Publication Information

{'id': 'https://openalex.org/W2158951763', 'doi': 'https://doi.org/10.1074/jbc.272.40.25238', 'title': 'Bcl-2 Undergoes Phosphorylation by c-Jun N-terminal Kinase/Stress-activated Protein Kinases in the Presence of the Constitutively Active GTP-binding Protein Rac1', 'display_name': 'Bcl-2 Undergoes Phosphorylation by c-Jun N-terminal Kinase/Stress-activated Protein Kinases in the Presence of the Constitutively Active GTP-binding Protein Rac1', 'publication_year': 1997, 'publication_date': '1997-10-01', 'ids': {'openalex': 'https://openalex.org/W2158951763', 'doi': 'https://doi.org/10.1074/jbc.272.40.25238', 'mag': '2158951763', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/9312139'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.272.40.25238', 'pdf_url': 'http://www.jbc.org/article/S0021925819635374/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819635374/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5030071065', 'display_name': 'Kinsey Maundrell', 'orcid': None}, 'institutions': [], 'countries': ['CH'], 'is_corresponding': False, 'raw_author_name': 'Kinsey Maundrell', 'raw_affiliation_strings': ['Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5112207363', 'display_name': 'Bruno Antonsson', 'orcid': None}, 'institutions': [], 'countries': ['CH'], 'is_corresponding': False, 'raw_author_name': 'Bruno Antonsson', 'raw_affiliation_strings': ['Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5018020668', 'display_name': 'Edith Magnenat', 'orcid': None}, 'institutions': [], 'countries': ['CH'], 'is_corresponding': False, 'raw_author_name': 'Edith Magnenat', 'raw_affiliation_strings': ['Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5068489786', 'display_name': 'Montserrat Camps', 'orcid': 'https://orcid.org/0000-0002-9849-8657'}, 'institutions': [], 'countries': ['CH'], 'is_corresponding': False, 'raw_author_name': 'Montserrat Camps', 'raw_affiliation_strings': ['Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5015575318', 'display_name': 'Marco Muda', 'orcid': None}, 'institutions': [], 'countries': ['CH'], 'is_corresponding': False, 'raw_author_name': 'Marco Muda', 'raw_affiliation_strings': ['Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5028304802', 'display_name': 'Christian Chabert', 'orcid': None}, 'institutions': [], 'countries': ['CH'], 'is_corresponding': False, 'raw_author_name': 'Christian Chabert', 'raw_affiliation_strings': ['Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5058552419', 'display_name': 'Corine Gilliéron', 'orcid': None}, 'institutions': [], 'countries': ['CH'], 'is_corresponding': False, 'raw_author_name': 'Corine Gillieron', 'raw_affiliation_strings': ['Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5026837926', 'display_name': 'Ursula Boschert', 'orcid': 'https://orcid.org/0000-0001-7541-5284'}, 'institutions': [], 'countries': ['CH'], 'is_corresponding': False, 'raw_author_name': 'Ursula Boschert', 'raw_affiliation_strings': ['Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5035554025', 'display_name': 'Elizabeth Vial-Knecht', 'orcid': None}, 'institutions': [], 'countries': ['CH'], 'is_corresponding': False, 'raw_author_name': 'Elizabeth Vial-Knecht', 'raw_affiliation_strings': ['Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5021776423', 'display_name': 'Jean‐Claude Martinou', 'orcid': 'https://orcid.org/0000-0002-9847-2051'}, 'institutions': [], 'countries': ['CH'], 'is_corresponding': False, 'raw_author_name': 'Jean-Claude Martinou', 'raw_affiliation_strings': ['Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland', 'institution_ids': []}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5007219308', 'display_name': 'Steve Arkinstall', 'orcid': None}, 'institutions': [], 'countries': ['CH'], 'is_corresponding': True, 'raw_author_name': 'Steve Arkinstall', 'raw_affiliation_strings': ['Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Geneva Biomedical Research Institute, Glaxo Wellcome Research and Development S.A., CH-1228 Plan-les-Ouates, Geneva, Switzerland', 'institution_ids': []}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 0, 'corresponding_author_ids': ['https://openalex.org/A5007219308'], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 9.554, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 406, 'citation_normalized_percentile': {'value': 0.96391, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 99, 'max': 100}, 'biblio': {'volume': '272', 'issue': '40', 'first_page': '25238', 'last_page': '25242'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10294', 'display_name': 'Cell death mechanisms and regulation', 'score': 0.9958, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10294', 'display_name': 'Cell death mechanisms and regulation', 'score': 0.9958, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11533', 'display_name': 'Melanoma and MAPK Pathways', 'score': 0.9946, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10169', 'display_name': 'Protein Kinase Regulation and GTPase Signaling', 'score': 0.9912, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [], 'concepts': [{'id': 'https://openalex.org/C184235292', 'wikidata': 'https://www.wikidata.org/wiki/Q421851', 'display_name': 'Kinase', 'level': 2, 'score': 0.64831245}, {'id': 'https://openalex.org/C118716', 'wikidata': 'https://www.wikidata.org/wiki/Q5514725', 'display_name': "GTP'", 'level': 3, 'score': 0.6143538}, {'id': 'https://openalex.org/C11960822', 'wikidata': 'https://www.wikidata.org/wiki/Q242736', 'display_name': 'Phosphorylation', 'level': 2, 'score': 0.5981396}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.557759}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.5121703}, {'id': 'https://openalex.org/C2779717556', 'wikidata': 'https://www.wikidata.org/wiki/Q15325735', 'display_name': 'RAC1', 'level': 3, 'score': 0.47580773}, {'id': 'https://openalex.org/C97029542', 'wikidata': 'https://www.wikidata.org/wiki/Q281417', 'display_name': 'Protein kinase A', 'level': 3, 'score': 0.4340515}, {'id': 'https://openalex.org/C90934575', 'wikidata': 'https://www.wikidata.org/wiki/Q6593810', 'display_name': 'Mitogen-activated protein kinase kinase', 'level': 4, 'score': 0.43074822}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.39589277}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.24163231}, {'id': 'https://openalex.org/C62478195', 'wikidata': 'https://www.wikidata.org/wiki/Q828130', 'display_name': 'Signal transduction', 'level': 2, 'score': 0.2224414}, {'id': 'https://openalex.org/C181199279', 'wikidata': 'https://www.wikidata.org/wiki/Q8047', 'display_name': 'Enzyme', 'level': 2, 'score': 0.12793377}], 'mesh': [], 'locations_count': 1, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.272.40.25238', 'pdf_url': 'http://www.jbc.org/article/S0021925819635374/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.272.40.25238', 'pdf_url': 'http://www.jbc.org/article/S0021925819635374/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 37, 'referenced_works': ['https://openalex.org/W1572174728', 'https://openalex.org/W1597498191', 'https://openalex.org/W1598719623', 'https://openalex.org/W1965217295', 'https://openalex.org/W1968590447', 'https://openalex.org/W1969158591', 'https://openalex.org/W1976385326', 'https://openalex.org/W1977707442', 'https://openalex.org/W1991865867', 'https://openalex.org/W1993112793', 'https://openalex.org/W1995819749', 'https://openalex.org/W1996522179', 'https://openalex.org/W2000646975', 'https://openalex.org/W2001880177', 'https://openalex.org/W2003487528', 'https://openalex.org/W2015129765', 'https://openalex.org/W2015805559', 'https://openalex.org/W2019572526', 'https://openalex.org/W2020721942', 'https://openalex.org/W2021658407', 'https://openalex.org/W2027039228', 'https://openalex.org/W2032449873', 'https://openalex.org/W2037758170', 'https://openalex.org/W2042584344', 'https://openalex.org/W2051219590', 'https://openalex.org/W2055181868', 'https://openalex.org/W2058285191', 'https://openalex.org/W2065568194', 'https://openalex.org/W2073541193', 'https://openalex.org/W2074169536', 'https://openalex.org/W2088481957', 'https://openalex.org/W2100837269', 'https://openalex.org/W2118873545', 'https://openalex.org/W2143772496', 'https://openalex.org/W2161641464', 'https://openalex.org/W2409635342', 'https://openalex.org/W4241091303'], 'related_works': ['https://openalex.org/W4236891841', 'https://openalex.org/W2473913708', 'https://openalex.org/W2441869695', 'https://openalex.org/W2127004079', 'https://openalex.org/W2073814836', 'https://openalex.org/W2062727033', 'https://openalex.org/W2056481979', 'https://openalex.org/W2038206601', 'https://openalex.org/W2002120054', 'https://openalex.org/W1997543461'], 'abstract_inverted_index': {'We': [0, 201, 3679, 4107, 5049, 5065], 'have': [1, 202, 537, 637, 1109, 4108], 'studied': [2, 203], 'the': [3, 6, 25, 39, 64, 76, 101, 143, 167, 174, 204, 207, 226, 240, 265, 277, 302, 344, 368, 375, 549, 856, 1001, 1035, 1077, 1311, 1315, 1440, 1446, 1459, 1469, 1580, 1932, 1975, 2026, 2034, 2040, 2046, 2105, 2115, 2119, 2123, 2142, 2154, 2165, 2222, 2356, 2363, 2410, 2414, 2821, 3673, 3690, 3727, 3965, 4064, 4165, 4188, 4380, 4404, 4415, 4432, 4517, 4527, 4568, 4571, 4596, 4626, 4691, 4742, 4825, 4884, 4903, 5004, 5046, 5055], 'phosphorylation': [4, 55, 95, 121, 134, 172, 205, 256, 296, 322, 335, 373, 863, 898, 1009, 1038, 1062, 3058, 3273, 3484, 3606, 3620, 3636, 3671, 3862, 3938, 3977, 4057, 4141, 4163, 4183, 4508, 4557, 4671, 4798, 4870, 5014], 'of': [5, 9, 78, 142, 155, 170, 177, 188, 206, 210, 279, 343, 356, 371, 378, 389, 476, 548, 560, 659, 699, 819, 826, 848, 868, 1039, 1057, 1066, 1072, 1180, 1200, 1213, 1252, 1310, 1322, 1388, 1394, 1399, 1405, 1434, 1439, 1445, 1452, 1462, 1579, 1585, 1643, 1774, 1836, 1915, 1931, 1943, 1990, 2029, 2039, 2045, 2070, 2122, 2231, 2369, 2378, 2386, 2403, 2431, 2453, 2497, 2509, 2581, 2584, 2589, 2723, 2820, 2830, 2876, 2884, 2893, 2901, 2939, 2950, 2966, 3066, 3096, 3102, 3109, 3114, 3118, 3122, 3126, 3131, 3139, 3158, 3345, 3348, 3375, 3394, 3607, 3662, 3676, 3692, 3747, 3838, 3848, 3856, 3926, 3944, 3988, 4026, 4066, 4167, 4175, 4298, 4306, 4316, 4369, 4377, 4379, 4407, 4414, 4431, 4472, 4513, 4516, 4526, 4549, 4560, 4567, 4598, 4607, 4621, 4656, 4693, 4709, 4725, 4775, 4797, 4938, 5003, 5036, 5042, 5045], 'Bcl-2': [7, 18, 52, 81, 94, 117, 145, 156, 171, 189, 208, 219, 253, 282, 295, 318, 346, 357, 372, 390, 634, 822, 857, 897, 945, 985, 1002, 1040, 1186, 1909, 1933, 2124, 2148, 2203, 2219, 2371, 2374, 2699, 2858, 2879, 2885, 3272, 3330, 3358, 3492, 3619, 3635, 3655, 3683, 3698, 3720, 3818, 3840, 3850, 3858, 3927, 3953, 3976, 3993, 4021, 4056, 4071, 4085, 4114, 4150, 4162, 4182, 4383, 4393, 4416, 4473, 4518, 4530, 4593, 4681, 4696, 4713, 4822, 4858, 4880, 4908, 5012, 5021], 'family': [8, 196, 209, 397, 635, 823, 844, 859, 1041, 1187, 2729, 3730, 3749, 4002, 4921], 'proteins': [10, 211, 2234, 3495], 'by': [11, 24, 72, 98, 140, 173, 191, 212, 225, 273, 299, 341, 374, 392, 692, 821, 829, 896, 1204, 1215, 1240, 2136, 2169, 2210, 2422, 2460, 2469, 2619, 2624, 2735, 2864, 2923, 2944, 3092, 3143, 3154, 3195, 3281, 3321, 3335, 3361, 3366, 3403, 3437, 3451, 3456, 3485, 3514, 3598, 3623, 3627, 3637, 3660, 3672, 3687, 3863, 4000, 4050, 4063, 4364, 4386, 4403, 4509, 4644, 4686, 4719, 4764, 4944], 'different': [12, 213, 1181, 3486], 'mitogen-activated': [13, 214, 415], 'protein': [14, 29, 215, 230, 425, 1058, 1085, 1317, 1448, 1722, 2178, 2198, 2212, 2265, 2896, 2904, 3111, 3468, 3585, 3712, 3841, 4321], '(MAP)': [15, 216], 'kinases.': [16, 217, 3678], 'Purified': [17, 218, 3329], 'was': [19, 220, 1684, 1698, 1714, 1736, 1764, 1910, 1920, 1961, 2017, 2064, 2110, 2134, 2157, 2193, 2204, 2243, 2272, 2700, 2861, 2970, 3062, 3274, 3318, 3333, 3359, 3609, 3621, 3644, 3656, 3699, 3721, 4022, 4058, 4081, 4086, 4142, 4151, 4362, 4399, 4682, 4697, 4859, 4889, 4894, 4909], 'found': [20, 221, 3705, 4648], 'to': [21, 222, 480, 486, 695, 715, 817, 878, 950, 989, 997, 1006, 1069, 1184, 1222, 1224, 1320, 1458, 1649, 1922, 1927, 1945, 2060, 2087, 2344, 2355, 2471, 2626, 3286, 3431, 3516, 3594, 3625, 3646, 3706, 3742, 3902, 4009, 4047, 4285, 4585, 4636, 4649, 4702, 4750, 4769, 4832, 4896, 5026, 5069], 'be': [22, 223, 951, 1007, 1044, 3595, 3685, 3707, 3827, 3917, 4017, 4650, 4924, 5024], 'phosphorylated': [23, 224, 952, 3334, 3658, 3686, 3821, 3849, 3995, 4592, 4608, 4683, 4891], 'c-Jun': [26, 227, 422, 1082], 'N-terminal': [27, 228, 423, 1083, 4430], 'kinase/stress-activated': [28, 229, 424, 1084], 'kinase': [30, 42, 103, 108, 231, 243, 304, 309, 433, 996, 1080, 1086, 1107, 1312, 1442, 1645, 1856, 2455, 3057, 3133, 3614, 3866, 4014, 4120, 4138, 4178, 4190, 4904, 5007], '(JNK/SAPK)': [31, 232], 'p54-SAPKβ,': [32, 233, 3504, 4287], 'and': [33, 45, 63, 75, 93, 180, 234, 246, 264, 276, 294, 381, 469, 497, 554, 641, 649, 651, 657, 701, 703, 881, 887, 1051, 1088, 1094, 1101, 1206, 1209, 1218, 1231, 1247, 1354, 1454, 1587, 1592, 1639, 1663, 1680, 1693, 1733, 1745, 1770, 1778, 1815, 1827, 1880, 1893, 1897, 1917, 1979, 1992, 2002, 2009, 2023, 2037, 2056, 2074, 2077, 2080, 2082, 2084, 2102, 2104, 2112, 2139, 2162, 2176, 2220, 2229, 2253, 2331, 2347, 2396, 2435, 2441, 2448, 2501, 2560, 2617, 2710, 2727, 2743, 2833, 2898, 2932, 3084, 3136, 3175, 3199, 3364, 3391, 3446, 3493, 3505, 3512, 3527, 3574, 3582, 3704, 3726, 3801, 4100, 4145, 4169, 4193, 4288, 4319, 4360, 4373, 4479, 4489, 4491, 4496, 4538, 4639, 4647, 4654, 4700, 4753, 4760, 4767, 4773, 4789, 4865, 4892, 4940, 5040, 5059, 5076], 'this': [34, 235, 842, 893, 995, 1633, 1957, 3802, 3910, 4361, 4481, 4913, 4941], 'is': [35, 70, 110, 166, 236, 271, 311, 367, 462, 545, 825, 873, 894, 1063, 1195, 1647, 3803, 3851, 3954, 3994, 4115, 4172, 4577, 4583, 4942], 'specific': [36, 104, 237, 305, 2981], 'insofar': [37, 238], 'as': [38, 116, 239, 317, 471, 473, 845, 1091, 1324, 1326, 1466, 1468, 1655, 1804, 2195, 2261, 2488, 2629, 2746, 2985, 3201, 3289, 3535, 3709, 3834, 4029, 4031, 4061, 4782, 4784, 4795, 4872, 4998, 5031], 'extracellular': [40, 241, 418, 830, 1078], 'signal-regulated': [41, 242, 419, 1079], '1': [43, 244, 2538, 2541, 2547, 2550, 2554, 2837, 3382, 3388, 3633, 3653], '(ERK1)': [44, 245], 'p38/RK/CSBP': [46, 247, 1089], '(p38)': [47, 248, 1090], 'catalyzed': [48, 249], 'only': [49, 119, 250, 320, 4067, 4618], 'weak': [50, 120, 251, 321, 4069], 'modification.': [51, 252], 'undergoes': [53, 118, 254, 319, 4868], 'similar': [54, 255, 4012, 4111, 4476], 'in': [56, 113, 135, 257, 314, 336, 712, 815, 884, 953, 1151, 1329, 1384, 1574, 1658, 1963, 1972, 1981, 2049, 2114, 2159, 2245, 2266, 2320, 2338, 2409, 2413, 2462, 2494, 2593, 2907, 2936, 2947, 3063, 3341, 3372, 3482, 3499, 3509, 3701, 3744, 3813, 3998, 4096, 4164, 4184, 4310, 4314, 4521, 4594, 4625, 4675, 4684, 4690, 4735, 4745, 4755, 4799, 4816, 4824, 4899, 4912, 4927], 'COS-7': [57, 114, 136, 258, 315, 337, 2313, 2822, 3510, 3702, 3930, 4185, 4522, 4563], 'when': [58, 122, 259, 323, 2094, 3952, 4084, 4149], 'coexpressed': [59, 260, 4023, 4116], 'together': [60, 261, 1396, 3963, 4123], 'with': [61, 83, 100, 124, 262, 284, 301, 325, 991, 1250, 1307, 1397, 1568, 1974, 1983, 1999, 2019, 2249, 2279, 2424, 2433, 2506, 2720, 2827, 2873, 2890, 2972, 3099, 3283, 3337, 3409, 3421, 3470, 3576, 3629, 3723, 3806, 3812, 3853, 3920, 3933, 3958, 3961, 3964, 3981, 4024, 4089, 4098, 4117, 4124, 4154, 4295, 4536, 4875, 4984, 4991], 'p54-SAPKβ': [62, 91, 263, 292, 2239, 3631, 3688, 3725, 3807, 3945, 3959, 3962, 4168, 4370, 4537, 4561, 4582, 4673], 'constitutive': [65, 266, 3728], 'Rac1': [66, 267, 1895, 1898, 3732, 3969, 4125, 4128, 4155, 4170, 4289, 4539], 'mutant': [67, 147, 268, 348, 1389, 1437, 2126, 2133, 3737, 3968, 4519, 4882], 'G12V.': [68, 269], 'This': [69, 165, 270, 366, 1194, 3734, 3825, 3937, 4079, 4308, 4542], 'seen': [71, 112, 272, 313, 4083, 4143], 'both': [73, 89, 274, 290, 643, 1227, 2218, 3724, 4365], '32PO4labeling': [74, 275], 'appearance': [77, 278, 4065], 'five': [79, 280, 3903, 4381, 4528], 'discrete': [80, 281], 'bands': [82, 283, 3905, 3914, 4072, 4384, 4531, 4874], 'reduced': [84, 285, 4396], 'gel': [85, 286, 2621, 3197, 3846, 4075, 4397, 4877], 'mobility.': [86, 287, 4878], 'As': [87, 288], 'anticipated,': [88, 289], 'intracellular': [90, 291, 533, 4176], 'activation': [92, 293, 1212, 1239, 1321, 1393, 1451, 1584, 3746, 3943, 3987, 4049, 4559, 4674, 4937, 5041], 'are': [96, 297, 690, 860, 1401, 3906, 3950, 4802, 4989, 5066], 'blocked': [97, 298], 'co-transfection': [99, 300], 'MAP': [102, 107, 178, 303, 308, 379, 432, 1074, 1106, 1182, 1644, 2454, 2725, 2968, 3056, 3487, 3583, 3590, 3613, 3642, 3677, 4013, 4119, 4137, 4177, 4189, 5006], 'phosphatase': [105, 306], 'MKP3/PYST1.': [106, 307], 'specificity': [109, 310, 4015], 'also': [111, 312, 947, 1110, 1566, 2733, 3657, 3916, 4109, 4293, 4400, 4867, 5067], 'cells': [115, 137, 316, 338, 890, 955, 1230, 2270, 2314, 2438, 2457, 3511, 3703, 3931, 4186, 4291, 4523, 4801, 4856], 'co-expressed': [123, 324, 3722], 'enzymatically': [125, 326, 3596], 'activated': [126, 327, 3513, 3597, 3630, 3663, 4033], 'ERK1': [127, 328, 1807, 3639, 4028, 4048, 4099], 'or': [128, 329, 491, 832, 1314, 1444, 1676, 2372, 2382, 2393, 2400, 2407, 2478, 2707, 2713, 2977, 3128, 3640, 3960, 4036, 4093, 4095, 4122, 4127, 4302, 4547], 'p38.': [129, 330], 'Four': [130, 331], 'critical': [131, 332, 1402, 1570], 'residues': [132, 333, 2063, 4551, 4669], 'undergoing': [133, 334, 4670], 'were': [138, 339, 1667, 1748, 1782, 1791, 1800, 1996, 2058, 2100, 2225, 2235, 2315, 2336, 2360, 2419, 2439, 2458, 2491, 2564, 2591, 2732, 2825, 2846, 2920, 3090, 3152, 3193, 3401, 3419, 3444, 3454, 3507, 3592, 4292, 4623, 4642, 4717, 4762, 4815], 'identified': [139, 340, 640, 1112, 3450, 4484, 4794, 4911], 'expression': [141, 342, 1433, 2144, 3498, 4515, 4823, 5056], 'quadruple': [144, 345, 2131], 'point': [146, 347, 2132], 'T56A,S70A,T74A,S87A.': [148, 349], 'Sequencing': [149, 350], 'phosphopeptides': [150, 351, 3449], 'derived': [151, 352, 4711], 'from': [152, 353, 1590, 1669, 1685, 1699, 1716, 1727, 1737, 1749, 1758, 1765, 1783, 1793, 1808, 1817, 1829, 1841, 1849, 1859, 1866, 1883, 1903, 2164, 3429, 3929, 4712], 'tryptic': [153, 354, 4714], 'digests': [154, 355], 'indicates': [157, 358, 1391, 4544], 'that': [158, 359, 855, 892, 1037, 1392, 1637, 4147, 4161, 4501, 4545, 4919], 'purified': [159, 360, 2163, 2205, 2248, 2273, 3277, 3360, 3496, 3816, 3992, 4601, 4687, 4699], 'GST-p54-SAPKβ': [160, 361, 3279, 3338, 4689], 'phosphorylates': [161, 362], 'identical': [162, 363, 3650], 'sitesin': [163, 364], 'vitro.': [164, 365], 'first': [168, 369, 3490], 'report': [169, 370, 1636, 4819, 4914], 'JNK/SAPK': [175, 376, 1214, 1238, 1323, 1395, 1441, 1453, 1573, 1586, 3674, 3748, 4001, 4920, 5005], 'class': [176, 377, 1108, 3675], 'kinases': [179, 380, 1059, 1075, 1183, 1390, 2726, 2969, 3488, 3591, 3643], 'could': [181, 382, 1043, 3684], 'indicate': [182, 383], 'a': [183, 384, 546, 558, 709, 846, 874, 1008, 1045, 1064, 1569, 1653, 1938, 1951, 1964, 2196, 2262, 2568, 2877, 3342, 3410, 3471, 3710, 3835, 3857, 4173, 4311, 4366, 4374, 4475, 4818, 4992], 'key': [184, 385], 'modification': [185, 386, 4569], 'allowing': [186, 387], 'control': [187, 388, 481, 818], 'function': [190, 391], 'cell': [192, 393, 403, 412, 493, 850, 1219, 1331, 1464, 1711, 2167, 2585, 2823, 4828, 4863, 4930], 'surface': [193, 394], 'receptors,': [194, 395], 'Rho': [195, 396, 3729], 'GTPases,': [197, 398], 'and/or': [198, 399], 'cellular': [199, 400, 1456, 4945], 'stresses.': [200, 401], 'Programmed': [402], 'death': [404, 494, 4864], '(PCD)': [405], '1The': [406], 'abbreviations': [407], 'used': [408, 1921], 'are:': [409], 'PCD,': [410, 1577], 'programmed': [411], 'death;': [413], 'MAP,': [414], 'protein;': [416, 438], 'ERK,': [417], 'kinase:': [420], 'JNK/SAPK,': [421, 1638, 4939], 'kinase;': [426], 'SEK1,': [427], 'SAPK': [428], 'ERK': [429, 1202, 1400], 'kinase-1;': [430], 'MKP,': [431], 'phosphatase;': [434], 'MBP,': [435, 3123, 3580], 'myelin': [436], 'basic': [437], 'ATF-2,': [439, 3581], 'activating': [440], 'transcription': [441], 'factor': [442, 1410], '2;': [443], 'HA,': [444], 'hemagglutinin;': [445], 'PCR,': [446], 'polymerase': [447, 1683], 'chain': [448], 'reaction;': [449], 'GST,': [450], 'glutathione': [451], 'S-transferase;': [452], 'EGF,': [453], 'epidermal': [454], 'growth': [455, 1205, 1409], 'factor;': [456], 'HPLC,': [457, 3362], 'high': [458], 'pressure': [459], 'liquid': [460, 2179, 2213, 3466], 'chromatography.': [461], 'an': [463, 3422, 3460, 3693, 3864, 4420], 'essential': [464, 4553], 'process': [465], 'for': [466, 474, 862, 1048, 1104, 1235, 1403, 1572, 2052, 2285, 2443, 2465, 2485, 2574, 2614, 2836, 2851, 2867, 2913, 2929, 3145, 3177, 3189, 3481, 3718, 4507, 4556, 4906, 5054, 5062, 5073], 'tissue': [467], 'development': [468], 'homeostasis': [470], 'well': [472, 1325, 1467, 4030, 4783], 'elimination': [475], 'damaged': [477], 'cells.': [478, 4020, 4564, 4901], 'Failure': [479], 'PCD': [482, 536, 660, 1253], 'appropriately': [483], 'can': [484, 3826, 3915, 4016], 'lead': [485, 1223], 'diseases': [487], 'involving': [488], 'either': [489, 3638, 3956, 4090], 'inadequate': [490], 'unwanted': [492], '(e.g..': [495], 'cancers': [496], 'neurodegeneration)': [498], '(1Raff': [499], 'M.C.': [500], 'Nature.': [501, 1521, 2304, 2601, 2956, 3166, 3307, 4461], '1992;': [502, 582], '356:': [503], '397-400Crossref': [504], 'PubMed': [505, 516, 529, 570, 585, 610, 626, 669, 683, 726, 761, 790, 806, 915, 971, 1026, 1126, 1140, 1173, 1275, 1301, 1378, 1426, 1490, 1525, 1558, 1627, 2308, 2605, 2658, 2694, 2775, 2810, 2960, 3014, 3050, 3170, 3231, 3267, 3311, 3567, 3774, 3796, 3883, 4222, 4258, 4278, 4355, 4465, 4849, 4978], 'Scopus': [506, 517, 586, 611, 627, 684, 762, 791, 807, 916, 972, 1027, 1127, 1141, 1174, 1276, 1302, 1379, 1427, 1491, 1526, 1559, 1628, 2309, 2606, 2659, 2695, 2776, 2811, 2961, 3015, 3051, 3171, 3232, 3268, 3312, 3568, 3775, 3797, 3884, 4223, 4259, 4279, 4356, 4466, 4850, 4979], '(2507)': [507], 'Google': [508, 519, 530, 571, 588, 613, 629, 670, 686, 727, 764, 793, 809, 918, 931, 943, 974, 1029, 1129, 1143, 1176, 1278, 1304, 1381, 1429, 1493, 1528, 1561, 1630, 2311, 2608, 2661, 2697, 2778, 2813, 2963, 3017, 3053, 3173, 3234, 3270, 3314, 3570, 3777, 3799, 3886, 3899, 4225, 4261, 4281, 4358, 4468, 4852, 4981], 'Scholar,': [509, 520, 572, 589, 614, 671, 728, 765, 794, 919, 932, 1130, 1144, 1153, 1360, 1494, 1529, 2662, 3018, 3235, 3778, 3887, 4226, 4262], '2Thompson': [510], 'C.B.': [511, 4454, 4843], 'Science.': [512, 581, 1422, 1623], '1995;': [513, 787, 912, 1120, 1134, 1423, 3768, 3790, 3880], '267:': [514], '1456-1462Crossref': [515], '(6244)': [518], '3Yang': [521], 'E.': [522, 563, 662, 719, 744, 771, 1114, 1510, 1535, 1537, 1842, 1904, 2246, 3500], 'Korsmeyer': [523, 564, 663, 720, 778, 797], 'S.J.': [524, 565, 664, 721, 798, 3555], 'Blood.': [525, 566, 665, 722], '1996;': [526, 567, 666, 680, 723, 928, 940, 963, 980, 1018, 1170, 1267, 1298, 1522, 1550, 2650, 2767, 3006, 3223, 3559, 3896, 4214, 4275, 4462], '88:': [527, 568, 667, 724], '386-401Crossref': [528, 569, 668, 725], 'Scholar).': [531, 630, 687, 810, 944, 983, 1030, 1177, 1305, 1382, 1430, 1562, 1631, 2312, 2698, 2814, 2964, 3054, 3271, 3315, 3571, 3900, 4282, 4469, 4853, 4982], 'Several': [532], 'molecules': [534], 'controlling': [535, 1576, 1660], 'now': [538, 638], 'been': [539, 639, 948, 987, 1111, 1192, 3739], 'identified.': [540], 'These': [541, 688, 4633], 'include': [542, 642, 4666], 'Bcl-2,': [543, 646, 1651, 2582, 3119, 4286, 4609, 4657, 4776], 'which': [544, 993, 2050, 2843, 4641, 5009], 'homologue': [547, 1003, 4417], 'Caenorhabditis': [550], 'elegans': [551], 'gene': [552, 843, 858, 1582], 'ced-9': [553], 'blocks': [555, 1450, 1583], 'apoptosis': [556, 820, 1328, 1406, 1594, 4898, 4946], 'under': [557, 2317, 3649, 3822], 'variety': [559], 'conditions': [561, 3651, 4045], '(3Yang': [562, 661, 718], '4Garcia': [573], 'I.': [574, 576, 1606, 1868, 2289, 2640, 2678, 2757, 2794, 2996, 3034, 3213, 3251, 3292, 4204, 4242, 4339, 4962], 'Martinou': [575, 579, 598, 1605, 1621, 2637, 2639, 2677, 2754, 2756, 2793, 2993, 2995, 3033, 3210, 3212, 3250, 4201, 4203, 4241, 4338, 4961], 'Tsujimoto': [577, 594], 'Y.': [578, 595], 'J.-C.': [580, 1622, 2638, 2755, 2994, 3211, 3756, 4202], '258:': [583], '302-306Crossref': [584], '(695)': [587], '5Dubois-Dauphin': [590], 'M.': [591, 732, 1415, 1496, 1860, 2632, 2642, 2664, 2676, 2749, 2759, 2780, 2792, 2988, 2998, 3020, 3032, 3205, 3215, 3237, 3249, 3539, 3547, 3754, 3788, 4196, 4206, 4228, 4240, 4325, 4337, 4440, 4948, 4960], 'Frankowski': [592], 'H.': [593, 3758, 4442], 'Huarte': [596], 'J.': [597, 750, 923, 960, 1161, 1169, 1264, 1286, 1417, 1543, 1809, 1818, 1830, 1885, 2299, 2647, 2683, 2764, 2799, 3003, 3039, 3220, 3256, 3302, 3556, 3891, 4211, 4247, 4274, 4344, 4845, 4967, 5071], 'J.C.': [599, 1016], 'Proc.': [600, 751, 780, 905, 1291, 3873], 'Natl.': [601, 752, 781, 906, 1292, 3874], 'Acad.': [602, 753, 782, 907, 1293, 3875], 'Sci.': [603, 754, 783, 908, 1119, 1294, 3876], 'U.': [604, 755, 784, 909, 1295, 2634, 2666, 2751, 2782, 2990, 3022, 3207, 3239, 3545, 3877, 4198, 4230, 4327, 4950], 'S.': [605, 734, 736, 756, 779, 785, 900, 910, 921, 1155, 1296, 1506, 1602, 1604, 1704, 1831, 2646, 2682, 2763, 2798, 3002, 3038, 3219, 3255, 3868, 3878, 3889, 4210, 4246, 4270, 4343, 4966], 'A.': [606, 757, 786, 911, 1284, 1297, 1516, 1610, 1705, 2668, 2680, 2784, 2796, 3024, 3036, 3241, 3253, 3541, 3553, 3780, 3782, 3786, 3879, 4232, 4244, 4329, 4341, 4746, 4952, 4964], '1994;': [607, 620, 758, 800, 2305, 3308], '91:': [608, 759], '3309-3313Crossref': [609], '(243)': [612, 685], '6Hengartner': [615], 'M.O.': [616], 'Horvitz': [617], 'H.R.': [618], 'Cell.': [619, 799, 1017, 1133, 1369, 1481, 3767, 3789], '76:': [621], '665-676Abstract': [622], 'Full': [623, 803, 966, 968, 1021, 1023, 1123, 1137, 1270, 1272, 1373, 1375, 1485, 1487, 1553, 1555, 2653, 2655, 2689, 2691, 2770, 2772, 2805, 2807, 3009, 3011, 3045, 3047, 3226, 3228, 3262, 3264, 3562, 3564, 3771, 3793, 4217, 4219, 4253, 4255, 4350, 4352, 4973, 4975], 'Text': [624, 804, 967, 969, 1022, 1024, 1124, 1138, 1271, 1273, 1374, 1376, 1486, 1488, 1554, 1556, 2654, 2656, 2690, 2692, 2771, 2773, 2806, 2808, 3010, 3012, 3046, 3048, 3227, 3229, 3263, 3265, 3563, 3565, 3772, 3794, 4218, 4220, 4254, 4256, 4351, 4353, 4974, 4976], 'PDF': [625, 805, 970, 1025, 1125, 1139, 1274, 1377, 1489, 1557, 2657, 2693, 2774, 2809, 3013, 3049, 3230, 3266, 3566, 3773, 3795, 4221, 4257, 4354, 4977], '(1057)': [628], 'In': [631, 1226, 1431, 1632, 1936, 3617, 4130, 4283, 4511, 4854], 'vertebrates,': [632], 'several': [633, 1216, 1330], 'members': [636, 824, 1042, 1188, 3750, 4003, 4922, 5002], 'repressors': [644], '(e.g.': [645, 653], 'Bcl-XL,': [647], 'Mcl-1,': [648], 'A1)': [650], 'promoters': [652], 'Bax,': [654, 3115], 'Bcl-XS,': [655], 'Bak,': [656], 'Bad)': [658], '7Farrow': [672], 'S.N.': [673], 'Brown': [674], 'R.': [675, 1364, 1476, 1498, 1620, 1819, 2636, 2753, 2992, 3209, 4200], 'Curr.': [676, 1548], 'Opin.': [677], 'Genet.': [678], 'Dev.': [679], '6:': [681, 1551], '45-49Crossref': [682], 'genes': [689, 1100], 'characterized': [691], 'their': [693, 704, 827, 3577], 'ability': [694, 1179], 'form': [696], 'complex': [697, 2881, 3088], 'networks': [698], 'homo-': [700], 'heterodimers,': [702], 'relative': [705], 'abundance': [706], 'probably': [707, 3985], 'plays': [708], 'major': [710, 812], 'role': [711, 1571, 1654], 'determining': [713, 849], 'sensitivity': [714], 'apoptotic': [716], 'signals': [717, 831, 4996], '8Sato': [729], 'T.': [730, 767, 1157, 3764], 'Hanada': [731], 'Bodrug': [733], 'Irie': [735], 'Iwama': [737], 'N.': [738, 902, 1850, 3543, 3762, 3870], 'Boise': [739, 774], 'L.': [740, 746, 775, 1541, 1608, 1867], 'Thompson': [741, 776, 4453, 4842], 'C.': [742, 777, 1884, 2672, 2674, 2788, 2790, 3028, 3030, 3245, 3247, 3549, 4236, 4238, 4333, 4335, 4956, 4958], 'Golemis': [743], 'Fong': [745], 'Wang': [747, 772, 1256], 'H.-G.': [748, 1012], 'Reed': [749, 1015], '9238-9242Crossref': [760], '(597)': [763], '9Sedlak': [766], 'Oltvai': [768], 'Z.': [769, 1413, 1518], 'Yang': [770, 935], 'K.': [773, 1533, 1616, 2295, 3298, 3551], '92:': [788, 913, 3881], '7834-7838Crossref': [789], '(788)': [792], '10Oltvai': [795], 'Z.N.': [796], '79:': [801], '189-192Abstract': [802], '(778)': [808], 'One': [811], 'unanswered': [813], 'question': [814, 1065], 'relation': [816], 'regulation': [828], 'external': [833], 'environment': [834, 3691], 'and,': [835], 'importantly,': [836], 'whether': [837, 3682, 4011, 4581], 'receptor-linked': [838], 'transduction': [839], 'pathways': [840, 1659], 'target': [841, 1010, 1656, 4554], 'means': [847], 'fate.': [851], 'Emerging': [852], 'data': [853], 'imply': [854], 'targets': [861, 994], 'suggesting': [864, 1652, 3669], 'one': [865, 4546], 'potential': [866, 4505], 'mechanism': [867, 1047], 'control.': [869], 'For': [870, 2217, 2450, 2579, 2815, 2857, 3055], 'instance,': [871, 1236], 'taxol': [872], 'chemotherapeutic': [875], 'agent': [876], 'known': [877, 1221, 3578], 'promote': [879], 'death,': [880], 'recent': [882], 'studies': [883, 4814], 'leukemic,': [885], 'prostate,': [886], 'nasopharyngeal': [888], 'carcinoma': [889], 'show': [891], 'accompanied': [895, 4363, 4943], '(11Haldar': [899, 3867], 'Jena': [901, 3869], 'Croce': [903, 924, 3871, 3892], 'C.M.': [904, 925, 3872, 3893], '4507-4511Crossref': [914, 3882], '(752)': [917, 3885], '12Haldar': [920, 3888], 'Chintapalli': [922, 3890], 'Cancer': [926, 1822, 3894], 'Res.': [927, 3895], '56:': [929, 3897], '1253-1255PubMed': [930, 3898], '13Shu': [933], 'C.-H.': [934], 'W.K.': [936], 'Huang': [937], 'T.-S.': [938], 'Apoptosis.': [939], '1:': [941], '141-146Crossref': [942], 'has': [946, 986, 1189, 3738], 'reported': [949, 988], 'Jurkat': [954, 1228], '(14Chen': [956], 'C.Y.': [957, 976], 'Faller': [958, 977], 'D.V.': [959, 978], 'Biol.': [961, 1265, 1549, 2648, 2684, 2765, 2800, 3004, 3040, 3221, 3257, 3557, 4212, 4248, 4345, 4968], 'Chem.': [962, 1266, 2649, 2685, 2766, 2801, 3005, 3041, 3222, 3258, 3558, 4213, 4249, 4346, 4969], '271:': [964, 1268, 2651, 2768, 3007, 3224, 3560, 4215], '2376-2379Abstract': [965], '(131)': [973], 'Scholar,15Chen': [975], 'Oncogene.': [979], '11:': [981], '1487-1498Google': [982], 'Interestingly,': [984], 'associate': [990], 'Raf-1,': [992], 'mitochondrial': [998, 5032], 'membranes': [999, 2628], 'where': [1000, 4113], 'Bad': [1004], 'appears': [1005, 3939], '(16Wang': [1011], 'Rapp': [1013], 'U.R.': [1014], '87:': [1019], '629-638Abstract': [1020], '(714)': [1028], 'Together,': [1031, 4662], 'these': [1032, 3599, 3823, 4131, 4550, 4587, 4663, 4813, 4855, 4900, 4987], 'observations': [1033, 4988], 'support': [1034, 4512, 5075], 'notion': [1036], 'pivotal': [1046], 'integrating': [1049], 'pro-': [1050], 'anti-apoptotic': [1052], 'signals.': [1053], 'The': [1054, 1178, 1797, 1987, 2012, 2097, 2129, 3912, 4391, 4411, 4565], 'molecular': [1055], 'identity': [1056], 'underlying': [1060, 4570], 'such': [1061, 4997, 5030], 'paramount': [1067], 'importance': [1068], 'our': [1070, 4916, 4985], 'understanding': [1071], 'PCD.': [1073, 1225], 'comprise': [1076], '(ERK),': [1081], '(JNK/SAPK),': [1087], 'three': [1092, 3589], 'structurally': [1093], 'functionally': [1095], 'distinct': [1096, 3904], 'enzyme': [1097], 'classes.': [1098], 'Multiple': [1099], 'splice': [1102], 'variants': [1103], 'each': [1105, 2092, 4498], '(17Cano': [1113], 'Mahadevan': [1115], 'L.C.': [1116], 'Trends': [1117, 1148], 'Biochem.': [1118], '20:': [1121], '117-122Abstract': [1122], '(1007)': [1128], '18Marshall': [1131], 'C.J.': [1132], '80:': [1135], '179-185Abstract': [1136], '(4287)': [1142], '19Cohen,': [1145], 'P.': [1146, 1342, 3760], '(1997)': [1147], 'Cell': [1149], 'Biol.,': [1150], 'pressGoogle': [1152], '20Gupta': [1154], 'Barrett': [1156], 'Whitmarsh': [1158], 'A.J.': [1159, 4837], 'Cavanagh': [1160], 'Sluss': [1162], 'H.K.': [1163], 'Derijard': [1164], 'B.': [1165, 1502, 1596, 2670, 2786, 3026, 3243, 4234, 4331, 4954, 5052], 'Davies': [1166, 3550], 'R.J.': [1167, 1261, 1419], 'EMBO': [1168, 4273, 4844], '15:': [1171, 4276], '2760-2770Crossref': [1172], '(1195)': [1175], 'phosphorylate': [1185, 1650], 'not': [1190, 1640, 4082, 4890, 4910], 'hitherto': [1191], 'reported.': [1193], 'surprising': [1196], 'given': [1197], 'many': [1198], 'reports': [1199, 3855], 'increased': [1201, 3622], 'activity': [1203, 4372], 'survival': [1207], 'factors': [1208], 'moreover,': [1210], 'preferential': [1211], 'stimuli': [1217, 1243, 3600], 'stresses': [1220, 1465], 'T': [1229], 'B104': [1232], 'lymphoma': [1233], 'cells,': [1234, 1386], 'sustained': [1237, 4936], 'some': [1241], 'pro-apoptotic': [1242, 1460, 4995, 5028], '(γ': [1244], 'radiation,': [1245], 'UV-C,': [1246], 'anti-IgM)': [1248], 'correlates': [1249], 'onset': [1251], '(21Chen': [1254], 'Y.-R.': [1255], 'X.': [1257, 1362, 1474], 'Templeton': [1258], 'D.': [1259, 1368, 1480, 4450], 'Davis': [1260, 1418], 'Tan': [1262], 'T.-H.': [1263], '31929-31936Abstract': [1269], '(859)': [1277], 'Scholar,22Graves': [1279], 'J.D.': [1280], 'Draves': [1281], 'K.E.': [1282], 'Craxton': [1283], 'Saklatvala': [1285], 'Krebs': [1287], 'E.G.': [1288], 'Clark': [1289], 'E.A.': [1290], '93:': [1299], '13814-13818Crossref': [1300], '(158)': [1303], 'Consistent': [1306, 3811], 'this,': [1308, 3604, 4514], 'overexpression': [1309], 'ASK-1': [1313], 'Fas-binding': [1316], 'Daax': [1318, 1449], 'leads': [1319], 'enhanced': [1327], 'lines': [1332], '(23Science': [1333], '275,': [1334, 1358], '90–94Ichijo,': [1335], 'H.,': [1336], 'Nishida,': [1337], 'E.,': [1338], 'Irie,': [1339], 'K.,': [1340, 1351, 1353], 'Dijke,': [1341], 'T.,': [1343, 1347], 'Saitoh,': [1344], 'M.,': [1345, 1349], 'Moriguchi,': [1346], 'Takagi,': [1348], 'Matsumoto,': [1350], 'Miyazono,': [1352], 'Gotoh,': [1355], 'Y.Science': [1356], ',': [1357], '90–94Google': [1359], '24Yang': [1361], 'Khosravi-Far': [1363, 1475], 'Chang': [1365, 1477, 4451], 'H.Y.': [1366, 1478], 'Baltimore': [1367, 1479], '1997;': [1370, 1482, 1624, 2686, 2802, 3042, 3259, 4250, 4347, 4846, 4970], '89:': [1371, 1483], '1067-1076Abstract': [1372, 1484], '(841)': [1380, 1492], 'Moreover,': [1383], 'PC12': [1385], 'use': [1387], 'inhibition': [1398, 4368], 'induction': [1404], 'following': [1407, 1798, 2277, 2364, 3497, 4558, 4672], 'nerve': [1408], 'withdrawal': [1411], '(25Xia': [1412], 'Dickens': [1414], 'Raingeaud': [1416], 'Greenberg': [1420], 'M.E.': [1421], '270:': [1424], '1326-1331Crossref': [1425], '(5074)': [1428], 'addition,': [1432, 1937], 'dominant': [1435, 3966, 4037], 'inhibitory': [1436, 3967, 4038], 'forms': [1438], 'SEK1': [1443, 1581, 2259, 3317], 'Fas-interacting': [1447], 'confers': [1455], 'resistance': [1457], 'effects': [1461], 'Fas,': [1463], 'DNA-damaging': [1470], 'drug': [1471], 'cis-platinum': [1472], '(24Yang': [1473], '26Verheij': [1495], 'Bose': [1497], 'Lin': [1499, 3781], 'X.H.': [1500], 'Yao': [1501], 'Jarvis': [1503], 'W.D.': [1504], 'Grant': [1505], 'Birrer': [1507], 'M.J.': [1508], 'Szabo': [1509], 'Zon': [1511, 1540, 1869, 2302, 3305], 'L.I.': [1512, 2303, 3306], 'Kyriakis': [1513, 1542, 2300, 3303], 'J.M.': [1514, 2301, 3304], 'Haimovitz-Friedman': [1515], 'Fuks': [1517], 'Kolesnick': [1519], 'R.N.': [1520], '380:': [1523], '75-79Crossref': [1524], '(1724)': [1527], '27Zanke': [1530], 'B.W.': [1531], 'Boudreau': [1532], 'Rubie': [1534], 'Winnett': [1536], 'Tibbles': [1538], 'L.A.': [1539, 4264], 'Liu': [1544], 'F.-F.': [1545], 'Woodgett': [1546, 1820, 2296, 3299], 'J.R.': [1547, 2297, 3300], '606-613Abstract': [1552], '(440)': [1560], 'Somewhat': [1563], 'surprisingly,': [1564], 'although': [1565, 3919, 4617], 'consistent': [1567, 3852, 4990], 'processes': [1575, 5029], 'deletion': [1578, 2036, 2125, 4881], 'protects': [1588], 'thymocytes': [1589], 'Fas': [1591], 'CD3-mediated': [1593], '(28Antonsson': [1595], 'Conti': [1597], 'F.': [1598, 1618], 'Ciavatta': [1599], 'A.-M.': [1600], 'Montessuit': [1601], 'Lewis': [1603], 'Bernasconi': [1607], 'Bernard': [1609], 'Mermod': [1611], 'J.-J.': [1612], 'Mazzei': [1613], 'G.': [1614], 'Maundrell': [1615], 'Gambale': [1617], 'Sadoul': [1619], '277:': [1625], '370-372Crossref': [1626], '(937)': [1629], 'paper': [1634], 'we': [1635, 3489, 4006, 4180, 4483, 4502, 4590], 'other': [1641, 1789], 'classes': [1642], 'tested,': [1646], 'able': [1648, 4584, 4895], 'substrate': [1657, 3110], 'apoptosis.': [1661], 'Restriction': [1662], 'DNA': [1664, 1682], 'modifying': [1665], 'enzymes': [1666], 'purchased': [1668, 1715], 'New': [1670], 'England': [1671], 'Biolabs': [1672], 'Inc.': [1673, 1719, 1730], '(Beverly,': [1674], 'MA)': [1675], 'Life': [1677, 1717], 'Technologies,': [1678, 1718, 2352], 'Inc.,': [1679], 'Taq': [1681], 'Perkin-Elmer.': [1686], '[γ-32P]ATP': [1687], '(5000': [1688], 'Ci/mmol),': [1689, 1692], '[γ-33P]ATP': [1690, 3354], '(1000': [1691], '[32P]orthophosphoric': [1694], 'acid': [1695, 3477], '(8500': [1696], 'Ci/mmol)': [1697], 'DuPont': [1700], 'de': [1701], 'Nemours': [1702], 'International': [1703], '(Regensdorf,': [1706], 'Switzerland).': [1707, 1787, 1796], "Dulbecco's": [1708, 2321], 'modified': [1709, 2322], "Eagle's": [1710], 'culture': [1712], 'medium': [1713, 2324, 2464], '(Basel,': [1720, 1753], 'Switzerland),': [1721, 1754, 1762, 1769], 'A-Sepharose': [1723, 2897], '4': [1724, 2840, 2855, 2871, 2917, 4631, 4660], 'Fast': [1725], 'Flow': [1726], 'Pharmacia': [1728], 'Biotech': [1729], '(Uppsala,': [1731], 'Sweden),': [1732], 'murine': [1734], 'EGF': [1735, 2472, 3517], 'Promega': [1738], '(Madison,': [1739], 'WI).': [1740], 'Anti-Bcl-2': [1741], 'antibodies': [1742, 2704, 2740], 'SC': [1743, 1746, 2705, 2708], '509': [1744, 2706], '492': [1747, 2709], 'Dr.': [1750, 5051, 5070], 'Glaser': [1751], 'AG': [1752], 'anti-Bcl-2': [1755, 2703], 'antibody': [1756, 2887], 'OM-11–925': [1757, 2888], 'AMS': [1759], 'Biotechnology': [1760], '(Lugano,': [1761], 'anti-HA.11': [1763], 'Rowag': [1766], 'Diagnostics': [1767], '(Zurich,': [1768], 'horseradish': [1771, 2717], 'peroxidase': [1772, 2718], 'conjugates': [1773], 'goat': [1775, 1779, 2711, 2714], 'anti-mouse': [1776, 2712], 'IgG': [1777, 1781, 2716], 'anti-rabbit': [1780, 2715], 'Bio-Rad': [1784], 'Laboratories': [1785], '(Glattbrugg,': [1786], 'All': [1788], 'chemicals': [1790], 'obtained': [1792, 1803], 'Sigma': [1794], '(Buchs,': [1795], 'plasmids': [1799], 'generous': [1801], 'gifts': [1802], 'follows:': [1805], 'pcDNA1-HA-p44': [1806, 2379], 'Pouyssegur': [1810], '(CNRS,': [1811], 'Nice,': [1812], 'France),': [1813], 'pMT2T-HA-p54-SAPKβ': [1814], 'pGEX-c-Jun-(5–89)': [1816], '(Ontario': [1821], 'Institute,': [1823], 'Toronto,': [1824], 'Canada),': [1825], 'pcDNA3-HA-p38': [1826], 'pGEX-ATF-2-(1–96)': [1828], 'Gutkind': [1832, 3765], '(NIDR,': [1833], 'National': [1834], 'Institutes': [1835], 'Health,': [1837], 'Bethesda,': [1838], 'MD),': [1839], 'pGEX-c-Jun-(1–79)': [1840], 'Bettini': [1843], '(Glaxo': [1844], 'Wellcome,': [1845], 'Verona,': [1846], 'Italy),': [1847], 'pGEX-ATF-2-(19–96)': [1848], 'Jones': [1851], '(ICRF,': [1852], 'London,': [1853, 1891], 'UK),': [1854, 1892], 'pGEX-MAPKAP': [1855], '2': [1857, 2332, 2466, 2495, 2575, 2868, 2914, 3081, 3134, 3714, 3809, 3843, 4042, 4054, 4105], 'Δ3B': [1858], 'Gaestel': [1861], '(MDC,': [1862], 'Berlin,': [1863], 'Germany),': [1864], 'pEBG-SEK1': [1865], '(Howard': [1870], 'Hughes': [1871, 2290, 3293], 'Medical': [1872], 'Institute': [1873], "Children's": [1874], 'Hospital,': [1875], 'Boston,': [1876], 'MA),': [1877], 'pEXV3-Myc-Ras': [1878, 1881, 2391, 2394], '(G12V)': [1879, 1896, 4035, 4052, 4092, 4126, 4156, 4171, 4540], '(T17N)': [1882, 1899, 3970, 4040, 4103], 'Marshall': [1886], '(Chester': [1887], 'Beatty': [1888], 'Labs,': [1889], 'ICR,': [1890], 'HA-tagged': [1894, 2967, 3502, 4027], 'cloned': [1900, 1911, 2024, 2113], 'into': [1901, 1912, 2025, 2118, 2141, 2241, 2503], 'pXJ40': [1902], 'Manser': [1905], '(Glaxo-IMCB,': [1906], 'Singapore,': [1907], 'Singapore).': [1908], 'theEcoRI': [1913], 'site': [1914, 1955, 2028, 2121, 4566], 'pUC19': [1916], 'PCR': [1918, 1959, 2015], 'mutagenesis': [1919, 1960], 'delete': [1923], 'nucleotides': [1924], '118–273': [1925], 'corresponding': [1926], 'amino': [1928, 2151, 2187, 3476, 4651, 4770], 'acids': [1929, 2152, 2188, 4652, 4771], '39–90': [1930], 'coding': [1934], 'sequence.': [1935], 'single': [1939, 4572], 'base': [1940], 'pair': [1941, 2108], 'change': [1942], 'C': [1944, 2155, 2191], 'G': [1946], 'at': [1947, 1956, 2091, 2153, 2189, 2482, 2571, 2611, 2839, 2848, 2854, 2870, 2916, 2925, 3148, 3180, 3185, 3323, 3369, 4721, 4861], 'position': [1948], '113': [1949], 'created': [1950], 'unique': [1952, 2041], 'ApaI': [1953, 2042, 2120], 'restriction': [1954, 2021], 'position.': [1958], 'performed': [1962, 2065, 2361, 2971, 3091, 3275, 4110], 'two-step': [1965], 'reaction': [1966], 'using': [1967, 2004, 2066, 2255, 2274, 2349, 2362, 2567, 2702, 2738, 2979, 3276, 3459, 3611, 3815, 3830, 3909, 4600], 'two': [1968, 4068, 4426, 4485, 4492, 4619, 4664], 'oligonucleotide': [1969], 'pairs,': [1970], 'CGCGGGCCCGGGGGCGCGGCGCCACATC': [1971], 'combination': [1973, 1982, 4097], '−21M13': [1976, 2008], 'forward': [1977], 'primer': [1978], 'CGCGGGCCCGTGGTCCACCTGGCCCTCCGC': [1980], 'M13': [1984, 2010], 'reverse': [1985], 'primer.': [1986], 'resulting': [1988, 2106, 2130], 'products': [1989], '0.2': [1991], '0.6': [1993], 'kilobases,': [1994], 'respectively,': [1995, 3534], 'purified,': [1997], 'cleaved': [1998], 'ApaI,': [2000], 'ligated,': [2001, 2103], 'reamplified': [2003], 'original': [2005], 'terminal': [2006], 'primers': [2007], 'reverse.': [2011], 'predicted': [2013, 4885], '0.8-kilobase': [2014], 'product': [2016], 'digested': [2018, 3365], 'EcoRI': [2020, 2027], 'endonuclease': [2022], 'pUC19.': [2030], 'Sequence': [2031], 'analysis': [2032, 2138, 2737, 3833, 3925, 4388], 'revealed': [2033], 'expected': [2035, 5025], 'creation': [2038], 'site.': [2043], 'Reconstitution': [2044], 'deleted': [2047], 'sequence': [2048, 2137], 'codons': [2051], 'Thr56,': [2053], 'Ser70,': [2054], 'Thr74,': [2055], 'Ser87': [2057], 'mutated': [2059], 'encode': [2061], 'Ala': [2062], 'four': [2067, 2934, 4378, 4525, 4668], 'overlapping': [2068], 'pairs': [2069], 'complementary': [2071], 'oligonucleotides': [2072, 2099], '(CCCGGGGGCCGCCCCCGCACCGGGCATCTTCTCCTCCCAG': [2073], 'GAGGAGAAGATGCCCGGTGCGGGGGCGGCCCCCGGGGGCC;': [2075], 'CCCGGGCACGCGCCCCATCCAGCCGCATC': [2076], 'CGGCTGGATGGGGCGCGTGCCCGGGCTGG;': [2078], 'CCGCGACCCGGTCGCCAGGACCGCGCCGCTGCAGGCCCCGGCTGC': [2079], 'CCGGGGCCTGCAGCGGCGCGGTCCTGGCGACCGGGTCGCGGGATG;': [2081], 'CCCCGGCGCCGACGCGGGGCCTGCGCTCGCCCCGGTGGGGCC': [2083], 'CCACCGGGGCGAGCGCAGGCCCCGCGTCGGCGCCGGGGGCAG)': [2085], 'designed': [2086], 'leaveApaI': [2088], 'compatible': [2089], 'sequences': [2090], 'end': [2093], 'ligated': [2095], 'together.': [2096], 'eight': [2098], 'annealed': [2101], '156-base': [2107], 'fragment': [2109], 'isolated': [2111], 'correct': [2116], 'orientation': [2117], 'described': [2127, 2630, 2747, 2986, 3202, 3290, 3536], 'above.': [2128], 'verifed': [2135], 'subcloned': [2140, 2240], 'mammalian': [2143, 3695], 'vector': [2145, 5057], 'pEE12.': [2146], 'Human': [2147, 2183, 3697], 'lacking': [2149, 2185, 4883], '34': [2150], 'terminus': [2156, 2192], 'expressed': [2158, 2194, 2244, 2260, 3508, 3700, 3955, 4087, 4152], 'Escherichia': [2160], 'coli': [2161], 'soluble': [2166], 'fraction': [2168], 'sequential': [2170], 'chromatography': [2171, 2180, 2214], 'on': [2172, 2206, 2577, 3941], 'Q-Sepharose,': [2173], 'phenyl-Sepharose,': [2174], 'heparin-Sepharose,': [2175], 'fast': [2177, 2211], 'Mono': [2181, 2215], 'Q.': [2182, 2216], 'Bax-α': [2184], '20': [2186, 2852, 3075, 3385], 'its': [2190, 5016], 'His-tagged': [2197, 2202], 'inE.': [2199], 'coli.': [2200, 3501], 'Soluble': [2201], 'Ni-NTA-agarose': [2207], 'columns': [2208], 'followed': [2209, 2468, 2623, 2943, 3142, 3436], 'Bax': [2221, 3494, 3608], 'C-terminal': [2223], 'truncations': [2224], 'necessary': [2226], 'because': [2227, 3946], 'solubility': [2228], 'yields': [2230], 'full-length': [2232, 4857], 'recombinant': [2233], 'unacceptably': [2236], 'low.': [2237], 'Mouse': [2238, 2258], 'pGEX4T3': [2242], 'coli,': [2247], 'glutathione-Sepharose': [2250, 2275, 3287], 'beads': [2251, 2276, 2906, 3288], '(Pharmacia),': [2252], 'eluted': [2254, 3420], 'standard': [2256], 'procedures.': [2257], 'GST': [2263], 'fusion': [2264], 'Chinese': [2267], 'hamster': [2268], 'ovary': [2269], '(pEBG-SEK1)': [2271], 'stimulation': [2278, 2452], 'tumor': [2280], 'necrosis': [2281], 'factor-α': [2282], '(50': [2283, 2512, 2882, 3069], 'ng/ml': [2284], '15': [2286, 3120, 3156], 'min)': [2287, 3526], '(29Sanchez': [2288, 3291], 'R.T.': [2291, 3294], 'Mayer': [2292, 3295], 'B.J.': [2293, 3296], 'Yee': [2294, 3297], 'Avruch': [2298, 3301], '372:': [2306, 3309], '794-798Crossref': [2307, 3310], '(930)': [2310, 3313], 'grown': [2316, 2337, 2442], '7.5%': [2318], 'CO2': [2319], "Eagles's": [2323], 'containing': [2325, 2517, 3074, 3351, 3381], '10%': [2326], '(v/v)': [2327, 2522, 2895, 2903], 'fetal': [2328], 'calf': [2329], 'serum': [2330], 'mm': [2333, 2342, 2513, 2519, 2539, 2545, 2551, 2555, 2909, 3070, 3082, 3377, 3386, 3389], 'glutamine.': [2334], 'Cells': [2335, 2490, 2563], '6-well': [2339], 'plates': [2340], '(35': [2341], 'diameter)': [2343], '80%': [2345], 'confluence': [2346], 'transfected': [2348, 4294], 'LipofectAMINE': [2350, 2434], '(Life': [2351], 'Inc.)': [2353], 'according': [2354], "manufacturer's": [2357], 'instructions.': [2358], 'Transfections': [2359], 'plasmid': [2365, 2417, 2436, 4299], 'concentrations:': [2366], '0.1': [2367], 'μg': [2368, 2377, 2385, 2402, 2588, 3113, 3117, 3121, 3125, 3130, 3393, 4305], 'pEE': [2370, 2373], '(T56A,S70A,T74A,S87A);': [2375], '1.0': [2376, 2384, 2401, 2937], 'ERK1,': [2380, 3503, 4094], 'pMT2T-HA-p54-SAPKβ,': [2381], 'pcDNA3-HA-p38;': [2383], 'pXJ40-HA-Rac1': [2387, 2389], '(G12V),': [2388, 2392, 4290], '(T17N),': [2390], '(T17N);': [2395], '0.05,': [2397], '0.1,': [2398], '0.25,': [2399], 'pMT-SM-Myc-MKP3,': [2404], 'pMT-SM-Myc-MKP3': [2405], '(C293S),': [2406], 'pMT-SM-Myc-MKP4': [2408], 'combinations': [2411, 4025], 'indicated': [2412, 4062], 'text.': [2415], 'Total': [2416], 'concentrations': [2418], 'maintained': [2420], 'constant': [2421], 'supplementing': [2423], 'appropriate': [2425], 'empty': [2426], 'vectors.': [2427], 'Following': [2428, 3183, 3572, 4604], '6': [2429, 3103, 4638, 4752, 4759], 'h': [2430, 2445, 2467, 2838, 2869, 2915], 'incubation': [2432, 2461, 3144, 3282, 3336, 3368, 3575, 3628], 'DNA,': [2437], 'washed': [2440, 2492, 2933], '40': [2444], 'before': [2446], 'lysis': [2447], 'extraction.': [2449], 'acute': [2451], 'activation,': [2456, 4139, 4179], 'starved': [2459], 'serum-free': [2463], 'exposure': [2470, 3515], '(10': [2473, 2476, 3112, 3339, 3518, 3523], 'nm),': [2474], 'anisomycin': [2475, 3522], 'μg/ml),': [2477], 'H2O2': [2479], '(0.5': [2480], 'mm)': [2481], '37': [2483, 3370], '°C': [2484, 2613, 2872, 3371], '10–30': [2486], 'min': [2487, 2853, 2931, 3147, 3179], 'indicated.': [2489], 'twice': [2493], 'ml': [2496, 2938], 'ice-cold': [2498, 2940], 'phosphate-buffered': [2499], 'saline': [2500], 'scraped': [2502], 'Eppendorf': [2504], 'tubes': [2505], '300': [2507, 2891, 2899], 'μl': [2508, 2829, 2875, 2883, 2892, 2900, 2949, 3065, 3095, 3101, 3108, 3138, 3157, 3347, 3374], 'buffer': [2510, 2598, 2831, 2941, 2953, 2973, 3067, 3140, 3163, 3349], 'TPP': [2511, 2832, 2942, 2974], 'Tris-HCl,': [2514, 2910], 'pH': [2515, 2911, 3072, 3379], '7.5,': [2516, 2912], '150': [2518], 'NaCl,': [2520], '1%': [2521], 'Nonidet': [2523], 'P-40,': [2524], '0.5%': [2525], '(w/v)': [2526, 2530], 'sodium': [2527, 2552, 3079], 'deoxycholate,': [2528], '0.1%': [2529, 3426], 'SDS,': [2531], '10': [2532, 2535, 2544, 2557, 2594, 2908, 3085, 3094, 3100, 3107, 3116, 3124, 3129, 3159, 3520, 4754, 4761], 'μg/ml': [2533, 2536], 'aprotinin,': [2534], 'leupeptin,': [2537], 'benzamidine,': [2540], 'mmphenylmethylsulfonyl': [2542], 'fluoride,': [2543], 'NaF,': [2546], 'mmsodium': [2548], 'pyrophosphate,': [2549], 'vanadate,': [2553, 3080], 'EDTA,': [2556], 'nm': [2558], 'calyculin,': [2559], '25': [2561, 2948], 'mmβ-glycerophosphate).': [2562, 3086], 'then': [2565, 2862, 2921, 4698, 5010], 'homogenized': [2566], 'sonicator': [2569], 'probe': [2570], 'full': [2572], 'power': [2573], 's': [2576], 'ice.': [2578], 'immunodetection': [2580], 'aliquots': [2583, 2817], 'lysates': [2586, 2824], '(20': [2587], 'protein)': [2590], 'diluted': [2592], '×': [2595, 2927, 3160, 3187, 3325, 3415], 'Laemmli': [2596, 2951, 3161], 'sample': [2597, 2952, 3162], '(30Laemmli': [2599, 2954, 3164], 'U.K.': [2600, 2955, 3165], '1970;': [2602, 2957, 3167], '227:': [2603, 2958, 3168], '680-685Crossref': [2604, 2959, 3169], '(215638)': [2607, 2962, 3172], 'Scholar),': [2609, 3800, 4359], 'heated': [2610], '95': [2612, 3181], '3': [2615, 2930], 'min,': [2616, 3191, 3435], 'separated': [2618, 3402], 'SDS-polyacrylamide': [2620, 3196], 'electrophoresis': [2622, 3198], 'electrotransfer': [2625], 'nitrocellulose': [2627], '(31Muda': [2631, 2748, 2987, 3204, 4195], 'Boschert': [2633, 2665, 2750, 2781, 2989, 3021, 3206, 3238, 3544, 4197, 4229, 4326, 4949], 'Dickinson': [2635, 2752, 2991, 3208, 4199], 'Camps': [2641, 2675, 2758, 2791, 2997, 3031, 3214, 3248, 3546, 4205, 4239, 4336, 4959], 'Schlegel': [2643, 2760, 2999, 3216, 4207], 'W.': [2644, 2761, 3000, 3217, 4208], 'Arkinstall': [2645, 2681, 2762, 2797, 3001, 3037, 3218, 3254, 3554, 4209, 4245, 4342, 4965], '4319-4326Abstract': [2652, 2769, 3008, 3225, 4216], '(323)': [2660, 2777, 3016, 3233, 4224], '32Muda': [2663, 3019, 3236, 4227, 4324], 'Smith': [2667, 2783, 3023, 3240, 4231, 4328, 4951], 'Antonsson': [2669, 2785, 3025, 3242, 4233, 4330, 4953], 'Gillieron': [2671, 2787, 3027, 3244, 3548, 4235, 4332, 4955], 'Chabert': [2673, 2789, 3029, 3246, 4237, 4334, 4957], 'Ashworth': [2679, 2795, 3035, 3252, 3552, 4243, 4340, 4963], '272:': [2687, 2803, 3043, 3260, 4251, 4348, 4971], '5141-5151Abstract': [2688, 2804, 3044, 3261, 4252, 4349, 4972], '(134)': [2696, 2812, 3052, 3269, 4260, 4357, 4980], 'detected': [2701, 3829, 4385, 4624, 4718, 4734], 'conjugate': [2719], 'chemiluminescence.': [2721], 'Levels': [2722], 'epitope-tagged': [2724], 'Ras': [2728, 4034, 4039, 4051, 4091, 4102], 'small': [2730], 'GTPases': [2731], 'monitored': [2734], 'Western': [2736, 3831, 4387], 'monoclonal': [2739, 2982], 'HA.11': [2741, 2983], '(HA)': [2742], '9E10': [2744], '(Myc)': [2745], 'Scholar,32Muda': [2779], 'immunoprecipitation,': [2816, 2859], '(200': [2818], 'μl)': [2819], 'mixed': [2826, 2835, 2863], '800': [2828], 'rotary': [2834, 2865], '°C,': [2841], 'after': [2842], 'time': [2844], 'they': [2845], 'centrifuged': [2847], '100,000': [2849], '×g': [2850], '°C.': [2856, 3150, 3182], 'supernatant': [2860], 'mixing': [2866, 3093], '50': [2874, 3064], 'preformed': [2878], 'immunoprecipitating': [2880], 'monclonal': [2886], 'preincubated': [2889], '50%': [2894, 2902], 'G-Sepharose': [2905], '°C).': [2918], 'Beads': [2919], 'sedimented': [2922], 'centrifugation': [2924, 3184, 3322], '10,000': [2926, 3186, 3324], 'g': [2928, 3188], 'times': [2935], 'final': [2945, 3060], 'resuspension': [2946, 3061], 'Immunoprecipitation': [2965], 'without': [2975], 'deoxycholate': [2976], 'SDS': [2978], 'HA-epitope': [2980], 'exactly': [2984], 'assays,': [3059], 'K': [3068, 3141, 3350], 'HEPES,': [3071], '7.4,': [3073], 'mmMgCl2,': [3076], '200': [3077], 'μm': [3078, 3353], 'dithiothreitol,': [3083, 3390], 'Immune': [3087], 'assays': [3089], 'bead': [3097], 'suspension': [3098], 'μm[γ-32P]ATP': [3104], '(∼300,000': [3105], 'dpm/pmol),': [3106], 'GST-ATF-2,': [3127], 'GST-MAPKAP': [3132], 'Δ3)': [3135], '30': [3137, 3146, 3149, 3525, 3532], 'Reactions': [3151], 'terminated': [3153], 'adding': [3155], 'Scholar)': [3174], 'heating': [3176], '5': [3178, 3190, 3327, 3392, 3440], 'supernatants': [3192], 'analyzed': [3194], 'autoradiography': [3200], 'previously': [3203, 3537, 3741], 'free': [3278], 'pre-activated': [3280], 'GST-SEK1': [3284], 'bound': [3285], 'Immobilized': [3316], 'subsequently': [3319], 'removed': [3320], 'gfor': [3326], 'min.': [3328, 3441, 4730], '(100': [3331], 'μg)': [3332, 3340], 'total': [3343], 'volume': [3344], '240': [3346], '100': [3352, 3376], '(3000': [3355], 'dpm/pmol).': [3356], 'Phosphorylated': [3357, 4695], 'lyophilized,': [3363], 'overnight': [3367], '90': [3373], 'Tris-HCl': [3378], '8.5': [3380], 'm': [3383], 'urea,': [3384], 'methylamine,': [3387], 'trypsin': [3395, 4605, 4703], '(Boehringer': [3396], 'Mannheim,': [3397], 'sequencing': [3398], 'grade).': [3399], 'Peptides': [3400, 3418], 'reverse-phase': [3404, 4706], 'HPLC': [3405, 4610, 4707], '(Hewlett': [3406], 'Packard': [3407], 'HP1090)': [3408], 'Brownlee': [3411], 'C18': [3412], 'column': [3413, 4736], '(220': [3414], '2.1': [3416], 'mm).': [3417], 'acetonitrile': [3423], 'gradient': [3424], '(in': [3425], 'trifluroacetic': [3427], 'acid)': [3428], '0': [3430], '55%': [3432], 'over': [3433, 3439, 4144], '60': [3434, 4729], '55–70%': [3438], 'Elution': [3442], 'fractions': [3443, 4737], 'collected,': [3445], 'radioactive': [3447], '33P-labeled': [3448], 'scintillation': [3452], 'spectrometry': [3453], 'sequenced': [3455, 4643, 4763], 'Edman': [3457, 4645, 4765], 'degradation': [3458, 4646, 4766], 'Applied': [3461], 'Biosystems': [3462], 'model': [3463, 3472, 4993], '494': [3464], 'pulsed': [3465], 'phase': [3467], 'sequencer': [3469], '148C': [3473], 'on-line': [3474], 'phenylthiohydantoin': [3475], 'analyzer.': [3478], 'To': [3479, 3716, 4159, 4579], 'test': [3480, 3717, 4010, 4580], 'vitro': [3483, 3999, 4685], 'employed': [3491], 'p38': [3506, 3641, 4118, 4136], 'nm,': [3519], 'min),': [3521, 3533], 'μg/ml,': [3524], 'hydrogen': [3528], 'peroxide': [3529], '(500': [3530], 'μm,': [3531], '(33Muda': [3538], 'Theodosiou': [3540], 'Rodrigues': [3542], '27205-27208Abstract': [3561], '(311)': [3569], 'immunoprecipitation': [3573], 'substrates': [3579], 'kinase-activated': [3584], 'kinase-2': [3586], '(MK2),': [3587], 'all': [3588, 4667], 'confirmed': [3593, 3804], '(Fig.1': [3601], 'A).': [3602, 3715, 3844], 'Despite': [3603], 'no': [3605, 3947, 4140], 'detectable': [3610, 4060], 'any': [3612], '(not': [3615, 3667, 3935, 4133, 4157, 4389, 4409], 'shown).': [3616, 3936, 4158, 4390, 4410], 'contrast,': [3618], 'up': [3624], '6-fold': [3626], '(Fig.': [3632, 3652, 3713, 3808, 3842, 3971, 4041, 4053, 4104, 4630, 4659], 'B).': [3634, 3654, 3810, 4632], 'limited': [3645], 'approximately': [3647], '2-fold': [3648], '4-fold': [3659], 'immunoprecipitates': [3661], 'p46': [3664], 'JNK1': [3665], '(SAPKγ)': [3666], 'shown),': [3668, 4134], 'selective': [3670], 'next': [3680, 4591], 'tested': [3681], 'within': [3689, 4019, 4480, 4562, 5015], 'intact': [3694, 4676, 4800], 'cell.': [3696], 'immunodetectable': [3708, 3839, 4070, 4317], '26-kDa': [3711], 'phosphorylation,': [3719], 'G-protein': [3731], '(G12V).': [3733], 'GTPase': [3735], 'defective': [3736], 'shown': [3740, 4727, 4744], 'result': [3743], 'moderate': [3745], '(34Coso': [3751], 'O.A.': [3752], 'Chiariello': [3753], 'Yu': [3755], 'Teramoto': [3757], 'Crespo': [3759], 'Xu': [3761], 'Miki': [3763], 'J.S.': [3766], '81:': [3769, 3791], '1137-1146Abstract': [3770], '(1576)': [3776], '35Minden': [3779], 'Claret': [3783], 'F.-X.': [3784], 'Abo': [3785], 'Karin': [3787], '1147-1157Abstract': [3792], '(1451)': [3798], 'here': [3805], 'vitroobservations': [3814], 'protein,': [3817], 'becomes': [3819], 'highly': [3820], 'conditions.': [3824], 'readily': [3828], 'blot': [3832], 'band': [3836, 3859, 3948, 4394, 4576], 'shift': [3837, 3860], 'Decreased': [3845], 'mobility': [3847, 4076, 4398, 4575], 'previous': [3854], 'upon': [3861, 3923, 3979, 4534], 'unidentified': [3865], 'Up': [3901], 'clearly': [3907], 'visible': [3908, 3951, 4871], 'technique.': [3911], 'same': [3913], 'seen,': [3918], 'poorer': [3921], 'resolution,': [3922], 'autoradiographic': [3924], 'immunoprecipitated': [3928], 'prelabeled': [3932], '[32P]H3PO4': [3934], 'dependent': [3940], 'enzymatic': [3942, 4371], 'shifts': [3949], 'alone': [3957, 3984, 4088, 4121, 4153], '2,': [3972], 'A': [3973, 4879], 'andB).': [3974], 'Limited': [3975], 'observed': [3978, 4533], 'co-expression': [3980], 'Rac': [3982], 'G12V': [3983], 'reflects': [3986], 'endogenous': [3989], 'JNK/SAPK.': [3990], 'Because': [3991], 'most': [3996], 'effectively': [3997], '(see': [4004, 4322], 'above),': [4005], 'set': [4007], 'out': [4008], 'demonstrated': [4018], 'constitutively': [4032], 'C).': [4043, 4078, 4106, 4661], 'Under': [4044], 'leading': [4046], 'D),': [4055], 'barely': [4059], 'displaying': [4073], 'slowed': [4074], '(Fig.2': [4077], 'effect': [4080], 'inactive': [4101], 'experiments': [4112, 4132], '(T17N).': [4129], 'despite': [4135], 'above': [4146], 'noted': [4148], 'confirm': [4160], 'presence': [4166, 4597, 4692], 'reflection': [4174], 'assessed': [4181], 'coexpressing': [4187], 'phosphatases': [4191], 'MKP3/PYST1': [4192, 4301], 'MKP4': [4194, 4303, 4320], '36Groom': [4263], 'Sneddon': [4265], 'A.A.': [4266], 'Alessi': [4267], 'D.R.': [4268], 'Dowd': [4269], 'Keyse': [4271], 'S.M.': [4272], '3621-3632Crossref': [4277], '(373)': [4280], 'addition': [4284], 'increasing': [4296], 'quantities': [4297], 'encoding': [4300], '(0.05–1.0': [4304], 'plasmid/well).': [4307], 'resulted': [4309], 'dose-dependent': [4312], 'increase': [4313], 'levels': [4315], 'MKP3/PYST': [4318], 'Ref.': [4323], 'graded': [4367], 'complete': [4375], 'disappearance': [4376], 'additional': [4382, 4529], 'fifth': [4392], 'showing': [4395], 'weakened': [4401], 'considerably': [4402], 'highest': [4405], 'level': [4406], 'MKP3': [4408], 'three-dimensional': [4412], 'structure': [4413], 'Bcl-XL': [4418], 'reveals': [4419], 'unstructured': [4421, 4477], '60-residue': [4422], 'flexible': [4423, 4886, 5017], 'loop': [4424, 4887, 5018], 'connecting': [4425], 'α-helices': [4427], 'localized': [4428], 'immediately': [4429], 'conserved': [4433], 'BH3': [4434], 'homology': [4435], 'domain': [4436], '(37Muchmore': [4437], 'S.W.': [4438, 4460, 4839, 4841], 'Sattler': [4439], 'Liang': [4441], 'Meadows': [4443], 'R.P.': [4444], 'Harlan': [4445], 'J.E.': [4446], 'Yoon': [4447], 'H.S.': [4448], 'Nettesheim': [4449], 'B.S.': [4452, 4835], 'Wong': [4455], 'S.-L.': [4456], 'Ng': [4457], 'S.-C.': [4458], 'Fesik': [4459, 4840], '381:': [4463], '335-341Crossref': [4464], '(1298)': [4467], 'Structural': [4470], 'modeling': [4471], 'predicts': [4474], 'loop,': [4478], 'region': [4482, 4888], 'serines': [4486], '(residues': [4487, 4494], '70': [4488], '87)': [4490], 'threonines': [4493], '56': [4495, 4779], '74),': [4497], 'preceding': [4499], 'prolines': [4500], 'reasoned': [4503], 'represent': [4504, 4552], 'sites': [4506, 4555, 4588, 4796], 'p54-SAPKβ.': [4510], 'T56A,S70A,T74A,S87A': [4520], 'abolished': [4524], 'normally': [4532], 'coexpression': [4535], '(Fig.3).': [4541], 'experiment': [4543], 'more': [4548], 'remaining': [4573], 'low': [4574], 'unknown.': [4578], 'modify': [4586], 'directly,': [4589], 'vitroin': [4595], '[33P]ATP': [4599], 'active': [4602], 'GST-p54-SAPKβ.': [4603], 'digestion': [4606], 'separation': [4611, 4708, 4743], 'resolved': [4612], '13': [4613], 'peptides': [4614, 4637, 4665, 4710, 4751, 4758], '(Fig.4': [4615], 'A),': [4616], 'peaks': [4620, 4634, 4748], '33P-radioactivity': [4622], 'entire': [4627], 'elution': [4628], 'profile': [4629], 'correspond': [4635, 4749, 4768], '10,': [4640], '27–68': [4653, 4772], '69–98': [4655, 4774], 'respectively': [4658], 'cells.Figure': [4677], '4Bcl-2': [4678], 'phosphopeptide': [4679], 'analysis.': [4680], 'preactivated': [4688], '[γ-33P]ATP.': [4694], 'subjected': [4701], 'digestion.': [4704], 'A,': [4705], 'digest.': [4715], 'Peaks': [4716], 'absorption': [4720], '214': [4722], 'nm.': [4723], 'Duration': [4724], 'chromatogram': [4726], 'represents': [4728], 'B,33P': [4731], 'radioactivity': [4732], '(cpm)': [4733], 'collected': [4738], 'every': [4739], 'minute': [4740], 'throughout': [4741], 'Radioactive': [4747], 'chromatogramA.': [4756], 'C,': [4757], 'respectively.': [4777], 'Threonine': [4778], '(peptide': [4780, 4792], '6)': [4781], 'serine': [4785, 4790], '70,': [4786], 'threonine': [4787], '74,': [4788], '87': [4791], '10)': [4793], 'underlined.View': [4803], 'Large': [4804], 'Image': [4805], 'Figure': [4806], 'ViewerDownload': [4807], 'Hi-res': [4808], 'image': [4809], 'Download': [4810], '(PPT)': [4811], 'While': [4812], 'progress': [4817], 'appeared': [4820], 'describing': [4821], 'immature': [4826], 'B': [4827, 4929], 'line': [4829, 4931], 'WEHI-231': [4830], 'exposed': [4831], 'anti-IgM': [4833], '(38Chang': [4834], 'Minn': [4836], 'Muchmore': [4838], '16:': [4847], '968-977Crossref': [4848], '(264)': [4851], 'ineffective': [4860], 'suppressing': [4862], 'strikingly': [4866], 'extensive': [4869], 'multiple': [4873], 'retarded': [4876], 'remarkably': [4893], 'block': [4897], 'Although': [4902], 'responsible': [4905], 'phosphorylating': [4907], '(46),': [4915], 'results': [4917], 'suggest': [4918], 'may': [4923], 'responsible.': [4925], 'Indeed,': [4926], 'another': [4928], '(B104)': [4932], 'cross-linking': [4933, 5000], 'mIgM': [4934, 4999], 'triggers': [4935], '(32Muda': [4947], 'Together': [4983], 'data,': [4986], 'whereby': [4994], 'activate': [5001], 'family,': [5008], 'disable': [5011], 'through': [5013], 'region.': [5019], 'Such': [5020], 'inactivation': [5022], 'would': [5023], 'reinforce': [5027], 'membrane': [5033], 'depolarization,': [5034], 'generation': [5035], 'reactive': [5037], 'oxygen': [5038], 'intermediates,': [5039], 'cysteine': [5043], 'proteases': [5044], 'caspase': [5047], 'family.': [5048], 'thank': [5050], 'Allet': [5053], 'pEE12': [5058], 'Chris': [5060], 'Herbert': [5061], 'photographic': [5063], 'work.': [5064], 'grateful': [5068], 'DeLamarter': [5072], 'continued': [5074], 'encouragement.': [5077]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2158951763', 'counts_by_year': [{'year': 2024, 'cited_by_count': 3}, {'year': 2023, 'cited_by_count': 5}, {'year': 2022, 'cited_by_count': 7}, {'year': 2021, 'cited_by_count': 3}, {'year': 2020, 'cited_by_count': 7}, {'year': 2019, 'cited_by_count': 6}, {'year': 2018, 'cited_by_count': 5}, {'year': 2017, 'cited_by_count': 8}, {'year': 2016, 'cited_by_count': 5}, {'year': 2015, 'cited_by_count': 10}, {'year': 2014, 'cited_by_count': 11}, {'year': 2013, 'cited_by_count': 15}, {'year': 2012, 'cited_by_count': 12}], 'updated_date': '2024-12-24T13:28:51.098631', 'created_date': '2016-06-24'}