Title: Constitutive Overexpression of Nrf2-dependent Heme Oxygenase-1 in A549 Cells Contributes to Resistance to Apoptosis Induced by Epigallocatechin 3-Gallate
Abstract: Epigallocatechin 3-gallate (EGC19194), the major polyphenol found in green tea, exerts antiproliferative and proapoptotic effects in many cancer cells. However, we found that among many cancer cells human lung adenocarcinoma A549 cells are markedly resistant to apoptosis induction by EGCG (even at 100 μm for 72 h). Heme oxygenase-1 (HO-1) induced by stress stimuli represents a prime cellular defense mechanism, but it may be associated with enhanced cell proliferation and chemoresistance in some cancer cells. Because we found that A549 cells constitutively overexpress HO-1 and its associated transcription factor Nrf2, we tested an hypothesis that EGCG resistance in these cells may be linked with Nrf2-mediated HO-1 overexpression. HO-1 inhibition with tin-protoporphyrin IX and silencing with RNA interference rendered cells more sensitive to apoptosis induction by EGCG and classical prooxidants. Interestingly, EGCG at high concentration (>200 μm) induced apoptosis by suppressing expression of HO-1 protein and mRNA, and this effect correlated with a decrease in both Nrf2-ARE binding and HO-1-ARE-luciferase activity, suggesting Nrf2-driven transcriptional activation of ho-1. Because we observed notably high levels of phosphorylated protein kinase Cα and its suppression by EGCG and deferoxamine (an iron chelator), a possible mechanism involving phosphorylated protein kinase Cα and iron in Nrf2-HO-1 activation was further investigated. Collectively, our findings suggest that Nrf2-mediated HO-1 overexpression confers resistance to apoptosis induction by EGCG; therefore, its inactivation may be a target for overcoming the resistance to chemoprevention and chemotherapy. Epigallocatechin 3-gallate (EGC19194), the major polyphenol found in green tea, exerts antiproliferative and proapoptotic effects in many cancer cells. However, we found that among many cancer cells human lung adenocarcinoma A549 cells are markedly resistant to apoptosis induction by EGCG (even at 100 μm for 72 h). Heme oxygenase-1 (HO-1) induced by stress stimuli represents a prime cellular defense mechanism, but it may be associated with enhanced cell proliferation and chemoresistance in some cancer cells. Because we found that A549 cells constitutively overexpress HO-1 and its associated transcription factor Nrf2, we tested an hypothesis that EGCG resistance in these cells may be linked with Nrf2-mediated HO-1 overexpression. HO-1 inhibition with tin-protoporphyrin IX and silencing with RNA interference rendered cells more sensitive to apoptosis induction by EGCG and classical prooxidants. Interestingly, EGCG at high concentration (>200 μm) induced apoptosis by suppressing expression of HO-1 protein and mRNA, and this effect correlated with a decrease in both Nrf2-ARE binding and HO-1-ARE-luciferase activity, suggesting Nrf2-driven transcriptional activation of ho-1. Because we observed notably high levels of phosphorylated protein kinase Cα and its suppression by EGCG and deferoxamine (an iron chelator), a possible mechanism involving phosphorylated protein kinase Cα and iron in Nrf2-HO-1 activation was further investigated. Collectively, our findings suggest that Nrf2-mediated HO-1 overexpression confers resistance to apoptosis induction by EGCG; therefore, its inactivation may be a target for overcoming the resistance to chemoprevention and chemotherapy. Epigallocatechin 3-gallate (EGCG), 2The abbreviations used are: EGCG, (-)-epigallocatechin 3-gallate; HO-1, heme oxygenase-1; Nrf2, nuclear factor erythroid 2-related factor 2; ARE, antioxidant-responsive element; PKC, protein kinase C; MAPKs, mitogen-activated protein kinases; ERK, extracellular signal-regulated kinase; SnPPIX, tin protoporphyrin IX; BSO, l-buthionine-(SR)-sulfoximine; GCL, glutamate-cysteine ligase; ROS, reactive oxygen species; DFO, deferoxamine; NAC, N-acetylcysteine; Trx, thioredoxine; SOD, superoxide dismutase; Gpx, glutathione peroxidase; siRNA, small interfering RNA; NSCLC, nonsmall cell lung cancer; t-BHP, tert-butylhydroperoxide; PARP, poly(ADP-ribose) polymerase; MTT, 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide; JNK, c-Jun NH2-terminal kinase; SAPK, stress-activated protein kinase; PI3K, phosphoinositol 3-kinase; RT, reverse transcription; NHBEs, human bronchial epithelial cells; PBS, phosphate-buffered saline; EMSA, electrophoretic mobility shift assay; TUNEL, terminal dUTP nick-end labeling; PI, propidium iodide. 2The abbreviations used are: EGCG, (-)-epigallocatechin 3-gallate; HO-1, heme oxygenase-1; Nrf2, nuclear factor erythroid 2-related factor 2; ARE, antioxidant-responsive element; PKC, protein kinase C; MAPKs, mitogen-activated protein kinases; ERK, extracellular signal-regulated kinase; SnPPIX, tin protoporphyrin IX; BSO, l-buthionine-(SR)-sulfoximine; GCL, glutamate-cysteine ligase; ROS, reactive oxygen species; DFO, deferoxamine; NAC, N-acetylcysteine; Trx, thioredoxine; SOD, superoxide dismutase; Gpx, glutathione peroxidase; siRNA, small interfering RNA; NSCLC, nonsmall cell lung cancer; t-BHP, tert-butylhydroperoxide; PARP, poly(ADP-ribose) polymerase; MTT, 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide; JNK, c-Jun NH2-terminal kinase; SAPK, stress-activated protein kinase; PI3K, phosphoinositol 3-kinase; RT, reverse transcription; NHBEs, human bronchial epithelial cells; PBS, phosphate-buffered saline; EMSA, electrophoretic mobility shift assay; TUNEL, terminal dUTP nick-end labeling; PI, propidium iodide. the major polyphenol found in green tea, is a widely studied cancer chemopreventive agent with potential anticancer activity. The major mechanism of EGCG-mediated anticancer effects is considered to be related to induction of apoptosis (1Ahmad N. Feyes D.K. Nieminen A.L. Agarwal R. Mukhtar H. J. Natl. Cancer Inst. 1997; 89: 1881-1886Crossref PubMed Scopus (728) Google Scholar, 2Khan N. Afaq F. Saleem M. Ahmad N. Mukhtar H. Cancer Res. 2006; 66: 2500-2505Crossref PubMed Scopus (680) Google Scholar). Studies have shown differential sensitivity among different tumor cells or tumor cells versus normal cells to EGCG (1Ahmad N. Feyes D.K. Nieminen A.L. Agarwal R. Mukhtar H. J. Natl. Cancer Inst. 1997; 89: 1881-1886Crossref PubMed Scopus (728) Google Scholar, 2Khan N. Afaq F. Saleem M. Ahmad N. Mukhtar H. Cancer Res. 2006; 66: 2500-2505Crossref PubMed Scopus (680) Google Scholar). In particular, in many cancer cells EGCG has been shown to modulate multiple and often different signal transduction pathways. The reason for these observed differences is not clear but may be because of the differential oxidative status imposed by EGCG in various cell types or cell type-specific expression of endogenous antioxidant defense enzymes. Heme oxygenase-1 (HO-1) is known to be highly induced by a variety of stress stimuli and many cancer chemopreventive agents, and it represents a prime cellular defense mechanism against oxidative stress via antioxidant function of its catalytic products like bilirubin and carbon monoxide (CO) with concomitant induction of iron sequestering ferritin (3Ryter S.W. Choi A.M. Antioxid. Redox. Signal. 2002; 4: 625-632Crossref PubMed Scopus (167) Google Scholar, 54Sikorski E.M. Hock T. Hill-Kapturczak N. Agarwal A. Am. J. Physiol. 2004; 286: F425-F441Crossref PubMed Scopus (211) Google Scholar). On the contrary, its overexpression in human cancers may offer cancer cells a growth advantage and cellular resistance against chemotherapy and photodynamic therapy (4Fang J. Akaike T. Maeda H. Apoptosis. 2004; 9: 27-35Crossref PubMed Scopus (177) Google Scholar, 5Nowis D. Legat M. Grzela T. Niderla J. Wilczek E. Wilczynski G.M. Glodkowska E. Mrowka P. Issat T. Dulak J. Jozkowicz A. Was H. Adamek M. Wrzosek A. Nazarewski S. Makowski M. Stoklosa T. Jakobisiak M. Golab J. Oncogene,. 2006; 25: 3365-3374Crossref PubMed Scopus (160) Google Scholar). Because the growth of most tumors depends on HO-1 (6Tanaka S. Akaike T. Beppu T. Beppu T. Ogawa M. Tamura F. Miyamoto Y. Maeda H. Br. J. Cancer. 2003; 88: 902-909Crossref PubMed Scopus (145) Google Scholar), it is also considered as a target for cancer therapy in humans. In this context, HO-1 induction by stress-related agents in several types of human cancer cells has been reported to play a role in chemoresistance to apoptosis (5Nowis D. Legat M. Grzela T. Niderla J. Wilczek E. Wilczynski G.M. Glodkowska E. Mrowka P. Issat T. Dulak J. Jozkowicz A. Was H. Adamek M. Wrzosek A. Nazarewski S. Makowski M. Stoklosa T. Jakobisiak M. Golab J. Oncogene,. 2006; 25: 3365-3374Crossref PubMed Scopus (160) Google Scholar, 7Sasaki T. Yoshida K. Kondo H. Ohmori H. Kuniyasu H. Virchows Arch. 2005; 446: 525-531Crossref PubMed Scopus (21) Google Scholar, 8Liu Z.M. Chen G.G. Ng E.K. Leung W.K. Sung J.J. Chung S.C. Oncogene. 2004; 23: 503-513Crossref PubMed Scopus (149) Google Scholar). Similarly, inhibition of HO-1 has been shown to lead to reduced tumor growth and increased sensitivity to chemotherapy (9Fang J. Sawa T. Akaike T. Akuta T. Sahoo S.K. Khaled G. Hamada A. Maeda H. Cancer Res. 2003; 63: 3567-3574PubMed Google Scholar, 10Fang J. Sawa T. Akaike T. Greish K. Maeda H. Int. J. Cancer. 2004; 109: 1-8Crossref PubMed Scopus (151) Google Scholar). There is accumulating evidence to show that Nrf2 is a key transcriptional factor that activates the antioxidant-reactive element (ARE) and in turn regulates the expression of antioxidant phase II detoxifying enzymes. It is interesting to note that the promoter region of ho-1 gene contains the ARE sequence (11Kobayashi A. Kang M.I. Watai Y. Tong K.I. Shibata T. Yamamoto M. Mol. Cell. Biol. 2006; 26: 221-229Crossref PubMed Scopus (697) Google Scholar, 12Lee J.S. Surh Y.J. Cancer Lett. 2005; 28: 171-184Crossref Scopus (455) Google Scholar, 13Kobayashi M. Yamamoto M. Antioxid. Redox. Signal. 2005; 7: 385-394Crossref PubMed Scopus (888) Google Scholar, 14Martin D. Rojo A.I. Salinas M. Diaz R. Gallardo G. Alam J. De Galarreta C.M. Cuadrado A. J. Biol. Chem. 2004; 279: 919-929Google Scholar). The mode of transcriptional activation of Nrf2 is not fully understood, but the available evidence points to two mechanisms. In the first, a sulfhydryl modification of its cytosolic sequestering protein Keap1 by chemical inducers leads to Nrf2 dissociation from Keap1 and subsequent translocation into the nucleus, thereby activating ARE (11Kobayashi A. Kang M.I. Watai Y. Tong K.I. Shibata T. Yamamoto M. Mol. Cell. Biol. 2006; 26: 221-229Crossref PubMed Scopus (697) Google Scholar). In the second pathway, it is considered that several upstream signaling kinases, including protein kinase C (PKC), phosphoinositol 3-kinase (PI3K), and mitogen-activated protein kinases (MAPKs, p38, ERK1/2, and JNK), regulate Nrf2/ARE activity (12Lee J.S. Surh Y.J. Cancer Lett. 2005; 28: 171-184Crossref Scopus (455) Google Scholar, 13Kobayashi M. Yamamoto M. Antioxid. Redox. Signal. 2005; 7: 385-394Crossref PubMed Scopus (888) Google Scholar, 14Martin D. Rojo A.I. Salinas M. Diaz R. Gallardo G. Alam J. De Galarreta C.M. Cuadrado A. J. Biol. Chem. 2004; 279: 919-929Google Scholar). However, it is still unclear which kinase acts as an upstream mediator of Nrf2. Histologically, non-small cell lung cancer (NSCLC) constitutes ∼85% of all lung cancers and often shows intrinsic multidrug resistance, which is a major problem in its chemotherapy (15Seve P. Dumontet C. Curr. Med. Chem. Anticancer Agents. 2005; 5: 73-88Crossref PubMed Scopus (143) Google Scholar). The expression levels of several factors such as p53, p-AKT, apoptosis-inducing factor, and multidrug resistance protein have been proposed recently to determine the chemoresistance against conventional treatment protocols (16Gallego M.A. Joseph B. Hemstrom T.H. Tamiji S. Mortier L. Kroemer G. Formstecher P. Zhivotovsky B. Marchetti P. Oncogene. 2004; 23: 6282-6291Crossref PubMed Scopus (88) Google Scholar, 17Ikuta K. Takemura K. Sasaki K. Kihara M. Nishimura M. Ueda N. Naito S. Lee E. Shimizu E. Yamauchi A. Biol. Pharm. Bull. 2005; 28: 707-712Crossref PubMed Scopus (35) Google Scholar). While comparing EGCG-mediated cytotoxicity in various cancer cells, we observed that human lung adenocarcinoma A549 cells, which belong to NSCLC, were significantly resistant to the induction of apoptosis by EGCG. We then found that these cells express high levels of constitutive HO-1 and Nrf2, as compared with other human cancer cells. It has been shown that HO-1 expression can be elevated in the lung in response to oxidative stress associated with infection, hyperoxia, and inflammatory diseases or acute respiratory distress syndrome (18Carter E.P. Garat C. Imamura M. Am. J. Physiol. 2004; 287: L24-L25Crossref PubMed Scopus (31) Google Scholar, 19Mumby S. Upton R.L. Chen Y. Stanford S.J. Quinlan G.J. Nicholson A.G. Gutteridge J.M. Lamb N.J. Evans T.W. Crit. Care Med. 2004; 32: 1130-1135Crossref PubMed Scopus (70) Google Scholar). Although Nrf2 plays a critical role in protection against pulmonary fibrosis, presumably through enhancement of cellular antioxidant capacity (53Cho H.Y. Reddy S.P. Yamamoto M. Kleeberger S.R. FASEB J. 2004; 18: 1258-1260Crossref PubMed Scopus (297) Google Scholar), HO-1/Nrf2 activation as a defense mechanism in carcinoma cells during lung carcinogenesis may lead to their resistance to chemopreventive and chemotherapeutic regimens. Here we first show that constitutively overexpressed HO-1 in A549 lung cancer cells is strongly associated with resistance to apoptosis induction by EGCG. We further demonstrate that this overexpression is regulated by phosphorylation of PKCα and subsequent activation of Nrf2. We suggest that the PKCα-Nrf2-HO-1 pathway may be exploited for targeted therapy of lung cancer. Chemicals and Reagents—A purified preparation of EGCG (>98% pure) was procured from Sigma, and aliquots of stock solution (20 mm) prepared in Me2SO were stored at -80 °C for further use. Ro-317549, PD98059, LY294002, and triciribine were obtained from Calbiochem. Tin-protoporphyrin-IX (SnPPIX) was obtained from Porphyrin Products (Logan, UT), and l-buthionine-(SR)-sulfoximine (BSO), N-acetylcysteine (NAC), and deferoxamine (DFO) were purchased from Sigma. Cell Treatment and Viability—The A549, LNCaP, DU145, PC-3, AsPC-1, HCC1419, SKOV-3, and HT-29, H196, and H441 human cancer cells were obtained from American Type Culture Collection (Manassas, VA) and cultured according to the manufacturer's protocol. Normal human bronchial epithelial cells (NHBEs) were procured form Cambrex BioScience (Walkersville, MD) and cultured as per the manufacturer's instructions. For measurement of cell viability, cells (2-5 × 104 cells per well for 24-well plate) were seeded into plates, cultured overnight in complete medium, and then treated with EGCG (0-100 μm) or other agents for 24, 48, and 72 h. After appropriate time periods, cells were subjected to MTT assay as described earlier (20Kweon M.H. Jung M.J. Sung H.C. Free Radic. Biol. Med. 2004; 36: 40-52Crossref PubMed Scopus (23) Google Scholar) to determine cell viability. DNA Fragmentation Assay—Following treatment of cells as described above, the cells were washed twice with PBS, pH 7.4, incubated with DNA lysis buffer (10 mm Tris, pH 7.5, 400 mm NaCl, 1 mm EDTA, and 1% Triton X-100) for 30 min on ice, and then centrifuged. The supernatant obtained was incubated with RNase (0.2 mg/ml) at room temperature and then with proteinase K (0.1 mg/ml) for 2 h at 37°C. DNA was extracted and resolved as described previously (21Kweon M.H. Park Y.I. Sung H.C. Mukhtar H. Free Radic. Biol. Med. 2006; 40: 1349-1361Crossref PubMed Scopus (39) Google Scholar). Immunoblot Analysis—Western blotting was performed as described previously (20Kweon M.H. Jung M.J. Sung H.C. Free Radic. Biol. Med. 2004; 36: 40-52Crossref PubMed Scopus (23) Google Scholar). Primary antibodies against HO-1 and HO-2 (dilution 1:200 and 1:1000; StressGen, Victoria, Canada), Nrf2, Keap1, the catalytic subunit of GCL, ferritin H, p53, SOD-1, proliferating cell nuclear antigen, apoptosis-inducing factor, Trx, p38, and procaspase-3 (dilution 1:200; Santa Cruz Biotechnology, Santa Cruz, CA), p-PKCα Ser-657, HIF-1α, p-AKT Ser-473, Gpx, p-NF-κB, c-Fos, Bax, and PI3K p85 (dilution 1:1000-2000; Upstate, Charlottesville, VA), p21 Waf1/Cip1, p-PKCδ Thr-505, PKCα, PKCδ, PARP, p-ERK44/42, p-p38, and p-SAPK/JNK, and SAPK/JNK (dilution 1:1000-2000, Cell signaling, Beverly, MA), and β-actin (1:2000, Sigma) were used to detect their corresponding antigens. Electrophoretic Mobility Shift Assay—EMSA for Nrf2-ARE binding was performed as described previously (22Saleem M. Kaur S. Kweon M.H. Adhami V.M. Afaq F. Mukhtar H. Carcinogenesis. 2005; 26: 1956-1964Crossref PubMed Scopus (118) Google Scholar). Briefly, synthetic double strand oligonucleotide corresponding to a human HO-1 ARE was biotinylated using the biotin 3′ end labeling kit (Pierce). Biotin end-labeled target DNA was incubated with anti-human Nrf2 antibody (1 μl) for 30 min to detect supershifted Nrf2, subjected to native gel electrophoresis, and transferred onto a nylon membrane. ARE-Nrf2 binding was detected using streptavidin-horseradish peroxidase conjugate and a chemiluminescent substrate followed by autoradiography. Binding specificity was tested by adding to nuclear extracts a 100-fold molar excess of cold ARE oligonucleotide. Transient Transfection of HO-1-ARE Reporter Vector and Luciferase Activity—HO-1/ARE reporter construct (hpHOpTi-Luc) provided by Dr. Jeffrey A. Johnson (University of Wisconsin, Madison) was made by inserting 34-bp DNA sequence (GAT CCT CTA GAG TCA CAG TGA CTT GGC AAA ATC AGA GAT CTC ACT GAA CCG TTT TAG TCT AG) located in 5′-flanking ARE region of human HO-1 gene into pTi-luciferase vector (23Chen C.Y. Jang J.H. Li M.H. Surh Y.J. Biochem. Biophys. Res. Commun. 2005; 331: 993-1000Crossref PubMed Scopus (382) Google Scholar). Cells were plated on 24-well plates at a density of 5 × 104 cells/well and transfected with ARE-luciferase reporter construct (0.25 μg/well) and β-galactosidase plasmid (0.1 μg/well) using Lipofectamine 2000 (Invitrogen). Luciferase activity was measured according to the manufacturer's instructions (Promega, Madison, WI), and β-galactosidase activity was determined to normalize transfection efficiency. RNA Interference—The small interfering RNA (siRNA) against ho-1 was procured from Dharmacon (Lafayette, CO). Transfection was performed using Dharmafect transfection kit (Dharmacon, Lafayette, CO) and following the manufacturer's protocol (24Saleem M. Kweon M.H. Yun J.M. Adhami V.M. Khan N. Syed D.N. Mukhtar H. Cancer Res. 2005; 65: 11203-11213Crossref PubMed Scopus (116) Google Scholar) with ho-1 siRNA, duplex D-0063732-05-0005, human HMOX1 (sense, GGCAGAGGGUGAUAGAAGAUU, and antisense, PUCUUCUAUCACCCUCUGCCUU). The targeting site was pooled from open reading frame region of human ho-1 (NCBI accession number NM002133). Cells were also transfected with nontargeting, negative control siRNA (Dharmacon), which allows assessing target specificity and any nonspecific gene silencing effects. Briefly, A549 cells were transfected with 25-100 nmol/liter of siRNAs directed against the ho-1 (ho-1siRNA) for 6-48 h. The cells were harvested and processed for preparation of cell lysate or RNA for biochemical assays. Flow Cytometric Analysis—Flow cytometry for apoptosis analysis was performed as described (20Kweon M.H. Jung M.J. Sung H.C. Free Radic. Biol. Med. 2004; 36: 40-52Crossref PubMed Scopus (23) Google Scholar). The cells transfected with siHO-1 RNA for 6, 12, 24, and 48 h were grown at a density of 1 × 106 cells in 100-mm culture dishes and treated with EGCG (80 μm) for 24 h or 0.5 mm H2O2 and 1 mm t-BHP for 6 h. The cells were trypsinized, processed for labeling with fluorescein-tagged dUTP nucleotide and PI by the use of an Apo-Direct apoptosis kit (Phoenix Flow Systems, San Diego), and analyzed by flow cytometry. Soft Agar Colony Formation Assay—Following 24 and 48 h of post-transfection with 25 nm HO-1 siRNA, cells were trypsinized and counted. A total of 5,000 cells in 0.7% agarose containing 20% fetal bovine serum and 2× RPMI medium were mixed with either EGCG solution (final concentration: 40 μm) or the same volume of PBS. The cells were poured onto 0.5% solidified agar in a 6-well plate, and the plates were incubated at 37 °C in a CO2-humidified incubator for 14 days. The resulting plates were stained with 0.5 ml of 0.005% crystal violet for 2 h and observed under the microscope. Annexin V-Fluos-PI Staining—Annexin V-Fluos-PI staining for confocal microscopy was performed according to the manufacturer's instructions (Roche Applied Science) and as described previously (24Saleem M. Kweon M.H. Yun J.M. Adhami V.M. Khan N. Syed D.N. Mukhtar H. Cancer Res. 2005; 65: 11203-11213Crossref PubMed Scopus (116) Google Scholar). Briefly, A549 cells were grown to about 60% confluency on cell culture slides and then treated with EGCG (0-300 μm) for 48 h. Apoptosis and necrosis were detected by using a Zeiss Axiovert 100 microscope (Carl Zeiss, Inc., Thornwood, NY). Immunocytochemistry of Nrf2—A549 cells grown on culture slides and treated with EGCG as indicated were fixed in 100% methanol and incubated with monoclonal rabbit anti-Nrf2 antibody (2.5 μg/ml) in phosphate-buffered saline containing 1.5% bovine serum albumin for 60 min at room temperature. The cells were incubated with fluorescein isothiocyanate-conjugated secondary antibody (Santa Cruz Biotechnology) for an additional 45 min in the dark. Stained cells were washed, mounted in an antifade mounting medium (Molecular Probes, Eugene, OR), and examined with a fluorescence confocal microscope (Zeiss LSM 510, Thornwood, NY). RT-PCR and Northern Blotting—mRNA levels and expression were determined by RT-PCR and Northern blot as described (21Kweon M.H. Park Y.I. Sung H.C. Mukhtar H. Free Radic. Biol. Med. 2006; 40: 1349-1361Crossref PubMed Scopus (39) Google Scholar). Specific primers for human HO-1 (size of PCR product, 775 bp; sense, 5′-CAA GGA GGT GCA CAC GG-3′, and antisense, 5′-GCT GGA TGT TGA GCA) and glyceraldehyde-3-phosphate dehydrogenase as a loading control (size of PCR product: 523 bp, sense, 5′-GAG TCG NCG CGG TTT CCT GC-3′, and antisense. 5′-CTG CTC CAA GCA CAG CTC AC-3′) were used for the first cDNA synthesis. For Northern blotting, 10 μg of total RNA was electrophoresed in 1% formaldehyde-agarose gel and transferred to a nylon membrane. Human HO-1 cDNA was labeled with [α-32P]dCTP (PerkinElmer Life Sciences) by the random hexamer priming system using a Rediprime™ II kit (Amersham Biosciences). Human Lung Adenocarcinoma A549 Cells Are Highly Resistant to EGCG Cytotoxicity—Initially we compared in vitro cytotoxicity of EGCG on eight kinds of human epithelial cancer cells (see Fig. 1B). Treatment of all cells with EGCG (0-100 μm; 24, 48, and 72 h) generated varying degrees of dose- and time-dependent cytotoxic response with least effect in A549 cells (Fig. 1A). The treatment of all but A549 cancer cells with EGCG (>40 μm) for 24 h showed initial toxicity; A549 cells were highly resistant even up to 100 μm EGCG treatment for 24-48 h. At 40 μm of treatment for 48 h, significant cytotoxicity (p < 0.01-0.001) was noted for SKOV-3, HT-29, HCC1419, and PC-3 cells, whereas moderate toxicity at the same concentration of EGCG was observed for AsPC-1 and LNCaP cells. All cells except A549 were found to be sensitive to 10 μm EGCG at 72 h of exposure, where a significant cytotoxicity (42-76% cell viability, p < 0.01-0.001) was observed. Among all cells tested, A549 cells were highly resistant inasmuch as 85% cell viability was sustained for 72 h at 40 μm EGCG (Fig. 1A). The IC50 value at 72 h of exposure to EGCG was estimated to be in the following order: A549 > AsPC-1 > HCC1419 > LNCaP > DU145 > PC-3 > SKOV-3 > HT-29 (Fig. 1B). Expression of Redox-related Antioxidant Enzymes and Transcription Factors in Cancer Cells; Elevated Expression of HO-1, GCL, and Nrf2 in A549 Cells—Because EGCG has been known to generate (i) extracellular H2O2 in cell culture medium, (ii) intracellular ROS by the Fenton reaction upon cell entry, and (iii) subsequently to induce oxidative stress-mediated apoptosis (25Elbling L. Weiss R.M. Teufelhofer O. Uhl M. Knasmueller S. Schulte-Hermann R. Berger W. Micksche M. FASEB J. 2005; 19: 807-809Crossref PubMed Scopus (265) Google Scholar, 26Nakagawa H. Hasumi K. Woo J.T. Nagai K. Wachi M. Carcinogenesis. 2004; 25: 1567-1574Crossref PubMed Scopus (211) Google Scholar), we next determined the expression of HO-1, which is an inducible ROS-scavenging antioxidant, along with its constitutive isoform HO-2, to investigate its relevance to EGCG sensitivity and cellular antioxidant status. Strikingly, HO-1 was observed to be constitutively overexpressed in A549 cells as compared with other cancer cells tested (Fig. 2A). However, the expression level of HO-2 was almost similar in all cell lines. Because HO-1 is a representative Nrf2-mediated phase II detoxifying defense enzyme against oxidative stress, we also determined the expression level of other antioxidant phase II defense proteins. A549 cells were found to express high levels of GCL and thioredoxine (Trx) but not ferritin and glutathione peroxidase (Gpx) as compared with other cells (Fig. 2B). In addition, wide variation in the expression level of other primary antioxidant enzymes such as superoxide dismutase (SOD) and catalase was observed in most human epithelial cancer cells tested, which did not show any significant correlation to EGCG sensitivity (Fig. 2B). We further found that A549 cells, among all other cancer cells, express the highest amount of total Nrf2 along with a relatively low level of its cytosolic anchor Keap1 and repressor Bach 1 (Fig. 2C). On the contrary, noticeable differences in the level of other redox-related transcription factors, such as NF-κB, AP-1, or HIF-1, were not observed between A549 cells and other cancer cells. We therefore hypothesized that the constitutive high expression of HO-1 and its associated transcription factor Nrf2 in A549 cells may be associated with the observed high resistance to EGCG-caused cytotoxicity. To determine whether HO-1 overexpression is a general property of lung cancer cells or unique to NSCLC represented by A549 cells, and if EGCG resistance is specific to lung-derived cancer cells, we explored this possibility with additional lung cancer cells (NSCLC H441 cells and SCLC H196 cells) and primary NHBEs. A549 cells were found to be most resistant to EGCG treatment even than NHBEs cells (data not shown). Significant overexpression of HO-1 as well as higher expression levels of Nrf2 and GCL were observed only in A549 cells (Fig. 2D), indicating that EGCG resistance, HO-1, and Nrf2 overexpression are unique to A549 cells. But it was interesting to observe an unexpectedly low expression level of ferritin in A549 cells (Fig. 2, B and D), which is known to be concomitantly up-regulated with HO-1 induction (3Ryter S.W. Choi A.M. Antioxid. Redox. Signal. 2002; 4: 625-632Crossref PubMed Scopus (167) Google Scholar, 54Sikorski E.M. Hock T. Hill-Kapturczak N. Agarwal A. Am. J. Physiol. 2004; 286: F425-F441Crossref PubMed Scopus (211) Google Scholar). Effect of SnPPIX and BSO on Resistance to EGCG-induced Apoptosis—To test our hypothesis, we first compared the effect of EGCG treatment (50 and 100 μm; 48 h) on the expression level of HO-1 and GCL in A549 cells and three kinds of EGCG-sensitive cells, SKOV-3, HCC1419, and HT-29 (Fig. 1B). Additionally, we performed DNA fragmentation analysis to confirm the apoptotic death caused by EGCG treatment. Although the levels of HO-1 and GCL in A549 cells were found to be decreased by EGCG treatment, this decrease was small when compared with other EGCG-sensitive cells (Fig. 3A). As expected, DNA fragmentation, which is an indicator of apoptosis, was not evident in A549 cells treated with EGCG (Fig. 3A). In sharp contrast, DNA fragmentation was clearly evident in SKOV3, HCC1419, and HT29 cells treated with EGCG even at 50 μm of concentration. These results suggested that the high expression of HO-1 and GCL in A549 cells might be related to their resistance to EGCG-induced apoptosis. To verify the antiapoptotic role of HO-1 and GCL, we performed a combinatorial study of EGCG with specific inhibitors of HO-1 and GCL, SnPPIX (9Fang J. Sawa T. Akaike T. Akuta T. Sahoo S.K. Khaled G. Hamada A. Maeda H. Cancer Res. 2003; 63: 3567-3574PubMed Google Scholar, 21Kweon M.H. Park Y.I. Sung H.C. Mukhtar H. Free Radic. Biol. Med. 2006; 40: 1349-1361Crossref PubMed Scopus (39) Google Scholar) and BSO, respectively (20Kweon M.H. Jung M.J. Sung H.C. Free Radic. Biol. Med. 2004; 36: 40-52Crossref PubMed Scopus (23) Google Scholar, 27Gong P. Cederbaum A.I. J. Biol. Chem. 2006; 281: 14573-14579Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). Cells were pretreated with SnPPIX (10 μm) and BSO (1 μm) for 2 h (nontoxic maximum effective concentrations), followed by treatment with EGCG (50-100 μm; 48 h). Both inhibitors rendered A549 cells more susceptible to EGCG treatment as assessed by the MTT (Fig. 3B) and DNA fragmentation assay (Fig. 3C), and this effect was found to be more pronounced (p < 0.01-0.001) by preincubation with SnPPIX than BSO (Fig. 3, B and C), suggesting a pivotal role of HO-1 in EGCG resistance of A549 cells. Effect of HO-1 Silencing on Cell Growth and Chemoresistance of A549 Cells—To more directly assess involvement of constitutive overexpression of HO-1 in EGCG resistance, we performed siRNA-mediated silencing of the ho-1 gene. As shown in Fig. 4, the expression of HO-1 protein (Fig. 4A) and mRNA (Fig. 4B) was effectively inhibited with all concentrations (25, 50, and 100 nm;48h) of ho-1 siRNA used. Nonsilencing siRNA did not exhibit any effect on HO-1 protein and mRNA. We next transfected cells with ho-1 siRNA (25 nm) for 6, 12, 24, and 48 h, respectiv