, 344, 394, 870, 924, 1040, 1045, 1119, 1348, 1382, 1444, 1468, 4113, 4161], 'been': [23, 345, 732, 871, 925, 1326, 4162, 4174], 'proposed': [24, 346], 'for': [25, 30, 95, 177, 347, 352, 417, 499, 1112, 1264, 1509, 1575, 1611, 1997, 2042, 2609, 2636, 2644, 2653, 2661, 2680, 2690, 2700, 2707, 2726, 2746, 2765, 2767, 2801, 2828, 3205, 3248, 3359, 3466, 3559, 3570, 3808, 3854, 3895, 3988, 4019, 4233, 4255], 'different': [26, 118, 348, 440, 954, 1117, 1363, 2324, 4159, 4236], 'occasionally': [28, 350], 'even': [29, 351, 1111, 4173], 'the': [31, 52, 75, 82, 86, 143, 202, 260, 277, 281, 288, 353, 374, 397, 404, 408, 465, 524, 582, 599, 603, 610, 701, 707, 786, 874, 957, 1113, 1145, 1258, 1322, 1334, 1391, 1396, 1410, 1448, 1462, 1470, 1486, 1519, 1536, 1548, 1580, 1592, 1605, 1732, 1886, 1988, 1998, 2275, 2283, 2330, 2334, 2342, 2345, 2348, 2354, 2576, 2590, 2596, 2621, 2628, 2669, 2711, 2750, 2777, 2787, 2812, 2871, 3049, 3104, 3139, 3296, 3301, 3341, 3360, 3371, 3531, 3544, 3617, 3622, 3733, 3748, 3754, 3759, 3784, 3910, 3913, 3920, 3989, 3994, 4026, 4045, 4054, 4068, 4077, 4085, 4091, 4115, 4155, 4166, 4178, 4222, 4268], 'same': [32, 83, 354, 405, 958, 1114], 'Rab3': [33, 79, 106, 170, 182, 189, 272, 303, 311, 355, 401, 428, 492, 504, 511, 594, 625, 633, 644, 1043, 1115, 1339, 1354, 1373, 1407, 1453, 1474, 1488, 1514, 1551, 1683, 1765, 2302, 2314, 2604, 3760, 4119, 4149, 4168, 4201, 4214, 4223, 4256, 4270], 'protein.': [34, 356], 'This': [35, 357, 1504], 'is': [36, 358, 665, 782, 797, 1344, 1368, 1573, 4227], 'exemplified': [37, 359], 'by': [38, 308, 360, 630, 1191, 1414, 1472, 1518, 2046, 2079, 2164, 2288, 2294, 2366, 2533, 2581, 2666, 2844, 2865, 3242, 3274, 3287, 3306, 3406, 3441, 3448, 3595, 3608, 3628, 3925, 3948, 3979, 4036], 'studies': [39, 307, 361, 629, 948, 1011, 1065, 1285, 1347, 1590, 2611, 4112], 'demonstrating': [40, 362], 'deletion': [42, 364, 1126], 'Rab3A': [44, 60, 235, 240, 366, 382, 557, 562, 664, 739, 1128, 1184, 1265, 1290, 1397, 1416, 1556, 1564, 1572, 1593, 1603, 2327, 2510, 2681, 2691, 2701, 2720, 2738, 3738], 'knock-out': [46, 306, 368, 628, 1130, 1259, 1377, 1594], 'mice': [47, 369, 1131, 1378, 2359], 'results': [48, 297, 370, 619, 1361], 'dysregulation': [50, 372], 'final': [53, 282, 375, 604, 1581], 'stages': [54, 376, 1607], 'exocytosis,': [56, 285, 378, 607, 1569], 'whereas': [57, 134, 379, 456, 1009, 1409], 'overexpression': [58, 231, 270, 380, 553, 592, 1557, 1565, 3736], 'neuroendocrine': [62, 384], 'cells': [63, 243, 275, 385, 565, 597, 794, 1187, 1288, 1419, 2614, 2864, 3046, 3082, 3147, 3171, 3260, 3329, 3345, 3373, 3461, 3771, 3794, 4028, 4075], 'causes': [64, 386, 1193], 'nearly': [65, 387], 'complete': [66, 388, 1201, 2591], 'inhibition': [67, 261, 389, 583, 1202, 1411, 1540, 2875], 'Ca2+-triggered': [69, 174, 264, 391, 496, 586, 2893, 3012], 'We': [71, 393, 1482, 4210, 4260], 'now': [73, 395, 1445], 'examined': [74, 396, 1349, 1535, 4114], 'properties': [76, 398], 'all': [78, 104, 168, 188, 400, 426, 490, 510, 1370, 1451, 1495, 1522, 4147, 4199], 'assays,': [84, 406], 'with': [85, 131, 259, 407, 453, 581, 927, 1069, 1589, 1718, 1731, 2023, 2098, 2202, 2326, 2347, 2363, 2627, 2668, 2776, 2809, 2811, 2867, 3175, 3215, 3403, 3410, 3483, 3747, 3775, 3797, 3817, 3935, 3960, 4012, 4032, 4067, 4099, 4216, 4246], 'long-term': [87, 409, 1152], 'goal': [88, 410, 4192], 'identifying': [90, 412], 'common': [92, 414], 'conceptual': [93, 415], 'framework': [94, 416], 'their': [96, 418, 4206], 'functions.': [97, 419, 1123], 'Using': [98, 420], 'quantitative': [99, 421], 'immunoblotting,': [100, 422], 'we': [101, 423, 1443, 1467, 1534, 1553], 'found': [102, 424, 1554], 'four': [105, 169, 427, 491, 1452, 1487, 1523, 3162, 3353, 4148, 4167, 4200, 4269], 'were': [108, 430, 1067, 1614, 1679, 1685, 1966, 1975, 1995, 2021, 2136, 2162, 2180, 2235, 2286, 2292, 2306, 2360, 2372, 2408, 2475, 2531, 2565, 2593, 2625, 2664, 2769, 2842, 2851, 3051, 3083, 3120, 3148, 3172, 3240, 3261, 3285, 3304, 3312, 3330, 3401, 3431, 3462, 3479, 3500, 3547, 3554, 3582, 3606, 3626, 3671, 3685, 3745, 3772, 3795, 3907, 3922, 3933, 3956, 3971, 3984, 3999, 4029, 4082, 4097], 'expressed': [109, 137, 431, 459, 783, 2300, 2861], 'brain': [111, 433, 708, 787, 2331, 2537, 3519, 3683], 'endocrine': [113, 144, 435, 466], 'tissues,': [114, 436], 'although': [115, 437, 1485], 'at': [116, 138, 438, 460, 1440, 1987, 2039, 2424, 3073, 3130, 3158, 3208, 3244, 3443, 3451, 3556, 3567, 3851, 3892, 3966, 4076, 4177], 'widely': [117, 439], 'levels.': [119, 441, 1464], 'Rab3C': [123, 155, 445, 477, 729, 741, 1909, 2849], 'co-localized': [124, 446], 'to': [125, 447, 734, 1133, 1267, 1328, 1359, 1432, 1498, 1764, 1890, 1971, 2279, 2310, 2315, 2853, 2869, 3099, 3138, 3255, 3340, 3457, 3469, 3674, 3857, 3938, 4043, 4090, 4194, 4198, 4204, 4212, 4229, 4251, 4267], 'synaptic': [126, 448, 668, 735, 745, 1142, 3636], 'secretory': [128, 248, 290, 450, 570, 612, 800, 1502], 'vesicles': [129, 249, 451, 571, 746, 801, 1427, 3637], 'consistent': [130, 452], 'potential': [132, 454, 1342, 1366, 1511], 'redundancy,': [133, 455], 'was': [136, 148, 206, 458, 470, 528, 940, 2351, 2428, 2550, 2607, 2774, 2807, 2833, 3253, 3320, 3350, 3374, 3455, 3638, 3815, 3848, 3866, 4063, 4193], 'high': [139, 461], 'levels': [140, 462, 4157, 4232, 4241], 'only': [141, 463, 1350], 'pituitary': [145, 467], '(where': [146, 468], 'it': [147, 469, 796, 1324, 1357, 1376, 4226], 'more': [149, 471], 'abundant': [150, 472, 667, 703], 'than': [151, 473], 'combined),': [156, 478], 'exocrine': [158, 480, 789], 'glands,': [159, 481], 'adipose': [162, 484], 'tissue.': [163, 485], 'In': [164, 486, 1035, 1465], 'transfected': [165, 487, 1380, 1415, 1479, 1529, 3165, 3313, 3372], 'PC12': [166, 242, 274, 488, 564, 596, 1186, 1287, 1418, 1480, 1530, 2613, 2863, 3045, 3081, 3146, 3259, 3344, 3366, 3378, 3492, 3511, 3580, 3623, 3744, 3770, 3981, 4027, 4074], 'cells,': [167, 489, 1190, 1381], 'strongly': [172, 494, 1525], 'inhibited': [173, 495, 1526], 'Except': [176, 498], 'mutation': [179, 200, 501, 522], 'fixes': [181, 503], 'into': [183, 292, 505, 614, 1185, 2376, 2567, 2595, 2786, 2819, 3295, 3334, 3616, 4053], 'permanently': [185, 237, 507, 559], 'GDP-bound': [186, 508], 'state,': [187, 509], 'mutations': [190, 512], 'tested': [191, 513], 'had': [192, 514], 'no': [193, 515, 4143, 4152], 'effect': [194, 516, 2879], 'on': [195, 517, 799, 1315, 1501, 2142, 2380, 2477, 2882, 2886, 2889, 2902, 2970, 3008, 3103, 3464, 3563, 3739, 3811, 4001, 4057], 'this': [196, 518, 1539, 4249], 'inhibition,': [197, 519], 'including': [198, 520, 2295], 'calmodulin-binding': [203, 525], 'site': [204, 526], 'described': [207, 529, 1688, 1967, 2238, 2388, 2431, 3315, 3641, 3688, 3764, 3987], 'as': [208, 313, 530, 635, 928, 932, 1434, 1516, 1687, 2237, 2333, 2353, 2387, 2430, 2539, 2771, 2898, 3017, 3314, 3640, 3687, 3763, 3986], 'inactivating': [209, 531], '(Coppola,': [210, 532], 'T.,': [211, 533], 'Perret-Menoud,': [212, 534], 'V.,': [213, 535], 'Lüthi,': [214, 536], 'S.,': [215, 537], 'Farnsworth,': [216, 538], 'C.': [217, 539, 1159, 1275, 1802, 1871, 1918, 1950, 2171, 2264, 3715], 'C.,': [218, 540], 'Glomset,': [219, 541], 'J.': [220, 227, 542, 549, 774, 815, 841, 861, 902, 917, 969, 994, 1028, 1055, 1082, 1215, 1232, 1252, 1695, 1786, 1817, 1836, 1855, 1902, 1960, 2065, 2125, 2172, 2257, 2265, 2450, 2981, 3002, 3726, 4129, 4136], 'A.,': [221, 543, 1808], 'Regazzi,': [223, 545], 'R.': [224, 546, 686, 773, 825, 887, 1027, 1104, 1170, 1306, 1692, 1774, 1782, 1815, 1834, 1867, 1901, 2118, 2250, 2396, 2443, 2463, 3000, 3706], '(1999)': [225, 547], 'EMBO': [226, 548, 1251, 1835, 3001, 3725], '18,': [228, 550], '5885–5891).': [229, 551], 'Unexpectedly,': [230, 552], 'wild': [233, 555, 2715, 2733, 2754], 'type': [234, 556, 2618, 2716, 2734, 2755], 'GTP-bound': [238, 560], 'mutant': [239, 561], 'caused': [244, 566], 'loss': [246, 568], 'an': [251, 299, 573, 621, 666, 1199, 1719, 2203, 2491, 2824, 3818], 'increase': [252, 574], 'constitutive,': [254, 576], 'Ca2+-independent': [255, 577, 1567], 'exocytosis': [256, 578, 748, 1204, 1413, 1433, 1477, 1527], 'correlated': [258, 580], 'Our': [266, 588], 'data': [267, 589, 869, 1260, 1317], 'indicate': [268, 590, 1261], 'impairs': [276, 598], 'normal': [278, 600, 1577], 'control': [279, 601, 3756], 'step': [283, 605, 1582], 'thereby': [286, 608], 'converting': [287, 609], 'pathway': [291, 613], 'constitutive': [294, 616, 1568, 2903], 'pathway.': [295, 617], 'These': [296, 618, 1585], 'offer': [298, 620], 'hypothesis': [300, 622, 1332], 'reconciles': [302, 624], 'transfection': [304, 626, 1038, 3125], 'suggesting': [309, 631], 'gatekeeper': [315, 637], 'late': [318, 640], 'stage': [319, 641], 'form': [646, 1150], 'related': [650], 'called': [653], 'function': [660, 1293], 'vesicle': [669, 1268, 1295], 'protein': [670, 705, 1463, 2218, 3953, 4179, 4247], '(1Fischer': [671], 'von': [672, 750, 763, 1017, 1796], 'Mollard': [673, 751, 764, 1018, 1797, 3721], 'G.': [674, 752, 765, 975, 1019, 1075, 1092, 1098, 1208, 1300, 1302, 1308, 1798, 1850, 2974], 'Mignery': [675], 'G.A.': [676], 'Baumert': [677, 3698], 'M.': [678, 710, 857, 998, 1090, 1155, 1244, 1271, 1770, 1897, 1922, 1952, 2112, 2122, 2244, 2254, 2437, 2447, 3699], 'Perin': [679], 'M.S.': [680], 'Hanson': [681, 1829], 'T.J.': [682], 'Burger': [683], 'P.M.': [684, 879, 1242, 3691], 'Jahn': [685, 755, 772, 1026, 1691, 1781, 1814, 1833, 1900, 1929, 1953, 3705, 3723], 'Südhof': [687, 722, 753, 770, 1024, 1160, 1171, 1276, 1693, 1779, 1812, 1934, 1958, 2123, 2255, 2448], 'T.C.': [688, 723, 754, 771, 1025, 1161, 1172, 1277, 1694, 1780, 1813, 1935, 1959, 2124, 2256, 2449], 'Proc.': [689, 980, 1874, 2066], 'Natl.': [690, 981, 1875, 2067], 'Acad.': [691, 982, 1876, 2068], 'Sci.': [692, 983, 1877, 2069], 'U.': [693, 984, 1878, 2070], 'S.': [694, 985, 1000, 1879, 1899, 1983, 2071, 2994, 3719], 'A.': [695, 769, 986, 992, 1023, 1096, 1880, 2072, 3644, 4127], '1990;': [696, 2403, 2470], '87:': [697], '1988-1992Google': [698], 'Scholar)': [699, 1701], 'most': [702], 'Rab': [704, 2320, 2523], '(2Geppert': [709], 'Bolshakov': [711], 'V.Y.': [712], 'Siegelbaum': [713], 'S.A.': [714, 853], 'Takei': [715, 1771, 1803, 1919, 1947], 'K.,': [716], 'De': [717, 1783, 1809, 1931, 1955, 2399, 2466, 3702], 'Camilli': [718, 1784, 1810, 1932, 1956, 2400, 2467, 3703], 'P.': [719, 881, 900, 1094, 1776, 1785, 1811, 1873, 1933, 1957, 2398, 2401, 2465, 2468, 3704], 'Hammer': [720], 'R.E.': [721], 'Nature.': [724, 757, 888, 1162, 1177, 1278, 2051], '1994;': [725, 777, 1031, 1235, 1253, 1820, 1858, 1937], '369:': [726], '493-497Google': [727], 'Scholar).': [728, 780, 921, 1034, 1109, 1181, 1256, 1313, 2130, 2178, 2406, 2473, 3399, 3656, 3730], 'has': [730, 1325, 4145, 4171], 'also': [731, 1597], 'localized': [733, 1500], 'vesicles,': [736], 'both': [738], 'coordinately': [742], 'dissociate': [743], 'from': [744, 1362, 1615, 1628, 1639, 1645, 1652, 1658, 1664, 1670, 1681, 2138, 2535, 2552, 3048, 3085, 3364, 3383, 3496, 3681, 3909, 4107], 'during': [747], '(3Fischer': [749], 'R.A.': [756, 1176, 1227, 2116, 2248, 2441, 3724], '1991;': [758, 1789], '349:': [759], '79-81Google': [760], 'Scholar,': [761, 821, 849, 892, 907, 973, 990, 1088, 1166, 1221, 1238, 2262, 2455, 3711], '4Fischer': [762], 'Stahl': [766, 1020, 1799], 'B.': [767, 898, 1021, 1800], 'Khoklatchev': [768, 1022, 1807], 'Biol.': [775, 817, 845, 1029, 1056, 1083, 1216, 1233, 1696, 1788, 1819, 1856, 1903, 2173, 2266, 2982, 4137], 'Chem.': [776, 1030, 1057, 1084, 1217, 1234, 1697, 1857, 1904, 2174, 2267, 2983, 4138], '269:': [778, 1032, 1236, 1859], '10971-10974Google': [779, 1033], 'primarily': [784], 'outside': [785], 'glands': [790], 'mast': [793], 'where': [795], 'enriched': [798, 2163], '(5Valentijn': [802], 'J.A.': [803, 859, 2998, 3389], 'Sengupta': [804], 'D.': [805, 1304, 1893, 3717], 'Gumkowski': [806], 'F.D.': [807], 'Tang': [808], 'L.H.': [809], 'Konieczko': [810], 'E.M.': [811, 1946], 'Jamieson': [812], 'J.D.': [813, 883, 1246], 'Eur.': [814, 901, 1816], 'Cell': [816, 843, 1787, 1818, 3813, 3846], '1996;': [818, 863, 1058], '70:': [819], '33-41Google': [820], '6Tuvim': [822], 'M.J.': [823], 'Adachi': [824], 'Chocano': [826], 'J.F.': [827], 'Moore': [828], 'R.H.': [829], 'Lampert': [830], 'R.M.': [831], 'Zera': [832], 'E.': [833, 835, 1050, 1979, 2110, 2242, 2392, 2435, 2459, 3693], 'Romero': [834], 'Knoll': [836], 'B.J.': [837], 'Dickey': [838], 'B.F.': [839], 'Am.': [840, 860], 'Respir.': [842], 'Mol.': [844], '1999;': [846, 1085, 1106, 1218, 1905, 2127, 2259, 2452, 2984, 3003], '20:': [847], '79-89Google': [848], '7Ohnishi': [850], 'H.': [851, 2061, 2558], 'Ernst': [852], 'Wys': [854], 'N.': [855, 1844], 'McNiven': [856], 'Williams': [858], 'Physiol.': [862], '271:': [864, 1059], 'G531-G538Google': [865], 'Scholar),': [866, 1008, 1061, 1282, 1908, 2055, 2076, 2271, 4142], 'but': [867, 946, 1062, 1283], 'conflicting': [868], 'reported': [872], 'about': [873, 1333], 'localization': [875, 952, 1015, 1335, 1449, 3741], 'Rab3B': [877, 1707, 2517, 2759, 2773, 2847], '(8Lledo': [878], 'Vernier': [880, 899], 'Vincent': [882, 1245], 'Mason': [884], 'W.T.': [885], 'Zorec': [886], '1993;': [889, 1962], '364:': [890], '540-544Google': [891], '9Stettler': [893], 'O.': [894], 'Nothias': [895], 'F.': [896, 1100, 1250], 'Tavitian': [897], 'Neurosci.': [903, 1961, 2126, 2258, 2451], '1995;': [904, 987, 1837], '7:': [905], '702-713Google': [906], '10Lin': [908], 'C.G.': [909, 961], 'Lin': [910, 962], 'Y.C.': [911, 963], 'Liu': [912, 964], 'H.W.': [913, 965], 'Kao': [914, 966], 'L.S.': [915, 967], 'Biochem.': [916, 968, 1001], '1997;': [918, 970, 1163, 1178, 1279], '324:': [919, 971], '85-90Google': [920, 972], 'Few': [922], 'endowed': [926], 'many': [929, 1319, 1346], 'contradictory': [930], 'attributes': [931], 'Rab3.': [933], 'For': [934, 1124, 1389, 2151, 2338, 2502, 3657, 3950], 'example,': [935, 1125, 1390], 'co-expression': [936], 'multiple': [938], 'Rab3s': [939, 955, 1496, 1524, 4160], 'observed': [941], 'several': [943], 'cell': [944, 959, 3283, 3302, 3379, 3477, 3493, 3512, 3982], 'types,': [945], 'some': [947, 1036], 'describe': [949], 'differential': [951], '(10Lin': [960], '11Baldini': [974], 'Scherer': [976], 'P.E.': [977, 1168], 'Lodish': [978], 'H.F.': [979], '92:': [988], '4284-4288Google': [989], '12Piiper': [991], 'Leser': [993], 'Lutz': [995], 'M.P.': [996], 'Beil': [997], 'Zeuzem': [999], 'Biophys.': [1002], 'Res.': [1003, 3652], 'Commun.': [1004], '2001;': [1005], '287:': [1006], '746-751Google': [1007], 'other': [1010, 1064, 1677, 2140, 2215, 2233], 'find': [1012, 1483], 'similar': [1014, 1070, 1507], '(4Fischer': [1016], 'reports,': [1037], 'experiments': [1039, 4096], 'revealed': [1041], 'distinct,': [1046, 1121], 'isoform-specific': [1047, 2143, 4100], '(13Weber': [1049], 'Jilling': [1051], 'T.': [1052, 2063, 2114, 2246, 2439, 2990, 4131], 'Kirk': [1053], 'K.L.': [1054], '6963-6971Google': [1060], 'they': [1066], 'associated': [1068], '(14Chung': [1072, 1205], 'S.H.': [1073, 1206, 2972], 'Joberty': [1074, 1207, 2973], 'Gelino': [1076, 1209, 2975], 'E.A.': [1077, 1210, 2976], 'Macara': [1078, 1211, 1230, 2977], 'I.G.': [1079, 1212, 1231, 2978], 'Holz': [1080, 1213, 2979], 'R.W.': [1081, 1214, 1223, 2980], '274:': [1086, 1219, 1906, 2985], '18113-18120Google': [1087, 1220, 2986], '15Iezzi': [1089], 'Escher': [1091], 'Meda': [1093], 'Charollais': [1095], 'Baldini': [1097, 1299, 1307], 'Darchen': [1099, 1249], 'Wollheim': [1101], 'C.B.': [1102], 'Regazzi': [1103, 2999], 'Endocrinology.': [1105], '13:': [1107, 1254, 1938, 1963], '202-212Google': [1108], 'Furthermore,': [1110], 'protein,': [1116, 1552], 'approaches': [1118], 'suggested': [1120, 1598], 'non-overlapping': [1122], 'leads': [1132], 'relatively': [1135, 1392], 'mild': [1136, 1393], 'phenotype': [1137, 1196, 1394], 'includes': [1139], 'altered': [1140], 'short-term': [1141], 'plasticity': [1143], 'absence': [1146], 'presynaptic': [1149], 'potentiation': [1153], '(16Geppert': [1154, 1270], 'Goda': [1156, 1272], 'Y.': [1157, 1273, 1848, 4125, 4133, 4135], 'Stevens': [1158, 1274], '387:': [1164, 1280], '810-814Google': [1165, 1281], '17Castillo': [1167], 'Janz': [1169, 2117, 2249, 2442], 'Malenka': [1173, 2119, 2251, 2444], 'R.C.': [1174, 2120, 2252, 2445], 'Nicoll': [1175, 2115, 2247, 2440], '388:': [1179], '590-593Google': [1180], 'Transfection': [1182], 'chromaffin': [1189], 'contrast,': [1192], 'dramatic': [1195], 'resulting': [1197, 2795, 2822], 'almost': [1200], '18Holz': [1222], 'Brondyk': [1224], 'W.H.': [1225], 'Senter': [1226], 'Kuizon': [1228], 'L.': [1229, 1240, 1806, 1828, 1924], '10229-10234Google': [1237], '19Johannes': [1239], 'Lledo': [1241], 'Roa': [1243], 'Henry': [1247], 'J.P': [1248], '2029-2037Google': [1255], 'Moreover,': [1257], 'role': [1263, 1601], 'unrelated': [1266, 1431], 'docking': [1269, 1296], 'microscopy': [1284], 'overexpressing': [1289], 'suggest': [1291], '(20Martelli': [1297], 'A.M.': [1298], 'Tabellini': [1301], 'Koticha': [1303], 'Bareggi': [1305], 'Traffic.': [1309], '2000;': [1310, 3727], '1:': [1311], '976-986Google': [1312], 'Based': [1314, 2969], 'these': [1316, 1438], 'others': [1320], 'literature,': [1323], 'difficult': [1327, 4228], 'formulate': [1329], 'coherent': [1331], 'proteins.': [1340, 2303, 3475], 'One': [1341, 3317, 3337, 4164], 'problem': [1343, 1367], 'subset': [1352], 'proteins,': [1355, 1515, 4150, 4169, 4202, 4271], 'making': [1356], 'impossible': [1358], 'compare': [1360], 'studies.': [1364], 'Another': [1365], 'assays': [1371, 3363, 3381], 'function,': [1374], 'be': [1375, 1400, 1421, 1430, 1499, 4252], 'or': [1379, 1619, 1726, 2210, 2229, 2497, 3220, 3233, 3758, 4284], 'limitations': [1384], 'inherently': [1387], 'indirect.': [1388], 'knocak-out': [1398], 'could': [1399, 1420], 'misleading': [1402], 'consequence': [1403], 'redundancy': [1405, 1512], 'among': [1406, 1513], 'isoforms,': [1408], 'because': [1422, 4182, 4225, 4239], 'defective': [1424], 'biogenesis': [1425], 'may': [1429], 'such.': [1435], 'To': [1436, 3573, 3731, 3929], 'address': [1437], 'problems,': [1439], 'least': [1441], 'partially,': [1442], 'directly': [1446, 1560, 3924], 'compared': [1447, 4146], 'using': [1455, 1541, 2081, 3122, 3549, 4084, 4272], 'specific,': [1456], 'standardized': [1457, 2293], 'antibodies': [1458, 1627, 1638, 1763, 1889, 1970, 2085, 2095, 2144, 3662, 4197, 4217, 4266], 'quantitation': [1460], 'addition,': [1466], 'explored': [1469], 'mechanism': [1471, 1537, 2872], 'which': [1473, 1596], 'inhibit': [1476, 1561], 'cells.': [1481, 1531, 3367], 'differentially': [1491], 'distributed': [1492], 'vertebrates,': [1494], 'appear': [1497], 'vesicles.': [1503], 'observation': [1505], 'suggests': [1506], 'confirmed': [1517], 'finding': [1520], 'However,': [1532], 'when': [1533], 'series': [1543, 2602], 'mutants': [1545], 'best': [1549], 'studied': [1550, 4175], 'did': [1558], 'not': [1559, 2908, 2915, 3037, 4172, 4244], 'Instead,': [1563], 'activated': [1566], 'indicating': [1570], 'essential': [1574], 'regulation': [1578], 'findings': [1586], 'agree': [1587], 'well': [1588], 'mice,': [1595], 'selective': [1600], 'terminal': [1606], 'Enzymes': [1610], 'DNA': [1612], 'manipulations': [1613], 'Roche': [1616], 'Molecular': [1617, 3128], 'Biochemicals': [1618], 'New': [1620], 'England': [1621], 'Biolabs': [1622], '(Beverly,': [1623], 'MA),': [1624], 'fluorescence-labeled': [1625], 'secondary': [1626, 1637, 1642, 2084, 2094], 'Jackson': [1629], 'ImmunoResearch': [1630], 'Laboratories': [1631], '(West': [1632], 'Grove,': [1633], 'PA),': [1634], 'horseradish': [1635, 2082], 'peroxidase-labeled': [1636, 2083], 'BioRad,': [1640], '125I-labeled': [1641], 'anti-rabbit': [1643], 'antibody': [1644], 'Amersham': [1646, 2091], 'Biosciences,': [1647], 'Eupergit': [1648, 3675], 'C1Z': [1649, 3676], 'methacrylate': [1650, 3677], 'microbeads': [1651], 'Röhm': [1653], 'Pharma': [1654], '(Darmstadt,': [1655], 'Germany),': [1656, 1661], 'Ni-NTA-agarose': [1657], 'Qiagen': [1659], '(Hilden,': [1660], 'Triton': [1662, 2168], 'X-114': [1663, 2169], 'Pierce,': [1665], 'nitrocellulose': [1667, 2058], 'membranes': [1668, 2059], '(Protran)': [1669], 'Schleicher': [1671], '&': [1672], 'Schuell': [1673], '(Dassel,': [1674], 'Germany).': [1675, 1992, 2019], 'All': [1676, 2290, 2840], 'reagents': [1678], 'purchased': [1680], 'Sigma.': [1682], 'antisera': [1684], 'raised': [1686], '(21Johnston': [1689], 'P.A.': [1690, 1778], '1989;': [1698, 3708], '264:': [1699], '1268-1273Google': [1700], 'rabbits': [1703], 'against': [1704], 'mouse': [1705, 1742, 1750, 1759, 2509, 2536], 'full-length': [1706, 1716], 'containing': [1708, 2570, 3057, 3265, 3486, 3586, 4014], 'C-terminal': [1710, 2798, 2912], 'hexahistidine': [1711, 1721, 2578, 2799, 2826], 'tag': [1712, 1722, 2579, 2624, 2800, 2827], '(U953': [1713], 'U954),': [1715], 'N-terminal': [1720, 2577, 2622, 2825], '(SA5838': [1723], 'SA5839),': [1725], 'keyhole': [1727], 'limpet': [1728], 'hemocyanin-coupled': [1729], 'peptides': [1730], 'following': [1733, 1999, 2670], 'amino': [1734], 'acid': [1735], 'sequences:': [1736], 'CASATDSRYGQKES': [1737], '(583;': [1738], 'residues': [1739, 1747, 1756], '2–14': [1740], 'Rab3A);': [1743], 'CNGKPALGDTP': [1744], '(αR3D#2,': [1745], 'SA5834;': [1746], '201–211': [1748], 'Rab3D);': [1751], 'ASEPPASPRDAAC': [1753], '(αR3D#3,': [1754], 'SA5837;': [1755], '2–13': [1757], 'Rab3D).': [1760], 'The': [1761, 2562, 3168, 3290, 3368, 3611, 3791, 3915, 4048], 'monoclonal': [1762, 3661], '(Cl42.1': [1766], 'Cl42.2': [1768, 3666], '(22Matteoli': [1769], 'K.': [1772, 1804, 1920, 1926, 1948], 'Cameron': [1773, 2395, 2462, 3694], 'Hurlbut': [1775], 'Johnston': [1777], '115:': [1790], '625-633Google': [1791], 'Scholar)),': [1792, 1823, 1840, 1861, 1940], 'Rab5': [1793], '(Cl621.3': [1794], '(23Fischer': [1795], 'Walch-Solimena': [1801, 1949], 'Daniels': [1805], '65:': [1821], '319-326Google': [1822], 'synaptobrevin': [1824], '2': [1825, 3422, 3514, 3830], '(Cl69.1': [1826], '(24Edelmann': [1827], 'P.I.': [1830], 'Chapman': [1831, 1927], 'E.R.': [1832, 1928], '14:': [1838], '224-231Google': [1839], 'NR1': [1841], '(Cl54.1': [1842], '(25Brose': [1843], 'Huntley': [1845], 'G.W.': [1846], 'Stern-Bach': [1847], 'Sharma': [1849], 'Morrison': [1851], 'J.H.': [1852], 'Heinemann': [1853], 'S.F.': [1854], '16780-16784Google': [1860], 'synaptophysin': [1863, 1942, 2013], 'I': [1864, 2014], '(Cl7.2': [1865], '(26Jahn': [1866], 'Schiebler': [1868], 'W.': [1869, 1895, 3713], 'Ouimet': [1870], 'Greengard': [1872, 2397, 2464], '1985;': [1881], '82:': [1882], '4137-4141Google': [1883], 'Scholar))': [1884, 1965], 'rabbit': [1887], 'polyclonal': [1888], 'endobrevin': [1891], '(27Fasshauer': [1892], 'Antonin': [1894], 'Margittai': [1896], 'Pabst': [1898, 3718], '15440-15446Google': [1907], '(R9,': [1910], 'P180,': [1911], 'P181': [1913], '(4,17)),': [1914], 'rabphilin': [1915, 2932], '(I734': [1916], '(28Li': [1917], 'Geppert': [1921, 1951, 2121, 2253, 2446], 'Daniell': [1923], 'Stenius': [1925], 'R.,': [1930, 1954], 'Neuron.': [1936, 2402, 2469, 3707], '885-898Google': [1939], 'II': [1943, 2569], '(αp37': [1944], '(29Fykse': [1945], '4997-5007Google': [1964], 'previously.': [1968], 'Polyclonal': [1969], 'Sec61α': [1972], 'LIMP-II': [1974, 2339], 'gifts': [1976], 'Dr.': [1978, 1982, 2557], 'Hartmann': [1980], 'Höning,': [1984], 'respectively': [1985], '(both': [1986], 'University': [1989], 'Göttingen,': [1991, 2018, 2495], 'Commercial': [1993], 'sources': [1994], 'used': [1996, 3321, 3375, 3501], 'antibodies:': [2000], 'anti-hexahistidine': [2001], '(mouse': [2002], 'anti-peptide': [2003], 'RGSHHHH,': [2004], 'Qiagen),': [2005], 'RIM': [2006], '1': [2007, 3109, 3114, 3266, 3487, 3587], '(Transduction': [2008], 'Laboratories,': [2009], 'Lexington,': [2010], 'KY),': [2011], '(580,': [2015], 'Synaptic': [2016], 'Systems,': [2017], 'Samples': [2020], 'diluted': [2022, 3816, 3934, 3957, 4009], 'sample': [2024], 'buffer': [2025, 2187, 3178, 3413, 3438, 3485, 3546, 3824, 3889, 3962, 3976], '(3%': [2026], 'SDS,': [2027], '50': [2028, 2033, 2040], 'mm': [2029, 2191, 2196, 2413, 3181, 3186, 3191, 3194, 3199, 3227, 3231, 3267, 3271, 3415, 3419, 3423, 3426, 3515, 3588, 3592, 3788, 3828, 3831, 3834], 'Tris/HCl,': [2030], '10%': [2031, 3058, 3517], 'glycerol,': [2032], 'mmdithiothreitol,': [2034], '0.1%': [2035], 'bromphenol': [2036], 'blue),': [2037], 'heated': [2038], '°C': [2041, 3075, 3210, 3445, 3558], '10': [2043, 2183, 3458, 3571, 3840, 3855, 3869, 3958, 4010], 'min,': [2044, 3250, 3561], 'separated': [2045], 'discontinuous': [2047, 3872], 'SDS-PAGE': [2048, 3974], '(30Laemmli': [2049], 'U.K.': [2050], '1970;': [2052], '277:': [2053], '680-685Google': [2054], 'transferred': [2056, 2594], 'onto': [2057, 3094, 3152, 3352, 3868], '(31Towbin': [2060], 'Staehelin': [2062], 'Gordon': [2064], '1979;': [2073], '76:': [2074], '4350-4354Google': [2075], 'probed': [2078], 'immunoblotting': [2080], 'enhanced': [2087], 'chemiluminescence': [2088], 'detection': [2089], '(ECL;': [2090], 'Biosciences)': [2092], 'or125I-labeled': [2093], 'quantification': [2097], 'Fujix': [2100], 'BAS-5000': [2101], '(Ray': [2102], 'Test,': [2103], 'Straubenhardt,': [2104], 'Germany)': [2105, 2386, 2496], 'detector': [2106], '(32Schlüter': [2107, 2239, 2432], 'O.M.': [2108, 2240, 2433], 'Schnell': [2109, 2241, 2434], 'Verhage': [2111, 2243, 2436], 'Tzounopoulos': [2113, 2245, 2438], '19:': [2128, 2260, 2453, 3728], '5834-5846Google': [2129, 2261, 2454], 'distinguished': [2137], 'each': [2139, 3323], 'based': [2141], '(see': [2145, 4258], 'Fig.': [2146], '1)': [2147], 'migration': [2149], 'size.': [2150], 'analysis': [2152, 3951], 'tissue': [2154, 2160, 2346, 4116], 'samples,': [2155], 'hydrophobic': [2156], 'rat': [2159, 3518, 3682], 'homogenates': [2161, 2222, 3684], 'phase': [2165, 2277], 'partitioning': [2166], '(33Bordier': [2170], '1981;': [2175, 2268], '256:': [2176, 2269], '1604-1607Google': [2177, 2270], 'Tissues': [2179], 'homogenized': [2181], 'volumes': [2184], 'homogenization': [2186], '(0.32m': [2188], 'sucrose,': [2189], '5': [2190, 3198, 3809, 4015], 'HEPES-NaOH,': [2192, 3200, 3427], 'pH': [2193, 2417, 3201, 3428, 3836], '7.4,': [2194], '0.1': [2195], 'EDTA,': [2197], '200': [2198, 3536], 'μm': [2199], 'phenylmethylsulfonyl': [2200, 3272, 3593], 'fluoride)': [2201], 'ultra-turrax': [2204], '(lung,': [2205], 'skeletal': [2206, 2225], 'muscle,': [2207], 'heart': [2208, 2227], 'muscle)': [2209], 'glass-Teflon': [2212], 'potter': [2213], '(all': [2214, 2232], 'tissues).': [2216], 'Equal': [2217], 'amounts': [2219, 2297, 3291, 3612, 3916], 'total': [2221, 3523, 3532, 3575, 4263], '(lung': [2223], 'muscles)': [2228], 'postnuclear': [2230, 3859, 3864], 'supernatants': [2231], 'tissues)': [2234], 'extracted': [2236], '33Bordier': [2263], 'aliquots': [2273], 'detergent': [2276], 'corresponding': [2278], '75': [2280], 'μg': [2281, 3110, 3115], 'starting': [2284], 'homogenate': [2285, 3847], 'analyzed': [2287, 3947, 3978], 'immunoblotting.': [2289, 3980], 'blots': [2291, 4105], 'known': [2296], 'heterologously': [2299], 'His-tagged': [2301], 'Peak': [2304], 'areas': [2305], 'background-subtracted': [2307], 'normalized': [2309, 4064], 'signals': [2311], 'recombinant': [2313], 'allow': [2316, 3470], 'comparison': [2317, 4066], 'between': [2318, 2323, 4235], 'various': [2319], 'isoforms': [2321], 'blots,': [2325], 'concentrations': [2328, 3527, 4081], 'cortex': [2332], 'reference': [2335, 2355], 'point': [2336], '(100%).': [2337], 'endobrevin,': [2341], 'signal': [2343], 'highest': [2349], 'amount': [2350, 3342, 4049, 4069], 'taken': [2352], 'point.': [2356], 'Anesthetized': [2357], 'adult': [2358], 'perfused': [2361], 'transcardially': [2362], 'PBS': [2364, 3264, 3585, 4013], 'followed': [2365, 3405, 3447], '4%': [2367], 'paraformaldehyde': [2368], 'PBS.': [2370], 'Brains': [2371], 'cryoprotected': [2373], 'cut': [2375], '20-μm': [2377], 'frontal': [2378], 'sections': [2379], 'cryomicrotome': [2382], '(CM1325,': [2383], 'Leica,': [2384], 'Bensheim,': [2385], '(34Mandell': [2389], 'J.W.': [2390, 2457], 'Townes-Anderson': [2391, 2458], 'Czernik': [2393, 2460], 'A.J.': [2394, 2461], '5:': [2404, 2471], '19-33Google': [2405, 2472], 'Slices': [2407], 'stored': [2409], 'antifreeze': [2411], '(25': [2412], 'sodium': [2414], 'phosphate': [2415], 'buffer,': [2416], '7.3,': [2418], '30%': [2419], 'ethylene': [2420], 'glycol,': [2421], '20%': [2422], 'glycerol)': [2423], '−20': [2425], '°C.': [2426], 'Immunostaining': [2427], 'performed': [2429, 2834, 3686, 3985, 4098], '34Mandell': [2456], 'Sections': [2474], 'mounted': [2476], 'gelatin-coated': [2478], 'microscopic': [2479], 'slides': [2480], 'withN-propylgallate': [2481], '(1,5%': [2482], '60%': [2484], 'glycerol': [2485], 'PBS)': [2487], 'viewed': [2489], 'epifluorescence': [2492], '(Axiophot,': [2493], 'Zeiss,': [2494], 'confocal': [2498], 'microscope': [2499], '(MRC-1024,': [2500], 'BioRad).': [2501], 'generation': [2503], 'N-terminally': [2505], 'hexahistidine-tagged': [2506], 'expression': [2507, 2598, 2605, 2763, 2832, 3750, 3761], 'constructs,': [2508], '(primers': [2511, 2518, 2525, 2543], '1236,': [2512], 'CGGGATCCGCTTCCGCCACAGACTCTCGC,': [2513], '1209,': [2515], 'TCAGCAGGCACAATCCTGATGAGG),': [2516], '931,': [2519], 'CATATGGCTTCAGTGACTGATGGTAAGACTGG': [2520], '932,GAATTCTGCTGCAGCAGAGGTGGGG),and': [2522], '3C': [2524], '1238,': [2526], 'GGATCCGCCTCTGCACAAGATGCCAGG,': [2527], '1213,': [2529], 'TTAGCAGCCACAGTTGGGCTGTGG)': [2530], 'cloned': [2532, 2566], 'PCR': [2534, 2563, 2667], 'cDNA': [2538, 2549], 'template.': [2540], 'Mouse': [2541, 2846], '1239,': [2544], 'CGGGATCCGCATCCGCTAGTGAGCCCCC,': [2545], '1212,': [2547], 'CTAACAGCTGCAGCTGCTCGGCTG)': [2548], 'amplified': [2551, 2626, 2775, 2808], 'plasmid': [2554, 3118], '(gift': [2555], 'Lodish,': [2559], 'Cambridge,': [2560], 'MA).': [2561], 'products': [2564], 'pBluescript': [2568], 'translation': [2572], 'initiation': [2573], 'sequence': [2574, 2717, 2735, 2756, 2813], '(introduced': [2580], 'primers': [2582, 2629, 2778, 2810], '1234,': [2583], 'CTAGAAAGCTTTCCACCATGAGAGGATCGCAT': [2584], 'CACCATCACCATCACG,': [2585], '1235,': [2587], '(GATCCGTGATGGTGATGGTGATGCGATCCTCTCATGGTGGAAAGCTTT),': [2588], 'inserts': [2592], 'eukaryotic': [2597], 'vector': [2599, 2788, 3751, 3757, 3762], 'pcDNA3.': [2600], 'A': [2601], 'vectors': [2606, 2764], 'constructed': [2608], 'cotransfection': [2610], '(Table': [2615], 'I).': [2616], 'Wild': [2617], 'constructs': [2619, 2841], 'lacking': [2620], 'histidine': [2623], '2029': [2630, 2722], '(CGGGATCCACCATGGCTTCCGCCACAGACTCTCGCTAT)': [2631], '2037': [2633, 2679, 2689, 2706], '(GGAATTCTC': [2634], 'AGCAGGCACAATCCTGATGAGG)': [2635], '2038': [2638, 2742], '(CGGGATCCACCATGGCTTCAGTGACTGAT': [2639], 'GGTAAGACTGG)': [2640], '2039': [2642], '(GGAATTCCTAGCAAGAGCAGTTCTGCTGGAG)': [2643], '2040': [2646], '(CGGGATCCACCA': [2647], 'TGAGACACGAGGCGCCCATGCAGATGGCCTCTGCACAAGATGCCAGGTTTG)': [2648], '2043': [2650], '(GGAATTCTTAGCA': [2651], 'GCCACAGTTGGGCTGTGG)': [2652], '2044': [2656], '(CGGGATCCACCATGGCATCCGCTAGTGAGCCCCCT)': [2657], '2047': [2659], '(GGAATTCCTAACAGCTGCAGCTGCTCGGCTG)': [2660], 'Rab3D.': [2662], 'Mutations': [2663], 'introduced': [2665], 'primers:': [2671], '2029,': [2672, 2683, 2693], '2031': [2673], '(GGTGCGGTACCGCTCTAGACCTGCTGTGTCCC),': [2674], '2030': [2675], '(GGGACACAGCAGGTCTAGAG': [2676], 'CGGTACCGCACC),': [2677], 'Q81L;': [2682], '2438': [2684], '(GACCTTGGAGTCTATGCCAACGGTGCTG),': [2685], '2437': [2686], '(CAGCACCGTTGGCATAGACTCCAAGGTC),': [2687], 'F59S;': [2692], '2461': [2694], '(CCTGGGCATTGTC': [2695], 'CGTCGAGTAAGTT),': [2696], '2460': [2697], '(AACTTACTCGACGGACAATGCCCAGG),': [2698], 'and2037': [2699], 'W125T;': [2702], '2340': [2703], '(TGATCATTGGGAACAGCAGCGTGGGCAAAAACTCGTT)': [2704], 'fragment': [2709, 2728, 2748], 'replacing': [2710, 2729, 2749], 'BclI': [2712], 'EcoRI': [2714], 'generating': [2719, 2737, 2758], 'T36N;': [2721], '2361': [2724], '(AGATCTGCAGCTTGATCGTCTTGTCGTTGAGGTAGATG)': [2725], 'theBamHI': [2730], 'BglII': [2732], 'R66L': [2739, 2760], 'R70T;': [2740], '2339': [2744], '(CTGCAGCTTCACAGTCTTCTCATGGAGGTAGACT)': [2745], 'BamHI': [2751], 'PstI': [2753], 'R70T.': [2761], 'Bacterial': [2762, 2831], 'antigens': [2766], 'immunization': [2768], 'generated': [2770, 4275], 'follows.': [2772], '931': [2779], '(CATATGGCTTCAGTGACTGATGGTAAGACTGG)': [2780], '932': [2782], '(GAATTCTGCTGCAGCAGAGGTGGGG)': [2783], 'subcloned': [2785, 2818], 'pHO2c': [2789], '(modified': [2790], 'pET2,': [2791], 'Novagen,': [2792], 'Madison,': [2793], 'WI),': [2794], 'affinity': [2802, 2829], 'purification': [2803], 'over': [2804], 'Ni-NTA-agarose.': [2805], 'CGCATATGGCATCCGCTAGTG': [2814], 'GCGGATCCTAACAGCTGCAGC': [2816], 'pET15b': [2820], '(Novagen),': [2821], 'purification.': [2830], 'Escherichia': [2836], 'coli': [2837], 'strain': [2838], 'BL21(DE3).': [2839], 'verified': [2843], 'sequencing.': [2845], 'sequences': [2850], 'submitted': [2852], 'GenBankTM': [2854], '(accession': [2855], 'numbers': [2856], 'AF312036': [2857], 'andAF312037).Table': [2858], 'IRab3': [2859], 'co-transfection': [2866], 'hGH': [2868, 2897, 3016, 3293, 3577, 3614, 3749, 4051, 4071], 'study': [2870, 3732, 4144, 4213], 'Rab3-dependent': [2874], 'exocytosisRab3': [2877], 'ProteinPresumptive': [2878], 'mutationsaBased': [2881], 'Refs.14': [2883], '48.Effect': [2885], 'exocytosisbEffect': [2888], 'KCl-,': [2890, 3009], '±-latrotoxin-,': [2891, 3010], 'release': [2894, 3013], 'co-transfected': [2896, 3015, 3121, 3746], 'shown': [2899, 3018], 'Figs.6-9.Effect': [2901], 'exocytosiscSee': [2904], 'Figs.': [2905, 3029], '10-12.': [2906], 'ND,': [2907, 3036], 'determined.Rab3AWild': [2909], 'typeStrong': [2910, 2942, 2953, 2961], 'inhibitionActivationRab3AΔCDeletes': [2911], 'cysteines;': [2913], 'thus': [2914, 2920, 2927, 2946, 2957, 2965], 'geranylgeranylatedStrong': [2916], 'inhibitionNDRab3A-T36NInhibits': [2917], 'GDP': [2918], 'dissociation;': [2919], 'preferentially': [2921, 2928, 2947, 2958, 2966], 'GDP-boundNo': [2922], 'inhibitionNo': [2923], 'effectRab3A-Q81LInhibits': [2924], 'GTP': [2925, 2944, 2955, 2963], 'hydrolysis;': [2926, 2945, 2956, 2964], 'GTP-boundStrong': [2929, 2948, 2959, 2967], 'inhibitionActivationRab3A-F59SInhibits': [2930], 'GTP-dependent': [2931], 'bindingStrong': [2933, 2940, 2951], 'inhibitionNDRab3A-W125THighly': [2934], 'conserved': [2935], 'Rab3-specific': [2936], 'residueStrong': [2937], 'inhibitionNDRab3A-R66L/R70TInhibits': [2938], 'calmodulin': [2939, 2950], 'inhibitionNDRab3BWild': [2941], 'inhibitionNDRab3B-Q81LInhibits': [2943], 'inhibitionNDRab3B-R66L/R70TInhibits': [2949], 'inhibitionNDRab3CWild': [2952], 'inhibitionNDRab3C-Q89LInhibits': [2954], 'inhibitionNDRab3DWild': [2960], 'inhibitionNDRab3D-Q81LInhibits': [2962], 'inhibitionNDa': [2968], 'Refs.14Chung': [2971], 'Scholar': [2987], '48Coppola': [2989], 'Perret-Menoud': [2991], 'V.': [2992], 'Lüthi': [2993], 'Farnsworth': [2995], 'C.C.': [2996], 'Glomset': [2997], '18:': [3004, 3397], '5885-5891Google': [3005], 'Scholar.b': [3006], 'Effect': [3007], 'Figs.Figure': [3020], '6,': [3021], 'Figure': [3022, 3024, 3026, 3030, 3032, 3034], '7,': [3023], '8,': [3025], '9.c': [3027], 'See': [3028], '10,': [3031], '11,': [3033], '12.': [3035], 'determined.': [3038], 'Open': [3039], 'table': [3040], 'new': [3043], 'tab': [3044], '(obtained': [3047, 4106], 'ATCC)': [3050], 'maintained': [3052], 'RPMI': [3054], '1640': [3055], 'medium': [3056, 3297, 3618], 'heat-inactivated': [3059], 'horse': [3060], 'serum,': [3061, 3065], '5%': [3062, 3078, 3212], 'fetal': [3063], 'bovine': [3064, 3489], 'penicillin': [3067], 'streptomycin': [3069], '(50': [3070, 3997], 'u/ml': [3071], 'each)': [3072], '37': [3074, 3209], 'CO2humidified': [3079], 'atmosphere.': [3080], 'split': [3084], 'confluent': [3087], 'flask': [3088], 'seeded': [3090], 'after': [3091, 3144, 3327, 3768, 4007, 4024], 'vigorous': [3092], 'trituration': [3093], '6-well': [3095, 3318, 3498], 'plates': [3096, 3155], '(35-mm': [3097], 'diameter)': [3098, 3157], 'achieve': [3100], '50–60%': [3101], 'confluence': [3102], 'day': [3105, 4022, 4078], 'transfection.': [3107], 'Typically,': [3108], 'phGH-CMV5': [3112], 'test': [3117], 'DNA/well': [3119], 'Fugene': [3123], '6': [3124, 3434, 3778], 'reagent': [3126], '(Roche': [3127], 'Biochemicals)': [3129], 'ratio': [3132, 3160], '1:3': [3134], '(μg:': [3135], 'μl)': [3136, 3998], 'according': [3137, 4089], "manufacturer's": [3140, 4092], 'specifications.': [3141, 4093], '2–3': [3142, 3481], 'days': [3143, 3326, 3767, 4002, 4058], 'transfection,': [3145, 3328, 4008, 4025], 'collected': [3149, 3331, 3908, 4000], 'replated': [3151], 'collagen-coated': [3153, 3354], '12-well': [3154], '(22-mm': [3156], '22-mm': [3163, 3355], 'wells/each': [3164], '35-mm': [3166, 3348], 'well.': [3167], 'next': [3169, 3792], 'day,': [3170, 3793], 'briefly': [3173], 'rinsed': [3174], 'Krebs': [3176], 'bicarbonate': [3177], '(KBB;': [3179], '118': [3180], 'NaCl,': [3182, 3829], '25': [3183], 'mmNaHCO3,': [3184], '3.5': [3185], 'KCl,': [3187], '1.25': [3188], 'mmCaCl2,': [3189], '1.2': [3190, 3193], 'MgSO4,': [3192], 'KH2PO4,': [3195], '11.5': [3196], 'mmglucose,': [3197], '7.5),': [3202, 3837], 'incubated': [3204, 3555, 3807], '15': [3206], 'min': [3207, 3810, 3856], 'CO2': [3213], 'atmosphere': [3214], 'KBB': [3216, 3404], '(for': [3217], 'basal': [3218], 'secretion)': [3219], 'stimulating': [3221], 'media': [3222, 3239, 3996, 4056], '(high': [3223], 'potassium': [3224, 3416, 3420], 'KBB:': [3225], '56': [3226], 'KCl': [3228], '59.5': [3230], 'NaCl;': [3232], '0.5': [3234, 3270, 3591, 3787], 'nmα-latrotoxin': [3235], 'KBB).': [3237], 'Assay': [3238], 'cleared': [3241, 3286, 3607], 'centrifugation': [3243], '1000': [3245], '×': [3246, 3901, 3968], 'g': [3247, 3569], '4–5': [3249, 3256], 'EDTA': [3252, 3268, 3589], 'added': [3254, 3456], 'mm.': [3257], 'Corresponding': [3258], 'lysed': [3262, 3583, 4035], 'fluoride': [3273, 3594], 'three': [3275, 3596, 3939, 4037], 'cycles': [3276, 3597, 3940, 4038], 'rapid': [3278, 3599, 3942], 'freezing': [3279, 3442, 3600, 3943, 4040], 'thawing.': [3281, 3602], 'Resulting': [3282, 3476, 3603], 'extracts': [3284, 3303, 3605, 3625], 'high-speed': [3288, 3609], 'centrifugation.': [3289, 3610], 'secreted': [3294, 3615, 4052], 'remaining': [3299, 3620, 4072], 'quantified': [3305, 3627], 'radioimmunoassay': [3307, 3629], '(Nichols': [3308, 3630], 'Institute': [3309, 3631], 'Diagnostics).': [3310, 3632], 'Cells': [3311, 3400, 3430], 'above.': [3316, 3765], 'plate': [3319, 3499], 'per': [3322], 'construct.': [3324], '3–4': [3325], 'divided': [3333], 'two': [3335], 'groups.': [3336], 'part,': [3338], 'equivalent': [3339], 'one': [3347, 3497], 'well,': [3349], 're-plated': [3351], 'wells': [3356], 'processed': [3358], 'standard': [3361], 'secretion': [3362, 3380, 3990], 'intact': [3365], 'remainder': [3369], 'cracked': [3377], 'modified': [3382], 'Klenchinet': [3384], 'al.': [3385], '(35Klenchin': [3386], 'V.A.': [3387], 'Kowalshyk': [3388], 'Martin': [3390], 'T.F.J.': [3391], 'Methods': [3392, 3394], 'Companion': [3393], 'Enzymol.': [3395], '1998;': [3396], '204-208Google': [3398], 'washed': [3402, 3480, 3510, 3796, 4031], 'second': [3408], 'washing': [3409], 'ice-cold': [3411, 3804], 'KGlu': [3412, 3437, 3484, 3539], '(120': [3414], 'glutamate,': [3417], '20': [3418, 3425, 3560, 3833], 'acetate,': [3421], 'EGTA,': [3424, 3832], '7.2).': [3429], 'resuspended': [3432, 3799, 3972], 'ml': [3435, 3802, 3862, 3870, 3906], 'permeabilized': [3440], '−80': [3444], 'overnight': [3446, 3774, 3965], 'slow': [3449], 'thawing': [3450, 4042], 'room': [3452], 'temperature.': [3453], 'EGTA': [3454], 'mm,': [3459], 'left': [3463], 'ice': [3465], '1–2': [3467], 'h': [3468, 3897], 'efficient': [3471], 'extraction': [3472], 'cytosolic': [3474], 'ghosts': [3478, 3494, 3581], 'times': [3482, 3841, 3959, 4011], 'mg/ml': [3488, 3522], 'serum': [3490], 'albumin.': [3491], 'prepared': [3495], '20–32': [3503], 'assay': [3504], 'reactions.': [3505], 'Each': [3506], 'reaction': [3507, 3533], 'mixture': [3508], 'contained': [3509], 'ghosts,': [3513], 'Mg-ATP,': [3516], 'cytosol': [3520], '(6–10': [3521], 'protein),': [3524], 'varying': [3526], 'calcium': [3529], 'volume': [3534, 3820], 'μl': [3537], 'buffer.': [3540], 'Free': [3541], 'Ca2+concentrations': [3542], 'EGTA-Ca2+': [3545], 'calculated': [3548], 'EqCal': [3550], 'software': [3551], '(Biosoft).': [3552], 'Reactions': [3553], '30': [3557], 'chilled': [3562], 'ice,': [3564], 'centrifuged': [3566, 3849, 3891, 3964], '3,000': [3568], 'min.': [3572], 'determine': [3574, 4044], 'cellular': [3576], 'levels,': [3578], 'pelleted': [3579], 'ghost': [3604, 3624], 'Isolation': [3633], 'small': [3635], 'done': [3639], 'previously': [3642, 3689], '(36Nagy': [3643], 'Baker': [3645], 'R.R.': [3646], 'Morris': [3647], 'S.J.': [3648], 'Whittaker': [3649], 'V.P.': [3650], 'Brain': [3651], '1976;': [3653], '109:': [3654], '285-309Google': [3655], 'immunoisolation': [3658], 'organelles,': [3660], 'Cl69.1': [3663], '(anti-synaptobrevin': [3664], '2),': [3665], '(anti-Rab3A),': [3667], 'Cl621.3': [3669], '(anti-Rab5)': [3670], 'coupled': [3672], 'covalently': [3673], 'microbeads,': [3678], 'isolations': [3680], '(37Burger': [3690], 'Mehl': [3692], 'P.L.': [3695], 'Maycox': [3696], 'P.R.': [3697], 'Lottspeich': [3700], 'F.,': [3701], '3:': [3709], '715-720Google': [3710], '38Antonin': [3712], 'Holroyd': [3714], 'Fasshauer': [3716], 'Von': [3720], 'G.F.': [3722], '6453-6464Google': [3729], 'effects': [3734], 'subcellular': [3740], 'hGH,': [3743, 3931], 'either': [3753, 4273], 'empty': [3755], 'Three': [3766], 'transfections,': [3769], 'labeled': [3773], '[3H]norepinephrine': [3776], '(AmershamBiosciences,': [3777], 'μCi,': [3779], '30–50': [3780], 'Ci/mmol/6-well': [3781], 'plate)': [3782], 'presence': [3785], 'ascorbic': [3789], 'acid.': [3790], 'KBB,': [3798], '0.25': [3801], 'water,': [3805], 'ice.': [3812], 'suspension': [3814], 'equal': [3819], '2×': [3822], 'TNE': [3823, 3888, 3961], '(1×': [3825], '=': [3826], '150': [3827], 'Tris-HCl,': [3835], 'passed': [3839], 'through': [3842], '28.5-gauge': [3844], 'needle.': [3845], 'twice': [3850], '800': [3852], '×g': [3853], 'obtain': [3858], 'supernatant.': [3860], '0.4': [3861], 'supernatant': [3865], 'loaded': [3867], 'sucrose': [3873, 3886], 'gradients': [3874], 'made': [3875], '2-ml': [3877], 'steps': [3878], '0.25,': [3880], '0.5,': [3881], '1,': [3882], '1.5,': [3883], '2m': [3885], '35,000': [3893], 'rpm': [3894], '2.5': [3896], '(SW41': [3898], 'rotor': [3899], '∼200,000': [3900], 'g).': [3902], 'Fractions': [3903], '0.5–0.6': [3905], 'top': [3911], 'gradients.': [3914], 'norepinephrine': [3918], 'fractions': [3921, 3932, 3955], 'determined': [3923, 4083], 'liquid': [3926], 'scintillation': [3927], 'counting.': [3928], 'measure': [3930, 4205], 'PBS,': [3936, 4033], 'subjected': [3937], 'thawing,': [3945], 'radioimmunoassay.': [3949], 'markers,': [3954], '200,000': [3967], 'g.': [3969], 'Membranes': [3970], 'loading': [3975], 'transfections': [3983], 'assays.': [3991], 'Aliquots': [3992], 'extracellular': [3995], '2,': [4003, 4059], '3,': [4004, 4060], '4': [4006, 4023, 4062], 'mmEDTA,': [4016], 'assayed': [4018], 'hGH.': [4020, 4047], 'On': [4021], 'collected,': [4030], 'intracellular': [4046], 'culture': [4055], '4.': [4079], 'Protein': [4080], 'BCA': [4086], 'method': [4087], '(Pierce)': [4088], 'RNA': [4094, 4104], 'blotting': [4095], 'probes': [4101], 'commercial': [4103], 'Clontech': [4108], 'Inc.).': [4109], 'Although': [4110], 'prior': [4111], 'distributions': [4117], '(e.g.': [4121], 'see': [4122], 'Ref.': [4123], '39Matsui': [4124], 'Kikuchi': [4126], 'Kondo': [4128], 'Hishida': [4130], 'Teranishi': [4132], 'Takai': [4134], '1988;': [4139], '263:': [4140], '11071-11074Google': [4141], 'measurements': [4153], 'relative': [4156], 'attempted.': [4163], 'yet': [4176], 'level,': [4180], 'presumably': [4181], 'lack': [4185], 'specific': [4187, 4196], 'antibodies.': [4188], 'Therefore': [4189], 'our': [4190], 'first': [4191], 'generate': [4195], 'sensitivity': [4207], 'specificity.': [4209], 'chose': [4211], 'instead': [4218], 'simply': [4220], 'measuring': [4221], 'mRNAs': [4224], 'quantify': [4230], 'mRNA': [4231, 4240], 'comparisons': [4234], 'often': [4242], 'do': [4243], 'correlate': [4245], 'levels;': [4248], 'proved': [4250], 'particularly': [4253], 'true': [4254], 'below).': [4259], 'characterized': [4261], 'nine': [4265], 'newly': [4274], '(583,': [4276], 'U953,': [4277], 'U954,': [4278], 'αR3D#2,': [4279], 'αR3D#3,': [4280], 'SA5838,': [4281], 'SA5839)': [4283], 'previou': [4285]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2160125876', 'counts_by_year': [{'year': 2024, 'cited_by_count': 5}, {'year': 2023, 'cited_by_count': 3}, {'year': 2022, 'cited_by_count': 8}, {'year': 2021, 'cited_by_count': 6}, {'year': 2020, 'cited_by_count': 9}, {'year': 2019, 'cited_by_count': 4}, {'year': 2018, 'cited_by_count': 2}, {'year': 2017, 'cited_by_count': 6}, {'year': 2016, 'cited_by_count': 2}, {'year': 2015, 'cited_by_count': 5}, {'year': 2014, 'cited_by_count': 5}, {'year': 2013, 'cited_by_count': 9}, {'year': 2012, 'cited_by_count': 11}], 'updated_date': '2024-12-12T20:00:03.456101', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
