Title: Probing the Role of PrP Repeats in Conformational Conversion and Amyloid Assembly of Chimeric Yeast Prions
Abstract: Oligopeptide repeats appear in many proteins that undergo conformational conversions to form amyloid, including the mammalian prion protein PrP and the yeast prion protein Sup35. Whereas the repeats in PrP have been studied more exhaustively, interpretation of these studies is confounded by the fact that many details of the PrP prion conformational conversion are not well understood. On the other hand, there is now a relatively good understanding of the factors that guide the conformational conversion of the Sup35 prion protein. To provide a general model for studying the role of oligopeptide repeats in prion conformational conversion and amyloid formation, we have substituted various numbers of the PrP octarepeats for the endogenous Sup35 repeats. The resulting chimeric proteins can adopt the [PSI+] prion state in yeast, and the stability of the prion state depends on the number of repeats. In vitro, these chimeric proteins form amyloid fibers, with more repeats leading to shorter lag phases and faster assembly rates. Both pH and the presence of metal ions modulate assembly kinetics of the chimeric proteins, and the extent of modulation is highly sensitive to the number of PrP repeats. This work offers new insight into the properties of the PrP octarepeats in amyloid assembly and prion formation. It also reveals new features of the yeast prion protein, and provides a level of control over yeast prion assembly that will be useful for future structural studies and for creating amyloid-based biomaterials. Oligopeptide repeats appear in many proteins that undergo conformational conversions to form amyloid, including the mammalian prion protein PrP and the yeast prion protein Sup35. Whereas the repeats in PrP have been studied more exhaustively, interpretation of these studies is confounded by the fact that many details of the PrP prion conformational conversion are not well understood. On the other hand, there is now a relatively good understanding of the factors that guide the conformational conversion of the Sup35 prion protein. To provide a general model for studying the role of oligopeptide repeats in prion conformational conversion and amyloid formation, we have substituted various numbers of the PrP octarepeats for the endogenous Sup35 repeats. The resulting chimeric proteins can adopt the [PSI+] prion state in yeast, and the stability of the prion state depends on the number of repeats. In vitro, these chimeric proteins form amyloid fibers, with more repeats leading to shorter lag phases and faster assembly rates. Both pH and the presence of metal ions modulate assembly kinetics of the chimeric proteins, and the extent of modulation is highly sensitive to the number of PrP repeats. This work offers new insight into the properties of the PrP octarepeats in amyloid assembly and prion formation. It also reveals new features of the yeast prion protein, and provides a level of control over yeast prion assembly that will be useful for future structural studies and for creating amyloid-based biomaterials. Prions were originally recognized as the causative agent of several mammalian neurodegenerative disorders, including scrapie in sheep, bovine spongiform encephalopathy (mad cow disease) in cattle, and Creutzfeldt-Jakob disease (CJD) in humans (1Prusiner S.B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13363-13383Crossref PubMed Scopus (5168) Google Scholar). According to the prion hypothesis, these maladies are due to a conformational conversion of the normal cellular prion protein (PrPC) 4The abbreviations used are: PrPC, cellular prion protein; PrPSc, pathological isoform of cellular prion protein; EPR, electron paramagnetic resonance; YPD, yeast peptone dextrose medium; AFM, atomic force microscopy; ThT, Thioflavin T; GST, glutathione S-transferase; MOPS, 4-morpholinepropanesulfonic acid; AFM, atomic force microscopy; ThT, thioflavin-T; SOD, superoxide dismutase. into an abnormal pathological isoform (PrPSc), a portion of which becomes highly resistant to proteinase-K digestion. Once prion formation is initiated (i.e. spontaneous conversion of cellular PrPC to PrPSc to generate infectivity), the PrPSc conformers can self-replicate by templating the conformational conversion of other PrPC molecules (1Prusiner S.B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13363-13383Crossref PubMed Scopus (5168) Google Scholar). Several prion-like proteins identified in yeast can also perpetuate their conformational states through a protein-based templating mechanism. Instead of causing fatal diseases, however, the yeast prions are sometimes beneficial, and can act as protein-only elements of inheritance (2Shorter J. Lindquist S. Nat. Rev. Genet. 2005; 6: 435-450Crossref PubMed Scopus (423) Google Scholar). For instance, the yeast prion phenotype [PSI+] is the result of the self-replicating conformational conversion of the protein Sup35, a translation termination factor. In its prion conformation, Sup35 is sequestered from its normal function, resulting in increased read-through of nonsense codons. This read-through can ultimately confer a wide spectrum of heritable new phenotypes (3Patino M.M. Liu J.J. Glover J.R. Lindquist S. Science. 1996; 273: 622-626Crossref PubMed Scopus (572) Google Scholar, 4Paushkin S.V. Kushnirov V.V. Smirnov V.N. TerAvanesyan M.D. Embo J. 1996; 15: 3127-3134Crossref PubMed Scopus (470) Google Scholar, 5Wickner R.B. Science. 1994; 264: 566-569Crossref PubMed Scopus (1089) Google Scholar). In vitro the Sup35 prions can form amyloid fibers in a template-based reaction that is thought to parallel in vivo prion conformational conversion and is reminiscent of the fiber formation of a wide range of amyloidogenic proteins (2Shorter J. Lindquist S. Nat. Rev. Genet. 2005; 6: 435-450Crossref PubMed Scopus (423) Google Scholar). The mammalian PrP and yeast Sup35 share several similar structural characteristics, including a well-folded C-terminal core and a natively unfolded N terminus. The N termini of both proteins contain oligopeptide repeats that influence their conformational conversion to the prion state (6Goldmann W. Chong A. Foster J. Hope J. Hunter N. J. Gen. Virol. 1998; 79: 3173-3176Crossref PubMed Scopus (70) Google Scholar, 7Liu J.J. Lindquist S. Nature. 1999; 400: 573-576Crossref PubMed Scopus (158) Google Scholar, 8Chiesa R. Piccardo P. Ghetti B. Harris D.A. Neuron. 1998; 21: 1339-1351Abstract Full Text Full Text PDF PubMed Scopus (281) Google Scholar, 9Flechsig E. Shmerling D. Hegyi I. Raeber A.J. Fischer M. Cozzio A. von Mering C. Aguzzi A. Weissmann C. Neuron. 2000; 27: 399-408Abstract Full Text Full Text PDF PubMed Scopus (237) Google Scholar, 10Bocharova O.V. Breydo L. Salnikov V.V. Baskakov I.V. Biochemistry-US. 2005; 44: 6776-6787Crossref PubMed Scopus (158) Google Scholar). The N terminus of wild-type human PrPC contains four perfect copies of a highly conserved octarepeat sequence (11van Rheede T. Smolenaars M.M.W. Madsen O. de Jong W.W. Mol. Biol. Evol. 2003; 20: 111-121Crossref PubMed Scopus (119) Google Scholar), PHGGGWGQ, and one imperfect copy, PQGGGTWGQ. Expansion of the octarepeat region, ranging from one to nine extra copies, has been found in several types of familial CJD and is associated with an earlier onset of pathology (12Goldfarb L.G. Brown P. Mccombie W.R. Goldgaber D. Swergold G.D. Wills P.R. Cervenakova L. Baron H. Gibbs C.J. Gajdusek D.C. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 10926-10930Crossref PubMed Scopus (290) Google Scholar, 13Vital C. Gray F. Vital A. Parchi P. Capellari S. Petersen R.B. Ferrer X. Jarnier D. Julien J. Gambetti P. Neuropath. Appl. Neuro. 1998; 24: 125-130Crossref PubMed Scopus (50) Google Scholar). When transgenic mice that express repeat-free PrP are infected by scrapie extracts or by PrP aggregates, they show a slower progression of disease (9Flechsig E. Shmerling D. Hegyi I. Raeber A.J. Fischer M. Cozzio A. von Mering C. Aguzzi A. Weissmann C. Neuron. 2000; 27: 399-408Abstract Full Text Full Text PDF PubMed Scopus (237) Google Scholar, 14Supattapone S. Bosque P. Muramoto T. Wille H. Aagaard C. Peretz D. Nguyen H.O. Heinrich C. Torchia M. Safar J. Cohen F.E. DeArmond S.J. Prusiner S.B. Scott M. Cell. 1999; 96: 869-878Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar) and exhibit different histopathological characteristics than mice with the wild-type protein (15Legname G. Baskakov I.V. Nguyen H.O. Riesner D. Cohen F.E. DeArmond S.J. Prusiner S.B. Science. 2004; 305: 673-676Crossref PubMed Scopus (908) Google Scholar). In vitro, expansion of the octarepeat region increases the spontaneous conversion rate of PrPC to a protease-resistant conformation (16Moore R.A. Herzog C. Errett J. Kocisko D.A. Arnold K.M. Hayes S.F. Priola S.A. Protein Sci. 2006; 15: 609-619Crossref PubMed Scopus (54) Google Scholar). Likewise, when the octarepeat region is fused to a GST (glutathione S-transferase) protein, it accelerates protein self-association and allows selective binding of PrPSc from brain extracts (17Leliveld S.R. Dame R.T. Wuite G.J. Stitz L. Korth C. J. Biol. Chem. 2006; 281: 3268-3275Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar). Sup35 has five imperfect copies of PQGGYQQYN. Reducing the number of repeats lowers the frequency of spontaneous prion induction (7Liu J.J. Lindquist S. Nature. 1999; 400: 573-576Crossref PubMed Scopus (158) Google Scholar, 18Shkundina I.S. Kushnirov V.V. Tuite M.F. Ter-Avanesyan M.D. Genetics. 2006; 172: 827-835Crossref PubMed Scopus (58) Google Scholar). Furthermore, the prion state associated with this variant is unstable and frequently spontaneously converts back to the non-prion state, [psi−] (7Liu J.J. Lindquist S. Nature. 1999; 400: 573-576Crossref PubMed Scopus (158) Google Scholar). Sup35 with an expanded number of repeats, however, induces a new and stable prion state much more frequently than wild-type Sup35 (7Liu J.J. Lindquist S. Nature. 1999; 400: 573-576Crossref PubMed Scopus (158) Google Scholar). Oligopeptide repeats of various lengths and compositions appear in several other amyloid-forming proteins in addition to prion proteins. The huntingtin protein associated with Huntington's disease contains a perfect polyglutamine repeat, and expansion of this repeat region results in early onset of the disease and an increase in the rate of in vitro amyloid formation (19Krobitsch S. Lindquist S. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1589-1594Crossref PubMed Scopus (458) Google Scholar, 20Scherzinger E. Lurz R. Turmaine M. Mangiarini L. Hollenbach B. Hasenbank R. Bates G.P. Davies S.W. Lehrach H. Wanker E.E. Cell. 1997; 90: 549-558Abstract Full Text Full Text PDF PubMed Scopus (1090) Google Scholar). α-Synuclein, a protein that plays a role in Parkinson disease and assembles into amyloid fibers in vitro, contains seven copies of a less defined repeat, XKTKEGVXXXX (21Kessler J.C. Rochet J.C. Lansbury P.T. Biochemistry-US. 2003; 42: 672-678Crossref PubMed Scopus (98) Google Scholar). The major and minor components of the Escherichia coli curli protein each consist of five 16-18 mer repeats, which are required for the formation of curli amyloid fibers and are involved in cell aggregation, biofilm formation, and surface adhesion (22Barnhart M.M. Chapman M.R. Annu. Rev. Microbiol. 2006; 60: 131-147Crossref PubMed Scopus (810) Google Scholar, 23Chapman M.R. Robinson L.S. Pinkner J.S. Roth R. Heuser J. Hammar M. Normark S. Hultgren S.J. Science. 2002; 295: 851-855Crossref PubMed Scopus (979) Google Scholar). Although oligopeptide repeats are clearly a crucial feature of these amyloid-forming proteins, the exact structural and functional role of these repeats remains unclear. Compared with these other oligopeptide repeats, the biophysical properties of the PrP octarepeats are well characterized. The octarepeat of PrP can selectively bind Cu(II) ions (24Millhauser G.L. Accounts Chem. Res. 2004; 37: 79-85Crossref PubMed Scopus (359) Google Scholar), and the histidine residues in the octarepeats act as the primary anchor point for Cu(II) binding (24Millhauser G.L. Accounts Chem. Res. 2004; 37: 79-85Crossref PubMed Scopus (359) Google Scholar). Structurally, Cu(II) binding can induce a conformational conversion of PrPC into protease-resistant species (10Bocharova O.V. Breydo L. Salnikov V.V. Baskakov I.V. Biochemistry-US. 2005; 44: 6776-6787Crossref PubMed Scopus (158) Google Scholar), and the efficiency of this conversion depends on the number of octarepeats (17Leliveld S.R. Dame R.T. Wuite G.J. Stitz L. Korth C. J. Biol. Chem. 2006; 281: 3268-3275Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar). Cu(II) ions combined with nicotinamide adenine dinucleotide phosphate (NADPH) can even induce spontaneous conformational change and aggregation of HuPrP-(23-98), a variant that only contains the octarepeat region of human PrP (25Shiraishi N. Utsunomiya H. Nishikimi M. J. Biol. Chem. 2006; 281: 34880-34887Abstract Full Text Full Text PDF PubMed Scopus (13) Google Scholar). Functionally, Cu(II) binding to the octarepeats induces PrPC endocytosis in neuronal cells, indicating a role for PrPC in Cu(II) sensing, uptake and/or transport (26Perera W.S. Hooper N.M. Curr. Biol. 2001; 11: 519-523Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar). Superoxide dismutase (SOD)-like activities have also been reported for the Cu(II)-bound PrPC, suggesting a neuronal function of PrPC as an anti-oxidant (27Jones S. Batchelor M. Bhelt D. Clarke A.R. Collinge J. Jackson G.S. Biochem. J. 2005; 392: 309-312Crossref PubMed Scopus (72) Google Scholar, 28Shiraishi N. Ohta Y. Nishikimi M. Biochem. Biophys. Res. Commun. 2000; 267: 398-402Crossref PubMed Scopus (42) Google Scholar, 29Treiber C. Pipkorn R. Weise C. Holland G. Multhaup G. Febs. J. 2007; 274: 1304-1311Crossref PubMed Scopus (19) Google Scholar), although that is still a subject of debate (30Hutter G. Heppner F.L. Aguzzi A. Biol. Chem. 2003; 384: 1279-1285Crossref PubMed Scopus (98) Google Scholar). Treatment of scrapie-infected mice with Cu(II) chelator d-(-)-penicillamine (d-PEN) delays the onset of prion disease in mice (31Sigurdsson E.M. Brown D.R. Alim M.A. Scholtzova H. Carp R. Meeker H.C. Prelli F. Frangione B. Wisniewski T. J. Biol. Chem. 2003; 278: 46199-46202Abstract Full Text Full Text PDF PubMed Scopus (175) Google Scholar). While the biophysical properties of the PrP repeats have been studied extensively, the role of the repeats in prion conformational conversion is not well understood, particularly because of the lack of knowledge on many details of PrP prion formation. One the other hand, the factors that guide prion conformational conversion have been best defined for Sup35. These factors include molecular chaperones that influence conformational conversion (32Shorter J. Lindquist S. Science. 2004; 304: 1793-1797Crossref PubMed Scopus (393) Google Scholar, 33Chernoff Y.O. Lindquist S.L. Ono B. Inge-Vechtomov S.G. Liebman S.W. Science. 1995; 268: 880-884Crossref PubMed Scopus (931) Google Scholar, 34Parsell D.A. Kowal A.S. Singer M.A. Lindquist S. Nature. 1994; 372: 475-478Crossref PubMed Scopus (742) Google Scholar, 35Schirmer E.C. Lindquist S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 13932-13937Crossref PubMed Scopus (86) Google Scholar), as well as specific sequence elements that control the maintenance and nucleation of the prion conformation and govern the formation of distinct prions strains and the existence of prion species barriers (36Krishnan R. Lindquist S.L. Nature. 2005; 435: 765-772Crossref PubMed Scopus (417) Google Scholar, 37Chien P. DePace A.H. Collins S.R. Weissman J.S. Nature. 2003; 424: 948-951Crossref PubMed Scopus (87) Google Scholar, 38Tanaka M. Collins S.R. Toyama B.H. Weissman J.S. Nature. 2006; 442: 585-589Crossref PubMed Scopus (502) Google Scholar, 39King C.Y. Diaz-Avalos R. Nature. 2004; 428: 319-323Crossref PubMed Scopus (420) Google Scholar, 40Tessier P.M. Lindquist S. Nature. 2007; 447: 556-561Crossref PubMed Scopus (122) Google Scholar). To provide a new model for studying prion conformational conversion and to better understand the role of the oligopeptide repeats in amyloid formation, we explored the role of the PrP octarepeats in the context of the yeast prion protein Sup35. We created chimeric proteins in which different numbers of hamster PrP repeats were substituted for the endogenous Sup35 repeats. Facilitated by the powerful genetic and biophysical techniques developed for yeast prions, we were able to characterize how the PrP octarepeats influence the conformational conversion and amyloid formation of these chimeric prion proteins both in vivo and in vitro. We find that increasing the number of PrP repeats in the chimeric proteins increases the spontaneous appearance of the [PSI+] phenotype in vivo and accelerates amyloid formation in vitro. Conformational conversion and amyloid formation by the chimeras are modulated by both pH and the presence of metal ions. Further, the manner in which these factors modulate conversion is highly sensitive to the number of PrP repeats. Our work offers new insight into the role of the PrP octarepeats in amyloid formation and prion formation, with implications for prion structure. It also allows us to control protein assembly by simply altering environmental conditions. This control will be useful for further functional and structural work and could provide a practical means of controlling assembly for biomaterial and biotechnology applications. Plasmid Construction and Gene Integration—A Sup35 integrative vector was constructed using pRS306 (41Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar). A fragment spanning from 1360 nucleotides upstream of Sup35 through a5′-region of Sup35 with a BspE1 site after the first Sup35 repeat was amplified (PCR primers 5′-CGACGGTATCGATAAGCTTG-3′ and 5′-GATAGCCTCTAGATTGGTATCCGGAATAACCTTG-3′) and ligated into pRS306 between ClaI and XbaI sites. A second fragment spanning from Sup35 downstream from the repeats with an EagI site just after the repeats to 800 nucleotides downstream from Sup35 was amplified (PCR primers 5′-CAGCAATCTAGACCACAAGGCGGCCGTGGAAATTAC-3′ and 5′-CGAATTGGAGCTCTTACTCG-3′) and ligated into the plasmid between XbaI and SacI sites. This plasmid was sequenced through the entire Sup35 region, and was named pRS306Sup35R1. The first two PrP repeats were added to pRS306Sup35R1 by annealing two complementary oligonucleotides and inserting them between the BspE1 and EagI sites. To ensure high purity of these lengthy oligos, they were ordered PAGE-purified and phosphorylated from Research Genetics (oligo sequences 5′-CCGGATATCCACAAGGTGGAGGTACTTGGGGTCAACCCCATGGAGGTGGTTGGGGTCAACCACAAGGC-3′ and 5′-GGCCGCCTTGTGGTTGACCCCAACCACCTCCGGGTTGACCCCAAGTACCTCCACCTTGTGGATAT-3′), and contained a BstXI site. The resulting plasmid was named pRS306Sup35R1+2. Subsequent repeats were added by inserting annealed oligos encoding three PrP repeats in the BstXI site (oligo sequences 5′-GAGGTTGGGGTCAACCCCATGGAGGAGGTTGGGGTCAACCCCATGGAGGTGGTTGGGGTCAACCCCATGGAG-3′ and 5′-ATGGGGTTGACCCCAACCACCTCCATGGGGTTGACCCCAACCTCCTCCATGGGGTTGACCCCAACCTCCTCC-3′). The addition of one copy of these annealed oligos created pRS306Sup35R1+5. The oligos contained two BstXI sites, so digestion with BstXI and self-ligation created pRS306Sup35R1+4, while digestion with BstXI and insertion of another copy of the annealed oligos created pRS306Sup35R1+7. In a similar manner, pRS306Sup35R1+6 and pRS306Sup35R1+8 were created. All of these plasmids were sequenced through the repeat region to confirm accuracy. The plasmids for the R1+8H1Q chimera were created by the same method, inserting oligos encoding PrP repeats in which the histidines were changed to glutamines into pRS306Sup35R1+2 (oligo sequences 5′-GAGGTTGGGGTCAACCC CAAGGAGGAGGTTGGGGTCAACCCCAAGGAGGTGGTTGGGGTCAACCCCAAGGAG-3′ and 5′-TTGGGGTTGACCCCAACCACCTCCTT GGGGTTGACCCCAACCTCCTCCTTGGGGTTGACCCCAACCTCCTCC-3′). The plasmids pRS306Sup35R1+8H1Q was created in this manner and sequenced through the repeat region. Note that these plasmids still contained the one histidine that was present in the repeats in pRS306Sup35R1+2. Bacterial expression constructs for R1+4, R1+8, and R1+8H1Q were created by excising the repeat region from the corresponding integration constructs with BstEII and MscI and ligating it into these sites in the expression construct pJC25NMstop (42Scheibel T. Kowal A.S. Bloom J.D. Lindquist S.L. Curr. Biol. 2001; 11: 366-369Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). These constructs were named pJC25R1+4stop, pJC25R1+8stop and pJC25R1+8H1Q. These plasmids were sequenced through the repeat region to confirm accuracy. Gene Integration and Replacement—The integration constructs were linearized with MluI and transformed into a [psi−] 74-D694 (genotype: ade1-14(UGA), trp1-289(UAG), his3Δ-200, ura3-52, leu2-3,112) strain. Transformants were selected on uracil-deficient medium (S.D.-Ura), and recombinant excision events were selected on medium containing 5-fluoroorotic acid. Strains in which the wild-type Sup35 gene had been replaced by the mutant copy were identified by PCR of a portion of the genomic Sup35 gene. The repeat region of the Sup35 gene was sequenced to confirm accuracy. Spontaneous Appearance of [PSI+] in R1+X Yeast Strains—All R1+X strains were grown on YPD plates, and then inoculated in liquid YPD. After overnight growth, the cells were plated on ADE- at 0.7 × 106, 1.4 × 106, and 6 × 106 cells/plate. After 7 days of incubation, colonies were counted. Protein Purification—Crude preparations of proteins were purified as previously described (43Serio T.R. Lindquist S.L. Annual Rev. Cell Dev. Biol. 1999; 15: 661-703Crossref PubMed Scopus (89) Google Scholar). Mass spectrometry analysis yielded the following masses: R1+4 was 27171.1 Da (calculated value is 27170.1 Da), R1+8 was 30277.6 Da (calculated value is 30277.3Da), and R1+8H1Q was 30222.9 Da (calculated value is 30223.3 Da). Protein concentrations were determined using the absorbance at 280 nm with molar extinction coefficients calculated as 25,600 (NM), 39400 (R1+4), 62160 (R1+8), and 62160 (R1+8H1Q). Fiber Formation—Proteins were dissolved in 6 m guanidine hydrochloride as a stock solution, and the concentration was determined by the absorbance at 280 nm. Solutions for unseeded polymerization reactions were prepared by dilution of the stock solution into aqueous buffers and allowed to assemble at room temperature either with our without agitation. Seeds for seeded reactions were prepared by sonicating preformed fibers in a VWR Aquasonic 50T water bath sonicator, and all seeded reactions contained 2% (w/w) of the seeds. The buffers for the tests at different pH values are: pH 7.2, 20 mm MOPS with 100 mm sodium chloride; pH 6.2, 5 mm potassium phosphate with 50 mm sodium sulfate; pH 4.9, 3.9, and 2.9, 5 mm potassium acetate with 50 mm sodium sulfate. Cu(II) Binding Reactions—Lyophilized protein was first dissolved in acidified 25 mm NEM, 300 mm NaCl and spin filtered through a 300 kDa cutoff membrane. An appropriate volume of 100 mm CuCl2 in deionized water was added and samples were mixed. Then samples were diluted to 5-20 μm final protein concentration using 30 mm NEM pH 8.1. All EPR samples contained 20% (v/v) glycerol as a cryoprotectant. Electron Spin Resonance Spectroscopy—X-band spectra (9.43 GHz) were acquired using a Bruker ELEXSYS E500 spectrometer and a TE102 cavity. Measurements were performed at ∼115-125K in a nitrogen vapor using cavity equipped with variable temperature control. The total bound Cu(II) was quantified by spin integration and comparison to accurate standard solutions containing Cu(II) in 10 mm imidazole at pH 7.4. Thioflavin-T Binding—Fiber formation was monitored by Thioflavin-T (44Krebs M.R.H. Bromley E.H.C. Donald A.M. J. Struct. Biol. 2005; 149: 30-37Crossref PubMed Scopus (604) Google Scholar) in both seeded and unseeded reactions (45Glover J.R. Kowal A.S. Schirmer E.C. Patino M.M. Liu J.J. Lindquist S. Cell. 1997; 89: 811-819Abstract Full Text Full Text PDF PubMed Scopus (545) Google Scholar). Attenuated Thioflavin T (ThT) intensity was observed at acidic pHs and in the presence of Cu(II), when SDS assay showed the same amount of free monomers left after polymerization reactions. ThT fluorescence intensity was baseline subtracted and then normalized to the maximum intensity when the polymerization reaction reached equilibrium. Monitoring Fiber Formation by SDS Solubility—At the indicated time points, 20 μl of the assembly mix was withdrawn and added to SDS-PAGE sample buffer. Samples were run on 12.5% SDS-PAGE gels and stained with Coomassie Blue G-250. The percentage of soluble protein was calculated by (gel band intensity at indicated time point) divided by (gel band intensity of zero hour sample after boiling). Chimeric Sup35 Proteins with PrP Repeats Can Support Both the Prion and Non-prion States—We first constructed chimeric proteins consisting of Sup35 with different numbers of PrP repeats substituted for the repeats of Sup35. Because the first repeats of Sup35 and PrP are the least similar to each other in sequence, and since the first Sup35 repeat is spatially separated from the others, we kept it intact. The last four full Sup35 repeats were replaced with the repeats from hamster PrP: one copy of the first hamster PrP imperfect repeat (PQGGGTWGQ) followed by varying numbers of the perfect hamster PrP repeats (PHGGGWGQ), as shown in Fig. 1A. Because our chimeras contained the first repeat (R1) of Sup35 plus two, four, five, six, seven, and eight repeats, they were named R1+2, R1+4, R1+5, R1+6, R1+7, and R1+8. We first asked how these chimeric proteins affected yeast prion biology in vivo. Starting with [psi−] cells, the wild-type SUP35 gene was replaced with a gene encoding R1+2, R1+4, R1+5, R1+6, R1+7, or R1+8 by homologous recombination. The strain we employed contains a nonsense codon in the ADE1 gene. In [PSI+] cells, wherein most of the Sup35 translation termination factor is sequestered in prion aggregates, ribosomes sometimes read through the stop codon. This allows the cells to grow on adenine deficient media (S.D.-Ade) and causes them to form white colonies when grown on rich media (YPD) (46Chernoff Y.O. Uptain S.M. Lindquist S.L. Methods Enzymol. 2002; 351: 499-538Crossref PubMed Scopus (96) Google Scholar, 47Derkatch I.L. Chernoff Y.O. Kushnirov V.V. IngeVechtomov S.G. Liebman S.W. Genetics. 1996; 144: 1375-1386Crossref PubMed Google Scholar). The [psi−] cells do not grow on S.D.-Ade, and produce red colonies on YPD because of the accumulation of a metabolic by-product of adenine biosynthesis (46Chernoff Y.O. Uptain S.M. Lindquist S.L. Methods Enzymol. 2002; 351: 499-538Crossref PubMed Scopus (96) Google Scholar). Strains in which wild-type Sup35 was replaced with R1+2 through R1+8 substitutions remained [psi−]. Increasing the Number of PrP Repeats Destabilizes Both the [psi−] and [PSI+] States—When wild-type cells are grown in YPD, they are stable in both the [PSI+] and the [psi−] states, and the rate of spontaneous conversion between these states is very low (7Liu J.J. Lindquist S. Nature. 1999; 400: 573-576Crossref PubMed Scopus (158) Google Scholar). To determine the stability of the [psi−] state in our mutant strains, we observed the spontaneous appearance of [PSI+] by streaking [psi−] cells on YPD followed by an S.D.-Ade plate. Wild-type Sup35 [psi−] strains produced colonies on S.D.-Ade medium rarely, approximately one per 106 cells/plate. R1+2, R1+4, R1+5, also rarely produced colonies. In contrast, colonies appeared ∼10-fold more frequently on S.D.-Ade medium with R1+6 and ∼100-fold more frequently with R1+7 and R1+8 strains. The colonies were confirmed as being true [PSI+] colonies by taking advantage of the fact that cells can be cured of the prion state by growing them on media containing guanidine hydrochloride. This produced red colonies that could not grow on S.D.-Ade medium. Thus, repeat expansion increased rate of spontaneous conversion from the [psi−] to the [PSI+] state. Next we examined the spontaneous conversion of R1+X [PSI+] strains to [psi−]. To create [PSI+] strains of R1+2, R1+4, R1+5, and R1+6, large numbers of the [psi−] strains were plated on S.D.-Ade and colonies that grew were selected. All of the [PSI+] strains were confirmed by growth and curing in the presence of 5 mm Gdn·HCl. Fig. 1B shows the growth of R1+X strains in both [psi−] and [PSI+] states on YPD. When R1+2, R1+4, R1+5, and R1+6 [PSI+] strains were grown on YPD-rich medium, the colonies appeared white, and red colonies were rarely observed, similar to wild-type Sup35 [PSI+] strains. Thus, the [PSI+] states of R1+2, R1+4, R1+5, and R1+6 were maintained stably. However, R1+7 and R1+8 strains frequently converted to [psi−] on YPD plates, with the colonies sectoring to red around the perimeter. Thus, extra copies of the PrP octarepeats destabilize both the prion and non-prion states. Increasing the Number of PrP Repeats Dramatically Accelerates Amyloid Formation in Vitro—Sup35 can be divided into three distinct regions, the N terminus with the oligopeptide repeats (amino acids 1-123), a highly charged middle region, and the C terminus (amino acids 254-685), which functions as a translation termination factor. The N terminus (N) and the middle region (M) of Sup35, often called NM, forms the prion-determining (PrD) domain. In vitro assembly of NM amyloid fibers recapitulates the induction and propagation of yeast prions in vivo (7Liu J.J. Lindquist S. Nature. 1999; 400: 573-576Crossref PubMed Scopus (158) Google Scholar, 39King C.Y. Diaz-Avalos R. Nature. 2004; 428: 319-323Crossref PubMed Scopus (420) Google Scholar, 48Tanaka M. Chien P. Naber N. Cooke R. Weissman J.S. Nature. 2004; 428: 323-328Crossref PubMed Scopus (681) Goog