Platelet-derived Growth Factor and Reactive Oxygen Species (ROS) Regulate Ras Protein Levels in Primary Human Fibroblasts via ERK1/2

Name: Work Video:
Duration: 3 min 30 s
Silvia Svegliati; Raffaella Cancello; Paola Sambo; Michele Maria Luchetti; Paolo Paroncini; Guido Orlandini; Giancarlo Discepoli; Roberto Paternò; Mariarosaria Santillo; Concetta Cuozzo; Silvana Cassano; Enrico V. Avvedimento; Armando Gabrielli
{'id': 'https://openalex.org/W2152951480', 'doi': 'https://doi.org/10.1074/jbc.m502851200', 'title': 'Platelet-derived Growth Factor and Reactive Oxygen Species (ROS) Regulate Ras Protein Levels in Primary Human Fibroblasts via ERK1/2', 'display_name': 'Platelet-derived Growth Factor and Reactive Oxygen Species (ROS) Regulate Ras Protein Levels in Primary Human Fibroblasts via ERK1/2', 'publication_year': 2005, 'publication_date': '2005-08-05', 'ids': {'openalex': 'https://openalex.org/W2152951480', 'doi': 'https://doi.org/10.1074/jbc.m502851200', 'mag': '2152951480', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/16081426'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m502851200', 'pdf_url': 'http://www.jbc.org/article/S0021925820594520/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820594520/pdf', 'any_repository_has_fulltext': True}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5043533199', 'display_name': 'Silvia Svegliati', 'orcid': 'https://orcid.org/0000-0001-6863-2600'}, 'institutions': [{'id': 'https://openalex.org/I4210107146', 'display_name': 'Ospedali Riuniti di Ancona', 'ror': 'https://ror.org/01j0qa041', 'country_code': 'IT', 'type': 'healthcare', 'lineage': ['https://openalex.org/I4210107146']}], 'countries': ['IT'], 'is_corresponding': False, 'raw_author_name': 'Silvia Svegliati', 'raw_affiliation_strings': ["Istituto di Clinica Medica Generale, Ematologia ed Immunologia Clinica, Universita' di Ancona, 60020 Ancona"], 'affiliations': [{'raw_affiliation_string': "Istituto di Clinica Medica Generale, Ematologia ed Immunologia Clinica, Universita' di Ancona, 60020 Ancona", 'institution_ids': ['https://openalex.org/I4210107146']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5040872428', 'display_name': 'Raffaella Cancello', 'orcid': 'https://orcid.org/0000-0002-8192-009X'}, 'institutions': [{'id': 'https://openalex.org/I4210107146', 'display_name': 'Ospedali Riuniti di Ancona', 'ror': 'https://ror.org/01j0qa041', 'country_code': 'IT', 'type': 'healthcare', 'lineage': ['https://openalex.org/I4210107146']}], 'countries': ['IT'], 'is_corresponding': False, 'raw_author_name': 'Raffaella Cancello', 'raw_affiliation_strings': ["Istituto di Clinica Medica Generale, Ematologia ed Immunologia Clinica, Universita' di Ancona, 60020 Ancona"], 'affiliations': [{'raw_affiliation_string': "Istituto di Clinica Medica Generale, Ematologia ed Immunologia Clinica, Universita' di Ancona, 60020 Ancona", 'institution_ids': ['https://openalex.org/I4210107146']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5017589815', 'display_name': 'Paola Sambo', 'orcid': 'https://orcid.org/0000-0002-2165-8608'}, 'institutions': [{'id': 'https://openalex.org/I4210107146', 'display_name': 'Ospedali Riuniti di Ancona', 'ror': 'https://ror.org/01j0qa041', 'country_code': 'IT', 'type': 'healthcare', 'lineage': ['https://openalex.org/I4210107146']}], 'countries': ['IT'], 'is_corresponding': False, 'raw_author_name': 'Paola Sambo', 'raw_affiliation_strings': ["Istituto di Clinica Medica Generale, Ematologia ed Immunologia Clinica, Universita' di Ancona, 60020 Ancona"], 'affiliations': [{'raw_affiliation_string': "Istituto di Clinica Medica Generale, Ematologia ed Immunologia Clinica, Universita' di Ancona, 60020 Ancona", 'institution_ids': ['https://openalex.org/I4210107146']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5079896587', 'display_name': 'Michele Maria Luchetti', 'orcid': 'https://orcid.org/0000-0001-9132-7401'}, 'institutions': [{'id': 'https://openalex.org/I4210107146', 'display_name': 'Ospedali Riuniti di Ancona', 'ror': 'https://ror.org/01j0qa041', 'country_code': 'IT', 'type': 'healthcare', 'lineage': ['https://openalex.org/I4210107146']}], 'countries': ['IT'], 'is_corresponding': False, 'raw_author_name': 'Michele Luchetti', 'raw_affiliation_strings': ["Istituto di Clinica Medica Generale, Ematologia ed Immunologia Clinica, Universita' di Ancona, 60020 Ancona"], 'affiliations': [{'raw_affiliation_string': "Istituto di Clinica Medica Generale, Ematologia ed Immunologia Clinica, Universita' di Ancona, 60020 Ancona", 'institution_ids': ['https://openalex.org/I4210107146']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5026462817', 'display_name': 'Paolo Paroncini', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I4210107146', 'display_name': 'Ospedali Riuniti di Ancona', 'ror': 'https://ror.org/01j0qa041', 'country_code': 'IT', 'type': 'healthcare', 'lineage': ['https://openalex.org/I4210107146']}], 'countries': ['IT'], 'is_corresponding': False, 'raw_author_name': 'Paolo Paroncini', 'raw_affiliation_strings': ["Istituto di Clinica Medica Generale, Ematologia ed Immunologia Clinica, Universita' di Ancona, 60020 Ancona"], 'affiliations': [{'raw_affiliation_string': "Istituto di Clinica Medica Generale, Ematologia ed Immunologia Clinica, Universita' di Ancona, 60020 Ancona", 'institution_ids': ['https://openalex.org/I4210107146']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5072549849', 'display_name': 'Guido Orlandini', 'orcid': 'https://orcid.org/0000-0003-1937-3758'}, 'institutions': [{'id': 'https://openalex.org/I124601658', 'display_name': 'University of Parma', 'ror': 'https://ror.org/02k7wn190', 'country_code': 'IT', 'type': 'education', 'lineage': ['https://openalex.org/I124601658']}], 'countries': ['IT'], 'is_corresponding': False, 'raw_author_name': 'Guido Orlandini', 'raw_affiliation_strings': ['Dipartimento di Medicina Sperimentale, Sezione di Istologia, Università di Parma, 43100 Parma'], 'affiliations': [{'raw_affiliation_string': 'Dipartimento di Medicina Sperimentale, Sezione di Istologia, Università di Parma, 43100 Parma', 'institution_ids': ['https://openalex.org/I124601658']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5025967935', 'display_name': 'Giancarlo Discepoli', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I71267560', 'display_name': 'University of Naples Federico II', 'ror': 'https://ror.org/05290cv24', 'country_code': 'IT', 'type': 'education', 'lineage': ['https://openalex.org/I71267560']}], 'countries': ['IT'], 'is_corresponding': False, 'raw_author_name': 'Giancarlo Discepoli', 'raw_affiliation_strings': ['Dipartimento di Medicina Clinica e Sperimentale, Università Federico II, 80131 Napoli'], 'affiliations': [{'raw_affiliation_string': 'Dipartimento di Medicina Clinica e Sperimentale, Università Federico II, 80131 Napoli', 'institution_ids': ['https://openalex.org/I71267560']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5113944916', 'display_name': 'Roberto Paternò', 'orcid': None}, 'institutions': [], 'countries': [], 'is_corresponding': False, 'raw_author_name': 'Roberto Paterno', 'raw_affiliation_strings': ['Laboratorio di Citogenetica, Ospedale G. Salesi 60020, Ancona'], 'affiliations': [{'raw_affiliation_string': 'Laboratorio di Citogenetica, Ospedale G. Salesi 60020, Ancona', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5042654274', 'display_name': 'Mariarosaria Santillo', 'orcid': 'https://orcid.org/0000-0003-1260-8980'}, 'institutions': [{'id': 'https://openalex.org/I71267560', 'display_name': 'University of Naples Federico II', 'ror': 'https://ror.org/05290cv24', 'country_code': 'IT', 'type': 'education', 'lineage': ['https://openalex.org/I71267560']}], 'countries': ['IT'], 'is_corresponding': False, 'raw_author_name': 'Mariarosaria Santillo', 'raw_affiliation_strings': ['Dipartimento di Neuroscienze-Sezione di Fisiologia, Università Federico II, 80131 Napoli'], 'affiliations': [{'raw_affiliation_string': 'Dipartimento di Neuroscienze-Sezione di Fisiologia, Università Federico II, 80131 Napoli', 'institution_ids': ['https://openalex.org/I71267560']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5019605351', 'display_name': 'Concetta Cuozzo', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I4210139435', 'display_name': 'Institute for Experimental Endocrinology and Oncology', 'ror': 'https://ror.org/04sn06036', 'country_code': 'IT', 'type': 'facility', 'lineage': ['https://openalex.org/I4210139435', 'https://openalex.org/I4210155236']}], 'countries': ['IT'], 'is_corresponding': False, 'raw_author_name': 'Concetta Cuozzo', 'raw_affiliation_strings': ['Dipartimento di Biologia e Patologia Molecolare e Cellulare, Istituto di Endocrinologia ed Oncologia Sperimentale del C. N. R., Università Federico II, 80131 Napoli, Italy'], 'affiliations': [{'raw_affiliation_string': 'Dipartimento di Biologia e Patologia Molecolare e Cellulare, Istituto di Endocrinologia ed Oncologia Sperimentale del C. N. R., Università Federico II, 80131 Napoli, Italy', 'institution_ids': ['https://openalex.org/I4210139435']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5054797603', 'display_name': 'Silvana Cassano', 'orcid': 'https://orcid.org/0000-0001-9868-7936'}, 'institutions': [{'id': 'https://openalex.org/I4210139435', 'display_name': 'Institute for Experimental Endocrinology and Oncology', 'ror': 'https://ror.org/04sn06036', 'country_code': 'IT', 'type': 'facility', 'lineage': ['https://openalex.org/I4210139435', 'https://openalex.org/I4210155236']}], 'countries': ['IT'], 'is_corresponding': False, 'raw_author_name': 'Silvana Cassano', 'raw_affiliation_strings': ['Dipartimento di Biologia e Patologia Molecolare e Cellulare, Istituto di Endocrinologia ed Oncologia Sperimentale del C. N. R., Università Federico II, 80131 Napoli, Italy'], 'affiliations': [{'raw_affiliation_string': 'Dipartimento di Biologia e Patologia Molecolare e Cellulare, Istituto di Endocrinologia ed Oncologia Sperimentale del C. N. R., Università Federico II, 80131 Napoli, Italy', 'institution_ids': ['https://openalex.org/I4210139435']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5082469062', 'display_name': 'Enrico V. Avvedimento', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I4210139435', 'display_name': 'Institute for Experimental Endocrinology and Oncology', 'ror': 'https://ror.org/04sn06036', 'country_code': 'IT', 'type': 'facility', 'lineage': ['https://openalex.org/I4210139435', 'https://openalex.org/I4210155236']}], 'countries': ['IT'], 'is_corresponding': True, 'raw_author_name': 'Enrico V. Avvedimento', 'raw_affiliation_strings': ['Dipartimento di Biologia e Patologia Molecolare e Cellulare, Istituto di Endocrinologia ed Oncologia Sperimentale del C. N. R., Università Federico II, 80131 Napoli, Italy'], 'affiliations': [{'raw_affiliation_string': 'Dipartimento di Biologia e Patologia Molecolare e Cellulare, Istituto di Endocrinologia ed Oncologia Sperimentale del C. N. R., Università Federico II, 80131 Napoli, Italy', 'institution_ids': ['https://openalex.org/I4210139435']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5069066410', 'display_name': 'Armando Gabrielli', 'orcid': 'https://orcid.org/0000-0002-4509-8772'}, 'institutions': [{'id': 'https://openalex.org/I4210107146', 'display_name': 'Ospedali Riuniti di Ancona', 'ror': 'https://ror.org/01j0qa041', 'country_code': 'IT', 'type': 'healthcare', 'lineage': ['https://openalex.org/I4210107146']}], 'countries': ['IT'], 'is_corresponding': True, 'raw_author_name': 'Armando Gabrielli', 'raw_affiliation_strings': ["Istituto di Clinica Medica Generale, Ematologia ed Immunologia Clinica, Universita' di Ancona, 60020 Ancona"], 'affiliations': [{'raw_affiliation_string': "Istituto di Clinica Medica Generale, Ematologia ed Immunologia Clinica, Universita' di Ancona, 60020 Ancona", 'institution_ids': ['https://openalex.org/I4210107146']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 4, 'corresponding_author_ids': ['https://openalex.org/A5082469062', 'https://openalex.org/A5069066410'], 'corresponding_institution_ids': ['https://openalex.org/I4210139435', 'https://openalex.org/I4210107146'], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 5.945, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 166, 'citation_normalized_percentile': {'value': 0.942565, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 98, 'max': 99}, 'biblio': {'volume': '280', 'issue': '43', 'first_page': '36474', 'last_page': '36482'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10937', 'display_name': 'Telomeres, Telomerase, and Senescence', 'score': 0.9964, 'subfield': {'id': 'https://openalex.org/subfields/2737', 'display_name': 'Physiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10937', 'display_name': 'Telomeres, Telomerase, and Senescence', 'score': 0.9964, 'subfield': {'id': 'https://openalex.org/subfields/2737', 'display_name': 'Physiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T12835', 'display_name': 'FOXO transcription factor regulation', 'score': 0.9913, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10294', 'display_name': 'Cell death mechanisms and regulation', 'score': 0.9854, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/primary', 'display_name': 'Primary (astronomy)', 'score': 0.6562382}, {'id': 'https://openalex.org/keywords/platelet-derived-growth-factor', 'display_name': 'Platelet-derived growth factor', 'score': 0.49364316}], 'concepts': [{'id': 'https://openalex.org/C48349386', 'wikidata': 'https://www.wikidata.org/wiki/Q424361', 'display_name': 'Reactive oxygen species', 'level': 2, 'score': 0.80222225}, {'id': 'https://openalex.org/C2777977315', 'wikidata': 'https://www.wikidata.org/wiki/Q7243056', 'display_name': 'Primary (astronomy)', 'level': 2, 'score': 0.6562382}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.5855178}, {'id': 'https://openalex.org/C2781294074', 'wikidata': 'https://www.wikidata.org/wiki/Q22327352', 'display_name': 'Platelet-derived growth factor', 'level': 5, 'score': 0.49364316}, {'id': 'https://openalex.org/C2775960820', 'wikidata': 'https://www.wikidata.org/wiki/Q408378', 'display_name': 'Growth factor', 'level': 3, 'score': 0.48831722}, {'id': 'https://openalex.org/C89560881', 'wikidata': 'https://www.wikidata.org/wiki/Q101026', 'display_name': 'Platelet', 'level': 2, 'score': 0.46969724}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.46273834}, {'id': 'https://openalex.org/C180361614', 'wikidata': 'https://www.wikidata.org/wiki/Q7202242', 'display_name': 'Platelet-derived growth factor receptor', 'level': 4, 'score': 0.3490433}, {'id': 'https://openalex.org/C502942594', 'wikidata': 'https://www.wikidata.org/wiki/Q3421914', 'display_name': 'Cancer research', 'level': 1, 'score': 0.3317755}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.2800736}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.24504709}, {'id': 'https://openalex.org/C203014093', 'wikidata': 'https://www.wikidata.org/wiki/Q101929', 'display_name': 'Immunology', 'level': 1, 'score': 0.21761686}, {'id': 'https://openalex.org/C170493617', 'wikidata': 'https://www.wikidata.org/wiki/Q208467', 'display_name': 'Receptor', 'level': 2, 'score': 0.12661317}, {'id': 'https://openalex.org/C121332964', 'wikidata': 'https://www.wikidata.org/wiki/Q413', 'display_name': 'Physics', 'level': 0, 'score': 0.0}, {'id': 'https://openalex.org/C1276947', 'wikidata': 'https://www.wikidata.org/wiki/Q333', 'display_name': 'Astronomy', 'level': 1, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D005347', 'descriptor_name': 'Fibroblasts', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D019950', 'descriptor_name': 'Mitogen-Activated Protein Kinase 1', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D048052', 'descriptor_name': 'Mitogen-Activated Protein Kinase 3', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D010982', 'descriptor_name': 'Platelet-Derived Growth Factor', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D017382', 'descriptor_name': 'Reactive Oxygen Species', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D012595', 'descriptor_name': 'Scleroderma, Systemic', 'qualifier_ui': 'Q000473', 'qualifier_name': 'pathology', 'is_major_topic': True}, {'descriptor_ui': 'D018631', 'descriptor_name': 'ras Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D017209', 'descriptor_name': 'Apoptosis', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015152', 'descriptor_name': 'Blotting, Northern', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002478', 'descriptor_name': 'Cells, Cultured', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004249', 'descriptor_name': 'DNA Damage', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005347', 'descriptor_name': 'Fibroblasts', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005434', 'descriptor_name': 'Flow Cytometry', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015151', 'descriptor_name': 'Immunoblotting', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D048369', 'descriptor_name': 'MAP Kinase Kinase 1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D048369', 'descriptor_name': 'MAP Kinase Kinase 1', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D008856', 'descriptor_name': 'Microscopy, Fluorescence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019950', 'descriptor_name': 'Mitogen-Activated Protein Kinase 1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D048052', 'descriptor_name': 'Mitogen-Activated Protein Kinase 3', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008954', 'descriptor_name': 'Models, Biological', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010084', 'descriptor_name': 'Oxidation-Reduction', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010641', 'descriptor_name': 'Phenotype', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010982', 'descriptor_name': 'Platelet-Derived Growth Factor', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010982', 'descriptor_name': 'Platelet-Derived Growth Factor', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D012333', 'descriptor_name': 'RNA, Messenger', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012333', 'descriptor_name': 'RNA, Messenger', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D020133', 'descriptor_name': 'Reverse Transcriptase Polymerase Chain Reaction', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012595', 'descriptor_name': 'Scleroderma, Systemic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013997', 'descriptor_name': 'Time Factors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014162', 'descriptor_name': 'Transfection', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018631', 'descriptor_name': 'ras Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 3, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m502851200', 'pdf_url': 'http://www.jbc.org/article/S0021925820594520/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': True, 'landing_page_url': 'https://www.openaccessrepository.it/record/95517', 'pdf_url': 'https://www.openaccessrepository.it/record/95517/files/fulltext.pdf', 'source': {'id': 'https://openalex.org/S4306402478', 'display_name': 'INFM-OAR (INFN Catania)', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I4210116497', 'host_organization_name': 'Istituto Nazionale di Fisica Nucleare, Sezione di Catania', 'host_organization_lineage': ['https://openalex.org/I4210116497'], 'host_organization_lineage_names': ['Istituto Nazionale di Fisica Nucleare, Sezione di Catania'], 'type': 'repository'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/16081426', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m502851200', 'pdf_url': 'http://www.jbc.org/article/S0021925820594520/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'score': 0.48, 'display_name': 'Life on land', 'id': 'https://metadata.un.org/sdg/15'}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 26, 'referenced_works': ['https://openalex.org/W1509176818', 'https://openalex.org/W1522402713', 'https://openalex.org/W164092231', 'https://openalex.org/W1852817901', 'https://openalex.org/W1975282307', 'https://openalex.org/W1982146148', 'https://openalex.org/W1984950118', 'https://openalex.org/W2000995954', 'https://openalex.org/W2001300582', 'https://openalex.org/W2001316916', 'https://openalex.org/W2001587093', 'https://openalex.org/W2014281330', 'https://openalex.org/W2018132272', 'https://openalex.org/W2022192502', 'https://openalex.org/W2025246092', 'https://openalex.org/W2050389860', 'https://openalex.org/W2051797016', 'https://openalex.org/W2072569792', 'https://openalex.org/W2075134796', 'https://openalex.org/W2079542159', 'https://openalex.org/W2087404852', 'https://openalex.org/W2095149231', 'https://openalex.org/W2122074407', 'https://openalex.org/W2137157955', 'https://openalex.org/W2325361549', 'https://openalex.org/W2334993460'], 'related_works': ['https://openalex.org/W952563013', 'https://openalex.org/W4232367895', 'https://openalex.org/W368310162', 'https://openalex.org/W2313163197', 'https://openalex.org/W2173917538', 'https://openalex.org/W2087890016', 'https://openalex.org/W2078751457', 'https://openalex.org/W1993789860', 'https://openalex.org/W1988539054', 'https://openalex.org/W1452374072'], 'abstract_inverted_index': {'The': [0, 138, 1161, 1271, 1479, 1876, 2009, 2228, 2241, 2475, 2544, 2618, 2711, 2721, 2732, 2864, 2978, 3251, 3329, 3593, 3636, 3852, 4171, 4336, 4626, 5428, 5545], 'levels': [1, 34, 139, 172, 695, 916, 2955, 3026, 3101, 3173, 3297, 3525, 3783, 3817, 3847, 3939, 3986, 4098, 4141, 4218, 4676, 4834, 5002, 5015, 5023, 5135, 5497, 5518, 5557, 5628], 'of': [2, 29, 49, 51, 65, 106, 116, 135, 140, 167, 187, 189, 203, 244, 254, 273, 281, 296, 351, 355, 508, 557, 571, 754, 809, 819, 825, 829, 833, 842, 879, 881, 924, 945, 958, 1003, 1028, 1041, 1171, 1178, 1299, 1315, 1323, 1330, 1338, 1414, 1447, 1470, 1544, 1657, 1660, 1735, 1852, 1935, 2057, 2151, 2225, 2244, 2258, 2289, 2308, 2379, 2426, 2433, 2441, 2463, 2477, 2505, 2551, 2561, 2572, 2579, 2593, 2610, 2679, 2763, 2786, 2871, 2876, 2936, 2956, 2993, 3020, 3049, 3077, 3102, 3122, 3160, 3174, 3189, 3253, 3261, 3303, 3331, 3354, 3373, 3386, 3390, 3453, 3495, 3549, 3554, 3572, 3603, 3632, 3649, 3655, 3664, 3677, 3691, 3735, 3739, 3818, 3832, 3838, 3895, 3949, 3973, 3987, 4021, 4030, 4032, 4099, 4126, 4173, 4252, 4277, 4288, 4300, 4302, 4320, 4325, 4365, 4376, 4399, 4425, 4449, 4601, 4619, 4634, 4636, 4659, 4677, 4780, 4804, 4823, 4896, 4915, 5021, 5046, 5067, 5091, 5098, 5101, 5139, 5146, 5180, 5201, 5296, 5298, 5301, 5315, 5322, 5328, 5379, 5389, 5391, 5396, 5444, 5462, 5489, 5507, 5515, 5535, 5542, 5615, 5629, 5638, 5644, 5650, 5653, 5663, 5708, 5719, 5721, 5724], 'Ras': [3, 88, 107, 141, 226, 245, 300, 494, 543, 882, 914, 1024, 1798, 1809, 1920, 2937, 2976, 2989, 3965, 4108, 4175, 4214, 4637, 4648, 4740, 4781, 4908, 5013, 5022, 5468, 5516, 5530, 5536], 'proteins': [4, 142, 1800, 2069, 3178, 4679, 5537], 'in': [5, 47, 54, 102, 123, 130, 143, 185, 192, 240, 261, 268, 345, 349, 521, 545, 752, 898, 927, 929, 1016, 1398, 1411, 1520, 1526, 1678, 1916, 1925, 1988, 2013, 2102, 2105, 2129, 2448, 2460, 2496, 2568, 2582, 2670, 2690, 2868, 2890, 2967, 3184, 3274, 3298, 3336, 3366, 3450, 3526, 3546, 3596, 3629, 3639, 3652, 3674, 3705, 3790, 3952, 3954, 3968, 4019, 4027, 4134, 4233, 4236, 4240, 4255, 4341, 4346, 4352, 4362, 4472, 4503, 4520, 4527, 4539, 4604, 4669, 4672, 4820, 4854, 4972, 5005, 5036, 5043, 5049, 5057, 5078, 5154, 5172, 5188, 5548, 5648], 'human': [6, 144, 1172, 1179, 2152, 2219, 2944], 'primary': [7, 103, 145, 241, 899, 2943, 3185, 3527, 3791, 3800, 4673, 4751, 4756, 4776, 5025, 5520, 5533, 5549, 5695], 'fibroblasts': [8, 55, 104, 146, 193, 242, 350, 1305, 1549, 1647, 1805, 2099, 2275, 2652, 2945, 3839, 3974, 4492, 4522, 4603, 5104, 5156, 5174, 5224], 'are': [9, 147, 326, 340, 496, 505, 548, 2905, 2933, 3179, 3722, 4014, 4680, 5143, 5205, 5702], 'regulated': [10, 148, 3181, 4651], 'by': [11, 20, 38, 109, 149, 158, 176, 247, 573, 815, 935, 943, 950, 1287, 1530, 1548, 1832, 1892, 1971, 2147, 2314, 2452, 2524, 2940, 2982, 3030, 3059, 3090, 3114, 3120, 3136, 3182, 3196, 3277, 3322, 3334, 3398, 3436, 3471, 3487, 3498, 3605, 3609, 3666, 3684, 3754, 3787, 3867, 3943, 3979, 4085, 4130, 4305, 4318, 4358, 4382, 4415, 4447, 4515, 4536, 4652, 4742, 4785, 4795, 4815, 4847, 4864, 4919, 4925, 4948, 4987, 5030, 5070, 5088, 5103, 5175, 5432, 5438, 5442, 5447, 5558], 'PDGF': [12, 16, 150, 154, 893, 946, 2997, 3031, 3050, 3091, 3095, 3115, 3158, 3183, 3187, 3257, 3314, 3335, 3399, 3414, 3420, 3437, 3449, 3472, 3499, 3517, 3537, 3633, 3695, 3712, 3725, 3914, 3925, 4022, 4786, 4796, 4809, 4824, 4848, 4882, 4890, 4989, 5018, 5209, 5219, 5433, 5478, 5490], '(platelet-derived': [13, 151], 'growth': [14, 120, 152, 258, 314, 436, 473, 1061, 3022, 4743, 5031, 5699], 'factor).': [15, 153], 'induced': [17, 155, 569, 1993, 3043, 3113, 3315, 3497, 3683, 3718, 3729, 3866, 3903, 4794], 'post-transcriptionally': [18, 156], 'Ha-Ras': [19, 36, 157, 174, 568, 897, 1864, 2946, 2959, 3005, 3054, 3088, 3105, 3112, 3161, 3262, 3275, 3296, 3316, 3332, 3365, 3396, 3510, 3523, 3604, 3665, 3680, 3719, 3730, 3749, 3758, 3769, 3778, 3795, 3845, 3864, 3929, 4100, 4227, 4253, 4516, 4538, 4805, 4833, 4845, 4860, 4873, 4974, 4980, 5000, 5132], 'stimulating': [21, 159, 574, 3197, 4033, 5206, 5215], 'reactive': [22, 160, 302, 466], 'oxygen': [23, 161, 303, 310, 467, 519], 'species': [24, 162, 304, 468], '(ROS)': [25, 163, 305], 'and': [26, 31, 67, 74, 82, 94, 111, 122, 133, 164, 169, 205, 212, 220, 232, 249, 260, 271, 286, 301, 335, 493, 518, 553, 561, 691, 750, 805, 894, 906, 948, 984, 996, 1011, 1031, 1039, 1050, 1078, 1101, 1114, 1123, 1143, 1152, 1174, 1278, 1318, 1379, 1418, 1459, 1472, 1489, 1528, 1538, 1662, 1762, 1830, 1844, 1857, 1867, 1890, 1928, 1964, 1978, 2001, 2040, 2081, 2120, 2255, 2273, 2281, 2326, 2381, 2385, 2459, 2470, 2516, 2535, 2574, 2654, 2698, 2716, 2755, 2774, 2817, 2829, 2878, 2888, 2919, 2958, 2985, 3035, 3044, 3104, 3130, 3176, 3191, 3266, 3294, 3310, 3352, 3477, 3520, 3533, 3538, 3551, 3565, 3569, 3579, 3591, 3681, 3708, 3715, 3744, 3746, 3768, 3811, 3815, 3883, 3905, 4013, 4057, 4077, 4088, 4133, 4166, 4178, 4196, 4216, 4222, 4224, 4228, 4239, 4266, 4292, 4330, 4348, 4360, 4396, 4440, 4550, 4597, 4615, 4644, 4745, 4759, 4770, 4787, 4791, 4811, 4849, 4869, 4881, 4945, 4969, 4999, 5016, 5041, 5094, 5133, 5136, 5225, 5267, 5290, 5310, 5394, 5500, 5540, 5551, 5560, 5626, 5636], 'ERK1/2.': [27, 165, 918, 5140], 'Activation': [28, 166, 1921], 'ERK1/2': [30, 76, 112, 168, 214, 250, 581, 690, 886, 1007, 3341, 3374, 3387, 3427, 3434, 3469, 3485, 3496, 3521, 3555, 3682, 3714, 3740, 3752, 3788, 3824, 4188, 4197, 4230, 4788, 4798, 4871, 4892, 4920, 4970, 5266, 5466], 'high': [32, 170, 3767, 3816, 3985, 4074, 4832, 5131, 5229, 5368, 5439], 'ROS': [33, 66, 86, 110, 171, 204, 224, 248, 386, 492, 516, 694, 895, 912, 959, 1030, 1541, 1546, 3190, 3194, 3254, 3271, 3286, 3442, 3456, 3481, 3508, 3519, 3717, 3721, 3764, 3963, 3988, 4080, 4204, 4217, 4359, 4391, 4460, 4510, 4746, 4761, 4793, 4802, 4816, 4968, 4998, 5011, 5134, 5230, 5440, 5485, 5528, 5556, 5630], 'stabilize': [35, 173], 'protein,': [37, 175, 2960, 3006, 3763, 4101], 'inhibiting': [39, 177], 'proteasomal': [40, 178, 4916], 'degradation.': [41, 179], 'We': [42, 99, 180, 237, 560, 794, 919, 2601, 4120, 4507, 4518, 4736, 5008, 5194, 5711], 'found': [43, 181, 684, 891, 4508, 5197], 'a': [44, 127, 182, 265, 522, 876, 904, 921, 1025, 1033, 1655, 1860, 1870, 1917, 2014, 2132, 2233, 2250, 2351, 2556, 2597, 2604, 2656, 2671, 2691, 2726, 2737, 2743, 3037, 3284, 3348, 3370, 3382, 3454, 3493, 3581, 3625, 3646, 3760, 3878, 3885, 4486, 4540, 4592, 4612, 4616, 4631, 4912], 'remarkable': [45, 183, 922], 'example': [46, 184, 923, 4914], 'vivo': [48, 186, 928, 4020, 4342], 'amplification': [50, 188, 2563, 4272, 4596], 'this': [52, 190, 872, 925, 3361, 3558, 3870, 4282, 4620, 5302, 5383, 5651, 5709], 'circuitry': [53, 191, 926], 'derived': [56, 194, 931, 3975, 4069, 4477, 5125], 'from': [57, 195, 550, 932, 1055, 1067, 1083, 1088, 1106, 1116, 1128, 1136, 1145, 1148, 1156, 1308, 1312, 1319, 1646, 1803, 1817, 1910, 2430, 2481, 3976, 4070, 4478, 4874, 5027, 5065, 5126, 5191, 5522], 'systemic': [58, 124, 196, 262, 936, 1017, 1042, 1339, 3980, 4131, 4479, 5071, 5127, 5329], 'sclerosis': [59, 125, 197, 263, 954, 1018, 1340, 4480, 5082, 5128, 5212, 5330], '(scleroderma)': [60, 198], 'lesions,': [61, 199], 'producing': [62, 200], 'vast': [63, 201], 'excess': [64, 202, 957], 'undergoing': [68, 206], 'rapid': [69, 207, 359], 'senescence.': [70, 84, 208, 222], 'High': [71, 209, 4258, 4260], 'ROS,': [72, 210, 1004, 3539, 4075, 4194, 4226, 4259, 4433, 4850, 5464], 'Ha-Ras,': [73, 211, 3650, 3819, 3904], 'active': [75, 213, 512, 835, 986, 3694, 3757, 4229, 4799], 'stimulated': [77, 215, 3029, 3541, 4436, 4514, 5157], 'collagen': [78, 216, 1274, 1280, 2155, 4303, 4426, 5102, 5380, 5397], 'synthesis,': [79, 217], 'DNA': [80, 218, 389, 991, 2616, 4262, 4289, 4532, 5037, 5374], 'damage,': [81, 219, 992, 4533, 5038, 5375], 'accelerated': [83, 221, 5320], 'Conversely': [85, 223], 'or': [87, 225, 831, 1006, 1095, 1827, 1850, 1865, 2232, 3064, 3070, 3289, 3301, 3459, 3504, 3634, 3759, 3835, 3915, 3923, 3926, 3936, 4180, 4206, 4390, 4455, 4459, 4495, 4661, 4668, 4764, 5182, 5465, 5467, 5524, 5641, 5668, 5698, 5700], 'inhibition': [89, 227, 437, 3789, 3894, 5461, 5488], 'interrupted': [90, 228], 'the': [91, 96, 114, 117, 131, 136, 229, 234, 252, 255, 269, 274, 277, 282, 297, 352, 499, 575, 679, 801, 806, 816, 834, 1009, 1013, 1037, 1313, 1320, 1327, 1331, 1336, 1377, 1380, 1486, 1554, 1614, 1649, 1658, 1818, 1900, 2111, 2121, 2142, 2149, 2237, 2245, 2256, 2268, 2306, 2309, 2334, 2449, 2453, 2461, 2464, 2482, 2497, 2552, 2559, 2562, 2569, 2576, 2683, 2699, 2761, 2764, 2830, 2836, 2954, 2994, 3010, 3018, 3021, 3078, 3081, 3123, 3126, 3141, 3172, 3281, 3299, 3391, 3403, 3423, 3446, 3451, 3460, 3531, 3534, 3542, 3547, 3621, 3630, 3653, 3659, 3662, 3675, 3702, 3724, 3733, 3736, 3860, 3874, 3893, 3932, 3959, 4025, 4028, 4124, 4137, 4245, 4275, 4344, 4374, 4384, 4394, 4450, 4499, 4524, 4598, 4609, 4675, 4678, 4778, 4821, 4842, 4851, 4859, 4865, 4926, 4995, 5074, 5092, 5144, 5147, 5185, 5199, 5202, 5218, 5299, 5308, 5312, 5326, 5387, 5505, 5513, 5532, 5552, 5613, 5624, 5627, 5633, 5659, 5706, 5717, 5722], 'signaling': [92, 230, 495, 939, 3375, 3960, 4023, 5148, 5479, 5646], 'cascade': [93, 231], 'restored': [95, 233], 'normal': [97, 235, 1014, 1316, 3337, 4104, 4115, 4491, 4521, 5155, 5171, 5472], 'phenotype.': [98, 236], 'conclude': [100, 238], 'that': [101, 239, 330, 567, 685, 892, 2549, 2575, 3111, 3171, 3260, 3308, 3419, 3468, 3480, 3492, 3516, 3585, 3601, 3614, 3643, 3687, 3711, 3901, 4065, 4186, 4310, 4509, 4739, 4858, 4870, 4889, 5010, 5062, 5167, 5198, 5477, 5512, 5612], 'stabilization': [105, 243, 3796, 3865], 'protein': [108, 246, 312, 470, 915, 1074, 2003, 2831, 2838, 2947, 3025, 3124, 3524, 3938, 4140, 4766, 4782, 4861, 4975, 5001, 5014, 5517], 'amplifies': [113, 251], 'response': [115, 253], 'cells': [118, 256, 930, 955, 989, 1408, 1428, 1480, 1508, 1523, 1555, 1681, 2122, 2293, 2995, 3079, 3142, 3282, 3338, 3367, 3392, 3447, 3543, 3622, 3804, 3875, 3983, 4095, 4117, 4234, 4312, 4367, 4385, 4404, 4451, 4505, 4674, 5026, 5063, 5331, 5392, 5521, 5550], 'to': [119, 257, 292, 913, 999, 1023, 1396, 1980, 2053, 2083, 2260, 2266, 2278, 2612, 2742, 3003, 3009, 3147, 3407, 3441, 3475, 3502, 3799, 3823, 3888, 3964, 4016, 4114, 4212, 4244, 4408, 4432, 4544, 4750, 4830, 4841, 4984, 5217, 5227, 5370, 5471, 5529, 5620], 'factors': [121, 259, 4744], 'represents': [126, 264], 'critical': [128, 266], 'factor': [129, 267, 474, 1062], 'onset': [132, 270], 'progression': [134, 272], 'disease.': [137, 275], 'Although': [276], 'detailed': [278], 'molecular': [279, 1034], 'nature': [280], 'link': [283, 3535, 4593, 4996], 'between': [284, 800, 1376, 3350, 3536, 4594, 4997], 'oncogenesis': [285], 'senescence': [287, 360, 5321, 5697], 'remains': [288], 'obscure,': [289], 'they': [290, 2566, 3728, 4607], 'appear': [291], 'be': [293, 4813, 4985], 'two': [294, 327, 1518, 2577], 'sides': [295], 'same': [298, 1487, 3404, 3933, 4500], 'coin.': [299], '3The': [306], 'abbreviations': [307], 'used': [308, 1384, 2265, 2345, 2581, 3880], 'are:ROSreactive': [309], 'speciesPKAcAMP-dependent': [311], 'kinasePDGFplatelet-derived': [313], 'factorPBSphosphate-buffered': [315], 'salineGSTglutathione': [316], 'S-transferaseFCSfetal': [317], 'calf': [318, 480], 'serumFACSfluorescence-activated': [319], 'cell': [320, 483, 2964, 4279, 4646, 5622], 'sorterNACN-acetyl': [321], 'cysteineERKextracellular': [322], 'signal-regulated': [323, 488], 'kinaseDPIdiphenylene': [324], 'iodonium': [325, 491, 1134], 'important': [328, 798], 'players': [329], 'underlie': [331], 'both': [332], 'phenotypes': [333, 5662], '(transformation': [334], 'senescence),': [336], 'but': [337, 3032], 'their': [338], 'effects': [339, 818, 3690, 4883, 5314, 5554], 'somewhat': [341], 'enigmatic.': [342], 'For': [343, 2044], 'example,': [344], 'mammalian': [346], 'cells,': [347, 3801, 5696], 'expression': [348, 832, 1987, 3831, 4658], 'oncogenic': [353, 802], 'allele': [354, 837], 'ras': [356, 810], '(v-Ha-Ras)': [357], 'triggers': [358, 5200], '(1Serrano': [361], 'M.': [362, 595, 610, 667, 697, 760, 762, 965, 1182, 1290, 1348, 1352, 1578, 1594, 1596, 1625, 1691, 1771, 1775, 2359, 2845, 3994, 4039, 4044, 4048, 4148, 4153, 4157, 4559, 4575, 4577, 5236, 5240, 5272, 5277, 5281, 5563], 'Lin': [363], 'A.W.': [364], 'McCurrach': [365], 'M.E.': [366, 2405], 'Beach': [367], 'D.': [368, 2179, 4702, 4953], 'Lowe': [369], 'S.W.': [370], 'Cell.': [371, 2199, 4722], '1997;': [372, 601, 768], '88:': [373], '593-602Abstract': [374], 'Full': [375, 377, 456, 458, 644, 646, 731, 733, 771, 773, 865, 1216, 1218, 1254, 1256, 1365, 1367, 1788, 1790, 2203, 2205, 2414, 2416, 4726, 4728, 5253, 5255, 5597, 5599, 5688], 'Text': [376, 378, 457, 459, 645, 647, 732, 734, 772, 774, 866, 1217, 1219, 1255, 1257, 1366, 1368, 1789, 1791, 2204, 2206, 2415, 2417, 4727, 4729, 5254, 5256, 5598, 5600, 5689], 'PDF': [379, 460, 648, 735, 775, 867, 1220, 1258, 1369, 1792, 2207, 2418, 4730, 5257, 5601, 5690], 'PubMed': [380, 405, 428, 461, 538, 604, 649, 673, 736, 776, 791, 868, 979, 1221, 1259, 1370, 1603, 1639, 1705, 1793, 2208, 2373, 2419, 2859, 3216, 3246, 4008, 4584, 4731, 4940, 4963, 5119, 5258, 5346, 5357, 5412, 5423, 5455, 5602, 5691], 'Scopus': [381, 406, 429, 462, 539, 605, 650, 674, 737, 777, 980, 1222, 1260, 1371, 1604, 1640, 1706, 1794, 2209, 2374, 2420, 2860, 3217, 3247, 4009, 4585, 4732, 4941, 4964, 5120, 5259, 5347, 5358, 5413, 5424, 5456, 5603], '(3994)': [382], 'Google': [383, 408, 431, 464, 541, 607, 652, 676, 739, 779, 792, 869, 982, 1224, 1262, 1373, 1606, 1642, 1673, 1708, 1725, 1796, 2211, 2376, 2422, 2862, 3219, 3249, 4011, 4587, 4734, 4943, 4966, 5122, 5261, 5349, 5360, 5415, 5426, 5458, 5605, 5692], 'Scholar).': [384, 465, 542, 677, 740, 793, 870, 1374, 1607, 1643, 1674, 1726, 1797, 2377, 2423, 2863, 3250, 4588, 4735, 4967, 5123, 5361, 5427, 5459, 5693], 'Also,': [385, 3830], 'mediate': [387], 'apoptosis,': [388, 4411], 'damage': [390, 4290], '(2Chang': [391], 'H.': [392, 528, 2177, 3232, 3238, 4700], 'Oehrl': [393], 'W.': [394], 'Elsner': [395], 'P.': [396, 612, 657, 699, 961, 967, 1184, 1344, 1621, 1627, 1687, 1693, 1767, 2355, 2361, 2841, 2847, 3990, 3996, 4929, 4931, 5232, 5565], 'Thiele': [397], 'J.J.': [398], 'Free': [399], 'Radic.': [400], 'Res.': [401, 424, 3212], '2003;': [402, 535, 3243], '37:': [403], '655-663Crossref': [404], '(66)': [407, 5121, 5348, 5414], 'Scholar),': [409, 432, 1225, 1263, 5262], 'RNA': [410, 2324, 2330, 2342, 2384, 2608], 'synthesis': [411, 2387], '(3Chen': [412, 3200], 'K.C.': [413, 3201], 'Zhou': [414, 3202], 'Y.': [415, 585, 3203], 'Xing': [416, 3204], 'K.': [417, 419, 583, 1235, 1237, 1243, 3205, 3207, 5110, 5337, 5403], 'Krysan': [418, 3206], 'Lou': [420, 3208], 'M.F.': [421, 622, 709, 1194, 3209, 5575], 'Exp.': [422, 3210], 'Eye': [423, 3211], '2004;': [425, 670, 2200, 3213, 4723], '78:': [426, 3214], '1057-1067Crossref': [427, 3215], '(69)': [430, 3218], 'as': [433, 435, 1341, 1684, 1764, 2390, 2900, 2907, 3806, 5319, 5538], 'well': [434], '(4Pani': [438], 'G.': [439, 624, 628, 711, 715, 971, 1196, 1200, 1572, 1631, 1667, 1697, 1711, 2365, 2401, 2851, 4000, 4553, 5577, 5581], 'Colavitti': [440], 'R.': [441, 445, 614, 630, 655, 701, 717, 1186, 1202, 1245, 1574, 1576, 1715, 2175, 4040, 4149, 4555, 4557, 4698, 5273, 5567, 5583], 'Bedogni': [442], 'B.': [443, 3236], 'Anzevino': [444], 'Borrello': [446], 'S.': [447, 618, 626, 659, 661, 663, 705, 713, 826, 969, 1190, 1198, 1354, 1592, 1629, 1695, 1777, 2171, 2363, 2849, 3998, 4573, 4694, 5242, 5571, 5579, 5664], 'Galeotti': [448], 'T.': [449, 532, 597, 616, 703, 1188, 1247, 2183, 2197, 4046, 4155, 4706, 4720, 5108, 5279, 5335, 5352, 5401, 5418, 5450, 5569], 'J.': [450, 534, 668, 765, 785, 850, 859, 1239, 1241, 1248, 1359, 1668, 1782, 2408, 3222, 3242, 5247, 5673, 5682], 'Biol.': [451, 640, 727, 766, 860, 1212, 1249, 2409, 5593, 5683], 'Chem.': [452, 767, 861, 1250, 2410, 5684], '2000;': [453, 1251, 2411], '275:': [454, 602, 1252, 2412], '38891-38899Abstract': [455], '(131)': [463], 'cAMP-dependent': [469], 'kinase': [471, 489, 3383, 3627], 'platelet-derived': [472, 1060], 'phosphate-buffered': [475, 1415], 'saline': [476, 1416], 'glutathione': [477], 'S-transferase': [478], 'fetal': [479], 'serum': [481, 4029, 4238], 'fluorescence-activated': [482], 'sorter': [484], 'N-acetyl': [485], 'cysteine': [486], 'extracellular': [487], 'diphenylene': [490, 1133], 'linked.': [497], 'In': [498, 871, 2139, 3402, 4642, 4753, 4775, 5160, 5382, 5504, 5694], 'yeast': [500, 843], 'Saccharomyces': [501], 'cerevisiae,': [502], 'cAMP-PKA': [503, 551], 'signals': [504, 5619], 'located': [506, 3384], 'downstream': [507, 3723, 4174], 'Ras.': [509], 'However,': [510, 3489, 3668, 4819, 5474], 'constitutively': [511, 3756], 'Ras2Val19': [513], 'affects': [514], 'endogenous': [515], 'production': [517, 570, 3195, 3255, 3765, 4511, 5100], 'consumption': [520], 'PKA-independent': [523], 'way': [524], '(5Hlavata': [525], 'L.': [526, 1346, 1769, 2189, 4712, 5234], 'Aguilaniu': [527], 'Pichova': [529], 'A.': [530, 636, 723, 973, 1208, 1350, 1358, 1588, 1633, 1699, 1719, 1773, 1781, 2367, 2393, 2395, 2399, 2853, 3234, 4002, 4050, 4052, 4058, 4159, 4161, 4167, 4569, 4771, 5238, 5246, 5283, 5285, 5291, 5589], 'Nystrom': [531], 'EMBO': [533], '22:': [536], '3337-3345Crossref': [537], '(95)': [540], 'isoforms': [544, 5618], 'higher': [546, 4097, 4143], 'eukaryotes': [547], 'uncoupled': [549], 'signaling,': [552], 'control': [554, 2234, 2606, 4116], 'many': [555], 'aspects': [556], 'redox': [558, 5543], 'metabolism.': [559], 'others': [562], 'have': [563, 683, 890, 4121, 4468, 4737, 5053, 5151, 5195], 'presented': [564, 3513], 'data': [565, 1021, 3169, 3512, 3637, 3853, 4471, 4590, 4627, 4852, 5501], 'showing': [566], 'superoxide': [572, 1615], 'membrane': [576, 746, 3128], 'NADPH': [577, 3198, 3290, 3461, 5445], 'oxidase': [578, 3199, 3291, 3462, 5446], 'complex': [579, 4599], 'via': [580, 689, 3518, 3713, 3716, 4891, 4950], '(6Irani': [582], 'Xia': [584], 'Zweier': [586], 'J.L.': [587], 'Sollott': [588], 'S.J.': [589], 'Der': [590], 'C.J.': [591], 'Fearon': [592], 'E.R.': [593], 'Sundaresan': [594], 'Finkel': [596], 'Goldschmidt-Clermont': [598], 'P.J.': [599], 'Science.': [600], '1649-1652Crossref': [603], '(1441)': [606], 'Scholar,': [608, 653, 780, 1709, 3220, 5350, 5416], '7Santillo': [609], 'Mondola': [611, 656, 698, 1183, 5564], 'Seru': [613, 700, 1185, 5566], 'Annella': [615, 702, 1187, 5568], 'Cassano': [617, 704, 1189, 1591, 4572, 5570], 'Ciullo': [619, 706, 1191, 5572], 'I.': [620, 707, 1192, 5573], 'Tecce': [621, 708, 1193, 5574], 'Iacomino': [623, 710, 1195, 5576], 'Damiano': [625, 658, 712, 1197, 5578], 'Cuda': [627, 714, 1199, 5580], 'Paterno': [629, 716, 1201, 1573, 4554, 5582], 'Martignetti': [631, 718, 1203, 5584], 'V.': [632, 719, 1204, 4054, 4163, 5287, 5585], 'Mele': [633, 720, 1205, 1589, 2396, 4570, 5586], 'E.': [634, 721, 764, 1206, 1590, 2397, 4055, 4164, 4571, 5112, 5288, 5339, 5405, 5587], 'Feliciello': [635, 722, 1207, 5588], 'Avvedimento': [637, 664, 724, 1209, 1597, 2406, 4578, 5590], 'E.V.': [638, 665, 725, 1210, 1598, 2407, 4579, 5591], 'Curr.': [639, 726, 1211, 5592], '2001;': [641, 728, 788, 976, 1213, 1636, 1702, 2370, 2856, 4005, 5594], '11:': [642, 729, 1214, 5595], '614-619Abstract': [643, 730, 1215, 5596], '(63)': [651, 738, 1223, 5604], '8Seru': [654], 'Svegliati': [660], 'Agnese': [662], 'Santillo': [666, 1595, 4576], 'Neurochem.': [669], '91:': [671], '613-622Crossref': [672], '(40)': [675], 'On': [678], 'other': [680, 4181], 'hand,': [681], 'we': [682, 874, 889, 2961, 3139, 3279, 3363, 3412, 3444, 3490, 3540, 3560, 3619, 3872, 3970, 4284, 4467, 4489, 4887, 4900, 5052, 5060, 5150, 5165, 5168, 5475, 5510], 'Ki-Ras-stimulated': [686], 'mitochondrial': [687], 'MnSOD': [688], 'reduced': [692, 3748, 4381, 5495], 'cellular': [693, 1029, 2329, 3587], '(7Santillo': [696, 1181, 5562], 'Different': [741], 'anchors': [742], 'may': [743, 5034, 5657], 'dictate': [744], 'different': [745, 1911, 2287, 3038, 5546, 5553, 5621], 'compartments,': [747], 'localizing': [748], 'Ha': [749], 'Ki-Ras': [751, 1180, 1866, 2382, 3024, 3040, 3177, 3782, 3935, 4496, 4545, 4662, 4765, 5181, 5561], 'proximity': [753], 'specific': [755, 2465, 2895, 2988, 3072], 'substrates': [756], '(9Yan': [757], 'Z.': [758, 4957], 'Chen': [759], 'Perucho': [761], 'Friedman': [763], '272:': [769], '30928-30936Abstract': [770], '(56)': [778], '10Prior': [781], 'I.A.': [782], 'Hancock': [783], 'J.F.': [784], 'Cell': [786, 1117], 'Sci.': [787], '114:': [789], '1603-1608Crossref': [790], 'note,': [795], 'also,': [796], 'an': [797, 3117, 3358, 5084], 'difference': [799], 'activated': [803, 3470, 4191, 4315, 4986], 'form': [804], 'wild-type': [807, 844, 5670], 'version': [808], 'genes.': [811, 5381], 'This': [812, 901, 938, 3318, 4371, 5362, 5656], 'is': [813, 941, 2486, 3319, 4649, 4663, 4747, 4783, 4806, 4827, 4862, 4911, 4923, 4946, 4981, 5003, 5055, 5083, 5364, 5386, 5436, 5480], 'illustrated': [814, 3704], 'opposing': [817], 'these': [820, 3168, 4071, 4094, 4278, 4366, 4443, 4470, 4978, 5616], 'forms': [821], 'on': [822, 885, 1838, 2006, 2077, 2651, 2666, 2883, 3426, 3732, 3928, 4808, 5555, 5705], 'life': [823, 839, 847], 'span': [824, 848], 'cerevisiae:': [827], 'deletion': [828], 'ras2': [830, 5669], 'RASVal19': [836], 'decreased': [838, 3008], 'span;': [840], 'overexpression': [841, 5179], 'RAS2': [845], 'extended': [846], '(11Sun': [849, 5672], 'Kale': [851, 5674], 'S.P.': [852, 5675], 'Childress': [853, 5676], 'A.M.': [854, 5677], 'Pinswasdi': [855, 5678], 'C.': [856, 2185, 2403, 3224, 4708, 5679], 'Jazwinski': [857, 5680], 'S.M.': [858, 5681], '1994;': [862, 5685], '269:': [863, 5686], '18638-18645Abstract': [864, 5687], 'work,': [873], 'present': [875, 4340, 4502], 'novel': [877, 905, 4632], 'level': [878, 1570, 4633], 'regulation': [880, 4635, 5514], 'proteins,': [883, 2965, 4638], 'dependent': [884, 5704], 'signaling.': [887, 3556, 5019], 'Specifically,': [888], 'induce': [896, 3004, 3522, 4762, 5268], 'fibroblasts.': [900, 1019, 3186, 3528, 3792, 4752, 5473], 'has': [902], 'revealed': [903, 1831], 'hitherto': [907], 'unknown': [908], 'pathway,': [909], 'which': [910, 2455, 3007, 3378, 3575, 3820, 4412, 4428, 5033, 5263, 5324], 'links': [911], 'through': [917, 3892], 'find': [920, 5061, 5476], 'patients': [933, 1324, 3977, 4031, 4072, 4128, 4481, 5068, 5213], 'affected': [934, 3786, 3978, 4129, 5069], 'sclerosis.': [937, 1043, 3981], 'pathway': [940, 3961, 5051, 5149], 'initiated': [942], 'stimulation': [944, 1849, 3258, 4018, 4810, 5029], 'receptor': [947, 3696, 3890, 4035, 5434, 5491], 'maintained': [949, 4681, 4814], 'ROS-ERK1/2': [951], 'signals.': [952, 5526, 5544], 'Systemic': [953, 5081, 5211], 'produce': [956, 3984, 5228], '(12Sambo': [960, 1620, 1686, 2354, 2840, 3989], 'Baroni': [962, 1622, 1688, 2356, 2842, 3991], 'S.S.': [963, 1623, 1689, 2357, 2843, 3992], 'Luchetti': [964, 1355, 1624, 1690, 1778, 2358, 2844, 3993, 5243], 'Paroncini': [966, 1626, 1692, 2360, 2846, 3995], 'Dusi': [968, 1353, 1628, 1694, 1776, 2362, 2848, 3997, 5241], 'Orlandini': [970, 1630, 1696, 2364, 2850, 3999], 'Gabrielli': [972, 1357, 1632, 1698, 1780, 2366, 2852, 4001, 5245], 'Arthritis': [974, 1634, 1700, 2368, 2854, 4003], 'Rheum.': [975, 1635, 1701, 2369, 2855, 4004], '44:': [977, 1637, 1703, 2371, 2857, 4006], '2653-2664Crossref': [978, 1638, 1704, 2372, 2858, 4007], '(213)': [981, 1641, 1707, 2375, 2861, 4010], 'Scholar)': [983, 2212, 4012, 4944, 5606], 'maintain': [985, 4797, 4831], 'Ras-ERK1/2.': [987], 'These': [988, 1020, 3982, 4354, 4403, 4589, 5141, 5221], 'accumulate': [990], 'activate': [993], 'ROS-dependent': [994], 'genes': [995, 2472, 4304], 'become': [997], 'prone': [998], 'stress-induced': [1000, 4296, 4410], 'apoptosis.': [1001, 5044], 'Inhibition': [1002, 5295], 'Ras,': [1005, 4195, 5305], 'down-regulates': [1008], 'loop': [1010, 5303, 5429], 'restores': [1012], 'phenotype': [1015, 4276, 4600, 5187, 5204, 5327, 5363], 'point': [1022], 'key': [1026, 5075], 'sensor': [1027], 'suggest': [1032, 4888, 5611], 'tool': [1035], 'for': [1036, 1273, 1279, 1335, 1385, 1435, 1461, 1491, 1560, 1998, 2060, 2283, 2346, 2467, 2489, 2541, 2687, 2708, 2767, 2776, 2823, 2880, 2998, 3863, 4024, 4611, 4835, 5482, 5492, 5726], 'diagnosis': [1038, 1337, 4614], 'therapy': [1040, 4618], "Reagents—Dulbecco's": [1044], 'modified': [1045], "Eagle's": [1046], 'medium,': [1047, 2119], 'FCS,': [1048, 1451], 'l-glutamine,': [1049], 'pen-strept-anfotB': [1051], 'solution': [1052, 2015, 2705], 'were': [1053, 1081, 1104, 1126, 1164, 1284, 1306, 1383, 1394, 1409, 1429, 1481, 1509, 1524, 1730, 1801, 1821, 1854, 1882, 1897, 1914, 1923, 1969, 2011, 2048, 2070, 2087, 2100, 2126, 2247, 2276, 2294, 2436, 2493, 2546, 2567, 2621, 2649, 2664, 2685, 2714, 2734, 2758, 2781, 2886, 2914, 2928, 2980, 3027, 3272, 3784, 3821, 3940, 4189, 4199, 4210, 4339, 4349, 4356, 4405, 4445, 4884], 'obtained': [1054, 1087, 1127, 1307, 2146], 'Invitrogen,': [1056], 'Life': [1057], 'Technologies.': [1058], 'Recombinant': [1059], 'BB': [1063], '(PDGF-BB)': [1064], 'was': [1065, 1086, 1550, 1611, 1652, 1682, 1992, 2004, 2113, 2213, 2264, 2312, 2331, 2343, 2388, 2522, 2723, 2833, 2866, 2897, 2948, 3001, 3041, 3056, 3116, 3132, 3438, 3473, 3500, 3607, 3616, 3645, 3766, 3779, 3797, 3908, 3966, 4082, 4110, 4142, 4273, 4379, 4413, 4429, 4434, 4512], 'purchased': [1066, 1082, 1105], 'Peprotech': [1068], '(Rocky': [1069], 'Hill,': [1070], 'NJ);': [1071], 'FTI-277,': [1072], 'farnesyl': [1073, 4086, 4207, 4387, 4456], 'transferase': [1075, 4087, 4208, 4388, 4457], 'inhibitor': [1076, 3083, 3292, 3372, 3463, 3882], 'H-Ampamb-Phe-Met-OH,': [1077], 'PD': [1079, 2299, 3563], '98059,': [1080], 'Calbiochem.': [1084], 'Genistein': [1085], 'ICN': [1089], 'Biomedicals': [1090, 1138], '(Aurora,': [1091], 'OH).': [1092], 'Anti-Ha-Ras': [1093, 1392], '(F235': [1094], 'SC520),': [1096], 'anti-Ki-Ras': [1097], '(F234),': [1098], 'anti-pan-Ras': [1099], '(F132),': [1100], 'anti-Rac1': [1102], 'antibodies': [1103, 1125, 1475, 1501, 1515, 2896, 3073, 3326, 5207, 5216, 5222], 'Santa': [1107], 'Cruz': [1108, 1477, 1812], 'Biotechnology.': [1109], 'Anti-phospho-p44/42': [1110], 'MAP': [1111], 'kinase,': [1112], 'anti-phospho-SAPK/JNK': [1113], 'anti-AKT': [1115], 'Signaling': [1118, 3951, 5048], 'Technology': [1119], '(Beverly,': [1120], 'MA).': [1121], 'Anti-H2AX': [1122], 'anti-p21WAF': [1124], 'Upstate': [1129], 'Biotechnology': [1130], '(Charlottesville,': [1131], 'VA);': [1132], '(DPI)': [1135, 3293], 'Alexis': [1137], '(Lansen,': [1139], 'CH),': [1140], 'N-acetyl-l-cysteine': [1141], '(NAC),': [1142], 'cycloheximide': [1144, 3084], 'Sigma.': [1146], 'U0126': [1147, 3566], 'Promega': [1149], '(Madison,': [1150], 'WI)': [1151], '2′,7′-dichlorofluorescein': [1153], 'diacetate': [1154], '(DCFH-DA)': [1155], 'Molecular': [1157, 1873], 'Probes': [1158], '(Eugene,': [1159], 'OR).': [1160], 'following': [1162, 1814, 2236, 2350, 2619, 2718, 2760, 3256], 'plasmids': [1163], 'employed:': [1165], 'dominant-negative': [1166, 1226, 1264, 3582], 'Ha-rasN17,': [1167], 'V12': [1168, 1175], 'positive': [1169, 1176], 'variant': [1170, 1177, 1228, 1232, 1266, 3584], 'Ha-ras': [1173], 'Rac': [1227, 1231], '(Rac1N17),': [1229], 'dominant-positive': [1230, 3761], '(Rac1V12)': [1233], '(13Suzukawa': [1234], 'Miura': [1236], 'Mitsushita': [1238], 'Resau': [1240], 'Hirose': [1242], 'Crystal': [1244], 'Kamata': [1246], '13175-13178Abstract': [1253], '(230)': [1261], 'MEK': [1265, 3380, 3577, 3583, 3588, 3610, 3762, 4089, 4202, 4418, 4454], 'pBabe-MKK-S217A': [1267], '(rat': [1268], 'GenBank™': [1269], 'z30163).': [1270], 'cDNA': [1272, 2386, 2427, 2611], 'α1(I)': [1275], '(Hf677': [1276], 'clone)': [1277, 1283], 'α2(I)': [1281], '(Hf32': [1282], 'kindly': [1285], 'donated': [1286], 'Dr.': [1288, 2226, 5713], 'Ch.': [1289], 'Lapiere': [1291], '(Laboratorie': [1292], 'de': [1293], 'Biologie': [1294], 'des': [1295], 'Tissues': [1296], 'Conjonctifs,': [1297], 'University': [1298, 5723], 'Liege,': [1300], 'Belgium).': [1301], 'Primary': [1302], 'Fibroblasts—Human': [1303], 'skin': [1304, 1322, 5093], 'punch': [1309], 'biopsies': [1310], 'taken': [1311], 'forearms': [1314], 'volunteers': [1317], 'involved': [1321, 3273], 'who': [1325], 'fulfilled': [1326], 'preliminary': [1328], 'criteria': [1329, 2762], 'American': [1332], 'Rheumatism': [1333], 'Association': [1334], 'described': [1342, 1685, 1765, 2239, 2352, 2391, 2901, 5054, 5152], '(14Sambo': [1343, 1766, 5231], 'Jannino': [1345, 1768, 5233], 'Candela': [1347, 1770, 5235], 'Salvi': [1349, 1772, 5237], 'Donini': [1351, 1774, 5239], 'M.M.': [1356, 1779, 5244], 'Investig.': [1360, 1783, 5248], 'Dermatol.': [1361, 1784, 5249], '1999;': [1362, 1722, 1785, 5250], '112:': [1363, 1786, 5251], '78-84Abstract': [1364, 1787, 5252], '(100)': [1372, 1795, 5260], 'Fibroblasts': [1375, 2663], 'fourth': [1378], 'sixth': [1381], 'subpassage': [1382], 'all': [1386, 4135, 4523], 'experiments.': [1387, 2270], 'Flow': [1388], 'Cytometric': [1389], 'Analysis': [1390], 'with': [1391, 1421, 1431, 1444, 1467, 1485, 1497, 1511, 1556, 1732, 1806, 1825, 1859, 1869, 1884, 1930, 1983, 1994, 2050, 2066, 2072, 2089, 2116, 2215, 2249, 2286, 2298, 2438, 2588, 2659, 2736, 2783, 2835, 2873, 2894, 2974, 2987, 2996, 3036, 3067, 3080, 3125, 3143, 3153, 3283, 3324, 3369, 3393, 3409, 3448, 3484, 3544, 3623, 3840, 3876, 3913, 3924, 4103, 4386, 4417, 4452, 4493, 5158, 5728, 5736], 'Antibody—Cells': [1393], 'grown': [1395, 2277], 'semiconfluency': [1397], '60-mm': [1399], 'culture': [1400, 1728, 2106, 2118, 2779, 4347, 4400], 'dishes.': [1401], 'After': [1402, 1517, 2108, 2675], 'trypsin': [1403], 'detachment,': [1404], '5': [1405, 2794, 4308, 4529], '×': [1406, 2821], '105': [1407], 'suspended': [1410], '1': [1412, 1758, 1954, 1957, 1981, 1995, 2033, 2439, 2517, 2536, 2797, 2813, 2910, 3265, 4790], 'ml': [1413, 1446, 1734, 1932, 2056, 2678, 2785, 2870], '(PBS)': [1417], 'fixed': [1419, 2715], 'overnight': [1420], '1%': [1422, 1743, 1943], 'formaldehyde': [1423], 'at': [1424, 1438, 1464, 1494, 1504, 1563, 1975, 2063, 2508, 2513, 2519, 2527, 2532, 2538, 2558, 2695, 2819, 2826, 4497, 5716], 'room': [1425], 'temperature.': [1426], 'Next,': [1427], 'permeabilized': [1430], '0.1%': [1432, 1454, 1749, 2968], 'Triton': [1433, 1455, 2804], 'X-100': [1434, 1456], '40': [1436, 2791, 2869], 'min': [1437, 1463, 1493, 1562, 2062, 2297, 2507, 2518, 2537, 2825, 2882, 3000, 3014, 3571], '4': [1439, 1465, 1495, 1976, 2064, 2827], '°C,': [1440, 2510, 2515, 2529, 2534, 2828], 'washed': [1441, 1483, 1924, 2012], 'four': [1442], 'times': [1443], '2': [1445, 1751, 1755, 2030, 2284, 2424, 2677, 2806, 2810, 3707, 5617], 'PBS': [1448, 1527, 1927], 'containing': [1449, 2016, 2607], '2%': [1450], '0.01%': [1452], 'NaN3,': [1453], '(buffer': [1457], 'A),': [1458], 'incubated': [1460, 1490, 1510, 2049, 2686, 2879], '45': [1462, 1492, 2511, 2525, 2530], '°C': [1466, 1496, 1565, 2065, 2521, 2540, 2697], '1:50': [1468, 1505], 'dilution': [1469], 'monoclonal': [1471, 1861, 3069], 'polyclonal': [1473, 1807, 3071], 'anti-Ha-Ras': [1474, 1826, 3068, 3325], '(Santa': [1476, 1811], 'Biotechnology).': [1478, 2094], 'then': [1482, 1868, 2344], 'twice': [1484], 'buffer': [1488, 1521, 1740, 1937, 2450, 2787, 2872], 'Cy2-conjugated': [1498, 1512], 'anti-mouse': [1499, 1513], 'IgG': [1500, 1514], '(Amersham': [1502, 1834], 'Biosciences)': [1503], 'dilution.': [1506], 'Control': [1507], 'alone.': [1516], 'washes': [1519], 'A,': [1522], 'resuspended': [1525, 2867], 'analyzed': [1529, 1898, 2554], 'flow': [1531], 'cytometry': [1532], 'using': [1533, 1613, 1654, 1899, 2131, 2317, 2333, 2725, 2916], 'FACScan': [1534], '(BD,': [1535], 'Heidelberg,': [1536], 'Germany)': [1537], 'WinMDI': [1539], 'software.': [1540], 'Determination—Fluorometric': [1542], 'determination': [1543], 'intracellular': [1545], 'generated': [1547, 4351], 'estimated': [1551, 1612], 'after': [1552, 2305, 2655, 2702, 3015], 'loading': [1553], 'DCFH-DA': [1557], '(10': [1558], 'μm)': [1559], '15': [1561, 2824, 2881, 2999, 3570], '37': [1564, 2696], 'before': [1566, 1848, 2653, 3150, 4343], 'assessing': [1567], 'DCF': [1568], 'fluorescence': [1569, 1893, 2727, 3060, 5729], '(15Cuda': [1571], 'Ceravolo': [1575, 4556], 'Candigliota': [1577, 4558], 'Perrotti': [1579, 4560], 'N.': [1580, 1713, 4561], 'Perticone': [1581, 4562], 'F.': [1582, 1586, 3228, 4042, 4151, 4563, 4567, 5275], 'Faniello': [1583, 4564], 'M.C.': [1584, 4565], 'Schepis': [1585, 4566], 'Ruocco': [1587, 4568], 'Bifulco': [1593, 4574], 'Circulation.': [1599, 4580], '2002;': [1600, 4581, 4959], '105:': [1601, 4582], '968-974Crossref': [1602, 4583], '(84)': [1605, 4586], 'Superoxide': [1608], 'anion': [1609], 'release': [1610, 1645], 'dismutase-inhibitable': [1616], 'cytochrome': [1617], 'c': [1618], 'reduction': [1619], 'H2O2': [1644, 3545, 3606, 3615, 3644, 3692, 3841, 3927, 4078, 4826], 'into': [1648, 3360], 'overlying': [1650], 'medium': [1651, 2112], 'assayed': [1653, 4317], 'modification': [1656], 'method': [1659, 2134], 'Valletta': [1661], 'Berton': [1663, 1666], '(16Valletta': [1664], 'E.A.': [1665], 'Immunol.': [1669], '1987;': [1670], '138:': [1671], '4366-4373PubMed': [1672], 'Oxidative': [1675], 'activity': [1676, 4109], 'imaging': [1677], 'living,': [1679], 'transfected': [1680, 4490], 'evaluated': [1683], '17Orlandini': [1710], 'Ronda': [1712], 'Gatti': [1714], 'Gazzola': [1716], 'G.C.': [1717], 'Borghetti': [1718], 'Methods': [1720], 'Enzymol.': [1721], '307:': [1723], '340-350PubMed': [1724], 'Immunoblotting—Cell': [1727], 'plates': [1729, 2780], 'lysed': [1731, 1929, 2782], '0.3': [1733], 'cold': [1736], 'radioimmune': [1737], 'precipitation': [1738, 2971], 'assay': [1739, 2839, 2972], '(1×': [1741], 'PBS,': [1742], 'Nonidet': [1744, 1944, 2028], 'P-40,': [1745, 1945, 2029], '0.5%': [1746, 2027], 'sodium': [1747, 1753, 1959, 2035, 2808], 'deoxycholate,': [1748], 'SDS,': [1750], 'mm': [1752, 1759, 1939, 1947, 1950, 1955, 1958, 1996, 2018, 2023, 2031, 2034, 2789, 2792, 2795, 2798, 2801, 2807, 2814, 3145], 'orthovanadate,': [1754, 2809], 'μg/ml': [1756, 1962, 1966, 2038, 2042, 2811], 'aprotinin,': [1757, 2812], 'phenylmethylsulfonyl': [1760, 2815], 'fluoride)': [1761, 2816], 'processed': [1763], 'Immunoprecipitation—Ras': [1799], 'immunoprecipitated': [1802, 2962], 'cultured': [1804, 1837, 2665, 4235], 'anti-pan': [1808], 'antibody': [1810, 1862], 'Biotechnology)': [1813], 'recommended': [1815], 'procedures': [1816], 'manufacturer.': [1819], 'Immunocomplexes': [1820], 'isolated,': [1822], 'electrophoresed,': [1823], 'immunoblotted': [1824], '-Ki-Ras': [1828], 'antibodies,': [1829, 3411], 'chemiluminescence': [1833], 'Biosciences).': [1835], 'Immunofluorescence—Fibroblasts,': [1836], 'Lab-Tek': [1839], 'chamber': [1840], 'glass': [1841], 'slides': [1842, 1912], '(Nalge-Nunc)': [1843], 'starved': [1845], '48': [1846, 2688], 'h': [1847, 2285, 2689, 3048, 3568, 5494], 'addition': [1851], 'inhibitors,': [1853, 4203], 'fixed,': [1855], 'permeabilized,': [1856], 'stained': [1858], 'against': [1863, 5208], 'tetramethylrhodamine': [1871], 'isothiocyanate-(TRITC;': [1872], 'Probes,': [1874], 'PoortGebouw,': [1875], 'Nederlands)': [1877], 'conjugated': [1878], 'secondary': [1879], 'antibody.': [1880, 2977], 'Slides': [1881], 'mounted': [1883], 'Vectorshield': [1885], '(H-100;': [1886], 'Vector,': [1887], 'Burlingame,': [1888], 'CA)': [1889], 'examined': [1891], 'microscope.': [1894], 'Acquired': [1895], 'images': [1896, 1909, 2733], 'Laser': [1901], 'Sharp': [1902], 'Processing': [1903], 'Bio-Rad': [1904, 2837], 'software': [1905, 2749], '(version': [1906], '3.2).': [1907], 'All': [1908, 2931, 4442], 'condition': [1913], 'acquired': [1915], 'blinded': [1918], 'fashion.': [1919], 'Assay—Cells': [1922], 'ice-cold': [1926], '0.5': [1931, 2800], 'per': [1933], 'plate': [1934], 'lysis': [1936, 1984], '(20': [1938, 2661], 'Hepes,': [1940, 2019, 2793], 'pH': [1941, 2020], '7.4,': [1942, 2021], '150': [1946], 'NaCl,': [1948, 2024, 2790], '10': [1949, 1961, 1965, 2037, 2041, 2506], 'MgCl2,': [1951, 2458, 2796], '10%': [1952, 2025], 'glycerol,': [1953, 2026], 'EDTA,': [1956, 2032, 2802], 'vanadate,': [1960, 2036], 'leupeptin,': [1963, 2039], 'aprotinin).': [1967], 'Lysates': [1968], 'cleared': [1970], 'centrifugation': [1972], '(13,000': [1973], 'rpm': [1974], '°C)': [1977], 'diluted': [1979], 'mg/ml': [1982], 'buffer.': [1985], 'GST-RBD': [1986, 2051], 'transformed': [1989], 'Escherichia': [1990], 'coli': [1991], 'isopropyl-1-thio-β-d-galactopyranoside': [1997], '1-2': [1999, 4241], 'h,': [2000, 2110], 'fusion': [2002], 'purified': [2005], 'glutathione-Sepharose': [2007, 2054], 'beads.': [2008], 'beads': [2010], '20': [2017], '120': [2022, 3013], 'aprotinin.': [2043], 'affinity': [2045], 'precipitation,': [2046], 'lysates': [2047], 'prebound': [2052], '(30': [2055], 'packed': [2058], 'beads)': [2059], '60': [2061], 'rocking.': [2067], 'Bound': [2068], 'eluted': [2071], 'SDS-PAGE': [2073], 'sample': [2074], 'buffer,': [2075], 'resolved': [2076, 2889], '12%': [2078, 2891], 'acrylamide': [2079], 'gels': [2080], 'subjected': [2082, 3406, 4015], 'Western': [2084], 'blotting.': [2085], 'Blots': [2086], 'probed': [2088], 'anti-Ras,': [2090], 'clone': [2091], 'Ras10': [2092], '(Upstate': [2093], 'Transfection—For': [2095], 'transfection': [2096], 'experiments,': [2097], 'confluent': [2098], 'plated': [2101], '100-mm': [2103], 'dishes': [2104, 2684], 'medium.': [2107], '24': [2109], 'discarded,': [2114], 'replaced': [2115], 'fresh': [2117], 'transfected.': [2123], 'Transfection': [2124], 'experiments': [2125, 2141], 'carried': [2127, 2479, 2494, 2898], 'out': [2128, 2495, 2614, 2899, 3110], 'duplicate': [2130], 'liposomal': [2133], '(Effectene,': [2135], 'Qiagen,': [2136], 'Hilden,': [2137], 'Germany).': [2138], 'selected': [2140], 'recombinant': [2143], 'plasmid': [2144], 'pGbC1A2-P': [2145], 'cloning': [2148], 'promoter': [2150], 'type': [2153, 5625, 5652], 'I': [2154], 'α2': [2156], 'chain': [2157], 'gene': [2158, 2221, 5671], '(COL1A2)': [2159], '(20Tuveson': [2160, 4683], 'D.A.': [2161, 4684], 'Shaw': [2162, 4685], 'A.T.': [2163, 4686], 'Willis': [2164, 4687], 'N.A.': [2165, 4688], 'Silver': [2166, 4689], 'D.P.': [2167, 4690], 'Jackson': [2168, 4691], 'E.L.': [2169, 4692], 'Chang': [2170, 2680, 4693], 'Mercer': [2172, 4695], 'K.L.': [2173, 4696], 'Grochow': [2174, 4697], 'Hock': [2176, 4699], 'Crowley': [2178, 4701], 'Hingorani': [2180, 4703], 'S.R.': [2181, 4704], 'Zaks': [2182, 4705], 'King': [2184, 4707], 'Jacobetz': [2186, 4709], 'M.A.': [2187, 4710], 'Wang': [2188, 4711], 'Bronson': [2190, 4713], 'R.T.': [2191, 4714], 'Orkin': [2192, 4715], 'S.H.': [2193, 4716], 'DePinho': [2194, 4717], 'R.A.': [2195, 4718], 'Jacks': [2196, 4719], 'Cancer': [2198, 4721], '5:': [2201, 4724], '375-387Abstract': [2202, 4725], '(626)': [2210, 4733], 'co-transfected': [2214], 'either': [2216, 4453, 5463], 'pS3CAT': [2217], 'carrying': [2218], 'catalase': [2220, 5183], '(a': [2222], 'kind': [2223], 'gift': [2224], 'Irani,': [2227], 'Johns': [2229], 'Hopkins,': [2230], 'Baltimore)': [2231], 'vector': [2235], 'procedure': [2238, 2353], 'above.': [2240, 2902], 'luciferase': [2242, 2262], 'activities': [2243], 'samples': [2246], 'measured': [2248, 2834, 3295, 3364, 3413], 'TD-20/20': [2251], 'luminometer': [2252], '(Turner': [2253], 'Design)': [2254], 'ratio': [2257, 4138, 4501, 4541], 'Renilla': [2259], 'firefly': [2261], 'values': [2263, 2913, 2924, 2932], 'normalize': [2267], 'co-transfection': [2269], 'Apoptosis': [2271], 'Assay—Normal': [2272], 'scleroderma': [2274, 4311, 4504, 4602, 5173, 5186, 5192, 5203, 5470], '80-90%': [2279], 'confluence': [2280], 'treated': [2282, 3140, 3280, 3445, 3620, 3873], 'concentrations': [2288], 'H2O2.': [2290, 3635, 3916, 5159], 'When': [2291], 'needed,': [2292], 'preincubated': [2295], '30': [2296, 2542], '98059': [2300, 3564], '(40': [2301], 'μmol/liter).': [2302], 'Six': [2303], 'hours': [2304], 'removal': [2307], 'stimulus,': [2310], 'apoptosis': [2311], 'detected': [2313], 'FACS': [2315, 3065], 'analysis': [2316, 2349, 3066, 4125, 4172], 'annexin': [2318], 'V-Cy3': [2319], '(Clontech,': [2320], 'Palo': [2321], 'Alto,': [2322], 'CA).': [2323], 'Isolation': [2325], 'Northern': [2327, 2347], 'Analysis—Total': [2328], 'extracted': [2332, 3135], 'RNeasy': [2335], 'Mini': [2336], 'kit': [2337], '(Qiagen).': [2338], 'Ten': [2339], 'micrograms': [2340], 'total': [2341, 2434, 2963], 'blot': [2348], 'RT-PCR': [2378], 'Ha-': [2380, 3175, 4494, 4660, 4763, 5559], 'mRNA—Total': [2383], 'performed': [2389, 2603, 2650, 2724], '(18Feliciello': [2392], 'Gallo': [2394], 'Porcellini': [2398], 'Troncone': [2400], 'Garbi': [2402], 'Gottesman': [2404], '303-311Abstract': [2413], '(41)': [2421, 4942], 'μl': [2425], 'products': [2428], '(derived': [2429], '2.5': [2431], 'μg': [2432], 'RNA)': [2435], 'amplified': [2437, 4357], 'unit': [2440], 'Ampli': [2442], 'Taq': [2443], 'Gold': [2444], '(PE': [2445], 'Applied': [2446], 'Biosystems)': [2447], 'provided': [2451], 'manufacturer,': [2454], 'contains': [2456], 'no': [2457, 3920], 'presence': [2462, 3019, 3300, 3452, 3548, 3631, 3654, 3676, 4026, 5506], 'primers': [2466, 2580, 2620], 'Ha-,': [2468], 'Ki-ras': [2469, 2623, 2631], 'actin': [2471], '(see': [2473, 3589], 'below).': [2474], 'amount': [2476], 'dNTPs': [2478], 'over': [2480], 'reverse': [2483], 'transcription': [2484, 4301, 4424, 5378], 'reaction': [2485, 2584], 'fully': [2487], 'sufficient': [2488, 3002], 'further': [2490], 'amplification.': [2491], 'Reactions': [2492], 'GeneAmp': [2498], 'PCR': [2499], 'system': [2500, 5309], '9600.': [2501], 'A': [2502, 4221, 4991], 'first': [2503, 4395], 'cycle': [2504], '95': [2509, 2528], 's': [2512, 2526, 2531], '65': [2514, 2533], '72': [2520, 2539], 'followed': [2523], 'cycles.': [2543], 'conditions': [2545], 'chosen': [2547], 'so': [2548, 4621, 4639], 'none': [2550], 'cDNAs': [2553], 'reached': [2555], 'plateau': [2557], 'end': [2560], 'protocol,': [2564], 'i.e.': [2565, 5632], 'exponential': [2570], 'phase': [2571], 'amplification,': [2573], 'sets': [2578], 'each': [2583, 2589], 'did': [2585, 3085, 3097, 3155, 3770, 3842], 'not': [2586, 3086, 3098, 3133, 3156, 3345, 3698, 3771, 3843, 3857, 3909, 3941, 4248, 4369, 4483, 4623, 4664, 4748, 4828, 4885, 4902, 5502], 'compete': [2587], 'other.': [2590], 'Each': [2591], 'set': [2592, 5264], 'reactions': [2594], 'always': [2595], 'included': [2596], 'no-sample': [2598], 'negative': [2599, 2605, 4363], 'control.': [2600], 'usually': [2602], 'instead': [2609], 'rule': [2613, 3109], 'genomic': [2615], 'contamination.': [2617], 'used:': [2622], 'long,': [2624], 'left': [2625, 2633, 2640], 'primer:': [2626, 2629, 2634, 2637, 2641, 2644], 'acatctctttgctgcccaat;': [2627], 'right': [2628, 2636, 2643], 'gagcgagactctgacaccaa.': [2630], 'short,': [2632], 'tcgacacagcaggtcaagag;': [2635], 'aggcatcatcaacaccctgt.': [2638], 'Ha-ras,': [2639], 'ccagctgatccagaaccatt;': [2642], 'aggtctcgatgtaggggatg.': [2645], 'Cytogenetic': [2646, 2769], 'Analysis—Cytogenetic': [2647], 'studies': [2648], '24-h': [2657], 'incubation': [2658, 3670], 'FTI-277': [2660], 'μm).': [2662], 'cover': [2667, 2712], 'glasses': [2668, 2713], 'placed': [2669], '35-mm': [2672], 'Petri': [2673], 'dish.': [2674], 'adding': [2676, 2703], 'Medium®': [2681], 'B': [2682, 4223], '5%': [2692], 'CO2': [2693], 'incubator': [2694], 'cultures': [2700], 'harvested': [2701], 'Colcemid': [2704], '(0,1': [2706], 'μg/ml)': [2707], '90': [2709], 'min.': [2710], 'Q-banded': [2717], 'standard': [2719], 'procedures.': [2720], 'evaluation': [2722], 'microscope': [2728], 'Zeiss': [2729], 'Axioplan': [2730], '2.': [2731, 4145], 'captured': [2735], 'couple-charged': [2738], 'camera': [2739], 'device': [2740], 'connected': [2741], 'personal': [2744, 4773], 'computer': [2745], 'running': [2746], 'MacKtype': [2747], '5.4': [2748], '(Powergene': [2750], 'Olympus': [2751], 'Italy).': [2752], 'Chromosome': [2753], 'identification': [2754], 'karyotype': [2756], 'designation': [2757], 'made': [2759], 'International': [2765], 'System': [2766], 'Human': [2768], 'Nomenclature': [2770], '(ISCN).': [2771], 'Chromatin': [2772], 'Extraction': [2773], 'Immunoblot': [2775, 2893], 'Phosphorylated': [2777], 'H2AX—Cell': [2778], '0.2': [2784], '(120': [2788], 'EGTA,': [2799], '0.6%': [2803], 'X-100,': [2805], 'centrifuged': [2818], '14,000': [2820], 'g': [2822], 'content': [2832], 'pellet': [2865], '80-100': [2874], 'units': [2875], 'DNase,': [2877], 'ice.': [2884], 'Extracts': [2885], 'denatured': [2887], 'SDS-PAGE.': [2892], 'Statistical': [2903], 'Analysis—Data': [2904], 'expressed': [2906], 'mean': [2908], '±': [2909], 'S.D.': [2911], 'Mean': [2912], 'compared': [2915, 4102], "Student's": [2917], 'paired': [2918], 'unpaired': [2920], 't': [2921], 'test.': [2922], 'p': [2923], 'less': [2925, 3033], 'than': [2926, 4144], '0.05': [2927], 'considered': [2929], 'significant.': [2930], 'two-tailed.': [2934], 'Induction': [2935], 'Protein': [2938], 'Levels': [2939], 'PDGF—In': [2941], 'quiescent': [2942], 'almost': [2949], 'undetectable.': [2950], 'To': [2951, 3108, 3268, 3356, 3431, 3529, 3557, 3612, 3869, 4281, 4465], 'determine': [2952, 3269, 3432, 3957], 'precisely': [2953], 'Ki-': [2957, 3103], 'solubilized': [2966], 'SDS': [2969], '(radioimmune': [2970], 'buffer),': [2973], 'pan': [2975], 'immunoprecipitates': [2979], 'separated': [2981], 'gel': [2983], 'electrophoresis': [2984], 'blotted': [2986], 'isoform': [2990], 'antibodies.': [2991, 4036], 'Stimulation': [2992, 3188], 'initial': [3011], 'level,': [3012], 'stimulation,': [3016, 4825], 'notwithstanding': [3017], 'factor.': [3023], 'also': [3028, 3057, 3320, 3340, 3439, 3651, 4111], 'efficiently': [3034, 3134], 'kinetics.': [3039], 'poorly': [3042], 'decayed': [3045, 4232], 'slowly': [3046, 4231], '(3': [3047], 'stimulation)': [3051], '(Fig.': [3052, 3062, 3074, 3092, 3106, 3162, 3327, 3400, 3429, 3506, 3773, 3848, 3946, 4091, 4106, 4118, 4192, 4328, 4334, 4401, 4421, 4437, 4462, 4546, 4800, 4817, 4876, 5498, 5607], '1A).': [3053], 'induction': [3055, 3089, 3159, 3263, 3276, 3333, 3353, 3397, 3602, 3663, 4741, 4803, 4846], 'visible': [3058], 'microscopy': [3061], '1B)': [3063], '1C).': [3075], 'Treatment': [3076, 3152, 3389], 'translational': [3082], 'prevent': [3087], '1D).': [3093], 'Moreover,': [3094, 4093, 4606], 'treatment': [3096, 3421, 3837, 3945, 4448], 'change': [3099, 3844], 'mRNA': [3100, 3846], '1E).': [3107], 'artifact,': [3118], 'caused': [3119], 'association': [3121], 'lipid-rich': [3127], 'fractions': [3129], 'consequently': [3131], 'immunoprecipitation': [3137, 3408], 'procedures,': [3138], '50': [3144], 'cyclodextrin': [3146, 3154], 'deplete': [3148], 'cholesterol': [3149], 'immunoprecipitation.': [3151], 'abolish': [3157], 'S1,': [3163], 'supplemental': [3164, 3775], 'material).': [3165, 3776, 3851], 'Taken': [3166, 3700], 'together,': [3167], 'indicate': [3170, 3515, 3642, 3710, 3859, 4630, 4857], 'post-translationally': [3180], 'ERK1/2—PDGF': [3192], 'activates': [3193], '19Kreuzer': [3221], 'Viedt': [3223], 'Brandes': [3225], 'R.P.': [3226], 'Seeger': [3227], 'Rosenkranz': [3229], 'A.S.': [3230], 'Sauer': [3231], 'Babich': [3233], 'Nurnberg': [3235], 'Kather': [3237], 'Krieger-Brauer': [3239], 'H.I.': [3240], 'Faseb.': [3241], '17:': [3244], '38-40Crossref': [3245], '(72)': [3248], 'kinetics': [3252, 3330], 'replicated': [3259, 3339, 4469, 4519], '(Figs.': [3264, 3741, 4219, 4789], '2A).': [3267], 'if': [3270, 3433, 3958, 4270, 4904], 'PDGF,': [3278, 3618], 'nonspecific': [3285], 'scavenger': [3287, 3457], '(NAC)': [3288, 3458], 'absence': [3302, 4822], 'PDGF.': [3304, 3488, 3667], 'Fig.': [3305, 3416, 3465, 3597, 3640, 3898, 4062, 4307, 4528, 4855, 5006, 5079, 5161], '2B': [3306], 'shows': [3307, 3418, 3467, 3900, 4064, 4309], 'NAC': [3309, 3476, 3503], 'DPI': [3311, 3505], 'significantly': [3312, 4380, 4513], 'inhibited': [3313, 3395, 3661, 3679, 4084, 4414, 4446, 4918, 5184], 'levels.': [3317, 3750, 3930, 4079, 4767, 4976, 4990], 'shown': [3321, 3595, 3638, 3854, 4853, 5004], 'immunofluorescence': [3323], '2C).': [3328], 'activation': [3342, 3428, 3435, 3486, 3734, 4198, 4287, 4299, 5138, 5443, 5614, 5643], 'profile': [3343], '(data': [3344, 3697, 4247, 4368, 4482], 'shown),': [3346], 'suggesting': [3347], 'relation': [3349], 'MEK-ERK1/2': [3351], 'Ha-Ras.': [3355, 4897, 5177, 5269], 'get': [3357], 'insight': [3359], 'process,': [3362], 'pretreated': [3368], 'chemical': [3371, 3550], '(PD': [3376], '98059),': [3377], 'inhibits': [3379, 3586, 4893], '(MAPKK),': [3381], 'upstream': [3385], '(MAPK).': [3388], 'PD98059': [3394, 4420], '2D).': [3401, 3430], 'extracts,': [3405], 'anti-Ras': [3410], 'receptor.': [3415, 3737, 5210, 5220], '2D': [3417], 'down-regulated': [3422, 5307], 'receptor,': [3424, 3726], 'independently': [3425, 3731], 'sensitive': [3440, 3474, 4407, 4431], 'depletion,': [3443], 'general': [3455], '(DPI).': [3464], '2E': [3466], 'DPI,': [3478], 'indicating': [3479, 3686], 'depletion': [3482], 'interfered': [3483], 'noticed': [3491], 'fraction': [3494], 'resistant': [3501], '2E).': [3507], 'Induce': [3509], 'Level—The': [3511], 'above': [3514, 3855, 5153], 'investigate': [3530], 'mechanism': [3532, 3861, 4843], 'biological': [3552, 5313], 'inhibitors': [3553, 4090, 4209, 4389, 4458], 'end,': [3559, 3871, 4283], 'employed': [3561], '1)': [3562, 4286, 4314, 5367], '(2': [3567, 4838], 'incubation,': [3573], 'respectively),': [3574], 'inhibit': [3576, 3889], '(MAPKK);': [3578], '2)': [3580, 4295, 4323, 5372], '"Materials': [3590], 'Methods").': [3592], 'results,': [3594], '3,': [3598, 3709, 4220, 4877], 'A-C,': [3599], 'demonstrate': [3600], 'abolished': [3608, 5311], 'inhibition.': [3611, 3825], 'confirm': [3613], 'down-stream': [3617], 'genistein,': [3624], 'tyrosine': [3626], 'inhibitor,': [3628, 4419], '3D': [3641], 'powerful': [3647], 'inducer': [3648], 'genistein.': [3656], 'As': [3657, 4485, 4840], 'expected,': [3658], 'drug': [3660], 'longer': [3669, 4836], 'periods': [3671, 4837], '(90': [3672], 'min)': [3673], 'genistein': [3678], 'H2O2,': [3685], 'long': [3688, 5483], 'term': [3689, 5484], 'required': [3693, 5481], 'shown).': [3699, 4249, 4370, 4484, 5503], 'together': [3701], 'data,': [3703], 'Figs.': [3706], 'protein.': [3720, 4909], 'because': [3727, 3802, 4201, 5059, 5097, 5487], 'Down-regulation': [3738, 5020], '2,': [3742], 'D': [3743, 4439], 'E': [3745], '3)': [3747, 4298, 4331, 5376], 'Maintaining': [3751], 'high,': [3753], 'expressing': [3755, 4537, 5666], 'decay': [3772], 'S2B,': [3774], 'Only': [3777], 'stabilized,': [3780], 'since': [3781], 'marginally': [3785], 'More': [3793], 'importantly,': [3794], 'peculiar': [3798], 'immortalized': [3803], 'such': [3805, 5318], '3T3': [3807], 'fibroblasts,': [3808, 4777, 5189, 5323], 'CHO,': [3809], 'PC12,': [3810], 'COS7': [3812], 'contained': [3813, 4096], 'stable': [3814], 'insensitive': [3822], '4S.': [3826], 'Cassano,': [3827], 'unpublished': [3828], 'observation.': [3829], 'constitutive': [3833, 4017, 5137], 'MEK-ERK2': [3834], 'prolonged': [3836], 'S3,': [3849], 'supplementary': [3850, 4548, 5609], 'do': [3856, 4901], 'clearly': [3858], 'responsible': [3862], 'PDGF-ROS-ERK1/2.': [3868], 'MG132,': [3877], 'widely': [3879], 'proteasome': [3881, 4868, 4894, 4905, 4927], 'monensin,': [3884], 'toxin': [3886], 'known': [3887], 'recycling': [3891], 'endosome': [3896], 'acidification.': [3897], '3E': [3899], 'MG132': [3902, 3944, 4880], 'its': [3906], 'effect': [3907, 3921], 'additive': [3910], 'when': [3911], 'administered': [3912], 'Conversely,': [3917, 5178], 'monensin': [3918], 'had': [3919], 'alone': [3922], 'Under': [3931, 4977], 'conditions,': [3934, 4979], 'PDGFR': [3937], 'influenced': [3942], '3F).': [3947], 'Amplification': [3948, 5045], 'ROS-Ras': [3950, 4271, 4595, 5047], 'Vivo': [3953, 4256], 'Scleroderma': [3955], 'Fibroblasts—To': [3956], 'connecting': [3962], 'relevant': [3967, 5056], 'vivo,': [3969, 5058], 'took': [3971], 'advantage': [3972], 'anti-PDGF': [4034], '5S.': [4037, 4146, 5270], 'Svegliati,': [4038, 4147, 5271], 'Santillo,': [4041, 4150, 5274], 'Bevilacqua,': [4043, 4152, 5276], 'Luchetti,': [4045, 4154, 5278], 'Spadoni,': [4047, 4156, 5280], 'Mancini,': [4049, 4158, 5282], 'Funaro,': [4051, 4160, 5284], 'Kazlavskas,': [4053, 4162, 5286], 'Avvedimento,': [4056, 4165, 5289], 'Gabrielli,': [4059, 4168, 5292], 'submitted': [4060, 4169, 5293], 'manuscript.': [4061, 4170, 5294], '4A': [4063], 'three': [4066], 'fibroblast': [4067, 4475], 'lines': [4068, 4476], 'contain': [4073, 5073, 5130], 'superoxide,': [4076], 'accumulation': [4081, 4324, 4779], 'severely': [4083], '4A).': [4092, 4225], 'controls': [4105], '4B).': [4107], 'increased': [4112, 4973], 'relative': [4113, 4543], '4C).': [4119], 'recently': [4122, 5196], 'completed': [4123], '46': [4127], 'sclerosis,': [4132, 5072], 'cases': [4136], 'Ha/Ki': [4139], 'effectors': [4176], '(AKT': [4177], 'ERK1/2)': [4179], 'stress': [4182, 4949], 'kinases': [4183], '(JNK)': [4184], 'indicated': [4185, 4526, 5077], 'only': [4187], 'selectively': [4190], '4D).': [4193], 'linked,': [4200], 'scavengers,': [4205], 'able': [4211, 4829], 'reduce': [4213], 'P-ERK1/2': [4215], 'low': [4237, 4682, 4988], 'days': [4242], 'returned': [4243], 'baseline': [4246], 'Biological': [4250], 'Consequences': [4251], 'Stabilization': [4254], 'Are': [4257], 'ERK,': [4261], 'Damage,': [4263], 'Collagen': [4264], 'Synthesis,': [4265], 'Senescence—We': [4267], 'next': [4268], 'asked': [4269], 'affecting': [4274], 'lines.': [4280], 'determined:': [4285], 'checkpoints': [4291], 'chromosomal': [4293, 4337], 'alterations;': [4294], 'apoptosis;': [4297, 5371], 'ROS.': [4306], 'contained:': [4313], 'ATM,': [4316], 'phosphorylation': [4319], 'histone': [4321], 'H2AX;': [4322], 'p21': [4326], 'WAF': [4327], '5A),': [4329], 'damaged': [4332], 'chromosomes': [4333], '5B).': [4335, 4402], 'aberrations': [4338], 'expansion': [4345], 'continuously': [4350], 'culture.': [4353], 'alterations': [4355], 'resulted': [4361], 'selection': [4364], 'explains': [4372], 'why': [4373], 'number': [4375], 'altered': [4377], 'metaphases': [4378], 'incubating': [4383], 'scavengers': [4392, 4461], 'during': [4393, 4666], 'second': [4397], 'day': [4398], 'extremely': [4406], 'oxidative': [4409, 5039], 'pretreatment': [4416], '5C).': [4422], 'Finally,': [4423], 'genes,': [4427], 'exquisitely': [4430], 'greatly': [4435], '5,': [4438, 4463], 'E).': [4441], 'features': [4444, 4525, 5142], 'B-E).': [4464], 'date': [4466], '∼15': [4473], 'independent': [4474, 4807], 'complementary': [4487], 'approach,': [4488], 'approximately': [4498], '(3:1).': [4506], 'expression.': [4517], '(collagen': [4530], 'induction,': [4531], 'H2O2-induced': [4534], 'apoptosis)': [4535], '5:1': [4542], 'S2,': [4547, 5608], 'material': [4549], 'Ref.': [4551], '15Cuda': [4552], 'establish': [4591], 'vivo.': [4605], 'provide': [4608], 'tools': [4610], 'possible': [4613], 'targeted': [4617], 'far': [4622, 4640], 'curable': [4624], 'illness.': [4625], 'reported': [4628], 'here': [4629], 'unknown.': [4641], 'established': [4643], 'immortal': [4645], 'lines,': [4647], 'solely': [4650], 'GTP-GDP': [4653], 'binding': [4654], 'activity.': [4655], 'Because': [4656, 4879], 'widespread': [4657], 'tolerated': [4665], 'development': [4667], 'adult': [4670], 'organisms,': [4671], 'evidence': [4738], 'unique': [4749], 'peripheral': [4754], 'lymphocytes,': [4755], 'mouse': [4757], 'neurons': [4758], 'astrocytes': [4760], '6E.': [4768], 'Janda': [4769], 'Porcellini,': [4772], 'communication.': [4774], 'triggered': [4784, 5430], '2).': [4792, 4801], 'can': [4812, 5169], '3).': [4818], 'h).': [4839], 'underlying': [4844], '3F': [4856], 'degraded': [4863, 4924], '26': [4866], 'S': [4867], 'protect': [4872], 'degradation': [4875, 4895, 4917], 'A-C).': [4878], 'additive,': [4886], 'At': [4898], 'present,': [4899], 'know': [4903], 'directly': [4906], 'degrades': [4907], 'There': [4910], 'similar': [4913], 'signaling:': [4921], 'c-Myc': [4922], '(21Bonvini': [4928], 'Nguyen': [4930], 'Trepel': [4932], 'J': [4933], 'Neckers': [4934], 'L.M.': [4935], 'Oncogene.': [4936, 4958], '1998;': [4937, 5354, 5420, 5452], '16:': [4938], '131-139Crossref': [4939], 'stabilized': [4947], 'MEKK1': [4951], '(22Alarcon-Vargas1': [4952], 'Tansey': [4954], 'W.P.': [4955], 'Ronai': [4956], '21': [4960], '(2002):': [4961], '4384-4391Crossref': [4962], '(30)': [4965], 'result': [4971, 5035], 'more': [4982], 'likely': [4983], 'schematic': [4992], 'diagram': [4993], 'illustrating': [4994], '6.': [5007, 5080], 'propose': [5009], 'increase': [5012], 'amplify': [5017], 'protects': [5024, 5519], 'excessive': [5028, 5523], 'factors,': [5032], 'stress,': [5040], 'ultimately': [5042], 'Vivo—The': [5050], 'isolated': [5064, 5190], 'lesions': [5066], 'elements': [5076], 'autoimmune': [5085], 'disease,': [5086], 'characterized': [5087, 5365], 'extensive': [5089], 'fibrosis': [5090, 5385], 'internal': [5095], 'organs,': [5096], 'exaggerated': [5099], '(23Kahari': [5105, 5332, 5398], 'V.M.': [5106, 5333, 5399], 'Vuorio': [5107, 5111, 5334, 5338, 5400, 5404], 'Nanto-Salonen': [5109, 5336, 5402], 'Biochim.': [5113, 5340, 5406], 'Biophys.': [5114, 5341, 5407], 'Acta.': [5115, 5342, 5408], '1984;': [5116, 5343, 5409], '781:': [5117, 5344, 5410], '183-186Crossref': [5118, 5345, 5411], 'Fibroblasts,': [5124], 'patients,': [5129], 'hallmarks': [5145], 'S2': [5162], '(supplementary': [5163], 'materials)': [5164, 5610], 'show': [5166], 'convert': [5170], 'overexpressing': [5176], 'lesions.': [5193], 'synthesize': [5214], 'stimulate': [5223], 'monocytes': [5226], 'off': [5265], 'any': [5297], 'components': [5300], '(ERK1/2,': [5304], 'ROS)': [5306], 'Ras-ROS': [5316], 'activation,': [5317, 5435], 'characterizes': [5325], '24Ohtsuka': [5351, 5417], 'Dermatology.': [5353, 5419, 5451], '196:': [5355, 5421, 5453], '204-207Crossref': [5356, 5422, 5454], '(2)': [5359, 5425, 5457], 'by:': [5366], 'susceptibility': [5369], 'severe': [5373], 'vigorous': [5377], 'framework,': [5384], 'consequence': [5388], 'loss': [5390, 5649], '(apoptosis)': [5393], 'deposition': [5395], 'initially': [5431], 'reinforced': [5437], 'produced': [5441], 'Ha-Ras-ERK1/2': [5448], '(24Ohtsuka': [5449], 'Thus,': [5460], 'converts': [5469], 'production,': [5486], '4-12': [5493], 'Ras-ROS-ERK1/2-collagen': [5496], '6': [5499], 'physiological': [5508], 'stimuli,': [5509], 'believe': [5511], 'inappropriate': [5525], 'Coupling': [5527], 'highlights': [5531], 'role': [5534], 'sensors': [5539], 'regulators': [5541], 'turn-over': [5547], 'compartments': [5623], 'generated;': [5631], 'metabolic': [5634, 5654], 'state,': [5635], 'availability': [5637], 'nutrients.': [5639], 'Constitutive': [5640], 'mutationally': [5642], 'Ras-ERK1/2': [5645], 'results': [5647], 'regulation.': [5655], 'explain': [5658], 'opposite': [5660], 'life-span': [5661], 'cerevisiae': [5665], 'ras2Val19': [5667], 'differentiation': [5701], 'critically': [5703], 'integrity': [5707], 'circuitry.': [5710], 'thank': [5712], 'Marcello': [5714], 'Melone': [5715], 'Institute': [5718], 'Physiology': [5720], 'Ancona': [5725], 'help': [5727], 'microscopy.': [5730], 'Download': [5731], '.pdf': [5732], '(.11': [5733], 'MB)': [5734], 'Help': [5735], 'pdf': [5737], 'files': [5738]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2152951480', 'counts_by_year': [{'year': 2024, 'cited_by_count': 4}, {'year': 2023, 'cited_by_count': 5}, {'year': 2022, 'cited_by_count': 1}, {'year': 2021, 'cited_by_count': 7}, {'year': 2020, 'cited_by_count': 6}, {'year': 2019, 'cited_by_count': 5}, {'year': 2018, 'cited_by_count': 7}, {'year': 2017, 'cited_by_count': 5}, {'year': 2016, 'cited_by_count': 10}, {'year': 2015, 'cited_by_count': 12}, {'year': 2014, 'cited_by_count': 8}, {'year': 2013, 'cited_by_count': 14}, {'year': 2012, 'cited_by_count': 15}], 'updated_date': '2024-12-10T05:09:24.632025', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
