Characterization of the human patatin-like phospholipase family

Name: Work Video:
Duration: 3 min 30 s
Paul A. Wilson; Scott D. Gardner; Natalie M. Lambie; Stéphane Commans; Daniel Crowther
{'id': 'https://openalex.org/W2155766136', 'doi': 'https://doi.org/10.1194/jlr.m600185-jlr200', 'title': 'Characterization of the human patatin-like phospholipase family', 'display_name': 'Characterization of the human patatin-like phospholipase family', 'publication_year': 2006, 'publication_date': '2006-06-26', 'ids': {'openalex': 'https://openalex.org/W2155766136', 'doi': 'https://doi.org/10.1194/jlr.m600185-jlr200', 'mag': '2155766136', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/16799181'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1194/jlr.m600185-jlr200', 'pdf_url': 'http://www.jlr.org/article/S0022227520434601/pdf', 'source': {'id': 'https://openalex.org/S11400418', 'display_name': 'Journal of Lipid Research', 'issn_l': '0022-2275', 'issn': ['0022-2275', '1539-7262'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jlr.org/article/S0022227520434601/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5033735039', 'display_name': 'Paul A. Wilson', 'orcid': 'https://orcid.org/0000-0003-4151-1846'}, 'institutions': [{'id': 'https://openalex.org/I188950975', 'display_name': 'GlaxoSmithKline (United Kingdom)', 'ror': 'https://ror.org/01xsqw823', 'country_code': 'GB', 'type': 'company', 'lineage': ['https://openalex.org/I188950975']}], 'countries': ['GB'], 'is_corresponding': True, 'raw_author_name': 'Paul A. Wilson', 'raw_affiliation_strings': ['Bioinformatics Discovery and Analysis, GlaxoSmithKline Research and Development, Stevenage, England SG1 2NY'], 'affiliations': [{'raw_affiliation_string': 'Bioinformatics Discovery and Analysis, GlaxoSmithKline Research and Development, Stevenage, England SG1 2NY', 'institution_ids': ['https://openalex.org/I188950975']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5113438511', 'display_name': 'Scott D. Gardner', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I196272386', 'display_name': 'Providence College', 'ror': 'https://ror.org/00rxpqe74', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I196272386']}, {'id': 'https://openalex.org/I4210114143', 'display_name': 'GlaxoSmithKline (United States)', 'ror': 'https://ror.org/025vn3989', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I188950975', 'https://openalex.org/I4210114143']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Scott D. Gardner', 'raw_affiliation_strings': ['Quantitative Expression, GlaxoSmithKline Research and Development, Upper Providence, Collegeville, PA 19426'], 'affiliations': [{'raw_affiliation_string': 'Quantitative Expression, GlaxoSmithKline Research and Development, Upper Providence, Collegeville, PA 19426', 'institution_ids': ['https://openalex.org/I196272386', 'https://openalex.org/I4210114143']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5085463443', 'display_name': 'Natalie M. Lambie', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I188950975', 'display_name': 'GlaxoSmithKline (United Kingdom)', 'ror': 'https://ror.org/01xsqw823', 'country_code': 'GB', 'type': 'company', 'lineage': ['https://openalex.org/I188950975']}], 'countries': ['GB'], 'is_corresponding': False, 'raw_author_name': 'Natalie M. Lambie', 'raw_affiliation_strings': ['Disease and Biomarker Transcriptomics, GlaxoSmithKline Research and Development, Stevenage, England SG1 2NY'], 'affiliations': [{'raw_affiliation_string': 'Disease and Biomarker Transcriptomics, GlaxoSmithKline Research and Development, Stevenage, England SG1 2NY', 'institution_ids': ['https://openalex.org/I188950975']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5070715742', 'display_name': 'Stéphane Commans', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I4210101023', 'display_name': 'GlaxoSmithKline (France)', 'ror': 'https://ror.org/00z1h3j87', 'country_code': 'FR', 'type': 'company', 'lineage': ['https://openalex.org/I188950975', 'https://openalex.org/I4210101023']}], 'countries': ['FR'], 'is_corresponding': False, 'raw_author_name': 'Stephane A. Commans', 'raw_affiliation_strings': ['Laboratoires GlaxoSmithKline, Centre de Recherches, 91951 Les Ulis, France'], 'affiliations': [{'raw_affiliation_string': 'Laboratoires GlaxoSmithKline, Centre de Recherches, 91951 Les Ulis, France', 'institution_ids': ['https://openalex.org/I4210101023']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5101422256', 'display_name': 'Daniel Crowther', 'orcid': 'https://orcid.org/0000-0002-7945-3330'}, 'institutions': [{'id': 'https://openalex.org/I188950975', 'display_name': 'GlaxoSmithKline (United Kingdom)', 'ror': 'https://ror.org/01xsqw823', 'country_code': 'GB', 'type': 'company', 'lineage': ['https://openalex.org/I188950975']}], 'countries': ['GB'], 'is_corresponding': False, 'raw_author_name': 'Daniel J. Crowther', 'raw_affiliation_strings': ['Bioinformatics Discovery and Analysis, GlaxoSmithKline Research and Development, Stevenage, England SG1 2NY'], 'affiliations': [{'raw_affiliation_string': 'Bioinformatics Discovery and Analysis, GlaxoSmithKline Research and Development, Stevenage, England SG1 2NY', 'institution_ids': ['https://openalex.org/I188950975']}]}], 'institution_assertions': [], 'countries_distinct_count': 3, 'institutions_distinct_count': 4, 'corresponding_author_ids': ['https://openalex.org/A5033735039'], 'corresponding_institution_ids': ['https://openalex.org/I188950975'], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 6.652, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 281, 'citation_normalized_percentile': {'value': 0.937953, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 98, 'max': 99}, 'biblio': {'volume': '47', 'issue': '9', 'first_page': '1940', 'last_page': '1949'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T11844', 'display_name': 'Lipid metabolism and biosynthesis', 'score': 0.9982, 'subfield': {'id': 'https://openalex.org/subfields/1303', 'display_name': 'Biochemistry'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T11844', 'display_name': 'Lipid metabolism and biosynthesis', 'score': 0.9982, 'subfield': {'id': 'https://openalex.org/subfields/1303', 'display_name': 'Biochemistry'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11150', 'display_name': 'Endoplasmic Reticulum Stress and Disease', 'score': 0.9838, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11041', 'display_name': 'Ubiquitin and proteasome pathways', 'score': 0.9776, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [], 'concepts': [{'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.51838785}, {'id': 'https://openalex.org/C12927208', 'wikidata': 'https://www.wikidata.org/wiki/Q210430', 'display_name': 'Phospholipase', 'level': 3, 'score': 0.42518753}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.38856456}, {'id': 'https://openalex.org/C70721500', 'wikidata': 'https://www.wikidata.org/wiki/Q177005', 'display_name': 'Computational biology', 'level': 1, 'score': 0.3254077}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.30045027}, {'id': 'https://openalex.org/C181199279', 'wikidata': 'https://www.wikidata.org/wiki/Q8047', 'display_name': 'Enzyme', 'level': 2, 'score': 0.14916047}], 'mesh': [], 'locations_count': 1, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1194/jlr.m600185-jlr200', 'pdf_url': 'http://www.jlr.org/article/S0022227520434601/pdf', 'source': {'id': 'https://openalex.org/S11400418', 'display_name': 'Journal of Lipid Research', 'issn_l': '0022-2275', 'issn': ['0022-2275', '1539-7262'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1194/jlr.m600185-jlr200', 'pdf_url': 'http://www.jlr.org/article/S0022227520434601/pdf', 'source': {'id': 'https://openalex.org/S11400418', 'display_name': 'Journal of Lipid Research', 'issn_l': '0022-2275', 'issn': ['0022-2275', '1539-7262'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'id': 'https://metadata.un.org/sdg/15', 'score': 0.69, 'display_name': 'Life on land'}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 37, 'referenced_works': ['https://openalex.org/W1827500364', 'https://openalex.org/W1966705420', 'https://openalex.org/W1969290128', 'https://openalex.org/W1976418350', 'https://openalex.org/W1977922844', 'https://openalex.org/W1980783399', 'https://openalex.org/W1981478386', 'https://openalex.org/W1982933066', 'https://openalex.org/W1992218082', 'https://openalex.org/W1996608120', 'https://openalex.org/W1998626477', 'https://openalex.org/W2004228538', 'https://openalex.org/W2006693036', 'https://openalex.org/W2015642465', 'https://openalex.org/W2017650269', 'https://openalex.org/W2027294838', 'https://openalex.org/W2040238011', 'https://openalex.org/W2069404833', 'https://openalex.org/W2074613556', 'https://openalex.org/W2088112537', 'https://openalex.org/W2105170604', 'https://openalex.org/W2106882534', 'https://openalex.org/W2110041134', 'https://openalex.org/W2110839026', 'https://openalex.org/W2114083522', 'https://openalex.org/W2128101553', 'https://openalex.org/W2139582206', 'https://openalex.org/W2141885858', 'https://openalex.org/W2144298599', 'https://openalex.org/W2144615256', 'https://openalex.org/W2149160071', 'https://openalex.org/W2150299268', 'https://openalex.org/W2161746138', 'https://openalex.org/W2171451814', 'https://openalex.org/W4210400672', 'https://openalex.org/W4230640326', 'https://openalex.org/W4248635034'], 'related_works': ['https://openalex.org/W959138513', 'https://openalex.org/W2408898930', 'https://openalex.org/W2087236557', 'https://openalex.org/W2055617588', 'https://openalex.org/W2046880949', 'https://openalex.org/W2005859080', 'https://openalex.org/W1762755856', 'https://openalex.org/W156722983', 'https://openalex.org/W1532774301', 'https://openalex.org/W1138617401'], 'abstract_inverted_index': {'Several': [0, 178], 'publications': [1, 179], 'have': [2, 180, 844], 'described': [3, 50, 181, 228, 1933, 2140, 4003], 'biological': [4, 182, 622], 'roles': [5, 183], 'for': [6, 184, 610, 1270, 1692, 1753, 1767, 1813, 2051, 2102, 2417, 2600, 2705, 2913, 3124, 3730, 3838, 4010], 'human': [7, 28, 46, 120, 166, 185, 206, 224, 298, 344, 1104, 1235, 1364, 1397, 1496, 1528, 1789, 2134, 2170, 2287, 2322, 2388, 2421, 2464, 2566, 2585, 2671, 2690, 2766, 3017, 3067, 3099, 3108, 3141, 3265, 3300, 3475, 3518, 3676, 3833, 3966, 3972, 3989], 'patatin-like': [8, 91, 138, 186, 269, 316, 548, 689, 802, 856, 885, 1137, 1335, 1368, 1520, 1790, 2030, 2300, 2352, 2394, 2422, 2559, 2567, 2605, 2664, 2672, 2710, 2854, 2906, 3301, 3388, 3532, 3677, 3973], 'phospholipases': [9, 187, 446, 488, 1390], '(PNPLAs)': [10, 188], 'in': [11, 61, 99, 148, 164, 189, 239, 277, 326, 342, 368, 371, 428, 453, 495, 618, 651, 699, 773, 828, 878, 892, 904, 932, 961, 1172, 1179, 1246, 1260, 1278, 1337, 1391, 1539, 1565, 1817, 1870, 2074, 2363, 2426, 2433, 2573, 2588, 2646, 2659, 2678, 2693, 2751, 2770, 3129, 3138, 3149, 3165, 3169, 3427, 3461, 3523, 3558, 3589, 3742, 3853, 3864, 3891, 4004], 'the': [12, 21, 45, 72, 90, 109, 154, 158, 173, 190, 199, 223, 250, 268, 287, 332, 336, 351, 529, 562, 567, 641, 798, 855, 872, 875, 905, 1031, 1159, 1274, 1330, 1334, 1346, 1375, 1386, 1403, 1504, 1544, 1547, 1555, 1571, 1641, 1678, 1688, 1719, 1788, 1885, 2044, 2067, 2094, 2200, 2213, 2290, 2364, 2399, 2405, 2411, 2420, 2439, 2449, 2454, 2463, 2565, 2579, 2582, 2589, 2597, 2603, 2608, 2632, 2642, 2650, 2670, 2684, 2687, 2694, 2702, 2708, 2713, 2737, 2747, 2755, 2765, 2788, 2794, 2804, 2810, 2823, 2829, 2853, 2866, 2870, 2874, 2878, 2889, 2894, 2905, 2945, 2948, 2954, 2958, 2967, 2971, 2976, 2983, 3004, 3025, 3054, 3060, 3066, 3088, 3092, 3098, 3107, 3125, 3130, 3146, 3150, 3166, 3170, 3298, 3387, 3400, 3407, 3414, 3428, 3430, 3453, 3462, 3465, 3474, 3507, 3517, 3529, 3535, 3539, 3543, 3561, 3568, 3587, 3598, 3623, 3639, 3646, 3666, 3680, 3686, 3692, 3722, 3775, 3794, 3876, 3885, 3963, 3971, 3982, 3988, 3996], 'regulation': [13, 191], 'of': [14, 26, 32, 71, 89, 96, 112, 118, 157, 192, 204, 210, 249, 267, 274, 290, 296, 335, 443, 485, 523, 566, 621, 638, 640, 655, 824, 874, 907, 952, 997, 1030, 1101, 1134, 1214, 1273, 1310, 1333, 1348, 1356, 1388, 1446, 1493, 1518, 1546, 1590, 1616, 1721, 1787, 1844, 1962, 1982, 2015, 2022, 2043, 2123, 2127, 2165, 2222, 2255, 2286, 2419, 2458, 2462, 2564, 2569, 2572, 2581, 2602, 2641, 2669, 2674, 2677, 2686, 2707, 2746, 2776, 2828, 2852, 2862, 2877, 2896, 2922, 2957, 2982, 3003, 3029, 3059, 3097, 3106, 3177, 3224, 3262, 3345, 3386, 3464, 3471, 3473, 3506, 3510, 3516, 3538, 3586, 3638, 3741, 3801, 3813, 3819, 3827, 3832, 3856, 3887, 3901, 3936, 3970, 3985, 3987, 3998], 'adipocyte': [15, 193, 981, 1251, 1338, 3920], 'differentiation.': [16, 133, 194, 311, 1252], 'Here,': [17, 195], 'we': [18, 196, 3690], 'report': [19, 197, 1186], 'on': [20, 198, 1995], 'characterization': [22, 67, 200, 245, 1961, 2563, 2668], 'and': [23, 39, 79, 161, 201, 217, 257, 339, 397, 508, 559, 613, 658, 695, 758, 896, 964, 993, 1099, 1113, 1142, 1148, 1176, 1210, 1241, 1243, 1255, 1306, 1340, 1361, 1384, 1498, 1511, 1635, 1658, 1687, 1732, 1762, 1770, 1831, 1863, 1872, 1929, 1960, 2010, 2017, 2046, 2049, 2057, 2088, 2195, 2203, 2262, 2264, 2275, 2312, 2355, 2404, 2413, 2436, 2442, 2486, 2508, 2551, 2594, 2610, 2617, 2625, 2635, 2699, 2715, 2722, 2730, 2740, 2803, 2841, 2873, 2933, 2970, 3042, 3091, 3143, 3154, 3220, 3243, 3260, 3274, 3341, 3367, 3375, 3449, 3526, 3534, 3584, 3659, 3713, 3753, 3780, 3796, 3867, 3897, 3932, 3965, 4006], 'expression': [24, 110, 202, 288, 639, 996, 1248, 1373, 1545, 1550, 3817, 3840, 3890, 3935, 3983], 'profiling': [25, 117, 203, 295], '10': [27, 205, 2076, 2387], 'PNPLAs.': [29, 207, 3990], 'A': [30, 84, 208, 262, 447, 489, 687, 1183, 1395, 1809, 3161, 3513], 'variety': [31, 209, 1355, 3740], 'bioinformatics': [33, 211, 1357], 'approaches': [34, 212, 1358], 'were': [35, 213, 1154, 1257, 1503, 1522, 1675, 1706, 1796, 1874, 1932, 2002, 2054, 2098, 2106, 2197, 2209, 2239, 2273, 2396, 2432, 2791, 3477, 3500, 3571, 3595, 3606, 3735, 3978, 4014], 'used': [36, 106, 214, 284, 1380, 1450, 1523, 1750, 1797, 2317, 2654, 2759, 2846, 3022, 3501, 3683, 3979], 'to': [37, 107, 150, 171, 215, 285, 328, 349, 424, 466, 509, 616, 647, 741, 807, 898, 958, 1025, 1064, 1156, 1168, 1181, 1343, 1352, 1359, 1381, 1453, 1483, 1524, 1542, 1622, 1780, 1800, 1859, 2114, 2119, 2212, 2318, 2376, 2448, 2649, 2754, 2763, 2787, 2822, 2847, 2929, 3023, 3064, 3078, 3114, 3397, 3502, 3608, 3622, 3634, 3648, 3665, 3684, 3721, 3759, 3767, 3980, 4022], 'identify': [38, 216, 1360, 3015], 'characterize': [40, 218, 1362, 1385, 3655], 'all': [41, 100, 165, 219, 278, 343, 554, 865, 1363, 1494, 3045, 3139, 3757, 3784, 3839], 'PNPLAs': [42, 220, 3476], 'encoded': [43, 221, 1564, 2391], 'by': [44, 82, 222, 260, 527, 937, 991, 1876, 2012, 2093, 2631, 2736, 2883, 2936, 3314, 3372, 3382, 3435, 3573, 3810, 3930], 'genome.': [47, 225], 'The': [48, 226, 356, 393, 949, 1017, 1162, 1561, 1746, 2041, 2638, 2743, 2782, 2856, 2917, 2941, 3102, 3133, 3174, 3439, 3662, 3816], 'genes': [49, 73, 139, 227, 251, 317, 2256], 'represent': [51, 229], 'a': [52, 57, 94, 119, 168, 230, 235, 272, 297, 346, 360, 404, 409, 426, 547, 619, 652, 821, 847, 859, 883, 984, 1027, 1173, 1354, 1367, 1454, 1471, 1485, 1526, 1583, 1879, 1963, 1996, 2075, 2109, 2120, 2283, 2320, 2326, 2337, 2392, 2660, 2774, 2849, 2998, 3047, 3383, 3410, 3487, 3492, 3497, 3613, 3636, 3675, 3739, 3769, 3811, 3828, 3854, 3923, 4017], 'divergent': [53, 231, 2938], 'family,': [54, 232, 3311], 'most': [55, 233, 2374], 'with': [56, 234, 408, 450, 492, 780, 901, 1144, 1158, 1371, 3070, 3399, 3560, 3597, 3774, 3858], 'highly': [58, 236, 1258, 2937, 2991, 3048], 'conserved': [59, 97, 237, 275, 738, 1061, 3049, 3127, 3511, 3530, 3575, 3614], 'ortholog': [60, 238, 951, 1029, 3033, 3156, 3172], 'several': [62, 125, 240, 303, 2860, 2900, 3574], 'mammalian': [63, 241, 879, 1032, 1392], 'species.': [64, 242], 'In': [65, 243, 2561, 2666, 2961], 'silico': [66, 244, 2562, 2574, 2667, 2679, 3743], 'predicts': [68, 246], 'that': [69, 127, 137, 247, 305, 315, 365, 401, 778, 800, 840, 854, 888, 2370, 2390, 2438, 2784, 2947, 2993, 3019, 3052, 3084, 3297, 3541, 3567, 3652, 3671, 3844], 'two': [70, 248, 1764, 2350, 3368], 'function': [74, 252, 2996, 3658], 'as': [75, 253, 511, 1451, 1751, 1798, 2026, 2139, 2240, 2258, 2629, 2655, 2734, 2760, 2773, 2813, 2931, 2997, 3190, 3312, 3496, 3550, 3904, 4002], 'integral': [76, 254], 'membrane': [77, 255, 471, 759, 781, 2515], 'proteins': [78, 256, 803, 1138, 1276, 1336, 1365, 3673], 'are': [80, 128, 146, 258, 306, 324, 550, 614, 2025, 2373, 2424, 2910, 3180, 3548, 3756], 'regulated': [81, 130, 259, 308], 'cAMP/cGMP.': [83, 261], 'structurally': [85, 263], 'guided': [86, 264], 'protein': [87, 265, 595, 771, 1019, 1428, 1567, 1624, 1694, 1794, 1818, 2540, 2767, 2796, 2825, 2890, 3733, 3782], 'alignment': [88, 266, 1441, 1620, 1725, 1748, 1769, 2293, 2805, 2851, 2858, 2891, 2918, 2942, 3588], 'domain': [92, 270, 549, 857, 1563, 2395, 2451, 2790, 3389, 3432], 'identifies': [93, 271, 775], 'number': [95, 273, 607, 1443, 2122, 2254, 2295, 2800, 3117, 3855], 'residues': [98, 276, 2783, 2876, 2898, 2909, 3540, 3570, 3577, 3579], 'family': [101, 114, 175, 279, 292, 353, 823, 1108, 1216, 1312, 1440, 2541, 2568, 2673, 3226, 3269, 3302, 3347, 3688], 'members.': [102, 280], 'Quantitative': [103, 281, 2061], 'PCR': [104, 282, 2062, 2082, 2090], 'was': [105, 283, 889, 955, 1166, 1265, 1351, 1400, 1449, 1551, 1568, 1607, 1638, 1749, 1990, 2063, 2137, 2186, 2227, 2316, 2807, 2845, 3380, 3395, 3417, 3437, 3443, 3459, 3556, 3565, 3719, 3822, 3847, 3993], 'determine': [108, 286, 1781, 3609, 3981], 'profile': [111, 289, 2407, 3818, 3984], 'each': [113, 291, 1519, 1566, 1987, 1993, 2023, 2052, 2103, 2418, 2601, 2706, 3472, 3554, 3820, 3986, 4011], 'member.': [115, 293], 'Affymetrix-based': [116, 294], 'preadipocyte': [121, 299], 'cell': [122, 132, 300, 310, 1160], 'line': [123, 301], 'identified': [124, 302, 882, 1401, 1875, 2349, 2792, 3075], 'members': [126, 304, 1109, 1786, 3270, 3370], 'differentially': [129, 307], 'during': [131, 309, 967, 1249], 'Cumulative': [134, 312], 'data': [135, 313, 3594, 3837, 3873], 'suggest': [136, 314], 'normally': [140, 318], 'expressed': [141, 319, 1259, 1529, 3848], 'at': [142, 320, 2899, 3617, 3630, 3849], 'very': [143, 321, 3850], 'low': [144, 322, 3851], 'levels': [145, 323, 1282, 3852], 'induced': [147, 325, 966, 990, 3929], 'response': [149, 327, 1180, 1342], 'environmental': [151, 329], 'signals.': [152, 330], 'Given': [153, 331, 1329, 3679], 'observed': [155, 333, 615, 1155, 3599], 'conservation': [156, 334, 2895, 2924], 'patatin': [159, 337, 357, 402, 986, 1439, 1562, 2450, 2789, 2959, 3494, 3668, 3925], 'fold': [160, 338, 1636, 2842, 2930, 3533], 'lipase': [162, 340, 877, 886, 903, 1112, 3055, 3196, 3273, 3903], 'motif': [163, 341, 2401], 'PNPLAs,': [167, 345], 'single': [169, 347, 3761], 'nomenclature': [170, 348, 3718], 'describe': [172, 350, 3685], 'PNPLA': [174, 352, 2292, 2465], 'is': [176, 354, 359, 366, 403, 422, 736, 797, 935, 989, 1059, 2964, 2990, 3136, 3144, 3521, 3620, 3765, 3808, 3928], 'proposed.': [177, 355], 'glycoprotein': [358], 'nonspecific': [361], 'lipid': [362, 405, 530, 690, 1393, 2517], 'acyl': [363, 406, 531, 691], 'hydrolase': [364, 407, 532, 692, 1212, 1308, 3222, 3343], 'found': [367, 957, 1167, 3396], 'high': [369, 2863], 'concentrations': [370, 2042], 'mature': [372], 'potato': [373, 534], 'tubers': [374], '(1Rydel': [375], 'T.J.': [376, 1715], 'Williams': [377], 'J.M.': [378], 'Krieger': [379], 'E.': [380, 974, 2159, 3913], 'Moshiri': [381], 'F.': [382, 926, 1577, 2147], 'Stallings': [383], 'W.C.': [384], 'Brown': [385], 'S.M.': [386], 'Pershing': [387], 'J.C.': [388], 'Purcell': [389], 'J.P.': [390], 'Alibhai': [391], 'M.F.': [392], 'crystal': [394, 3488], 'structure,': [395], 'mutagenesis,': [396], 'activity': [398, 1213, 1309, 3223, 3344], 'studies': [399, 870, 3651], 'reveal': [400], 'Ser-Asp': [410], 'catalytic': [411, 2879, 2984, 3544, 3569], 'dyad..Biochemistry.': [412], '2003;': [413], '42:': [414], '6696-6708Crossref': [415], 'PubMed': [416, 461, 503, 540, 603, 665, 705, 753, 790, 833, 944, 1012, 1076, 1127, 1228, 1324, 1436, 1477, 1600, 1667, 1699, 1741, 1854, 1922, 1971, 2179, 2343, 3238, 3288, 3359, 3951], 'Scopus': [417, 462, 504, 541, 666, 706, 754, 791, 834, 945, 1013, 1077, 1128, 1229, 1325, 1478, 1601, 1631, 1668, 1700, 1742, 1855, 1923, 1972, 2180, 2344, 3239, 3289, 3360, 3952], '(222)': [418], 'Google': [419, 464, 506, 543, 604, 668, 708, 756, 793, 836, 947, 1015, 1079, 1130, 1231, 1327, 1437, 1480, 1603, 1633, 1670, 1702, 1744, 1778, 1829, 1857, 1925, 1974, 2182, 2346, 3241, 3291, 3362, 3954], 'Scholar).': [420, 544, 794, 837, 948, 1016, 1080, 1328, 1604, 1671, 1703, 1745, 1926, 1975, 2183, 2347], 'Patatin': [421], 'reported': [423, 1024, 1132, 1267], 'play': [425], 'role': [427, 873, 1387], 'plant': [429, 454, 496, 514, 3493], 'signaling': [430], '(2Holk': [431, 473], 'A.': [432, 474, 573, 585, 680, 818, 922, 928, 1406, 1418, 1808, 1898, 1906, 2143, 2157], 'Rietz': [433, 475], 'S.': [434, 476, 583, 589, 674, 816, 972, 1416, 1422, 1841, 3911], 'Zahn': [435, 477], 'M.': [436, 478, 587, 628, 632, 684, 920, 1420, 1758, 1908], 'Quader': [437, 479], 'H.': [438, 480, 678, 719, 723, 1042, 1046, 1836], 'Scherer': [439, 481], 'G.F.E.': [440, 482], 'Molecular': [441, 483], 'identification': [442, 484, 1589], 'cytosolic,': [444, 486], 'patatin-related': [445, 487], 'from': [448, 470, 490, 533, 739, 846, 864, 1062, 1402, 1884, 1979, 1986, 2133, 2169, 2289, 2607, 2712, 2836, 3035, 3419, 3445, 3491, 3875, 3995], 'Arabidopsis': [449, 491], 'potential': [451, 493], 'functions': [452, 494], 'signal': [455, 497, 1845, 1864, 2250, 2267, 2621, 2726], 'transduction..Plant': [456, 498], 'Physiol.': [457, 499, 536], '2002;': [458, 500, 1474, 2340], '130:': [459, 501], '90-101Crossref': [460, 502], '(123)': [463, 505], 'Scholar),': [465, 507, 605, 669, 709, 757, 1634, 3363, 3955], 'cleave': [467], 'fatty': [468], 'acids': [469], 'lipids': [472], 'act': [510, 899], 'defense': [512], 'against': [513], 'parasites': [515], '(3Strickland': [516], 'J.A.': [517, 764, 970, 1612, 3909], 'Orr': [518], 'G.L.': [519], 'Walsh': [520], 'T.A.': [521], 'Inhibition': [522], 'Diabrotica': [524], 'larval': [525], 'growth': [526], 'patatin,': [528], 'tubers..Plant': [535], '1995;': [537], '109:': [538], '667-674Crossref': [539], '(82)': [542], 'Proteins': [545], 'encoding': [546, 983, 1366, 3922], 'ubiquitously': [551], 'distributed': [552], 'across': [553, 2260, 2925], 'life': [555], 'forms,': [556], 'including': [557, 624, 2865], 'eukaryotes': [558], 'prokaryotes': [560], '[see': [561], 'species': [563], 'distribution': [564], 'tree': [565, 3416, 3442], 'PFAM': [568, 594, 1404, 1427, 2291, 2365, 2400, 2412, 2609, 2714, 2795], '(protein': [569], 'family)': [570], 'database': [571, 1491, 1533, 1559, 1573, 1882, 1888, 2324, 3008, 3880], '(4Bateman': [572, 1405], 'Coin': [574, 1407], 'L.': [575, 1408], 'Durbin': [576, 1409], 'R.': [577, 725, 727, 729, 910, 918, 1048, 1050, 1052, 1410], 'Finn': [578, 1411], 'R.D.': [579, 1412], 'Hollich': [580, 1413], 'V.': [581, 1414], 'Griffiths-Jones': [582, 1415], 'Khanna': [584, 1417], 'Marshall': [586, 1419], 'Moxon': [588, 1421], 'Sonnhammer': [590, 1423], 'E.L.L.': [591, 1424], 'et': [592, 929, 1082, 1207, 1303, 1425, 1911, 1955, 2162, 3217, 3316, 3338], 'al.The': [593, 1426, 1912], 'families': [596, 1429], 'database..Nucleic': [597, 1430, 1916], 'Acids': [598, 1431, 1736, 1917], 'Res.': [599, 1219, 1315, 1432, 1737, 1918, 2174, 3229, 3350], '2004;': [600, 830, 941, 1004, 1119, 1433, 1851, 2176, 3280, 3943], '32:': [601, 1434], 'D138-D141Crossref': [602, 1435], 'accession': [606], 'PF01734': [608], '(http://www.sanger.ac.uk//cgi-bin/Pfam/getacc?PF01734),': [609], 'further': [611, 1382, 1552, 3736], 'details],': [612], 'participate': [617], 'miscellany': [620], 'roles,': [623], 'sepsis': [625], 'induction': [626], '(5Allewelt': [627], 'Coleman': [629], 'F.T.': [630], 'Grout': [631], 'Priebe': [633], 'G.P.': [634], 'Pier': [635], 'G.B.': [636], 'Acquisition': [637], 'Pseudomonas': [642], 'aeruginosa': [643], 'ExoU': [644], 'cytotoxin': [645], 'leads': [646], 'increased': [648, 3888], 'bacterial': [649, 696, 813], 'virulence': [650], 'murine': [653, 894, 1136, 1250], 'model': [654, 1812, 3515, 3555], 'acute': [656], 'pneumonia': [657], 'systemic': [659], 'spread..Infect.': [660], 'Immun.': [661], '2000;': [662], '68:': [663], '3998-4004Crossref': [664], '(154)': [667], 'host': [670, 697], 'colonization': [671, 698], '(6La': [672], 'Camera': [673], 'Geoffroy': [675], 'P.': [676, 1579, 1892, 1902, 2153], 'Samaha': [677], 'Ndiaye': [679], 'Rahim': [681], 'G.': [682, 914, 916, 924, 1806, 1839, 1910], 'Legrand': [683], 'Heitz': [685], 'T.': [686, 1200, 1296, 3210, 3331], 'pathogen-inducible': [688], 'facilitates': [693], 'fungal': [694], 'Arabidopsis..Plant': [700], 'J.': [701, 717, 1040, 1192, 1194, 1288, 1290, 1575, 1645, 1940, 2149, 2155, 3202, 3204, 3323, 3325], '2005;': [702, 787, 1220, 1316, 1919, 3230, 3351], '44:': [703], '810-825Crossref': [704], '(122)': [707], 'triglyceride': [710, 734, 939, 1000, 1057, 1211, 1281, 1307, 3221, 3342, 3939], 'metabolism': [711], '(7Kurat': [712, 1035], 'C.F.': [713, 1036], 'Natter': [714, 1037], 'K.': [715, 721, 1038, 1044, 1649, 1900], 'Petschnigg': [716, 1039], 'Wolinski': [718, 1041], 'Scheuringer': [720, 1043], 'Scholz': [722, 1045], 'Zimmermann': [724, 1047], 'Leber': [726, 1049], 'Zechner': [728, 1051], 'Kohlwein': [730, 1053], 'S.D.': [731, 766, 1054], 'Obese': [732, 1055], 'yeast:': [733, 1056], 'lipolysis': [735, 1058], 'functionally': [737, 1060], 'mammals': [740, 1063], 'yeast..J.': [742, 1065], 'Biol.': [743, 1002, 1066, 1117, 1663, 1825, 1850, 3278, 3941], 'Chem.': [744, 1003, 1067, 1118, 3279, 3942], '2006;': [745, 1068], '281:': [746, 1069], '491-500Abstract': [747, 1070], 'Full': [748, 750, 1007, 1009, 1071, 1073, 1122, 1124, 1223, 1225, 1319, 1321, 3233, 3235, 3283, 3285, 3354, 3356, 3946, 3948], 'Text': [749, 751, 1008, 1010, 1072, 1074, 1123, 1125, 1224, 1226, 1320, 1322, 3234, 3236, 3284, 3286, 3355, 3357, 3947, 3949], 'PDF': [752, 1011, 1075, 1126, 1227, 1323, 3237, 3287, 3358, 3950], '(246)': [755, 1078], 'trafficking': [760], '(8Shohdy': [761], 'N.': [762, 1683, 1756, 1894, 1944], 'Efe': [763], 'Emr': [765], 'Shuman': [767], 'H.A.': [768], 'Pathogen': [769], 'effector': [770], 'screening': [772], 'yeast': [774, 1018], 'Legionella': [776], 'factors': [777], 'interfere': [779], 'trafficking..Proc.': [782], 'Natl.': [783, 1593], 'Acad.': [784, 1594], 'Sci.': [785, 1473, 1595, 2339], 'USA.': [786, 1596], '102:': [788], '4866-4871Crossref': [789], '(179)': [792], 'Of': [795], 'interest': [796], 'observation': [799, 3379, 3886], 'prokaryotic': [801], 'appear': [804], 'more': [805, 1184, 3788], 'similar': [806, 2897], 'eukaryotic': [808], 'paralogues': [809], 'than': [810, 2452], 'any': [811], 'other': [812, 866, 3604], 'lipases': [814, 1237], '(9Banerji': [815], 'Flieger': [817], 'Patatin-like': [819], 'proteins:': [820], 'new': [822, 2661], 'lipolytic': [825, 867, 2999, 3188], 'enzymes': [826], 'present': [827], 'bacteria?.Microbiology.': [829], '150:': [831], '522-525Crossref': [832], '(96)': [835], 'This': [838, 2348, 3378, 3716, 3842], 'suggests': [839], 'distant': [841], 'homologs': [842], 'may': [843, 3959], 'arisen': [845], 'common': [848], 'ancestor.': [849], 'Together,': [850], 'these': [851, 1389, 1447, 2987, 3672], 'observations': [852, 1377, 3643], 'indicate': [853], 'represents': [858], 'unique': [860, 2299, 3369, 3667], 'superfamily': [861], 'quite': [862], 'distinct': [863], 'families.': [868], 'Recent': [869], 'investigating': [871], 'hormone-sensitive': [876, 902], 'adipose': [880, 933, 938, 2135, 2171], 'tissue': [881, 934, 1988, 2104, 3893, 4012], 'novel': [884, 985, 1103, 3264, 3924], '(TTS-2.2)': [887, 3755], 'significantly': [890], 'upregulated': [891, 960, 1178], 'differentiating': [893, 962], 'adipocytes': [895, 963], 'appeared': [897], 'coordinately': [900], 'catabolism': [906], 'triglycerides': [908], '(10Zimmermann': [909], 'Strauss': [911], 'J.G.': [912], 'Haemmerle': [913], 'Schoiswohl': [915], 'Birner-Gruenberger': [917], 'Riederer': [919], 'Lass': [921], 'Neuberger': [923], 'Eisenhaber': [925], 'Hermetter': [927], 'al.Fat': [930], 'mobilization': [931], 'promoted': [936], 'lipase..Science.': [940], '306:': [942], '1383-1386Crossref': [943], '(1533)': [946], 'rat': [950, 1873, 3036, 3171, 3964], 'this': [953, 1349, 2816, 3178, 3902, 3957], 'gene': [954, 982, 1034, 1164, 1247, 1372, 1497, 1499, 1521, 1791, 3110, 3821, 3907, 3921], 'also': [956, 1266, 2919, 2943, 3145], 'be': [959, 1026, 1169, 1379, 3021, 3079, 3304, 3635, 3645, 3768], 'transiently': [965], 'fasting': [968, 992, 3931], '(11Villena': [969, 3908], 'Roy': [971, 3910], 'Sarkadi-Nagy': [973, 3912], 'Kim': [975, 1193, 1289, 3203, 3324, 3914], 'K.H.': [976, 3915], 'Sul': [977, 3916], 'H.S.': [978, 3917], 'Desnutrin,': [979, 3918], 'an': [980, 1540, 1690, 2819, 2979, 3080, 3121, 3309, 3364, 3504, 3627, 3905, 3919], 'domain-containing': [987, 3926], 'protein,': [988, 3771, 3927], 'glucocorticoids:': [994, 3933], 'ectopic': [995, 3934], 'desnutrin': [998, 3937], 'increases': [999, 3938], 'hydrolysis..J.': [1001, 3940], '279:': [1005, 1120, 3281, 3944], '47066-47075Abstract': [1006, 3945], '(510)': [1014, 3953], 'Tgl4': [1020], 'has': [1021, 3111, 3192], 'since': [1022], 'been': [1023, 3112], 'functional': [1028, 2627, 2732, 3175], 'TTS-2.2': [1033, 1254], 'Jenkins': [1081, 1951], 'al.': [1083, 3317], '(12Jenkins': [1084, 3245], 'C.M.': [1085, 3246], 'Mancuso': [1086, 3247], 'D.J.': [1087, 3248], 'Yan': [1088, 3249], 'W.': [1089, 1204, 1300, 1896, 3214, 3250, 3335], 'Sims': [1090, 3251], 'H.F.': [1091, 3252], 'Gibson': [1092, 1714, 3253], 'B.': [1093, 3254], 'Gross': [1094, 3255], 'R.W.': [1095, 3256], 'Identification,': [1096, 3257], 'cloning,': [1097, 1958, 3258], 'expression,': [1098, 1959, 3259], 'purification': [1100, 3261], 'three': [1102, 1135, 1153, 3263], 'calcium-independent': [1105, 2379, 3266], 'phospholipase': [1106, 2031, 2380, 3267], 'A2': [1107, 3268], 'possessing': [1110, 3271], 'triacylglycerol': [1111, 3272], 'acylglycerol': [1114, 3275], 'transacylase': [1115, 3276], 'activities..J.': [1116, 3277], '48968-48975Abstract': [1121, 3282], '(685)': [1129, 3290], 'Scholar)': [1131, 1232, 1438, 1481, 1779, 1830, 1858, 3242, 3292], 'details': [1133], '[adiponutrin': [1139], '(ADPN),': [1140, 3700], 'TTS-2.2,': [1141, 1239, 2303], 'GS2]': [1143], 'abundant': [1145], 'triacylglyerol': [1146], '(catabolic)': [1147], 'transacylation': [1149, 3244], '(anabolic)': [1150], 'activities.': [1151, 3293], 'All': [1152, 2207, 2386, 3732], 'associate': [1157], 'membrane.': [1161], 'ADPN': [1163, 3624], 'transcript': [1165, 1516, 2323], 'virtually': [1170], 'absent': [1171], 'fasted': [1174], 'state': [1175], 'dramatically': [1177], 'feeding.': [1182], 'recent': [1185], '(13Lake': [1187, 1283, 3197, 3318], 'A.C.': [1188, 1284, 3198, 3319], 'Sun': [1189, 1285, 3199, 3320], 'Y.': [1190, 1286, 3200, 3321], 'Li': [1191, 1197, 1287, 1293, 3201, 3207, 3322, 3328], 'Johnson': [1195, 1291, 3205, 3326], 'J.W.': [1196, 1292, 3206, 3327], 'D.': [1198, 1294, 3208, 3329], 'Revett': [1199, 1295, 3209, 3330], 'Shih': [1201, 1297, 3211, 3332], 'H.H.': [1202, 1298, 3212, 3333], 'Liu': [1203, 1299, 3213, 3334], 'Paulsen': [1205, 1301, 3215, 3336], 'J.E.': [1206, 1302, 3216, 3337], 'al.Expression,': [1208, 1304, 3218, 3339], 'regulation,': [1209, 1305, 3219, 3340], 'adiponutrin': [1215, 1311, 3225, 3346], 'members..J.': [1217, 1313, 3227, 3348], 'Lipid': [1218, 1314, 3228, 3349], '46:': [1221, 1317, 3231, 3352], '2477-2487Abstract': [1222, 1318, 3232, 3353], '(234)': [1230, 1326, 3240, 3361], 'characterized': [1233, 3737, 3809], 'four': [1234, 3307, 3999], 'ADPN-like': [1236, 1275, 2455, 3310, 3401], '(ADPN,': [1238, 2302], 'GS2,': [1240], 'GS2-like)': [1242], 'detailed': [1244, 2425], 'changes': [1245], 'Both': [1253, 2410, 2430, 3793], 'GS2': [1256], 'metabolically': [1261], 'active': [1262], 'tissues.': [1263], 'It': [1264], 'that,': [1268], 'except': [1269], 'ADPN,': [1271], 'overexpression': [1272], 'resulted': [1277, 2769], 'decreased': [1279], 'intracellular': [1280, 2377], 'significant': [1331, 2393, 2626, 2731], 'association': [1332], 'differentiation': [1339, 2164], 'their': [1341], 'metabolic': [1344], 'stimuli,': [1345], 'purpose': [1347], 'investigation': [1350], 'use': [1353], 'domain.': [1369, 2591, 2696, 2907, 2960], 'Combined': [1370], 'data,': [1374], 'collected': [1376], 'will': [1378, 3644, 3653], 'assess': [1383], 'metabolism.': [1394], 'redundant': [1396, 1527], 'sequence': [1398, 1530, 1619, 1724, 1727, 1768, 1915, 2019, 2124, 2315, 2512, 2537, 2587, 2653, 2692, 2758, 2812, 2830, 2950, 3007, 3028, 3051, 3069, 3105, 3433, 3562], 'set': [1399, 2285, 3831, 3882], '(accession': [1442, 2294, 2799, 3116], 'PF01734).': [1444], 'Each': [1445, 2314], 'sequences': [1448, 1501, 1517, 1795, 2288, 2301, 2372, 2389, 2444, 2768, 3018, 3034, 3063, 3157, 3390, 3734, 3783, 3798], 'input': [1452, 1752, 1799, 2780, 3647], 'Position-Specific': [1455], 'Iterated': [1456], 'Basic': [1457], 'Local': [1458], 'Alignment': [1459], 'Search': [1460], 'Tool': [1461], '(PSI-BLAST)': [1462], '(14Koretke': [1463, 2329], 'K.K.': [1464, 2330], 'Russell': [1465, 2331], 'R.B.': [1466, 2332], 'Lupas': [1467, 2333], 'A.N.': [1468, 2334], 'Folds': [1469, 2335], 'without': [1470, 2336], 'fold..Protein': [1472, 2338], '11:': [1475, 2341], '1575-1579Crossref': [1476, 2342], '(21)': [1479, 2345], 'search': [1482, 2319, 2402, 2408], 'query': [1484, 1525, 2797, 3065], 'nonredundant': [1486, 1880, 2284, 2321], '(>94%': [1487], 'identity': [1488], 'between': [1489, 1785, 2779, 3962], 'sequences)': [1490], 'composed': [1492], 'available': [1495, 3140, 3549], 'prediction': [1500, 1637, 1843, 2839, 2843, 3744], '(included': [1502], 'TREMBL,': [1505], 'Swiss-Protein,': [1506], 'GenPept,': [1507], 'ENSEMBL,': [1508], 'GeneSeqP,': [1509], 'PIR,': [1510], 'PDB': [1512], 'databases).': [1513], 'Equivalent': [1514, 3872, 3991], 'full-length': [1515, 2651, 2756, 2824, 3104], 'tag': [1531], '(EST)': [1532], '(GenBank': [1534], 'release': [1535], '151,': [1536], 'December': [1537, 3011], '2005)': [1538, 3012], 'effort': [1541], 'verify': [1543], 'transcripts.': [1548], 'Gene': [1549, 3727], 'verified': [1553, 3823], 'using': [1554, 1570, 1609, 1640, 1654, 1677, 1708, 2004, 2066, 2108, 2188, 2199, 2233, 2277, 2325, 2398, 2793, 2809, 3479, 3738, 3824, 4016], 'GeneLogic': [1556, 3877], 'Genesis': [1557, 3878], 'Enterprise': [1558, 3879], '(http://www.genelogic.com/genomics/genesis.cfm).': [1560], 'delineated': [1569], 'SMART': [1572, 2636, 2741], '(15Schultz': [1574], 'Milpetz': [1576], 'Bork': [1578], 'Ponting': [1580], 'C.P.': [1581], 'SMART,': [1582], 'simple': [1584], 'modular': [1585], 'architecture': [1586], 'research': [1587], 'tool:': [1588], 'signalling': [1591], 'domains..Proc.': [1592], '1998;': [1597, 1826], '95:': [1598], '5857-5864Crossref': [1599], '(3029)': [1602], 'Secondary': [1605], 'structure': [1606, 1626, 2838, 3489], 'predicted': [1608, 2459, 2604, 2620, 2643, 2709, 2725, 2748, 2928, 3032, 3061, 3103, 3607, 3758, 3766], 'JNET': [1610], '(16Cuff': [1611], 'Barton': [1613], 'G.J.': [1614], 'Application': [1615], 'enhanced': [1617], 'multiple': [1618, 1723], 'profiles': [1621, 3969], 'improve': [1623], 'secondary': [1625, 2837], 'prediction..Proteins.': [1627], '1999;': [1628, 1968], '40:': [1629], '502-511Crossref': [1630], '(663)': [1632], 'completed': [1639, 1707, 2138], 'FUGUE': [1642, 2406, 2414, 2611, 2716], 'application': [1643, 1681], '(17Shi': [1644], 'Blundell': [1646], 'T.L.': [1647], 'Mizuguchi': [1648], 'FUGUE:': [1650], 'sequence-structure': [1651], 'homology': [1652, 1673, 2447, 2778, 2786, 3469], 'recognition': [1653], 'environment-specific': [1655], 'substitution': [1656, 3123, 3135, 3179], 'tables': [1657], 'structure-dependent': [1659], 'gap': [1660, 1730], 'penalties..J.': [1661], 'Mol.': [1662, 1824, 1849], '2001;': [1664], '310:': [1665], '243-257Crossref': [1666], '(1085)': [1669], 'Low-resolution': [1672, 3468], 'models': [1674, 3470], 'generated': [1676, 2297, 3478], 'Swiss-PDB': [1679], 'Viewer': [1680], '(18Guex': [1682], 'Peitsch': [1684], 'M.C.': [1685], 'SWISS-MODEL': [1686], 'Swiss-PdbViewer:': [1689], 'environment': [1691], 'comparative': [1693], 'modeling..Electrophoresis.': [1695], '1997;': [1696], '18:': [1697], '2714-2723Crossref': [1698], '(9641)': [1701], 'Sequence': [1704, 2069, 3294], 'alignments': [1705, 2368, 2772], 'ClustalW': [1709], '(19Thompson': [1710], 'J.D.': [1711, 1834], 'Higgins': [1712], 'D.G.': [1713], 'CLUSTAL': [1716], 'W:': [1717], 'improving': [1718], 'sensitivity': [1720], 'progressive': [1722], 'through': [1726], 'weighting,': [1728], 'position-specific': [1729], 'penalties': [1731], 'weight': [1733], 'matrix': [1734], 'choice..Nucleic': [1735], '1994;': [1738], '22:': [1739], '4673-4680Crossref': [1740], '(56002)': [1743], 'resulting': [1747, 2857, 3440], 'PhyloWin': [1754], '(20Galtier': [1755], 'Gouy': [1757], 'Gautier': [1759], 'C.': [1760, 1890, 1942, 2145, 2151, 2161], 'SeaView': [1761], 'Phylo_win,': [1763], 'graphic': [1765], 'tools': [1766], 'molecular': [1771, 1957], 'phylogeny..Comput.': [1772], 'Appl.': [1773], 'Biosci.': [1774], '1996;': [1775], '12:': [1776], '543-548PubMed': [1777], 'putative': [1782, 3299], 'evolutionary': [1783, 3600], 'relationships': [1784, 3601], 'family.': [1792, 3678, 3974], 'Full-length': [1793], 'TMHMM': [1801], '(21Sonnhammer': [1802], 'E.L.': [1803], 'von': [1804, 1837], 'Heijne': [1805, 1838], 'Krogh': [1807], 'hidden': [1810], 'Markov': [1811], 'predicting': [1814], 'transmembrane': [1815, 1861, 2623, 2728, 3762], 'helices': [1816], 'sequences..Proc.': [1819], 'Int.': [1820], 'Conf.': [1821], 'Intell.': [1822], 'Syst.': [1823], '6:': [1827], '175-182PubMed': [1828], 'SignalP': [1832, 1847], '(22Bendtsen': [1833], 'Nielsen': [1835], 'Brunak': [1840], 'Improved': [1842], 'peptides:': [1846], '3.0..J.': [1848], '340:': [1852], '783-795Crossref': [1853], '(5660)': [1856], 'predict': [1860], 'domains': [1862, 2423, 2606, 2711], 'peptide': [1865, 2586, 2652, 2691, 2757], 'sequences,': [1866, 2353], 'respectively.': [1867, 2060, 2613, 2718], 'Putative': [1868], 'orthologs': [1869], 'mouse': [1871, 3038], 'reverse': [1877, 2047], 'BLASTing': [1878], 'nucleotide': [1881, 1887, 1914, 2494, 2522, 3006, 3803], 'derived': [1883, 2835, 3418, 3490, 3691], 'EMBL': [1886, 1913, 3005], '(23Kanz': [1889], 'Aldebert': [1891], 'Althorpe': [1893], 'Baker': [1895], 'Baldwin': [1897], 'Bates': [1899], 'Browne': [1901], 'van': [1903], 'den': [1904], 'Broek': [1905], 'Castro': [1907], 'Cochrane': [1909], '33:': [1920], 'D29-D33Crossref': [1921], '(221)': [1924], 'Tissue': [1927], 'processing': [1928], 'sample': [1930, 1989, 2105, 3830, 4013], 'preparation': [1931], 'previously': [1934, 2141, 3193], '(24Sarau': [1935], 'H.M.': [1936], 'Ames': [1937], 'R.S.': [1938], 'Chambers': [1939], 'Ellis': [1941], 'Elshourbagy': [1943], 'Foley': [1945], 'J.J.': [1946], 'Schmidt': [1947], 'D.B.': [1948], 'Muccitelli': [1949], 'R.M.': [1950], 'O.': [1952], 'Murdock': [1953], 'P.R.': [1954], 'al.Identification,': [1956], 'cysteinyl': [1964], 'leukotriene': [1965], 'receptor..Mol.': [1966], 'Pharmacol.': [1967], '56:': [1969], '657-663Crossref': [1970], '(306)': [1973], 'Briefly,': [1976, 3748], 'cDNA': [1977], 'prepared': [1978, 2210], '0.4': [1980], 'ng': [1981], 'poly(A+)': [1983], 'RNA': [1984, 2185, 2193, 2225, 3992], 'extracted': [1985, 2187, 3874, 3994], 'loaded': [1991], 'into': [1992, 3306], 'well': [1994], '384-well': [1997], 'optical': [1998], 'microplate.': [1999], 'Gene-specific': [2000, 3975], 'primers': [2001, 3977], 'designed': [2003], 'Primer': [2005], 'Express': [2006], 'software': [2007], '(Applied': [2008, 2072, 2086, 2096], 'Biosystems)': [2009, 2073, 2087, 2097], 'confirmed': [2011], 'BLAST': [2013, 2367], 'searches': [2014, 3002], 'public': [2016, 2590, 2695], 'propriety': [2018], 'databases.': [2020], 'Details': [2021], 'primer': [2024, 2048], 'follows': [2027], '(gene': [2028], 'name/forward/reverse/probe):': [2029], '3': [2032, 2593, 2698, 3525], '(PNPLA3)/ADPN/AAATGCCAGTGAGCAGCCAA/TCTCTGCTGGACAGCCCTTG/FAM-CTCCCCATGCACACCTGAGCAGGACT-TAMRA;': [2033], 'PNPLA7/FLJ43070/GCCTCTGTACCTGCCCTGCT/CTGTATGCAGGGCTGCTGGT/FAM-CCCAGAGAACCCTAACACAGCCTGGGG-TAMRA;': [2034], 'PNPLA6/NTE/AGCCACAGATGCCTGAGGAC/GGGCAGGTCAGTCCAGTGTG/FAM-CTCACTCCCCCTCCTGCTGCTATGCCT-TAMRA;': [2035], 'PNPLA9/PLA2G6/ACCGCGAGGAGTTCCAGAAG/AATGGACGAGGTCAGCTGGG/FAM-TCATCCACCTGCTGCTCTCACCCTGAG-TAMRA;': [2036], 'PNPLA8/iPLA2γ/GCTAGACCCTGTTGCCCAGA/GGTTCTTGCAGCAAAGGCAG/FAM-TTGAACCACATCTCACAGCCTCTGTGA-TAMRA;': [2037], 'PNPLA1/GCAGTGGGAGATTGGGCTTT/TGTCCCAACCATGATCCCTG/FAM-AAAATTCCTGCTCTGCCACAGCTCCAC-TAMRA;': [2038], 'PNPLA4/GS2/AACGTGTGGCAATTGTGGGA/CCCTAACTGCACTGGGAGCA/FAM-TTGGCTGTGTCCCCACCCAAATCTCAT-TAMRA;': [2039], 'PNPLA5/GS2-like/GGCGGACTTGTGGTGGATG/GATGGGCCCAAGGAGCTG/FAM-AAACCTCGAGGGCCATGTTCCTCAGC-TAMRA.': [2040], 'forward': [2045], 'probe': [2050], 'assay': [2053], '900,': [2055, 2056], '100': [2058], 'nM,': [2059], 'carried': [2064], 'out': [2065], '7900HT': [2068], 'Detector': [2070], 'System': [2071], 'μl': [2077], 'reaction': [2078], 'volume.': [2079], 'TaqMan': [2080, 2116, 3825, 3976, 4024], 'Universal': [2081], 'Master': [2083], 'Mix': [2084], '2X': [2085], 'universal': [2089], 'conditions': [2091], 'recommended': [2092], 'vendor': [2095], 'used.': [2099], 'Abundance': [2100, 4008], 'values': [2101, 4009], 'calculated': [2107, 4015], 'genomic': [2110, 4018], 'DNA': [2111, 4019], 'standard': [2112, 2234, 4020], 'curve': [2113, 4021], 'convert': [2115, 4023], 'fluorescent': [2117], 'output': [2118], 'known': [2121], 'copies.': [2125], 'Differentiation': [2126], 'multipotent': [2128, 2166], 'adipose-derived': [2129], 'stem': [2130], 'cells,': [2131], 'isolated': [2132], 'tissue,': [2136], '(25Rodriguez': [2142], 'Elabd': [2144], 'Delteil': [2146], 'Astier': [2148], 'Vernochet': [2150], 'Saint-Marc': [2152], 'Guesnet': [2154], 'Guezennec': [2156], 'Amri': [2158], 'Dani': [2160], 'al.Adipocyte': [2163], 'cells': [2167], 'established': [2168], 'tissue..Biochem.': [2172], 'Biophys.': [2173], 'Commun.': [2175], '315:': [2177], '255-263Crossref': [2178], '(255)': [2181], 'Total': [2184], 'Trizol': [2189], '(Invitrogen,': [2190], 'Carlsbad,': [2191], 'CA).': [2192], 'purity': [2194], 'integrity': [2196], 'evaluated': [2198], 'Agilent': [2201], 'Bioanalyzer': [2202], 'Optical': [2204], 'Density': [2205], 'spectrophotometer.': [2206], 'samples': [2208, 2226], 'according': [2211], 'Affymetrix': [2214, 2235], '(Palo': [2215], 'Alto,': [2216], 'CA)': [2217], 'protocol': [2218], '(http://www.affymetrix.com/support/).': [2219], 'Fifteen': [2220], 'micrograms': [2221], 'labeled': [2223], 'copy': [2224, 3861], 'hybridized': [2228], 'onto': [2229], 'U133plus2': [2230], 'microarrays': [2231], '(Affymetrix)': [2232], 'protocols.': [2236], 'Quality-control': [2237], 'parameters': [2238], 'follows:': [2241], 'noise': [2242], '(RawQ)': [2243], '<': [2244, 2251, 2269], '3,': [2245], 'consistent': [2246, 2253, 3694], 'scale': [2247], 'factors,': [2248], 'background': [2249], '50,': [2252], 'called': [2257], '“present”': [2259], 'arrays,': [2261], 'β-actin': [2263], 'GAPDH': [2265], '5′/3′': [2266], 'ratios': [2268], '3.': [2270], 'Signal': [2271, 2475], 'intensities': [2272], 'collated': [2274], 'analyzed': [2276], "Rosetta's": [2278], 'Resolver': [2279], 'Biosoftware': [2280], '(http://www.rosettabio.com/products/resolver/default.htm).': [2281], 'Extracting': [2282], 'PF01734)': [2296], 'eight': [2298], 'Neuropathy': [2304], 'Target': [2305], 'Esterase': [2306], '(NTE),': [2307, 3706, 3750], 'FLJ43070,': [2308], 'IPA2γ,': [2309], 'PNPLA1,': [2310, 3696, 3776], 'PNPLA4,': [2311], 'PNPLA5).': [2313], 'PSI-BLAST-based': [2327], 'algorithm': [2328], 'additional': [2351, 3016], 'XM_066899': [2354], 'Phospholipase': [2356], 'A2,': [2357], 'group': [2358], 'VI': [2359], '(PLA2G6),': [2360, 3712], 'not': [2361, 2384, 2952, 3014, 3073, 3159, 3186, 3404, 3451, 3895], 'included': [2362, 3460], 'alignment.': [2366], 'indicated': [2369, 2437, 3296, 3843], 'both': [2371, 2966, 3087, 3195, 3528, 3656], 'homologous': [2375], 'membrane-associated': [2378], 'A2γ': [2381], '(iPLA2γ)': [2382], '(data': [2383, 3072, 3403, 3894], 'shown).': [2385, 3160, 3405], 'compared': [2397], 'tool': [2403, 2798], 'tool.': [2409], 'similarity': [2415], 'scores': [2416], 'Table': [2427], '1': [2428, 2887], '.': [2429], 'techniques': [2431], 'broad': [2434], 'agreement': [2435], 'NTE,': [2440], 'NTE-like,': [2441], 'iPLA2γ': [2443], 'had': [2445], 'higher': [2446, 3860], 'did': [2453, 3013, 3450], 'subfamily.TABLE': [2456], '1Summary': [2457], 'key': [2460], 'characteristics': [2461, 2885], 'familyGene': [2466], 'NamePeptide': [2467], 'LengthPFAM': [2468], 'E': [2469], 'Value': [2470], '(PF01734)FUGUE': [2471], 'Similarity': [2472], 'Score': [2473], '(hs1oxwa)Predicted': [2474], 'PeptidePredicted': [2476], 'Transmembrane': [2477], 'DomainOther': [2478], 'Predicted': [2479], 'MotifsPNPLA14372.7e-9': [2480], '(5–81)6.91Tyrosine': [2481], 'kinase': [2482, 2489, 2503, 2531, 2555, 3790], 'phosphorylation': [2483, 2490, 2504, 2532, 2556, 3791], 'site': [2484, 2491, 2500, 2505, 2519, 2528, 2533, 2549, 2557], '(29–36': [2485], '169–177)PNPLA87822e-52': [2487], '(445–640)19.56Tyrosine': [2488], '(217–223)PNPLA71,3174.5e-56': [2492], '(928–1,094)16.8713–32Cyclic': [2493], 'binding': [2495, 2523, 3804], 'sites': [2496, 2524], '(145–694)': [2497], 'Glycosaminoglycan': [2498, 2526], 'attachment': [2499, 2511, 2518, 2527, 2536], '(1,027–1,030)': [2501], 'Tyrosine': [2502, 2530], '(1,013–1,020,': [2506], '1,127–1,135,': [2507], '1,181–1,188)': [2509], 'Cell': [2510, 2535], '(658–660)PNPLA25041.8e-25': [2513], '(10–179)13.367–26Prokaryotic': [2514], 'lipoprotein': [2516], '(36–46)PNPLA61,3272.9e-63': [2520], '(933–1,099)17.539–31Cyclic': [2521], '(147–701)': [2525], '(735–738)': [2529], '(403–410)': [2534], '(663–665)': [2538], 'Uncharacterized': [2539], 'UPF0028': [2542], 'signature': [2543, 3056], '(954–986)PNPLA98064.1e-55': [2544], '(481–665)13.34Ankyrin': [2545], 'repeats': [2546], '(151–412)PNPLA54295.7e-13': [2547], '(12–181)16.19Glycosaminoglycan': [2548], '(33–36': [2550], '353–356)PNPLA34813.7e-25': [2552], '(10–179)14.90PNPLA42539.8e-41': [2553], '(6–176)15.73YesTyrosine': [2554], '(246–253)PNPLA,': [2558], 'phospholipase.': [2560, 2665], 'phospholipases.': [2570, 2675], 'Summary': [2571, 2676], 'predictions:': [2575, 2680], 'column': [2576, 2681], '2': [2577, 2682, 3392], 'indicates': [2578, 2683], 'length': [2580, 2685], 'longest': [2583, 2688], 'representative': [2584, 2689, 3514, 3829], 'Columns': [2592, 2614, 2697, 2719], '4': [2595, 2700, 3870], 'list': [2596, 2701], 'scoring': [2598, 2703], 'outputs': [2599, 2704], 'algorithms,': [2612, 2717], '5,': [2615, 2720], '6,': [2616, 2721], '7': [2618, 2723], 'summarize': [2619, 2724], 'peptides,': [2622, 2727], 'domains,': [2624, 2729], 'motifs': [2628, 2644, 2733, 2749], 'determined': [2630, 2735, 2785], 'SignalP,': [2633, 2738], 'TMHMM,': [2634, 2739], 'applications.': [2637, 2742], 'relative': [2639, 2744, 2821], 'positions': [2640, 2745, 2902, 3448, 3605], 'shown': [2645, 2750, 3522], 'parentheses': [2647, 2752], 'refer': [2648, 2753], 'input.': [2656, 2761, 2814], 'Open': [2657], 'table': [2658], 'tab': [2662], 'PNPLA,': [2663], 'Attempts': [2762], 'align': [2764], 'low-quality': [2771], 'result': [2775], 'minimal': [2777], 'sequences.': [2781, 2855, 3467], 'PF01734/patatin': [2801], 'domain),': [2802], 'procedure': [2806], 'repeated': [2808], 'restricted': [2811], 'Although': [2815], 'approach': [2817], 'demonstrated': [2818, 3194], 'improvement': [2820], 'alignment,': [2826, 3563], 'much': [2827], 'remained': [2831], 'poorly': [2832], 'aligned.': [2833], 'Information': [2834], '(JNET)': [2840], '(FUGUE)': [2844], 'generate': [2848], 'manual': [2850], 'highlighted': [2859, 2920], 'regions': [2861, 2927, 3800], 'conservation,': [2864], 'characteristic': [2867, 3637], 'glycine-rich': [2868, 2968, 3089], 'region,': [2869], 'nucleophilic': [2871, 2977], 'elbow,': [2872], 'aspartate-glycine': [2875], 'center.': [2880], 'When': [2881, 3553, 3592], 'shaded': [2882], 'physiochemical': [2884, 2923], '(Fig.': [2886, 3391, 3602, 3869], '),': [2888], 'clearly': [2892], 'illustrated': [2893], 'defined': [2901], 'dispersed': [2903], 'throughout': [2904], 'Such': [2908, 3642], 'obvious': [2911], 'candidates': [2912], 'future': [2914, 3649], 'mutagenesis': [2915, 3650], 'studies.': [2916], 'blocks': [2921], 'those': [2926], 'α-helices': [2932], 'β-sheets': [2934], 'interspersed': [2935], 'loop': [2939], 'regions.': [2940], 'highlights': [2944], 'fact': [2946], 'PNPLA1': [2949, 2994, 3062, 3100, 3109, 3394, 3436, 3458], 'does': [2951, 3185], 'include': [2953], 'N-terminal': [2955, 3026, 3050], 'region': [2956, 2969, 3090, 3812], 'particular,': [2962], 'it': [2963, 2989, 3184, 3564], 'missing': [2965], 'G-X-S-X-G': [2972, 3093], 'motif,': [2973, 3094], 'which': [2974, 3772], 'includes': [2975, 3120], 'serine,': [2978], 'essential': [2980], 'component': [2981], 'dyad.': [2985], 'Without': [2986], 'residues,': [2988], 'unlikely': [2992], 'could': [2995, 3020, 3303], 'enzyme.': [3000], 'Extensive': [3001], '(release': [3009], '85,': [3010], 'extend': [3024], 'coding': [3027], 'PNPLA1.': [3030], 'However,': [3031], '(XP_342106),': [3037], '(XP_484618),': [3039], 'dog': [3040], '(XP_538884),': [3041], 'chimpanzee': [3043], '(XP_527370)': [3044], 'demonstrate': [3046], 'encodes': [3053], 'motifs.': [3057], 'Use': [3058], 'genome': [3068], 'BLASTP': [3071], 'shown)': [3074, 3896], 'what': [3076], 'appears': [3077, 3633], 'additional,': [3081], 'upstream': [3082, 3096], 'exon': [3083], 'would': [3085], 'encode': [3086, 3760, 3785, 3799], 'immediately': [3095], 'locus.': [3101], 'submitted': [3113, 3720], 'GenBank': [3115], 'AM182887).': [3118], 'PNPLA4': [3119, 3191, 3701, 3764], 'alanine': [3122, 3134], 'first': [3126], 'glycine': [3128], 'G-X-G-X-X-G': [3131], 'motif.': [3132], 'seen': [3137], 'transcripts': [3142], 'equivalent': [3147, 3167], 'residue': [3148, 3163, 3422, 3447, 3616, 3629], 'dog,': [3151], 'mouse,': [3152], 'cow,': [3153], 'frog': [3155], '(alignment': [3158], 'serine': [3162], 'occurs': [3164], 'position': [3168, 3618, 3631], 'sequence.': [3173], 'implications': [3176], 'currently': [3181], 'unclear,': [3182], 'but': [3183], 'negate': [3187], 'activity,': [3189], 'comparisons': [3295], 'divided': [3305], 'subfamilies:': [3308], 'proposed': [3313, 3717], 'Lake': [3315], 'NTE-like': [3365, 3640], 'subfamily,': [3366, 3625], 'represented': [3371, 3434, 3674], 'PNPLA9': [3373, 3711, 3807], '(PLA2G6)': [3374], 'PNPLA8': [3376, 3709, 3777], '(iPLA2γ).': [3377], 'reinforced': [3381], 'phylogenetic': [3384, 3441], 'comparison': [3385], ').': [3393, 3871], 'cluster': [3398], 'subfamily': [3402, 3610], 'Because': [3406], 'method': [3408], 'incorporated': [3409], 'global': [3411], 'gap-removal': [3412], 'function,': [3413], 'initial': [3415], 'only': [3420], '72': [3421], 'positions.': [3423], 'To': [3424], 'increase': [3425], 'confidence': [3426], 'analysis,': [3429], 'partial': [3431], 'removed.': [3438], 'constructed': [3444], '144': [3446], 'alter': [3452], 'previous': [3454, 3899], 'relationship': [3455], '(i.e.,': [3456, 3486], 'when': [3457], 'analysis)': [3463], 'remaining': [3466], 'Macromolecular': [3480], 'Structure': [3481], 'Database': [3482], '(MSD)': [3483], 'entry': [3484], '1OXW': [3485], 'isozyme)': [3495], 'template.': [3498], 'These': [3499], 'give': [3503], 'approximation': [3505], 'three-dimensional': [3508], 'organization': [3509], 'residues.': [3512], 'PNPLA3': [3519, 3699, 3845, 3889], '(ADPN)': [3520, 3846], 'Fig.': [3524, 3590], 'illustrates': [3527], 'α/β,': [3531], 'spatial': [3536], 'orientation': [3537], 'compose': [3542], 'dyad': [3545], '(model': [3546], 'coordinates': [3547], 'supplementary': [3551, 3836], 'data).': [3552, 3841], 'examined': [3557], 'conjunction': [3559], 'apparent': [3566], '“framed”': [3572], 'hydrophobic': [3576], '(e.g.,': [3578, 3612], '8,': [3580], '49,': [3581], '109,': [3582], '189,': [3583], '195': [3585], '2).': [3591], 'structural': [3593], 'combined': [3596], '2),': [3603], 'specificity': [3611, 3664], 'leucine': [3615], '9': [3619], 'specific': [3621], 'whereas': [3626, 3806], 'isoleucine': [3628], '46': [3632], 'subfamily).': [3641], 'fully': [3654], 'enzyme': [3657, 3669], 'substrate': [3660], 'recognition.': [3661], 'collective': [3663], 'suggested': [3670], 'numerous': [3681], 'aliases': [3682], 'various': [3687], 'members,': [3689], 'following': [3693], 'nomenclature:': [3695], 'PNPLA2': [3697, 3754], '(TTS2.2),': [3698], '(GS2),': [3702], 'PNPLA5': [3703], '(GS2-like),': [3704], 'PNPLA6': [3705, 3749, 3795], 'PNPLA7': [3707, 3751, 3781, 3797], '(NTE-like),': [3708, 3752], '(iPLA2γ),': [3710, 3778], 'PNPLA10P': [3714], '(pseudogene).': [3715], 'Human': [3723], 'Genome': [3724], 'Organization': [3725], '(HUGO)': [3726], 'Nomenclature': [3728], 'Committee': [3729], 'approval.': [3731], 'algorithms': [3745], '(Table': [3746], '1).': [3747], 'domains.': [3763], 'secreted': [3770], 'along': [3773], 'PNPLA6,': [3779], 'one': [3786], 'or': [3787], 'tyrosine': [3789], 'sites.': [3792], 'cyclic': [3802], 'sites,': [3805], 'ankyrin': [3814], 'repeats.': [3815], 'analysis': [3826], 'tissues': [3834, 3857, 3997], '(see': [3835], 'marginally': [3859], 'numbers': [3862], 'detected': [3863], 'liver,': [3865], 'bone,': [3866], 'macrophages': [3868], '(probe': [3881], '233030_at)': [3883], 'supported': [3884], 'liver': [3892], 'contradict': [3898], 'descriptions': [3900], 'adipocyte-specific': [3906], 'although': [3956], 'discrepancy': [3958], 'reflect': [3960], 'variation': [3961], 'species.Fig.': [3967], '4.Expression': [3968], 'unrelated': [4000], 'donors': [4001], 'Materials': [4005], 'Methods.': [4007], 'fluo': [4025]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2155766136', 'counts_by_year': [{'year': 2024, 'cited_by_count': 4}, {'year': 2023, 'cited_by_count': 12}, {'year': 2022, 'cited_by_count': 16}, {'year': 2021, 'cited_by_count': 14}, {'year': 2020, 'cited_by_count': 21}, {'year': 2019, 'cited_by_count': 12}, {'year': 2018, 'cited_by_count': 11}, {'year': 2017, 'cited_by_count': 18}, {'year': 2016, 'cited_by_count': 16}, {'year': 2015, 'cited_by_count': 17}, {'year': 2014, 'cited_by_count': 15}, {'year': 2013, 'cited_by_count': 22}, {'year': 2012, 'cited_by_count': 27}], 'updated_date': '2024-12-10T04:18:54.246956', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
