Salt-inducible Kinase Regulates Hepatic Lipogenesis by Controlling SREBP-1c Phosphorylation

Name: Work Video:
Duration: 3 min 30 s
Young-Sil Yoon; Woo-Young Seo; Minwoo Lee; Seong‐Tae Kim; Seung‐Hoi Koo
{'id': 'https://openalex.org/W2154406084', 'doi': 'https://doi.org/10.1074/jbc.m900096200', 'title': 'Salt-inducible Kinase Regulates Hepatic Lipogenesis by Controlling SREBP-1c Phosphorylation', 'display_name': 'Salt-inducible Kinase Regulates Hepatic Lipogenesis by Controlling SREBP-1c Phosphorylation', 'publication_year': 2009, 'publication_date': '2009-02-26', 'ids': {'openalex': 'https://openalex.org/W2154406084', 'doi': 'https://doi.org/10.1074/jbc.m900096200', 'mag': '2154406084', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/19244231', 'pmcid': 'https://www.ncbi.nlm.nih.gov/pmc/articles/2667731'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m900096200', 'pdf_url': 'http://www.jbc.org/article/S0021925820398860/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820398860/pdf', 'any_repository_has_fulltext': True}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5071901978', 'display_name': 'Young-Sil Yoon', 'orcid': 'https://orcid.org/0000-0001-5127-4966'}, 'institutions': [{'id': 'https://openalex.org/I848706', 'display_name': 'Sungkyunkwan University', 'ror': 'https://ror.org/04q78tk20', 'country_code': 'KR', 'type': 'education', 'lineage': ['https://openalex.org/I848706']}], 'countries': ['KR'], 'is_corresponding': False, 'raw_author_name': 'Young-Sil Yoon', 'raw_affiliation_strings': ['Department of Molecular Cell Biology, Sungkyunkwan University School of Medicine, 300 Chunchun-dong, Jangan-gu, Suwon, Gyeonggi-do 440-746, Korea'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Cell Biology, Sungkyunkwan University School of Medicine, 300 Chunchun-dong, Jangan-gu, Suwon, Gyeonggi-do 440-746, Korea', 'institution_ids': ['https://openalex.org/I848706']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5077974952', 'display_name': 'Woo-Young Seo', 'orcid': 'https://orcid.org/0000-0003-0852-109X'}, 'institutions': [{'id': 'https://openalex.org/I848706', 'display_name': 'Sungkyunkwan University', 'ror': 'https://ror.org/04q78tk20', 'country_code': 'KR', 'type': 'education', 'lineage': ['https://openalex.org/I848706']}], 'countries': ['KR'], 'is_corresponding': False, 'raw_author_name': 'Woo-Young Seo', 'raw_affiliation_strings': ['Department of Molecular Cell Biology, Sungkyunkwan University School of Medicine, 300 Chunchun-dong, Jangan-gu, Suwon, Gyeonggi-do 440-746, Korea'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Cell Biology, Sungkyunkwan University School of Medicine, 300 Chunchun-dong, Jangan-gu, Suwon, Gyeonggi-do 440-746, Korea', 'institution_ids': ['https://openalex.org/I848706']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5100768026', 'display_name': 'Minwoo Lee', 'orcid': 'https://orcid.org/0000-0002-3369-2790'}, 'institutions': [{'id': 'https://openalex.org/I848706', 'display_name': 'Sungkyunkwan University', 'ror': 'https://ror.org/04q78tk20', 'country_code': 'KR', 'type': 'education', 'lineage': ['https://openalex.org/I848706']}], 'countries': ['KR'], 'is_corresponding': False, 'raw_author_name': 'Min-Woo Lee', 'raw_affiliation_strings': ['Department of Molecular Cell Biology, Sungkyunkwan University School of Medicine, 300 Chunchun-dong, Jangan-gu, Suwon, Gyeonggi-do 440-746, Korea'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Cell Biology, Sungkyunkwan University School of Medicine, 300 Chunchun-dong, Jangan-gu, Suwon, Gyeonggi-do 440-746, Korea', 'institution_ids': ['https://openalex.org/I848706']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5100646692', 'display_name': 'Seong‐Tae Kim', 'orcid': 'https://orcid.org/0000-0001-7436-1405'}, 'institutions': [{'id': 'https://openalex.org/I848706', 'display_name': 'Sungkyunkwan University', 'ror': 'https://ror.org/04q78tk20', 'country_code': 'KR', 'type': 'education', 'lineage': ['https://openalex.org/I848706']}], 'countries': ['KR'], 'is_corresponding': False, 'raw_author_name': 'Seong-Tae Kim', 'raw_affiliation_strings': ['Department of Molecular Cell Biology, Sungkyunkwan University School of Medicine, 300 Chunchun-dong, Jangan-gu, Suwon, Gyeonggi-do 440-746, Korea'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Cell Biology, Sungkyunkwan University School of Medicine, 300 Chunchun-dong, Jangan-gu, Suwon, Gyeonggi-do 440-746, Korea', 'institution_ids': ['https://openalex.org/I848706']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5059299742', 'display_name': 'Seung‐Hoi Koo', 'orcid': 'https://orcid.org/0000-0001-8769-2879'}, 'institutions': [{'id': 'https://openalex.org/I848706', 'display_name': 'Sungkyunkwan University', 'ror': 'https://ror.org/04q78tk20', 'country_code': 'KR', 'type': 'education', 'lineage': ['https://openalex.org/I848706']}], 'countries': ['KR'], 'is_corresponding': True, 'raw_author_name': 'Seung-Hoi Koo', 'raw_affiliation_strings': ['Department of Molecular Cell Biology, Sungkyunkwan University School of Medicine, 300 Chunchun-dong, Jangan-gu, Suwon, Gyeonggi-do 440-746, Korea'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Cell Biology, Sungkyunkwan University School of Medicine, 300 Chunchun-dong, Jangan-gu, Suwon, Gyeonggi-do 440-746, Korea', 'institution_ids': ['https://openalex.org/I848706']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': ['https://openalex.org/A5059299742'], 'corresponding_institution_ids': ['https://openalex.org/I848706'], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 2.435, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 61, 'citation_normalized_percentile': {'value': 0.944383, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 95, 'max': 96}, 'biblio': {'volume': '284', 'issue': '16', 'first_page': '10446', 'last_page': '10452'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T12964', 'display_name': 'Diet, Metabolism, and Disease', 'score': 0.9991, 'subfield': {'id': 'https://openalex.org/subfields/2712', 'display_name': 'Endocrinology, Diabetes and Metabolism'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T12964', 'display_name': 'Diet, Metabolism, and Disease', 'score': 0.9991, 'subfield': {'id': 'https://openalex.org/subfields/2712', 'display_name': 'Endocrinology, Diabetes and Metabolism'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T11339', 'display_name': 'Metabolism, Diabetes, and Cancer', 'score': 0.999, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10351', 'display_name': 'Liver Disease Diagnosis and Treatment', 'score': 0.9989, 'subfield': {'id': 'https://openalex.org/subfields/2713', 'display_name': 'Epidemiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/lipogenesis', 'display_name': 'Lipogenesis', 'score': 0.8790122}], 'concepts': [{'id': 'https://openalex.org/C141359234', 'wikidata': 'https://www.wikidata.org/wiki/Q2734301', 'display_name': 'Lipogenesis', 'level': 3, 'score': 0.8790122}, {'id': 'https://openalex.org/C11960822', 'wikidata': 'https://www.wikidata.org/wiki/Q242736', 'display_name': 'Phosphorylation', 'level': 2, 'score': 0.71898186}, {'id': 'https://openalex.org/C85051948', 'wikidata': 'https://www.wikidata.org/wiki/Q416064', 'display_name': 'Sterol regulatory element-binding protein', 'level': 4, 'score': 0.70008427}, {'id': 'https://openalex.org/C184235292', 'wikidata': 'https://www.wikidata.org/wiki/Q421851', 'display_name': 'Kinase', 'level': 2, 'score': 0.47231743}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.44281885}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.42840737}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.33318913}, {'id': 'https://openalex.org/C126322002', 'wikidata': 'https://www.wikidata.org/wiki/Q11180', 'display_name': 'Internal medicine', 'level': 1, 'score': 0.32740998}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.2952714}, {'id': 'https://openalex.org/C4733338', 'wikidata': 'https://www.wikidata.org/wiki/Q2792936', 'display_name': 'Lipid metabolism', 'level': 2, 'score': 0.29336375}, {'id': 'https://openalex.org/C86339819', 'wikidata': 'https://www.wikidata.org/wiki/Q407384', 'display_name': 'Transcription factor', 'level': 3, 'score': 0.2904694}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.149825}, {'id': 'https://openalex.org/C71924100', 'wikidata': 'https://www.wikidata.org/wiki/Q11190', 'display_name': 'Medicine', 'level': 0, 'score': 0.13024876}], 'mesh': [{'descriptor_ui': 'D015971', 'descriptor_name': 'Gene Expression Regulation, Enzymologic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D050155', 'descriptor_name': 'Lipogenesis', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D008099', 'descriptor_name': 'Liver', 'qualifier_ui': 'Q000201', 'qualifier_name': 'enzymology', 'is_major_topic': True}, {'descriptor_ui': 'D017346', 'descriptor_name': 'Protein-Serine-Threonine Kinases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D051780', 'descriptor_name': 'Sterol Regulatory Element Binding Protein 1', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D055372', 'descriptor_name': 'AMP-Activated Protein Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D055372', 'descriptor_name': 'AMP-Activated Protein Kinases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D000595', 'descriptor_name': 'Amino Acid Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002478', 'descriptor_name': 'Cells, Cultured', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D022781', 'descriptor_name': 'Hepatocytes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D022781', 'descriptor_name': 'Hepatocytes', 'qualifier_ui': 'Q000166', 'qualifier_name': 'cytology', 'is_major_topic': False}, {'descriptor_ui': 'D022781', 'descriptor_name': 'Hepatocytes', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D050155', 'descriptor_name': 'Lipogenesis', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008099', 'descriptor_name': 'Liver', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051379', 'descriptor_name': 'Mice', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D046228', 'descriptor_name': 'Microarray Analysis', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008969', 'descriptor_name': 'Molecular Sequence Data', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010766', 'descriptor_name': 'Phosphorylation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017346', 'descriptor_name': 'Protein-Serine-Threonine Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017346', 'descriptor_name': 'Protein-Serine-Threonine Kinases', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D051381', 'descriptor_name': 'Rats', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017207', 'descriptor_name': 'Rats, Sprague-Dawley', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016415', 'descriptor_name': 'Sequence Alignment', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051780', 'descriptor_name': 'Sterol Regulatory Element Binding Protein 1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051780', 'descriptor_name': 'Sterol Regulatory Element Binding Protein 1', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}], 'locations_count': 4, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m900096200', 'pdf_url': 'http://www.jbc.org/article/S0021925820398860/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': True, 'landing_page_url': 'https://europepmc.org/articles/pmc2667731', 'pdf_url': 'https://europepmc.org/articles/pmc2667731?pdf=render', 'source': {'id': 'https://openalex.org/S4306400806', 'display_name': 'Europe PMC (PubMed Central)', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1303153112', 'host_organization_name': 'European Bioinformatics Institute', 'host_organization_lineage': ['https://openalex.org/I1303153112'], 'host_organization_lineage_names': ['European Bioinformatics Institute'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': True, 'landing_page_url': 'https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2667731', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S2764455111', 'display_name': 'PubMed Central', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/19244231', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m900096200', 'pdf_url': 'http://www.jbc.org/article/S0021925820398860/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'display_name': 'Affordable and clean energy', 'score': 0.83, 'id': 'https://metadata.un.org/sdg/7'}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 45, 'referenced_works': ['https://openalex.org/W1494992303', 'https://openalex.org/W1541902039', 'https://openalex.org/W1570718731', 'https://openalex.org/W1603786143', 'https://openalex.org/W1763120049', 'https://openalex.org/W1769885077', 'https://openalex.org/W1862601716', 'https://openalex.org/W1890325716', 'https://openalex.org/W1932186111', 'https://openalex.org/W1944329969', 'https://openalex.org/W1968872717', 'https://openalex.org/W1970205234', 'https://openalex.org/W1972709924', 'https://openalex.org/W1974747471', 'https://openalex.org/W1976903510', 'https://openalex.org/W1979270142', 'https://openalex.org/W1989133036', 'https://openalex.org/W1992860556', 'https://openalex.org/W2006256602', 'https://openalex.org/W2009046935', 'https://openalex.org/W2009094549', 'https://openalex.org/W2017895218', 'https://openalex.org/W2034046497', 'https://openalex.org/W2040109162', 'https://openalex.org/W2056728315', 'https://openalex.org/W2076418082', 'https://openalex.org/W2077971415', 'https://openalex.org/W2080082392', 'https://openalex.org/W2082493662', 'https://openalex.org/W2086024671', 'https://openalex.org/W2089086088', 'https://openalex.org/W2097632838', 'https://openalex.org/W2110967191', 'https://openalex.org/W2111137336', 'https://openalex.org/W2112668580', 'https://openalex.org/W2121048884', 'https://openalex.org/W2129747400', 'https://openalex.org/W2136980094', 'https://openalex.org/W2138226825', 'https://openalex.org/W2146544786', 'https://openalex.org/W2157371286', 'https://openalex.org/W2158465207', 'https://openalex.org/W2168526937', 'https://openalex.org/W2171142773', 'https://openalex.org/W2177231190'], 'related_works': ['https://openalex.org/W4229051507', 'https://openalex.org/W3166656728', 'https://openalex.org/W3115787002', 'https://openalex.org/W2750955292', 'https://openalex.org/W2283164498', 'https://openalex.org/W2133767155', 'https://openalex.org/W2132483253', 'https://openalex.org/W2090350705', 'https://openalex.org/W1984988808', 'https://openalex.org/W111788607'], 'abstract_inverted_index': {'Liver': [0, 248], 'plays': [1, 249], 'a': [2, 19, 31, 43, 149, 250, 267, 279, 291, 397, 500, 547, 730, 733, 951, 1009, 1025, 1167, 1263, 1571, 1608, 1617, 2064, 2352, 2615, 2618, 2695, 2814, 2907, 3074, 3087, 3093, 3347, 3400, 3411, 3449, 3547, 3717, 4103, 4325, 4447, 4515, 4963, 5105], 'major': [3, 251, 1618, 2619, 3275, 3304, 3401, 3525, 4165], 'role': [4, 252, 4917], 'in': [5, 9, 28, 63, 105, 160, 168, 210, 253, 257, 276, 311, 353, 408, 416, 458, 650, 719, 772, 790, 968, 1030, 1052, 1056, 1146, 1250, 1260, 1269, 1378, 1484, 1613, 1632, 1641, 1655, 1715, 2106, 2399, 2510, 2516, 2533, 2571, 2645, 2690, 2711, 2743, 2745, 2813, 2821, 2839, 2863, 2874, 2882, 2906, 2949, 2991, 3023, 3182, 3230, 3354, 3431, 3477, 3482, 3553, 3570, 3627, 3678, 3694, 3722, 3726, 3778, 3783, 3797, 3802, 3875, 3896, 3958, 4100, 4110, 4170, 4256, 4264, 4290, 4356, 4361, 4375, 4391, 4450, 4503, 4544, 4594, 4605, 4645, 4663, 4680, 4741, 4788, 4806, 4817, 4845, 4854, 4898, 4903, 4906, 4945, 5008, 5016, 5112, 5120], 'regulating': [6, 254, 504, 4785], 'energy': [7, 24, 255, 272, 505, 4811], 'homeostasis': [8, 256, 973, 4169], 'mammals.': [10, 258], 'During': [11, 259], 'feeding': [12, 260, 569, 1144], 'conditions,': [13, 261], 'excessive': [14, 262], 'glucose': [15, 263, 514, 527, 541, 3832, 4012, 4063], 'is': [16, 42, 119, 145, 202, 264, 290, 367, 393, 450, 499, 531, 542, 571, 643, 653, 679, 693, 722, 950, 1005, 1046, 1137, 1164, 1176, 1248, 1267, 1334, 1371, 1461, 1604, 2632, 2687, 3002, 3092, 3098, 3104, 3260, 3272, 3373, 3383, 3502, 3564, 3656, 3903, 3924, 3949, 3962, 3987, 4151, 4248, 4309, 4316, 4336, 4353, 4370, 4622, 4675, 4943, 4959], 'converted': [17, 265, 543], 'into': [18, 266, 533, 544, 2461, 3819], 'preferred': [20, 268], 'storage': [21, 269], 'form': [22, 270, 1011], 'of': [23, 52, 79, 90, 95, 103, 112, 124, 130, 139, 156, 192, 199, 208, 217, 228, 231, 245, 271, 300, 327, 338, 343, 351, 360, 372, 378, 387, 404, 440, 447, 456, 465, 476, 479, 493, 513, 526, 566, 576, 589, 659, 675, 689, 717, 740, 786, 953, 971, 1037, 1182, 1240, 1257, 1271, 1368, 1384, 1392, 1395, 1459, 1573, 1583, 1592, 1599, 1616, 1630, 1649, 1658, 1670, 1709, 1769, 1774, 1780, 1916, 1920, 1979, 2098, 2104, 2109, 2143, 2191, 2233, 2241, 2254, 2345, 2392, 2406, 2413, 2418, 2464, 2478, 2591, 2613, 2697, 2714, 2754, 2829, 2856, 2861, 2870, 2978, 2998, 3013, 3061, 3138, 3142, 3253, 3274, 3281, 3296, 3322, 3325, 3397, 3406, 3460, 3465, 3490, 3516, 3523, 3528, 3557, 3595, 3625, 3638, 3644, 3661, 3666, 3687, 3707, 3763, 3774, 3792, 3823, 3827, 3900, 3909, 3915, 3945, 3967, 3984, 3993, 3998, 4017, 4052, 4059, 4114, 4147, 4155, 4261, 4282, 4322, 4327, 4342, 4359, 4379, 4400, 4406, 4431, 4438, 4465, 4470, 4478, 4493, 4506, 4547, 4577, 4582, 4588, 4597, 4608, 4648, 4652, 4688, 4703, 4716, 4728, 4749, 4765, 4779, 4794, 4797, 4804, 4809, 4837, 4841, 4850, 4918, 4948, 5006, 5108, 5123, 5131, 5159, 5165, 5172, 5190, 5200], 'sources': [25, 273], 'as': [26, 56, 99, 274, 304, 347, 645, 663, 1008, 1166, 1184, 1186, 1244, 1680, 1881, 1942, 1983, 2285, 2358, 2426, 2520, 2536, 2575, 2910, 3418, 3834, 4268, 4285, 4644, 4962], 'triacylglycerol': [27, 174, 275, 422], 'liver': [29, 106, 220, 277, 354, 468, 498, 519, 773, 938, 1332, 1793, 2042, 2185, 2214, 2485, 4257, 4856, 4957, 5019, 5133], 'via': [30, 126, 225, 278, 374, 473, 546, 573, 1034, 2411, 3521, 3990, 4014, 4428, 4614, 5156, 5175], 'collective': [32, 280, 548], 'metabolic': [33, 281, 549, 1341, 2755, 4894, 4971], 'pathway': [34, 65, 282, 313, 550, 721, 4266, 4613, 5178], 'termed': [35, 283, 551], 'lipogenesis.': [36, 284, 1174, 1581, 3663, 4599], 'Sterol': [37, 285, 895], 'regulatory': [38, 151, 286, 399, 641, 896, 906, 1021, 1619, 2699, 3305, 3451, 4297, 4401, 4552], 'element-binding': [39, 287, 897, 907], 'protein': [40, 288, 898, 911, 1467, 1472, 1980, 2092, 2100, 3947, 4455, 4555], '1c': [41, 289], 'master': [44, 292, 1168, 5106], 'regulator': [45, 293, 1170, 2621, 5107], 'for': [46, 136, 153, 214, 242, 294, 384, 401, 462, 490, 503, 732, 782, 1171, 1178, 1611, 1720, 1729, 1783, 1871, 2132, 2330, 2623, 2980, 3278, 3307, 3334, 3403, 3470, 3808, 4090, 4167, 4299, 4403, 4585, 4762, 4784, 5209, 5215], 'this': [47, 64, 295, 312, 720, 1369, 2624, 3600, 4494, 5124], 'process': [48, 213, 296, 461, 1136], 'by': [49, 85, 116, 159, 180, 190, 234, 297, 333, 364, 407, 428, 438, 482, 655, 682, 695, 725, 736, 1048, 1466, 1903, 1913, 2027, 2053, 2060, 2140, 2152, 2164, 2188, 2326, 2397, 2471, 2531, 2585, 2635, 2674, 2707, 2720, 2757, 2879, 2946, 2987, 3005, 3020, 3170, 3255, 3365, 3387, 3504, 3509, 3536, 3567, 3585, 3716, 3758, 3907, 3952, 4258, 4312, 4319, 4344, 4409, 4412, 4467, 4497, 4517, 4554, 4700, 4819, 5126, 5147], 'activating': [50, 298], 'number': [51, 299], 'enzyme': [53, 301, 583, 2056, 2704], 'genes,': [54, 97, 302, 345, 661, 1242], 'such': [55, 98, 246, 303, 346, 494, 662, 690, 1243, 2519, 2574, 2592, 3417, 4267, 4284, 5186], 'Fasn': [57, 114, 305, 362, 664, 1245, 1877, 2332, 2778, 2862, 2896, 2981, 3014, 3348, 3361, 3493, 3499, 3562, 3608, 3675, 3691, 3714, 4694], 'or': [58, 306, 668, 699, 1246, 1470, 1733, 1792, 1817, 2041, 2493, 2503, 2626, 2649, 2678, 2760, 2833, 2849, 2891, 2982, 3069, 3201, 3218, 3367, 3436, 3497, 3621, 3702, 3782, 3813, 3922, 4096, 4254, 4288, 4558, 4690, 4738, 4847, 4975], 'Acaca,': [59, 307, 1247, 2577, 4287], 'that': [60, 73, 196, 308, 321, 444, 553, 965, 1012, 1569, 1646, 2404, 2468, 2604, 2736, 2867, 2899, 2973, 3028, 3072, 3157, 3235, 3267, 3299, 3393, 3443, 3513, 3574, 3634, 3889, 3981, 4105, 4144, 4154, 4350, 4382, 4414, 4563, 4708, 4776, 4940, 4967, 5170], 'are': [61, 185, 309, 433, 515, 777, 966, 2469, 2529, 2583, 2594, 2651, 2718, 2984, 3017, 3073, 3158, 4163, 4564, 4697], 'involved': [62, 310, 967, 2570, 2644, 4109, 4263, 4374, 4543, 5119], 'at': [66, 121, 314, 369, 581, 586, 2129, 2223, 2387, 3052, 3149, 3206, 3214, 3221, 3245, 3286, 3577, 4339], 'the': [67, 74, 82, 113, 122, 141, 206, 215, 226, 243, 315, 322, 330, 361, 370, 389, 454, 463, 474, 491, 508, 518, 521, 524, 536, 574, 582, 587, 656, 764, 783, 954, 1014, 1031, 1035, 1042, 1053, 1059, 1149, 1161, 1172, 1179, 1382, 1390, 1457, 1475, 1574, 1596, 1628, 1656, 1804, 1824, 1914, 2047, 2141, 2189, 2239, 2242, 2245, 2321, 2414, 2462, 2497, 2517, 2572, 2646, 2840, 2868, 3057, 3062, 3251, 3268, 3300, 3320, 3424, 3458, 3533, 3561, 3575, 3582, 3589, 3607, 3619, 3622, 3635, 3713, 3760, 3766, 3770, 3779, 3793, 3820, 3991, 4015, 4050, 4111, 4164, 4265, 4291, 4332, 4340, 4357, 4376, 4429, 4504, 4545, 4551, 4568, 4586, 4595, 4606, 4646, 4672, 4681, 4685, 4733, 4759, 4763, 4770, 4777, 4792, 4807, 4834, 4855, 4904, 4907, 4915, 4946, 5009, 5121, 5129, 5144, 5157, 5176, 5198], 'transcriptional': [68, 316, 704, 784, 1169, 1180, 2620, 3543, 4112, 4377, 4615], 'level.': [69, 317], 'Here': [70, 318, 1566, 4395], 'we': [71, 319, 1567, 2401, 2474, 2842, 2968, 3179, 3330, 3467, 3545, 3785, 4396, 4924, 5139], 'show': [72, 320, 1568, 2972, 4303], 'salt-inducible': [75, 323, 945], 'kinase': [76, 162, 324, 410, 1468, 2110, 2136, 3184, 3232, 4440, 4456, 4534, 4537, 4556, 4782], '(SIK)': [77, 325], 'family': [78, 326, 1159, 4245], 'proteins': [80, 236, 328, 484, 2171, 3066, 3195, 4508], 'regulates': [81, 329, 1578], 'hepatic': [83, 93, 173, 200, 331, 341, 421, 448, 1173, 1398, 1580, 1590, 1638, 1659, 2255, 2409, 2751, 2950, 3044, 3662, 3799, 3876, 3894, 3959, 3985, 4060, 4088, 4158, 4598, 4609, 4720, 4786, 4810, 4930, 5153, 5202], 'lipogenesis': [84, 201, 224, 332, 449, 472, 552, 567, 741, 1377, 3517, 3895, 3986, 4150, 4787], 'modulating': [86, 334], 'SREBP-1c': [87, 157, 209, 232, 335, 405, 457, 480, 1162, 1183, 1252, 1272, 1396, 1460, 1600, 1603, 1626, 1633, 1650, 2622, 2939, 3034, 3051, 3143, 3254, 3282, 3312, 3326, 3398, 3529, 3542, 3645, 3655, 3764, 3777, 3818, 4106, 4148, 4278, 4335, 4444, 4479, 4626, 4704, 4717, 5114, 5173], 'activity.': [88, 336, 4445, 4549], 'Overexpression': [89, 337, 1582], 'SIK1': [91, 104, 182, 339, 352, 430, 1584, 1593, 1612, 1631, 2534, 2586, 2601, 2605, 2676, 2758, 2765, 2857, 2871, 2880, 3006, 3021, 3029, 3236, 3256, 3357, 3388, 3568, 3586, 3612, 3615, 3688, 3811, 3814, 3828, 3901, 3937, 3970, 4085, 4737, 4935, 4942], 'inhibits': [92, 340, 2408], 'expression': [94, 179, 184, 342, 427, 432, 591, 678, 692, 1598, 1636, 1781, 2405, 2589, 2686, 2706, 2712, 2742, 2752, 2838, 2881, 2905, 2940, 3007, 3035, 3332, 3440, 3501, 3506, 3677, 3882, 3914, 4004, 4009, 4051, 4260, 4308, 4752, 4849, 4933, 5005], 'lipogenic': [96, 177, 344, 425, 660, 676, 788, 1241, 1385, 1586, 2609, 2640, 2716, 2740, 2836, 2903, 3045, 3407, 3794, 3880, 4631, 4750, 4931], 'Fasn,': [100, 348, 2576, 3916, 4286], 'whereas': [101, 349, 1255, 1589, 2588, 4277], 'knockdown': [102, 350, 1591, 2761, 2834, 4740, 4936], 'greatly': [107, 355, 3829, 4005], 'enhances': [108, 356], 'their': [109, 357], 'expression.': [110, 358, 2085, 3047, 3370, 3389, 4161, 4954], 'Regulation': [111, 359], 'gene': [115, 178, 363, 426, 590, 677, 691, 1587, 1635, 2610, 2616, 2705, 2741, 2837, 2904, 3046, 3408, 3500, 3676, 3715, 3795, 3881, 4008, 4160, 4751, 4932, 4953], 'SIK': [117, 235, 365, 483, 2398, 2472, 2636, 2737, 2817, 2831, 2900, 2989, 3048, 3065, 3171, 3308, 3667, 3753, 3775, 3891, 4003, 4410, 4498, 4824, 5149, 5177, 5191], 'kinases': [118, 366, 1473, 3172, 4584, 4710, 4767, 5150], 'mediated': [120, 204, 368, 452], 'level': [123, 371, 588, 4013, 4341], 'transcription': [125, 373, 658, 962, 1016, 1044, 1386, 2421, 4281, 4343, 4367], 'phosphorylation': [127, 207, 375, 455, 2412, 3252, 3280, 3295, 3522, 3540, 3576, 3636, 3992, 4019, 4430, 4469, 4651, 5158], 'and': [128, 164, 176, 376, 412, 424, 559, 562, 585, 685, 769, 1019, 1039, 1397, 1637, 1758, 1777, 1790, 1833, 1876, 1925, 1990, 2069, 2101, 2156, 2174, 2221, 2236, 2272, 2496, 2525, 2578, 2670, 2727, 2729, 3079, 3102, 3155, 3163, 3166, 3176, 3209, 3248, 3340, 3342, 3379, 3421, 3473, 3475, 3486, 3642, 3671, 3879, 3956, 3969, 3975, 4010, 4149, 4157, 4275, 4519, 4571, 4875, 5162, 5212], 'inactivation': [129, 377], 'nuclear': [131, 379, 916], 'SREBP-1c.': [132, 229, 380, 477, 3596, 3912, 3999, 4432, 5166], 'Among': [133, 381, 1158, 4244], 'candidate': [134, 382], 'sites': [135, 383, 3277, 3302], 'SIK-dependent': [137, 197, 385, 445, 3264, 3316, 3514], 'regulation': [138, 198, 244, 386, 446, 492, 1394, 1648, 3405, 3515, 3660, 3983, 4016, 4146, 4505, 4587, 4596, 4607, 4796, 4808, 4947], 'SREBP-1c,': [140, 194, 388, 442, 1388, 3466, 4380, 4664], 'serine': [142, 390, 1621, 2415, 3068, 3147, 3215, 3224, 3269, 3289, 3323, 3395, 3415, 3419, 3463, 3526, 3539, 3579, 3994, 4471, 4476, 4649, 4665, 4669, 5160, 5163], '329': [143, 391, 1622, 3156, 3216, 3270, 3396, 3643, 3995, 5161], 'residue': [144, 392, 2417, 3271], 'shown': [146, 394, 778, 1139, 1335, 1462, 1605, 2403, 2509, 2596, 2888, 2942, 3353, 3481, 3552, 4371, 4459, 4540, 4619, 4676, 4725, 5012], 'to': [147, 187, 395, 435, 517, 779, 1058, 1140, 1156, 1262, 1336, 1381, 1463, 1481, 1595, 1606, 1623, 1803, 1907, 2082, 2158, 2597, 2638, 2943, 2971, 3042, 3263, 3315, 3376, 3658, 3787, 4250, 4372, 4442, 4460, 4475, 4514, 4541, 4567, 4624, 4628, 4677, 4718, 4768, 4891, 4913, 4927, 4969, 5013, 5117, 5128, 5142, 5184, 5196], 'be': [148, 396, 780, 1141, 1337, 1464, 1482, 1607, 1653, 2598, 2877, 2944, 3168, 3519, 4108, 4373, 4388, 4501, 4542, 4678, 4758, 4814, 5014, 5118, 5180, 5194], 'critical': [150, 398, 1654, 4502, 4679, 4944, 4964], 'site': [152, 400, 1620, 4495], 'SIK-mediated': [154, 402, 3279, 3294, 3328, 3404, 3538, 3659, 3790, 3943, 3982, 4057, 4145, 4682], 'repression': [155, 403, 705, 3791, 4058], 'activity': [158, 233, 406, 481, 584, 1458, 1651, 2948, 3001, 3016, 3041, 3363, 3496, 3693, 4352, 4696, 5174, 5192], 'vitro': [161, 409, 3183, 3231], 'assay': [163, 411, 2263, 3185, 3233, 3684, 3721], 'reverse': [165, 413, 2722], 'transcription-PCR': [166, 414, 2723], 'analysis': [167, 415, 1975, 2480, 2732, 2749], 'primary': [169, 417, 501, 1673, 2039, 2281, 2844, 2864, 2883, 2992, 3478, 3571, 3628, 3680, 3696, 3723, 4742], 'hepatocytes.': [170, 418, 3479, 3681, 3724], 'Finally,': [171, 419], 'reduced': [172, 420, 3004, 3019], 'levels': [175, 189, 423, 437, 512, 1640, 2590, 2713, 2860, 3801, 3878, 3948, 3961, 4064, 4321, 5155], 'adenoviral': [181, 429, 1710, 2854, 2872, 2988], 'transgenic': [183, 431, 1253, 4848], 'restored': [186, 434, 3951, 3964], 'normal': [188, 436], 'co-infection': [191, 439, 3908], 'mutant': [193, 441, 1819, 3259, 3381, 3603, 3654, 3673, 3703, 3817, 3911, 4054], 'suggesting': [195, 443, 729, 2603, 2898, 3027, 3266, 3298, 3442, 3573, 3633, 4381, 4707, 4939], 'indeed': [203, 451, 3238, 3394, 3447, 3890, 3988, 4815, 4941], 'through': [205, 453, 520], 'vivo.': [211, 459, 3803, 3897], 'The': [212, 460, 496, 564, 639, 673, 1366, 2135, 2226, 2343, 3898, 4296, 4580], 'development': [216, 464, 1367, 5122, 5199], 'nonalcoholic': [218, 466, 1330, 4976, 5017], 'fatty': [219, 467, 556, 727, 1331, 1399, 4292, 4421, 4610, 4721, 4950, 4956, 5018, 5109, 5132], 'involves': [221, 469], 'de': [222, 470, 1375, 5000], 'novo': [223, 471, 1376, 5001], 'activation': [227, 475, 575, 785, 1181, 4378, 4836, 5189], 'Modulation': [230, 478], 'would': [237, 485, 1652, 4590, 4711, 4774, 4889], 'provide': [238, 486], 'an': [239, 487, 646, 1721, 2260, 2744, 3181, 5181], 'attractive': [240, 488, 5182], 'means': [241, 489], 'diseases.': [247, 495, 5203], 'mammalian': [497], 'organ': [502], 'homeostasis.': [506, 1661, 4799], 'After': [507, 1706, 2238], 'food': [509, 775], 'intake,': [510], 'high': [511, 1264], 'transported': [516], 'bloodstream.': [522], 'Initially,': [523], 'remnant': [525], 'not': [528, 1153, 3031, 3508, 3617, 3631, 3838, 4079, 4310, 4387, 4500, 4618, 4745, 4754, 4896], 'utilized': [529], 'immediately': [530], 'metabolized': [532], 'glycogen.': [534], 'For': [535], 'longer': [537], 'term': [538], 'storage,': [539], 'excess': [540], 'triglycerides': [545], 'includes': [554], 'glycolysis,': [555], 'acid': [557, 666, 1400, 3140, 3151, 4293, 4422, 4611, 4722, 4951, 5110], 'biosynthesis,': [558], 'triglyceride': [560, 1639], 'synthesis': [561, 1401], 'maturation.': [563], 'control': [565, 674, 2502, 2851, 3886, 4076], 'during': [568, 1143], 'conditions': [570, 1062, 1145], 'achieved': [572, 654, 694, 3520], 'key': [577], 'rate-limiting': [578], 'enzymes': [579], 'both': [580], '(1Towle': [592], 'H.C.': [593], 'Kaytor': [594], 'E.N.': [595], 'Shih': [596], 'H.M.': [597], 'Annu.': [598, 621, 756], 'Rev.': [599, 622, 757], 'Nutr...': [600, 623, 747, 758, 859], '1997;': [601, 624, 1292], '17:': [602, 625], '405-433Google': [603], 'Scholar,': [604, 614, 751, 804, 817, 832, 851, 863, 986, 1081, 1097, 1208, 1295, 1354, 1433, 1520, 4190, 4206, 4987, 5053, 5075], '2Vaulont': [605], 'S.': [606, 819, 844, 1076, 1203, 1319, 1439, 1687, 1691, 1852, 1854, 1955, 1957, 2299, 2303, 2367, 2439, 2441, 2550, 2552, 2922, 2957, 3117, 3121, 3851, 3853, 4031, 4033, 4185, 5059], 'Kahn': [607, 824, 841, 4878], 'A.': [608, 821, 825, 842, 865, 1125, 2916, 4234], 'FASEB': [609], 'J...': [610, 711], '1994;': [611, 712, 759], '8:': [612], '28-35Google': [613], '3Girard': [615], 'J.': [616, 746, 798, 812, 826, 858, 879, 888, 980, 1066, 1282, 1289, 1305, 1322, 1349, 1359, 1427, 1449, 1497, 1501, 1514, 1560, 1697, 2196, 2202, 2371, 2374, 2920, 2931, 2953, 2960, 4133, 4175, 4485, 4524, 4525, 4880, 4982, 4992, 5047, 5069], 'Ferre': [617, 1228, 4127], 'P.': [618, 1216, 1229, 1346, 1860, 1963, 2447, 2558, 3859, 4039, 4120, 4124, 4128, 4979], 'Foufelle': [619, 1230, 4129], 'F.': [620, 1231, 1309, 1858, 1961, 2445, 2556, 3857, 4037, 4130], '325-352Google': [626], 'Scholar-4Hillgartner': [627], 'F.B.': [628], 'Salati': [629], 'L.M.': [630], 'Goodridge': [631], 'A.G.': [632], 'Physiol.': [633, 4881], 'Rev...': [634], '1995;': [635], '75:': [636], '47-76Google': [637], 'Scholar).': [638, 715, 762, 894, 1003, 1134, 1238, 1328, 1365, 1455, 1565, 1705, 1869, 1972, 2317, 2381, 2456, 2567, 2936, 2966, 3135, 3868, 4048, 4139, 4243, 4886, 4998, 5103], 'latter': [640], 'mechanism': [642, 731, 1151, 3452, 3535, 5146], 'considered': [644, 2384], 'adaptive': [647], 'response': [648, 1057, 1261], 'and,': [649], 'many': [651], 'cases,': [652], 'enhanced': [657, 1597, 4355, 5015], '(fatty': [665], 'synthase)': [667], 'Acaca': [669, 2775], '(acetyl-CoA': [670], 'carboxylase': [671], 'α).': [672], 'coordinately': [680], 'regulated': [681, 1465, 2470, 2530, 2634, 2945, 4311, 4318, 4338], 'various': [683, 969, 4439, 4893], 'hormonal': [684], 'nutritional': [686], 'cues.': [687], 'Inhibition': [688], 'fasting': [696], 'hormone': [697], 'glucagon': [698], 'its': [700, 737, 1187, 3040, 3649, 4314, 4351, 4468, 4592], 'intracellular': [701, 4320], 'signal,': [702], 'cAMP-mediated': [703], '(5Lemaigre': [706], 'F.P.': [707], 'Rousseau': [708], 'G.G.': [709], 'Biochem.': [710], '303:': [713], '1-14Google': [714], 'Expression': [716, 1239, 2391, 2612], 'genes': [718, 1189, 1259, 2515, 2569, 2593, 2643, 2717, 2756, 4116, 4262, 4283, 5007], 'also': [723, 1138, 2607, 2633, 2894, 3003, 3018, 3037, 3963, 4354, 4539, 4698, 4902], 'down-regulated': [724], 'polyunsaturated': [726], 'acids,': [728], 'feedback': [734], 'inhibition': [735, 3489, 4113], 'end-point': [738], 'product': [739], '(6Clarke': [742], 'S.D.': [743, 753, 853, 3731], 'Jump': [744, 754, 856], 'D.B.': [745, 755, 857], '1996;': [748], '126:': [749], '1105S-1109SGoogle': [750], '7Clarke': [752], '14:': [760], '83-98Google': [761], 'On': [763, 4331], 'contrary,': [765], 'increased': [766, 1374, 2689, 4929], 'carbohydrate': [767, 1265], 'metabolism': [768, 4427, 4812], 'insulin': [770, 4360], 'actions': [771], 'following': [774], 'consumption': [776], 'responsible': [781, 1177], 'entire': [787, 4630], 'programs': [789], 'mammals': [791, 4171, 4789], '(8Iynedjian': [792], 'P.B.': [793], 'Ucla': [794], 'C.': [795, 990, 1212, 1218, 1223], 'Mach': [796], 'B.': [797, 1225, 2926, 2928, 4877], 'Biol.': [799, 827, 889, 1323, 2203, 4134, 4526], 'Chem...': [800, 828, 890, 1324, 2204, 4135, 4527], '1987;': [801, 814], '262:': [802], '6032-6038Google': [803], '9Minderop': [805], 'R.H.': [806], 'Hoeppner': [807], 'W.': [808, 1856, 1959, 2443, 2554, 3855, 4035], 'Seitz': [809], 'H.J.': [810], 'Eur.': [811, 878], 'Biochem...': [813, 880, 2962], '164:': [815], '181-187Google': [816], '10Vaulont': [818], 'Munnich': [820], 'Decaux': [822], 'J.F.': [823], '1986;': [829], '261:': [830], '7621-7625Google': [831], '11Cuif': [833], 'M.H.': [834], 'Cognet': [835], 'M.': [836, 1210, 1301, 1403, 1407, 1415, 1421, 1425, 1435, 1437, 1447, 1499, 1556, 1699, 1864, 1967, 2198, 2310, 2312, 2376, 2451, 2562, 3128, 3130, 3863, 4043, 4126, 4481, 5023, 5027, 5035, 5041, 5045, 5055, 5057, 5067, 5079, 5085, 5089, 5093, 5097], 'Boquet': [837], 'D.': [838, 1105, 4122, 4214, 4866], 'Tremp': [839], 'G.': [840, 1487, 2297, 3115], 'Vaulont': [843], 'Mol.': [845, 1092, 1232, 1428, 1450, 4201, 5048, 5070], 'Cell.': [846, 1233, 2961], 'Biol...': [847, 1234], '1992;': [848], '12:': [849], '4852-4861Google': [850], '12Clarke': [852], 'Armstrong': [854], 'M.K.': [855], '1990;': [860, 881], '120:': [861], '218-224Google': [862], '13Katsurada': [864], 'Iritani': [866], 'N.': [867, 873, 1299, 1321, 1347, 1405, 1419, 1505, 1507, 4980, 5025, 5039, 5077, 5087], 'Fukuda': [868], 'H.': [869, 1197, 1276, 1297, 1685, 1862, 1965, 2308, 2449, 2560, 3126, 3861, 4041, 5083], 'Matsumura': [870], 'Y.': [871, 1107, 1193, 1307, 1311, 1491, 1493, 2293, 2363, 3111, 4216, 5081], 'Nishimoto': [872], 'Noguchi': [874], 'T.': [875, 877, 1099, 1317, 1411, 1413, 1443, 1503, 2369, 4208, 4864, 5031, 5033, 5063], 'Tanaka': [876, 5084], '190:': [882], '427-433Google': [883], 'Scholar-14Paulauskis': [884], 'J.D.': [885, 975, 1087, 1191, 1288, 1356, 1358, 4196, 4989, 4991], 'Sul': [886], 'H.S.': [887, 1528, 1532, 1544], '1989;': [891], '264:': [892], '574-577Google': [893], '(SREBP)': [899], '2The': [900], 'abbreviations': [901], 'used': [902], 'are:': [903], 'SREBP,': [904], 'sterol': [905, 1061], 'protein;': [908, 933], 'AMPK,': [909, 4838], 'AMP-activated': [910, 1471], 'kinase;': [912, 946], 'TAG,': [913], 'triacylglycerol;': [914], 'nSREBP-1c,': [915, 3297], 'SREBP-1c;': [917], 'b/HLH/LZ,': [918], 'basic': [919, 955, 3078, 3094], 'helix': [920, 922, 956, 958], 'loop': [921, 957], 'leucine': [923, 959], 'zipper;': [924], 'WT,': [925, 1873], 'wild': [926, 3197, 3240, 3336, 3700], 'type;': [927], 'Ad,': [928], 'adenovirus;': [929], 'GFP,': [930], 'green': [931], 'fluorescent': [932], 'GST,': [934], 'glutathione': [935], 'S-transferase;': [936], 'LXR,': [937], 'X': [939, 1794, 3097], 'receptor;': [940], 'CA,': [941, 1786], 'constitutively': [942, 3437, 4851], 'active;': [943], 'SIK,': [944, 4559], 'US,': [947], 'unspecific': [948], 'shRNA.': [949], 'member': [952, 1572], 'zipper': [960], '(b/HLH/LZ)': [961], 'factor': [963, 1017, 1045, 1387, 4368], 'families': [964], 'pathways': [970, 3446, 4424, 4441, 4895], 'lipid': [972, 1660, 2183, 2256, 4168, 4798], '(15Horton': [974], 'Goldstein': [976, 1067, 1090, 1110, 1126, 1283, 4176, 4199, 4219, 4235], 'J.L.': [977, 1068, 1091, 1111, 1127, 1284, 2295, 3113, 4177, 4200, 4220, 4236], 'Brown': [978, 1069, 1088, 1112, 1120, 1285, 4178, 4197, 4221, 4229], 'M.S.': [979, 1070, 1089, 1113, 1121, 1286, 4179, 4198, 4222, 4230], 'Clin.': [981, 1290, 1360, 1515, 4993], 'Invest...': [982, 1291, 1361, 1516, 4994], '2002;': [983, 1094, 1115, 1351, 4203, 4224, 4984], '109:': [984], '1125-1131Google': [985], '16Raghow': [987], 'R.': [988, 1109, 1417, 1423, 1489, 1693, 2361, 4218, 5037, 5043, 5095], 'Yellaturu': [989], 'Deng': [991], 'X.': [992, 1221, 1495, 1848, 1951, 2435, 2546, 3847, 4027], 'Park': [993, 1531, 1545, 5214], 'E.A.': [994], 'Elam': [995], 'M.B.': [996], 'Trends': [997], 'Endocrinol.': [998], 'Metab...': [999, 4870], '2008;': [1000, 1430, 1552, 5050, 5100], '19:': [1001, 1236], '65-73Google': [1002], 'SREBP': [1004, 4384, 4507], 'first': [1006], 'synthesized': [1007], 'precursor': [1010], 'contains': [1013], 'N-terminal': [1015, 1043], 'domains': [1018], 'C-terminal': [1020], 'domain': [1022, 3584, 4570], 'linked': [1023], 'with': [1024, 1340, 1373, 1744, 1750, 1766, 2095, 2167, 2209, 2217, 2230, 2328, 2487, 2490, 2499, 2600, 2846, 3190, 3346, 3410, 3599, 3611, 3884, 3927, 3933, 3936, 3965, 4068, 4074, 4084, 4102, 4642, 4668, 4934, 5004], 'central': [1026], 'transmembrane': [1027], 'domain.': [1028, 3426], 'Bound': [1029], 'endoplasmic': [1032], 'reticulum': [1033], 'interaction': [1036], 'SCAP': [1038], 'INSIG': [1040], 'proteins,': [1041, 4825], 'released': [1047], 'sequential': [1049], 'proteolytic': [1050], 'cleavages': [1051], 'Golgi': [1054], 'apparatus': [1055], 'low': [1060], '(17Sun': [1063, 4172], 'L.P.': [1064, 4173], 'Seemann': [1065, 4174], 'Proc.': [1071, 1198, 4180], 'Natl.': [1072, 1199, 4181], 'Acad.': [1073, 1200, 4182], 'Sci.': [1074, 1201, 4183], 'U.': [1075, 1202, 4184], 'A...': [1077, 1204, 4186], '2007;': [1078, 2378, 4187], '104:': [1079, 4188], '6519-6526Google': [1080, 4189], '18Brown': [1082, 4191], 'A.J.': [1083, 4192], 'Sun': [1084, 4193], 'L.': [1085, 1844, 1846, 1947, 1949, 2431, 2433, 2542, 2544, 2924, 2955, 3843, 3845, 4023, 4025, 4194], 'Feramisco': [1086, 4195], 'Cell..': [1093, 1114, 1130, 2313, 3131, 4202, 4223, 4239], '10:': [1095, 1703, 4204], '237-245Google': [1096, 4205], '19Yang': [1098, 4207], 'Espenshade': [1100, 1128, 4209, 4237], 'P.J.': [1101, 1129, 4210, 4238], 'Wright': [1102, 4211], 'M.E.': [1103, 4212], 'Yabe': [1104, 4213], 'Gong': [1106, 4215], 'Aebersold': [1108, 4217], '110:': [1116, 4225], '489-500Google': [1117, 2935, 4226], 'Scholar-20DeBose-Boyd': [1118, 4227], 'R.A.': [1119, 1850, 1953, 2289, 2437, 2548, 3107, 3849, 4029, 4228], 'Li': [1122, 1490, 4231], 'W.P.': [1123, 4232], 'Nohturfft': [1124, 4233], '1999;': [1131, 1235, 1325, 4240], '99:': [1132, 4241], '703-712Google': [1133, 4242], 'This': [1135], 'activated': [1142], 'liver,': [1147, 2693, 2841, 5113], 'although': [1148, 4346, 4491], 'exact': [1150, 1476], 'has': [1152, 4601], 'been': [1154, 4603], 'demonstrated': [1155, 1483], 'date.': [1157], 'members,': [1160, 4246], 'isoform': [1163], 'implicated': [1165, 4604], 'Insulin': [1175], 'well': [1185], 'target': [1188, 1601, 1634, 2514, 3276, 3402, 4625, 4661, 4713], '(21Horton': [1190], 'Bashmakov': [1192], 'Shimomura': [1194, 1277], 'I.': [1195, 1214, 1278, 1445, 5065], 'Shimano': [1196], '1998;': [1205], '95:': [1206], '5987-5992Google': [1207], '22Foretz': [1209], 'Pacot': [1211], 'Dugail': [1213], 'Lemarchand': [1215], 'Guichard': [1217], 'Le': [1219], 'Liepvre': [1220], 'Berthelier-Lubrano': [1222], 'Spiegelman': [1224], 'Kim': [1226, 1527, 1529, 1533, 1541, 2030, 5208], 'J.B.': [1227, 1542], '3760-3768Google': [1237], 'elevated': [1249], 'liver-specific': [1251], 'mice,': [1254, 3887, 4846], 'induction': [1256, 2764, 2977, 2997], 'these': [1258, 3444, 3461, 4300], 'diet': [1266], 'impaired': [1268], 'livers': [1270], 'knock-out': [1273, 4840], 'mice': [1274, 1887, 3871, 3931, 3934, 4072, 4077], '(23Shimano': [1275], 'Hammer': [1279], 'R.E.': [1280], 'Herz': [1281], 'Horton': [1287, 1357, 4990], '100:': [1293], '2115-2124Google': [1294], '24Shimano': [1296], 'Yahagi': [1298], 'Amemiya-Kudo': [1300], 'Hasty': [1302], 'A.H.': [1303], 'Osuga': [1304], 'Tamura': [1306], 'Shionoiri': [1308], 'Iizuka': [1310], 'Ohashi': [1312], 'K.': [1313, 1315, 1409, 1441, 4118, 5029, 5061, 5091], 'Harada': [1314, 1418, 5038], 'Gotoda': [1316], 'Ishibashi': [1318], 'Yamada': [1320], '274:': [1326], '35832-35839Google': [1327], 'Recently,': [1329, 2937], 'disease': [1333, 1370, 4958, 5020, 5125], 'highly': [1338], 'associated': [1339], 'diseases,': [1342, 4972], 'including': [1343, 4823, 4973], 'diabetes': [1344, 4974], '(25Angulo': [1345, 4978], 'Engl.': [1348, 4981], 'Med...': [1350, 1429, 1451, 1701, 4983, 5049, 5071], '346:': [1352, 4985], '1221-1231Google': [1353, 4986], '26Browning': [1355, 4988], '2004;': [1362, 1702, 2314, 3132, 4995], '114:': [1363, 4996], '147-152Google': [1364, 4997], 'characterized': [1372], 'part': [1379, 4818], 'due': [1380], 'hyperactivation': [1383], 'underscoring': [1389], 'importance': [1391, 3321, 3459, 4593, 4793], 'tight': [1393, 4795], '(27Kohjima': [1402, 5022], 'Higuchi': [1404, 5024], 'Kato': [1406, 5026, 5078], 'Kotoh': [1408, 1440, 5028, 5060, 5090], 'Yoshimoto': [1410, 1442, 5030, 5062], 'Fujino': [1412, 5032], 'Yada': [1414, 1416, 5034, 5036], 'Enjoji': [1420, 1446, 5040, 5066, 5096], 'Takayanagi': [1422, 5042, 5094], 'Nakamuta': [1424, 5044, 5092], 'Int.': [1426, 1448, 5046, 5068], '21:': [1431, 5051], '507-511Google': [1432, 5052], '28Nakamuta': [1434, 5054], 'Kohjima': [1436, 5056, 5088], 'Morizono': [1438, 5058], 'Miyagi': [1444, 5064], '2005;': [1452, 1866, 1969, 2453, 2564, 3865, 4045, 4871, 5072], '16:': [1453, 5073], '631-635Google': [1454, 5074], 'Although': [1456, 3243, 4049, 4306, 4617], 'A': [1469, 2683, 2726, 3175, 3485, 3919, 4273, 4457, 4557], '(AMPKs),': [1474], 'underlying': [1477], 'mechanisms': [1478, 2700, 4298, 4402, 4553], 'have': [1479, 2402], 'yet': [1480], 'vivo': [1485, 2746], '(29Zhou': [1486], 'Myers': [1488], 'Chen': [1492], 'Shen': [1494], 'Fenyk-Melody': [1496], 'Wu': [1498], 'Ventre': [1500], 'Doebber': [1502], 'Fujii': [1504], 'Musi': [1506], 'Hirshman': [1508], 'M.F.': [1509], 'Goodyear': [1510], 'L.J.': [1511], 'Moller': [1512], 'D.E.': [1513], '2001;': [1517, 4136], '108:': [1518], '1167-1174Google': [1519], '30Park': [1521], 'K.G.': [1522], 'Min': [1523], 'A.K.': [1524], 'Koh': [1525], 'E.H.': [1526], 'M.O.': [1530], 'Y.D.': [1534], 'Yoon': [1535], 'T.S.': [1536], 'Jang': [1537], 'B.K.': [1538], 'Hwang': [1539], 'J.S.': [1540], 'Choi': [1543], 'J.Y.': [1546, 1558, 4483], 'Lee': [1547, 1549, 1688], 'I.K.': [1548], 'K.U.': [1550], 'Hepatology..': [1551], '48:': [1553], '1477-1486Google': [1554], 'Scholar-31Lu': [1555], 'Shyy': [1557, 4482], 'Am.': [1559, 4484], 'Physiol...': [1561, 4486], '2006;': [1562, 4487, 4883], '290:': [1563, 4488], 'C1477-C1486Google': [1564, 4489], 'SIK1,': [1570, 1784, 1988], 'AMPK-related': [1575, 3063, 4634], 'kinases,': [1576, 2473, 3064, 4411, 4635, 4822], 'directly': [1577, 4627], 'SREBP-1c-dependent': [1579], 'reduces': [1585, 2858, 3360, 3830, 4006, 4087], 'expression,': [1588, 2535, 2897, 3409, 3511], 'leads': [1594, 4968], 'genes.': [1602, 2641], 'direct': [1609, 3771], 'substrate': [1610, 4639], 'vitro.': [1614], 'Mutation': [1615], 'alanine': [1624, 3204, 3212, 3219], 'on': [1625, 1976, 2176, 2279, 2701, 2835, 3327, 3560, 3606, 3668, 3689, 3709, 3776, 4510, 4692], 'negates': [1627], 'effects': [1629, 2828, 2869, 3665, 3686, 3706, 3773, 4687, 4727], 'mice.': [1642, 1908, 3824], 'These': [1643, 3390, 3977, 4140], 'data': [1644, 2079, 3391, 3978, 4141], 'suggest': [1645, 3392, 4143, 4397], 'SIK1-dependent': [1647], 'modulation': [1657, 4405, 5171], 'Materials—T0901317': [1662], 'was': [1663, 1764, 1811, 1821, 1901, 1981, 2006, 2017, 2024, 2044, 2093, 2138, 2162, 2186, 2215, 2228, 2248, 2257, 2283, 2324, 2348, 2941, 4348, 4458, 4538, 5011, 5115], 'purchased': [1664, 1812, 1889, 1993, 2007], 'from': [1665, 1677, 1813, 1890, 1994, 2008, 2018, 2037, 2184, 2483, 3077, 3413, 4153, 4831], 'Cayman': [1666], 'Chemical': [1667], 'Co.': [1668], 'Cultures': [1669], 'Primary': [1671, 1985, 2822], 'Hepatocytes—Rat': [1672], 'hepatocytes': [1674, 2040, 2282, 2845, 2884, 2993, 3024, 3629, 3697, 4743], 'were': [1675, 1713, 1726, 1742, 1838, 1879, 1888, 1911, 1936, 1992, 2058, 2080, 2150, 2172, 2383, 2969, 3429, 4829, 4925, 5140], 'prepared': [1676, 1937], 'Sprague-Dawley': [1678], 'rats,': [1679], 'described': [1681, 1839, 1943, 2286, 2359], '(32Koo': [1682], 'S.H.': [1683, 1842, 1945, 2365, 2429, 2540, 3841, 4021], 'Satoh': [1684], 'Herzig': [1686], 'C.H.': [1689], 'Hedrick': [1690, 1853, 1956, 2366, 2440, 2551, 3852, 4032], 'Kulkarni': [1692], 'Evans': [1694], 'R.M.': [1695], 'Olefsky': [1696], 'Montminy': [1698, 1863, 1966, 2311, 2375, 2450, 2561, 3129, 3862, 4042], 'Nat.': [1700], '530-534Google': [1704], '16': [1707], 'h': [1708], 'infection,': [1711], 'cells': [1712, 1741, 2951], 'maintained': [1714, 1743], 'serum-free': [1716], 'medium': [1717, 1747], '199': [1718], '(MediaTech)': [1719, 1748], 'additional': [1722], '24–48': [1723], 'h.': [1724], 'Cells': [1725], 'subsequently': [1727], 'harvested': [1728], 'reporter': [1730, 3350, 3495], 'assays': [1731, 2275], '(Ad-Fasn-Luc)': [1732], 'quantitative': [1734, 2061, 2721], 'PCR': [1735, 2062, 2067, 2327], 'analysis.': [1736], 'Transfection': [1737], 'Assays—Human': [1738], 'hepatoma': [1739, 4452], 'HepG2': [1740, 4451], "Ham's": [1745], 'F-12': [1746], 'supplemented': [1749], '10%': [1751], 'fetal': [1752], 'bovine': [1753], 'serum,': [1754], '10': [1755, 1759], 'units/ml': [1756], 'penicillin,': [1757], 'μg/ml': [1760], 'streptomycin.': [1761], 'Each': [1762], 'transfection': [1763], 'performed': [1765, 1982, 2284, 2475, 3180, 3343, 3546], '300': [1767], 'ng': [1768, 1773, 1779], 'luciferase': [1770, 1878, 3683], 'construct,': [1771], '50': [1772, 2117, 2120], 'β-galactosidase': [1775], 'plasmid,': [1776], '2.5–100': [1778], 'vector': [1782], 'AMPKα2': [1785], 'adiponectin,': [1787], 'nSREBP-1c': [1788, 1810, 1820, 1872, 1874, 2318, 3194, 3335, 3369, 3382, 3471, 3559, 3604, 3626, 3710, 3954, 4055], '(WT': [1789], 'mutants),': [1791], 'receptor': [1795], 'α': [1796, 4843], '(LXRα)': [1797], 'using': [1798, 1823, 1938, 2046, 2063, 2259, 2276, 2351, 2481, 3186, 3433], 'Fugene': [1799], '6': [1800], 'reagent': [1801], 'according': [1802], "manufacturer's": [1805], 'instructions.': [1806], 'Plasmid': [1807], 'DNA—pCMV': [1808], 'SPORT': [1809], 'Addgene.': [1814], 'S265A/S266A,': [1815, 3338], 'S329A,': [1816, 3339], 'S265A/S266A/S329A': [1818, 3341, 3380, 3474, 3505, 3602, 3672, 3816, 3910, 3968, 4053, 4082], 'generated': [1822, 1880, 2052, 3331, 3468], 'QuikChange': [1825], 'site-directed': [1826], 'mutagenesis': [1827], 'kit': [1828, 2068, 2264], '(Stratagene).': [1829], 'Adenoviruses—Ad-GFP,': [1830], 'Ad-SIK1,': [1831], 'Ad-US,': [1832], 'Ad-SIK1': [1834, 2494, 2504, 2847, 3708], 'RNA': [1835, 2036, 2505], 'interference': [1836, 2506], 'adenoviruses': [1837, 2495, 3469, 3971], 'previously': [1840, 2287, 2538, 3836, 4801], '(33Koo': [1841, 1944, 2428, 2539, 3840, 4020], 'Flechner': [1843, 1946, 2430, 2541, 3842, 4022], 'Qi': [1845, 1948, 2432, 2543, 3844, 4024], 'Zhang': [1847, 1950, 2434, 2545, 3846, 4026], 'Screaton': [1849, 1952, 2436, 2547, 3848, 4028], 'Jeffries': [1851, 1954, 2298, 2438, 2549, 3116, 3850, 4030], 'Xu': [1855, 1958, 2442, 2553, 3854, 4034], 'Boussouar': [1857, 1960, 2444, 2555, 3856, 4036], 'Brindle': [1859, 1962, 2446, 2557, 3858, 4038], 'Takemori': [1861, 1964, 2307, 2448, 2559, 3125, 3860, 4040], 'Nature..': [1865, 1968, 2377, 2452, 2563, 3864, 4044], '437:': [1867, 1970, 2454, 2565, 3866, 4046], '1109-1111Google': [1868, 1971, 2455, 2566, 3867, 4047], 'Adenoviruses': [1870], 'S265A/S266A/S329A,': [1875], 'described.': [1882, 1984], 'Animal': [1883, 1923], 'Experiments—Male,': [1884], '7-week-old': [1885], 'C57BL/6': [1886], 'Charles': [1891], 'River': [1892], 'Laboratories.': [1893], 'Recombinant': [1894], 'adenovirus': [1895, 2848, 3807, 3938], '(0.5': [1896], '×': [1897], '109': [1898], 'plaque-forming': [1899], 'units)': [1900], 'delivered': [1902], 'tail': [1904, 3821], 'vein': [1905], 'injection': [1906], 'All': [1909, 2078], 'experiments': [1910, 3345, 3432], 'conducted': [1912, 4449], 'guidelines': [1915], 'Sungkyunkwan': [1917], 'University': [1918], 'School': [1919], 'Medicine': [1921], 'Institutional': [1922], 'Care': [1924], 'Use': [1926], 'Committee.': [1927], 'Western': [1928, 1931, 1973, 2165, 2730], 'Blot': [1929], 'Analysis—For': [1930], 'blot,': [1932], 'whole': [1933], 'cell': [1934, 3780, 4363, 4453], 'extracts': [1935], 'SDS': [1939], 'lysis': [1940], 'buffer,': [1941], 'blot': [1974, 2731], '50–100': [1977], 'μg': [1978, 2097], 'antibodies': [1986], 'against': [1987, 2004, 2022], 'α-tubulin,': [1989], 'GFP': [1991, 2767, 3809, 3885, 4075], 'Santa': [1995], 'Cruz': [1996], 'Biotechnology,': [1997], 'Inc.': [1998], '(Santa': [1999], 'Cruz,': [2000], 'CA).': [2001], 'Polyclonal': [2002], 'antibody': [2003, 2014, 2021, 2278, 5211], 'ACC': [2005], 'Cell': [2009, 4869], 'Signaling': [2010], 'Technology.': [2011], 'M2': [2012], 'monoclonal': [2013], '(for': [2015, 4857], 'FLAG)': [2016], 'Sigma.': [2019], 'Monoclonal': [2020], 'FAS': [2023, 2322, 3946, 5210], 'kindly': [2025], 'provided': [2026], 'Prof.': [2028, 5206], 'Kyung-Sup': [2029, 5207], '(Yonsei': [2031], 'University,': [2032], 'Korea).': [2033], 'Quantitative': [2034], 'PCR—Total': [2035], 'either': [2038, 2491, 2500, 2675, 3434, 3491, 3699], 'tissue': [2043], 'extracted': [2045, 2187], 'RNeasy': [2048], 'minikit': [2049], '(Qiagen).': [2050], 'cDNAs': [2051], 'Superscript': [2054], 'II': [2055], '(Invitrogen)': [2057], 'analyzed': [2059, 2325], 'SYBR': [2065], 'Green': [2066], 'TP800': [2070], 'thermal': [2071], 'cycler': [2072], 'DICE': [2073], 'real': [2074], 'time': [2075], 'system': [2076], '(TAKARA).': [2077], 'normalized': [2081], 'ribosomal': [2083], 'L32': [2084], 'In': [2086, 3597, 4446, 4654, 4920, 5135], 'Vitro': [2087], 'Kinase': [2088], 'Assay—Affinity-purified': [2089], 'FLAG-SIK': [2090, 2161], 'fusion': [2091], 'incubated': [2094], '1': [2096], 'GST-SREBP-1c': [2099], '370': [2102], 'kilobecquerels': [2103], '[γ-32P]ATP': [2105], '30': [2107, 2130, 2133], 'μl': [2108], 'buffer': [2111], '(25': [2112], 'mm': [2113, 2118, 2121, 2124, 2127], 'HEPES,': [2114], 'pH': [2115], '7.5,': [2116], 'Tris,': [2119], 'MgCl2,': [2122], '5': [2123, 2126], 'MnCl2,': [2125], 'dithiothreitol)': [2128], '°C': [2131], 'min.': [2134], 'reaction': [2137], 'stopped': [2139], 'addition': [2142], 'SDS-polyacrylamide': [2144, 2153], 'gel': [2145, 2154], 'electrophoresis': [2146, 2155], 'loading': [2147], 'buffer.': [2148], 'Proteins': [2149], 'separated': [2151], 'transferred': [2157], 'nitrocellulose.': [2159], 'Immunoprecipitated': [2160], 'confirmed': [2163, 2719], 'blotting': [2166], 'α-FLAG': [2168], 'antibody.': [2169], 'Radiolabeled': [2170], 'visualized': [2173], 'quantified': [2175], 'BAS': [2177], '(Fuji).': [2178], 'Hepatic': [2179, 3755, 3913, 4999], 'Triacylglycerol': [2180], '(TAG)': [2181], 'Analysis—Total': [2182], 'method': [2190], 'Folch': [2192], 'et': [2193], 'al.': [2194], '(34Folch': [2195], 'Lees': [2197], 'Sloane': [2199], 'Stanley': [2200], 'G.H.': [2201], '1957;': [2205], '226:': [2206], '497-509Google': [2207], 'Scholar)': [2208], 'slight': [2210], 'modification.': [2211], 'Briefly,': [2212], 'mouse': [2213, 2484, 2692, 2875], 'homogenized': [2216], 'chloroform/MeOH': [2218], '(2:1,': [2219], 'v/v)': [2220], 'centrifuged': [2222], 'room': [2224], 'temperature.': [2225], 'supernatant': [2227], 'washed': [2229], '0.2': [2231], 'volumes': [2232], '0.9%': [2234], 'NaCl': [2235], 'centrifuged.': [2237], 'removal': [2240], 'upper': [2243], 'phase,': [2244], 'remaining': [2246], 'solution': [2247], 'evaporated': [2249], 'under': [2250], 'vacuum.': [2251], 'TAG': [2252, 3756, 3800, 3877, 3960, 5154], 'content': [2253], 'measured': [2258], 'enzymatic': [2261], 'colorimetric': [2262], '(Wako': [2265], 'Chemicals).': [2266], 'Chromatin': [2267], 'Immunoprecipitation': [2268], 'Assays—Nuclear': [2269], 'isolation,': [2270], 'cross-linking': [2271], 'chromatin': [2273, 3548, 3718], 'immunoprecipitation': [2274, 3549, 3719], 'anti-FLAG': [2277], 'rat': [2280, 2331, 3679, 3695], '(35Screaton': [2288, 3106], 'Conkright': [2290, 3108], 'M.D.': [2291, 3109], 'Katoh': [2292, 3110], 'Best': [2294, 3112], 'Canettieri': [2296, 3114], 'Guzman': [2300, 3118], 'E.': [2301, 3119], 'Niessen': [2302, 3120], 'Yates': [2304, 2372, 3122], 'III,': [2305, 2373, 3123], 'J.R.': [2306, 3124], 'Okamoto': [2309, 3127], '119:': [2315, 3133], '61-74Google': [2316, 3134], 'occupancy': [2319, 3711], 'over': [2320, 3712, 4425], 'promoter': [2323, 3000, 3015, 3563, 3609, 3692, 4695], 'primers': [2329], '(forward,': [2333], 'ggcggccacgccacatgggctgacagc;': [2334], 'reverse,': [2335], 'ccccggcgctcctcagtcccagcccca).': [2336], 'Statistical': [2337], 'Analyses—Results': [2338], 'represent': [2339, 3303, 3728], 'mean': [2340, 3729], '±': [2341, 3730], 'S.E.': [2342], 'comparison': [2344], 'different': [2346], 'groups': [2347], 'carried': [2349], 'out': [2350, 2825], 'two-tailed': [2353], 'unpaired': [2354], "Student's": [2355], 't': [2356, 3743], 'test': [2357, 3788], '(36Dentin': [2360], 'Liu': [2362, 2958], 'Koo': [2364], 'Vargas': [2368], 'Heredia': [2370], '449:': [2379], '366-369Google': [2380], 'Differences': [2382], 'statistically': [2385], 'significant': [2386, 3873], 'p': [2388, 3736, 3740], '<': [2389, 3737, 3741], '0.05.': [2390], 'Lipogenic': [2393], 'Genes': [2394], 'Are': [2395], 'Regulated': [2396], 'Liver—Previously,': [2400], 'SIKs': [2407, 4415, 4636], 'gluconeogenesis': [2410], '171': [2416, 4650], 'CRTC2': [2419, 4018, 4156], '(CREB-regulated': [2420], 'coactivator': [2422], '2)': [2423], '(also': [2424], 'known': [2425, 2513, 4249], 'TORC2)': [2427], 'To': [2457, 3455, 3531], 'gain': [2458], 'further': [2459, 3318, 3456, 4086, 4142], 'insight': [2460], 'nature': [2463], 'potential': [2465, 2826, 3146, 3594, 4436, 4659], 'signaling': [2466], 'cascades': [2467], 'two': [2476, 3445, 4301, 4383, 4407, 4709], 'sets': [2477], 'microarray': [2479], 'RNAs': [2482], 'infected': [2486], 'adenoviruses,': [2488], 'one': [2489, 3273], 'Ad-GFP': [2492, 2850], 'other': [2498, 2639, 3414, 4333, 4820], 'Ad-US': [2501], 'adenoviruses.': [2507], 'As': [2508, 2887, 3352, 3480, 3551, 4000, 4633, 4724, 5104], 'Table': [2511], '1,': [2512, 2655, 2725], 'gluconeogenesis,': [2518], 'G6pc': [2521, 2787, 4097], '(glucose-6-phosphatase,': [2522], 'catalytic': [2523], 'subunit)': [2524], 'Pcx': [2526, 2790], '(pyruvate': [2527], 'carboxylase)': [2528], 'changes': [2532, 2710], 'reported': [2537, 3835, 4001], 'Surprisingly,': [2568], 'lipogenesis,': [2573, 4061, 5002], 'Gpd1': [2579, 2784], '(glycerol-3-phosphate': [2580], 'dehydrogenase': [2581], '1)': [2582, 2685, 4095], 'up-regulated': [2584], 'knockdown,': [2587], 'generally': [2595, 2652], 'lower': [2599, 4067], 'overexpression,': [2602], 'could': [2606, 2738, 2876, 2893, 3030, 3038, 3167, 3237, 3518, 3892, 4757, 5179], 'regulate': [2608, 2739, 2902, 3033, 3039, 3893, 4251, 4443, 4719, 4769, 4892, 5152], 'transcription.': [2611], 'Srebf1,': [2614], 'encoding': [2617], 'process,': [2625], 'Thrsp': [2627, 2781, 3923], '(thyroid': [2628], 'hormone-responsive': [2629], 'SPOT14': [2630], 'homolog)': [2631], 'similarly': [2637, 4712], 'Interestingly,': [2642, 2680, 3614, 4365], 'cholesterol': [2647, 2702, 4252, 4426], 'biosynthesis': [2648, 4255, 5111], 'uptake': [2650, 4253], 'unaffected': [2653, 3386], '(aminoacylase': [2654], 'Fdps': [2656, 2799], '(farnesyl': [2657], 'diphosphate': [2658, 2662], 'synthetase),': [2659], 'Ggdps': [2660], '(geranylgeranyl': [2661], 'synthase': [2663, 2684, 4536], '1),': [2664, 3921], 'Ldlr': [2665, 2802], '(low': [2666], 'density': [2667], 'lipoprotein': [2668], 'receptor),': [2669], 'Pmvk': [2671, 2793], '(phosphomevalonate': [2672], 'kinase))': [2673], 'overexpression': [2677, 2759, 2832, 2855, 2990, 3022, 3358, 3569, 3826, 3902], 'knockdown.': [2679], 'Hmgcs1': [2681, 2796], '(3-hydroxy-3-methylglutaryl-coenzyme': [2682, 4272], 'rather': [2688], 'SIK1-infected': [2691], 'showing': [2694, 2735, 2750, 2866, 3685, 3888, 4324, 4413], 'lack': [2696], 'general': [2698], 'synthetic': [2703, 4952], 'SIK.': [2708], 'Indeed,': [2709, 2853, 2967, 3825, 4684], 'selected': [2715], '(Fig.': [2724, 2733, 2885, 2994, 3008, 3025, 3173, 3283, 3453, 3940, 3972, 4098, 4705, 4937], 'B)': [2728], '1C),': [2734], 'setting.Table': [2747], '1Microarray': [2748], 'patterns': [2753], 'Gene': [2762], '-Fold': [2763], 'versus': [2766, 2770], 'SIKI': [2768], 'RNAi': [2769], 'US': [2771], 'Srebf1': [2772, 2983, 2999], '0.571': [2773], '1.347': [2774], '0.991': [2776], '1.764': [2777], '0.652': [2779], '1.416': [2780], '0.680': [2782], '7.360': [2783], '0.622': [2785], '1.502': [2786], '0.819': [2788], '1.399': [2789], '0.853': [2791], '1.257': [2792], '0.952': [2794], '0.852': [2795], '1.337': [2797], '0.683': [2798], '0.741': [2800], '0.832': [2801], '1.125': [2803], '1.080': [2804], 'Acy1': [2805], '0.959': [2806], '1.051': [2807], 'Ggps1': [2808], '1.234': [2809], '1.15': [2810], 'Open': [2811], 'table': [2812], 'new': [2815], 'tab': [2816], 'Regulates': [2818, 3754], 'SREBP-1c-mediated': [2819, 3011], 'Transcription': [2820], 'Hepatocytes—To': [2823], 'rule': [2824], 'secondary': [2827], 'adenovirus-mediated': [2830], 'transduced': [2843], 'viruses.': [2852], 'mRNA': [2859], 'hepatocytes,': [2865, 3572], 'infection': [2873], 'replicated': [2878], '2A).': [2886], 'previously,': [2889, 4002, 4726], 'AMPK': [2890, 2912, 2947, 3439, 4600, 4643, 4689, 4734, 4805, 4842, 4853, 4888], 'adiponectin': [2892, 3435, 4691, 4729], 'reduce': [2895], 'may': [2901, 3587, 3646, 4730], 'similar': [2908, 3450, 4638], 'manner': [2909], 'does': [2911, 3616], '(37Da': [2913], 'Silva': [2914], 'Morais': [2915], 'Lebrun': [2917], 'V.': [2918], 'Abarca-Quinones': [2919], 'Brichard': [2921], 'Hue': [2923], 'Guigas': [2925], 'Viollet': [2927], 'Leclercq': [2929], 'I.A.': [2930], 'Hepatol...': [2932], '2009;': [2933, 2963, 4528], '50:': [2934], 'LXR-mediated': [2938], '(38Yang': [2952], 'Craddock': [2954], 'Hong': [2956], 'Z.M.': [2959], '106:': [2964], '414-426Google': [2965], 'able': [2970, 4926, 5141], 'LXR': [2974, 4369], 'ligand': [2975], 'T0901317-mediated': [2976], 'mRNAs': [2979, 4089], 'effectively': [2985, 3359], 'blocked': [2986, 3503, 3566, 3906, 4699], '2B).': [2995], 'LXR-dependent': [2996], '2C).': [3009], 'However,': [3010, 3371], 'enhancement': [3012], '2D),': [3026], 'only': [3032, 3647, 4417, 4897], 'but': [3036, 3507, 4901], 'modulate': [3043, 4629], 'Directly': [3049], 'Modifies': [3050], 'Three': [3053], 'Serine': [3054, 3761], 'Residues': [3055, 3762], 'within': [3056, 3423, 3581, 3765, 4671], 'b/HLH/LZ': [3058, 3425, 3583, 3767, 4569, 4673], 'Domain—As': [3059], 'members': [3060], 'phosphorylate': [3067, 3239], 'threonine': [3070], 'residues': [3071, 3148, 3225, 3290, 3324, 3464, 3527, 3580], 'fixed': [3075], 'distance': [3076], 'hydrophobic': [3080, 3088], 'amino': [3081, 3089, 3095, 3100, 3139, 3150], 'acids': [3082], '(HBXX(S/T)XXH,': [3083], 'where': [3084], 'H': [3085], 'represents': [3086, 3399], 'acid,': [3090, 3096, 3101], 'B': [3091, 3974], 'any': [3099], 'S/T': [3103], 'serine/threonine)': [3105], 'Close': [3136], 'investigation': [3137], 'sequences': [3141, 3199, 3202, 4562, 4641, 4662, 4715], 'revealed': [3144, 3234, 4435], 'three': [3145, 3223, 3288, 3301, 3462, 3524, 3578, 4658], 'positions': [3152], '265,': [3153, 3640], '266,': [3154, 3422, 3641], 'conserved': [3159], 'among': [3160, 4657], 'mouse,': [3161], 'rat,': [3162], 'human': [3164], 'species': [3165], 'phosphorylated': [3169], '3,': [3174], 'C).': [3177, 3976], 'Consequently,': [3178], 'immunoprecipitated': [3187], 'FLAG-SIK1': [3188], 'together': [3189, 4667, 5003], 'four': [3191], 'purified': [3192], 'GST-fused': [3193], 'bearing': [3196], 'type': [3198, 3241, 3701], '(WT)': [3200], 'containing': [3203], 'substitutions': [3205, 3220], 'serines': [3207, 3246, 3639], '265': [3208, 3247, 3420, 4477], '266': [3210, 3249], '(S265/266A),': [3211], 'substitution': [3213], '(S329A),': [3217], 'all': [3222, 3287], 'depicted': [3226], 'above': [3227], '(3A).': [3228], 'An': [3229], 'nSREBP-1c.': [3242, 3704], 'mutations': [3244], 'affect': [3250, 3648, 4461], 'modestly,': [3257], 'S329A': [3258, 3372, 4701], 'strongly': [3261], 'refractory': [3262, 3375, 3657], 'phosphorylation,': [3265], '3B).': [3284], 'Mutations': [3285], 'almost': [3291, 3384, 3904], 'completely': [3292, 3385, 3905], 'block': [3293], 'targets': [3306, 4561], 'kinases.': [3309], 'Triple': [3310], 'Mutant': [3311], 'Is': [3313], 'Refractory': [3314], 'Inhibition—To': [3317], 'confirm': [3319], 'inhibition,': [3329, 3378], 'vectors': [3333], 'type,': [3337], 'co-transfection': [3344], 'Luc': [3349, 3362, 3494], 'plasmid.': [3351], 'Fig.': [3355, 3483, 3554], '4A,': [3356], 'driven': [3364], 'WT': [3366, 3472, 3510, 3558, 3670], 'S265A/S266A': [3368], 'largely': [3374], 'SIK1-mediated': [3377, 3488], 'contribution': [3412], 'residues,': [3416], 'Similar': [3427], 'results': [3428, 3796, 5168], 'obtained': [3430], 'active': [3438, 4389, 4852], 'vector,': [3441], 'share': [3448, 4637], '4B).': [3454], 'verify': [3457], 'tested': [3476], '5,': [3484], 'B,': [3487, 3682], 'Ad': [3492], 'endogenous': [3498, 4949], 'confirming': [3512], 'identified.': [3530], 'understand': [3532], 'molecular': [3534, 5145], 'which': [3537, 4473, 5148], 'affects': [3541], 'activity,': [3544], 'assay.': [3550], '5C,': [3555], 'binding': [3556, 3591, 3651, 4463], 'partially': [3565, 3950], 'inhibit': [3588], 'DNA': [3590, 3650, 4462], 'and/or': [3592, 3996], 'dimerization': [3593], 'accordance': [3598, 4101], 'idea,': [3601], 'remains': [3605, 4065], 'even': [3610, 4911], 'overexpression.': [3613], 'alter': [3618, 4746], 'stability': [3620], 'cellular': [3623], 'localization': [3624], '(data': [3630, 3837, 4078, 4753], 'shown),': [3632], 'status': [3637], 'activity.FIGURE': [3652], '5Triple': [3653], 'A,': [3664], 'SREBP1c': [3669], '(3A)-induced': [3674], 'SREBP-1c-induced': [3690], 'expressing': [3698], 'C,': [3705], '(IP)': [3720], 'Data': [3725], 'A–C': [3727], '(n': [3732], '=': [3733], '3)': [3734], '(**,': [3735], '0.01;': [3738], '*,': [3739], '0.05,': [3742], 'test).View': [3744], 'Large': [3745], 'Image': [3746], 'Figure': [3747], 'ViewerDownload': [3748], 'Hi-res': [3749], 'image': [3750], 'Download': [3751], '(PPT)': [3752], 'Levels': [3757], 'Targeting': [3759], 'Domain—Having': [3768], 'seen': [3769], 'inhibitory': [3772, 4686], 'culture': [3781], 'vitro,': [3784], 'wanted': [3786], 'whether': [3789], 'decreased': [3798], 'We': [3804, 5204], 'thus': [3805], 'injected': [3806, 3935], 'alone,': [3810, 3812], 'plus': [3815, 3929, 4070], 'veins': [3822], 'blood': [3831], 'levels,': [3833], 'shown)': [3839], 'Furthermore,': [3869, 3942, 4887], 'SIK1-injected': [3870], 'display': [3872], 'reduction': [3874, 3944, 3957], 'compared': [3883, 3932, 4073], 'effect': [3899], 'Scd1': [3917, 4289], '(stearoyl-coenzyme': [3918], 'desaturase': [3920], 'significantly': [3925, 4066], 'higher': [3926], 'Ad-S265A/S266A/S329A': [3928, 3953], 'Ad-SIK-injected': [3930], 'alone': [3939, 4496], '6A).': [3941], 'co-infection,': [3955], 'co-injection': [3966], '6,': [3973], 'clearly': [3979], 'indicate': [3980], 'targeted': [3989], '265/266': [3997, 4670, 5164], 'gluconeogenic': [4007, 4115, 4159], 'plasma': [4011, 4062], 'restores': [4056], 'Ad-SIK': [4069], 'S265A/S266A/S329A-injected': [4071], 'shown).': [4080, 4755], 'Rather,': [4081], 'co-expression': [4083], 'cytosolic': [4091], 'Pck1': [4092], '(phosphoenolpyruvate': [4093], 'carboxykinase': [4094], '6D),': [4099], 'notion': [4104], 'might': [4107, 4386, 4499, 4790, 4813, 5193], '(39Chakravarty': [4117], 'Leahy': [4119], 'Becard': [4121], 'Hakimi': [4123], 'Foretz': [4125], 'Hanson': [4131], 'R.W.': [4132], '276:': [4137], '34816-34823Google': [4138], 'distinct': [4152], 'SREBPs': [4162, 4408], 'regulators': [4166], 'SREBP-2': [4247, 4307], 'controlling': [4259], 'Ldlr,': [4269], 'Hmgcs1,': [4270], 'Hmgcr': [4271], 'reductase),': [4274], 'Fdps,': [4276], 'selectively': [4279, 4731], 'activates': [4280], 'biosynthetic': [4294, 4423, 4612], 'program.': [4295], 'factors': [4302, 4385], 'considerable': [4304], 'differences.': [4305], 'sterols,': [4313, 4323], 'processing': [4315], 'tightly': [4317], 'case': [4326, 4647], 'end': [4328], 'product-mediated': [4329], 'inhibition.': [4330], 'hand,': [4334], 'mainly': [4337], 'insulin,': [4345], 'it': [4347, 4621, 4910], 'suggested': [4349, 5116], 'presence': [4358, 4764], 'some': [4362, 4392], 'types.': [4364], 'oxysterol-sensing': [4366], 'simultaneously': [4390], 'physiological': [4393], 'conditions.': [4394], 'another': [4398, 4532], 'layer': [4399], 'differential': [4404], 'can': [4416, 5151], 'specifically': [4418], 'shut': [4419], 'down': [4420], 'Recent': [4433], 'studies': [4434, 4832], 'involvement': [4437], 'study': [4448], 'lines,': [4454], 'ability': [4464], 'SREBP-1a': [4466], '338,': [4472], 'corresponds': [4474], '(31Lu': [4480], 'Scholar),': [4490, 4531], 'modification': [4492], 'based': [4509], 'our': [4511, 4655, 4921, 5136], 'results.': [4512], 'According': [4513], 'report': [4516], 'Bengoechea': [4518], 'Ericsson': [4520, 4523], '(40Bengoechea-Alonso': [4521], 'M.T.': [4522], '284:': [4529], '5885-5895Google': [4530], 'serine/threonine': [4533], 'glycogen': [4535], 'down-regulation': [4546, 4748], 'SREBP-1': [4548, 4578, 4589], 'Unlike': [4550], 'GSK3': [4560], 'C': [4565], 'terminal': [4566], 'promotes': [4572], 'ubiquitin': [4573], 'ligase': [4574], 'Fbw7-dependent': [4575], 'degradation': [4576], 'proteins.': [4579], 'implication': [4581], 'multiple': [4583, 4766], 'underscore': [4591], 'long': [4602], 'mechanisms.': [4616], 'unswervingly,': [4620], 'thought': [4623], 'programs.': [4632], 'recognition': [4640], 'CRTC2.': [4653], 'hands,': [4656], 'AMPK/SIK': [4660], '329,': [4666], 'domain,': [4674], 'regulation.': [4683], 'SREBP-mediated': [4693], 'mutation': [4702], '4B),': [4706], 'specific': [4714], 'biosynthesis.': [4723], 'activate': [4732], 'pathway,': [4735, 5010], 'since': [4736, 4826], 'SIK2': [4739], 'did': [4744], 'adiponectin-dependent': [4747], 'What': [4756], 'logical': [4760], 'explanation': [4761], 'same': [4771], 'pathway?': [4772], 'One': [4773], 'suspect': [4775], 'existence': [4778], 'seemingly': [4780], 'redundant': [4781], 'functions': [4783], 'accentuate': [4791], 'Alternatively,': [4800], 'identified': [4802], 'roles': [4803], 'assumed': [4816], 'related': [4821], 'most': [4827], 'conclusions': [4828], 'drawn': [4830], 'utilizing': [4833], 'pharmacological': [4835], 'systemic': [4839], 'subunits': [4844], 'reviews,': [4858], 'see': [4859], 'Refs.': [4860], '41Kahn': [4861], 'B.B.': [4862, 4879], 'Alquier': [4863], 'Carling': [4865], 'Hardie': [4867], 'D.G.': [4868], '1:': [4872], '15-25Google': [4873], 'Scholar': [4874], '42Xue': [4876], '(Lond.)..': [4882], '574:': [4884], '73-83Google': [4885], 'function': [4890], 'peripheral': [4899], 'organs': [4900], 'hypothalamus': [4905], 'brain,': [4908], 'making': [4909], 'harder': [4912], 'gauge': [4914], 'hepatocyte-specific': [4916], 'AMPK.': [4919], 'current': [4922, 5137], 'studies,': [4923], 'observe': [4928], '1B),': [4938], 'Nonalcoholic': [4955], 'now': [4960], 'regarded': [4961], 'pathogenic': [4965], 'condition': [4966], 'severe': [4970, 5201], 'steatohepatitis': [4977], 'patients': [5021], '43Higuchi': [5076], 'Shundo': [5080], 'Tajiri': [5082], 'Yamashita': [5086], 'Hepatol.': [5098], 'Res...': [5099], '38:': [5101], '1122-1129Google': [5102], 'contributing': [5127], 'onset': [5130], 'phenotypes.': [5134], 'study,': [5138], 'identify': [5143], 'Our': [5167], 'propose': [5169], 'approach': [5183], 'relieve': [5185], 'symptoms.': [5187], 'Pharmacological': [5188], 'beneficial': [5195], 'deter': [5197], 'thank': [5205], 'Sun-Myeong': [5213], 'technical': [5216], 'assistance.': [5217]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2154406084', 'counts_by_year': [{'year': 2024, 'cited_by_count': 1}, {'year': 2023, 'cited_by_count': 7}, {'year': 2022, 'cited_by_count': 4}, {'year': 2021, 'cited_by_count': 4}, {'year': 2020, 'cited_by_count': 3}, {'year': 2019, 'cited_by_count': 5}, {'year': 2018, 'cited_by_count': 3}, {'year': 2017, 'cited_by_count': 3}, {'year': 2016, 'cited_by_count': 4}, {'year': 2015, 'cited_by_count': 4}, {'year': 2014, 'cited_by_count': 7}, {'year': 2013, 'cited_by_count': 3}, {'year': 2012, 'cited_by_count': 2}], 'updated_date': '2024-12-08T23:33:37.579772', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
