Publication Information

{'id': 'https://openalex.org/W2146103904', 'doi': 'https://doi.org/10.1074/jbc.m211424200', 'title': 'Role of Cyclooxygenase 2 in Protein Kinase C βII-mediated Colon Carcinogenesis', 'display_name': 'Role of Cyclooxygenase 2 in Protein Kinase C βII-mediated Colon Carcinogenesis', 'publication_year': 2003, 'publication_date': '2003-03-01', 'ids': {'openalex': 'https://openalex.org/W2146103904', 'doi': 'https://doi.org/10.1074/jbc.m211424200', 'mag': '2146103904', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/12480928'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m211424200', 'pdf_url': 'http://www.jbc.org/article/S0021925819323981/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819323981/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5110212704', 'display_name': 'Wangsheng Yu', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I55302922', 'display_name': 'The University of Texas Medical Branch at Galveston', 'ror': 'https://ror.org/016tfm930', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I55302922']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Wangsheng Yu', 'raw_affiliation_strings': ['From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048'], 'affiliations': [{'raw_affiliation_string': 'From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048', 'institution_ids': ['https://openalex.org/I55302922']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5003409853', 'display_name': 'Nicole R. Murray', 'orcid': 'https://orcid.org/0000-0002-6833-8273'}, 'institutions': [{'id': 'https://openalex.org/I55302922', 'display_name': 'The University of Texas Medical Branch at Galveston', 'ror': 'https://ror.org/016tfm930', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I55302922']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Nicole R. Murray', 'raw_affiliation_strings': ['From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048'], 'affiliations': [{'raw_affiliation_string': 'From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048', 'institution_ids': ['https://openalex.org/I55302922']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5022618390', 'display_name': 'Capella Weems', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I55302922', 'display_name': 'The University of Texas Medical Branch at Galveston', 'ror': 'https://ror.org/016tfm930', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I55302922']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Capella Weems', 'raw_affiliation_strings': ['From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048'], 'affiliations': [{'raw_affiliation_string': 'From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048', 'institution_ids': ['https://openalex.org/I55302922']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5051346077', 'display_name': 'Lu Chen', 'orcid': 'https://orcid.org/0000-0002-4092-7236'}, 'institutions': [{'id': 'https://openalex.org/I55302922', 'display_name': 'The University of Texas Medical Branch at Galveston', 'ror': 'https://ror.org/016tfm930', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I55302922']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Lu Chen', 'raw_affiliation_strings': ['From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048'], 'affiliations': [{'raw_affiliation_string': 'From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048', 'institution_ids': ['https://openalex.org/I55302922']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5101425988', 'display_name': 'Huiping Guo', 'orcid': 'https://orcid.org/0000-0002-2527-3131'}, 'institutions': [{'id': 'https://openalex.org/I55302922', 'display_name': 'The University of Texas Medical Branch at Galveston', 'ror': 'https://ror.org/016tfm930', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I55302922']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Huiping Guo', 'raw_affiliation_strings': ['From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048'], 'affiliations': [{'raw_affiliation_string': 'From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048', 'institution_ids': ['https://openalex.org/I55302922']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5008614688', 'display_name': 'Richard T. Ethridge', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I55302922', 'display_name': 'The University of Texas Medical Branch at Galveston', 'ror': 'https://ror.org/016tfm930', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I55302922']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Richard Ethridge', 'raw_affiliation_strings': ['From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048'], 'affiliations': [{'raw_affiliation_string': 'From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048', 'institution_ids': ['https://openalex.org/I55302922']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5055971768', 'display_name': 'Jeffrey D. Ceci', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I55302922', 'display_name': 'The University of Texas Medical Branch at Galveston', 'ror': 'https://ror.org/016tfm930', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I55302922']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Jeffrey D. Ceci', 'raw_affiliation_strings': ['From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048'], 'affiliations': [{'raw_affiliation_string': 'From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048', 'institution_ids': ['https://openalex.org/I55302922']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5066347342', 'display_name': 'B. Mark Evers', 'orcid': 'https://orcid.org/0000-0002-9425-2342'}, 'institutions': [{'id': 'https://openalex.org/I55302922', 'display_name': 'The University of Texas Medical Branch at Galveston', 'ror': 'https://ror.org/016tfm930', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I55302922']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'B. Mark Evers', 'raw_affiliation_strings': ['From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048'], 'affiliations': [{'raw_affiliation_string': 'From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048', 'institution_ids': ['https://openalex.org/I55302922']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5026692399', 'display_name': 'E. Aubrey Thompson', 'orcid': 'https://orcid.org/0000-0002-9001-4240'}, 'institutions': [{'id': 'https://openalex.org/I55302922', 'display_name': 'The University of Texas Medical Branch at Galveston', 'ror': 'https://ror.org/016tfm930', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I55302922']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'E. Aubrey Thompson', 'raw_affiliation_strings': ['From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048'], 'affiliations': [{'raw_affiliation_string': 'From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048', 'institution_ids': ['https://openalex.org/I55302922']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5081306238', 'display_name': 'Alan P. Fields', 'orcid': 'https://orcid.org/0000-0001-9529-0888'}, 'institutions': [{'id': 'https://openalex.org/I55302922', 'display_name': 'The University of Texas Medical Branch at Galveston', 'ror': 'https://ror.org/016tfm930', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I55302922']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Alan P. Fields', 'raw_affiliation_strings': ['From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048'], 'affiliations': [{'raw_affiliation_string': 'From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048', 'institution_ids': ['https://openalex.org/I55302922']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 6.082, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 73, 'citation_normalized_percentile': {'value': 0.924774, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 94, 'max': 95}, 'biblio': {'volume': '278', 'issue': '13', 'first_page': '11167', 'last_page': '11174'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10678', 'display_name': 'Inflammatory mediators and NSAID effects', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2736', 'display_name': 'Pharmacology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10678', 'display_name': 'Inflammatory mediators and NSAID effects', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2736', 'display_name': 'Pharmacology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T10276', 'display_name': 'Helicobacter pylori-related gastroenterology studies', 'score': 0.9947, 'subfield': {'id': 'https://openalex.org/subfields/2746', 'display_name': 'Surgery'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T10756', 'display_name': 'Estrogen and related hormone effects', 'score': 0.9935, 'subfield': {'id': 'https://openalex.org/subfields/1311', 'display_name': 'Genetics'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [], 'concepts': [{'id': 'https://openalex.org/C195794163', 'wikidata': 'https://www.wikidata.org/wiki/Q420877', 'display_name': 'Protein kinase C', 'level': 3, 'score': 0.825744}, {'id': 'https://openalex.org/C555283112', 'wikidata': 'https://www.wikidata.org/wiki/Q1637543', 'display_name': 'Carcinogenesis', 'level': 3, 'score': 0.67086965}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.5140158}, {'id': 'https://openalex.org/C502942594', 'wikidata': 'https://www.wikidata.org/wiki/Q3421914', 'display_name': 'Cancer research', 'level': 1, 'score': 0.4872893}, {'id': 'https://openalex.org/C2779689624', 'wikidata': 'https://www.wikidata.org/wiki/Q410251', 'display_name': 'Cyclooxygenase', 'level': 3, 'score': 0.47012198}, {'id': 'https://openalex.org/C118131993', 'wikidata': 'https://www.wikidata.org/wiki/Q423671', 'display_name': 'Transforming growth factor', 'level': 2, 'score': 0.44914913}, {'id': 'https://openalex.org/C207001950', 'wikidata': 'https://www.wikidata.org/wiki/Q141124', 'display_name': 'In vivo', 'level': 2, 'score': 0.4286769}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.4190969}, {'id': 'https://openalex.org/C170493617', 'wikidata': 'https://www.wikidata.org/wiki/Q208467', 'display_name': 'Receptor', 'level': 2, 'score': 0.41450557}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.40712923}, {'id': 'https://openalex.org/C184235292', 'wikidata': 'https://www.wikidata.org/wiki/Q421851', 'display_name': 'Kinase', 'level': 2, 'score': 0.40337473}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.27295205}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.13838819}, {'id': 'https://openalex.org/C181199279', 'wikidata': 'https://www.wikidata.org/wiki/Q8047', 'display_name': 'Enzyme', 'level': 2, 'score': 0.11000195}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.069068044}, {'id': 'https://openalex.org/C150903083', 'wikidata': 'https://www.wikidata.org/wiki/Q7108', 'display_name': 'Biotechnology', 'level': 1, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D002471', 'descriptor_name': 'Cell Transformation, Neoplastic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D003110', 'descriptor_name': 'Colonic Neoplasms', 'qualifier_ui': 'Q000473', 'qualifier_name': 'pathology', 'is_major_topic': True}, {'descriptor_ui': 'D007527', 'descriptor_name': 'Isoenzymes', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D011451', 'descriptor_name': 'Prostaglandin-Endoperoxide Synthases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D011493', 'descriptor_name': 'Protein Kinase C', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D015153', 'descriptor_name': 'Blotting, Western', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D003110', 'descriptor_name': 'Colonic Neoplasms', 'qualifier_ui': 'Q000201', 'qualifier_name': 'enzymology', 'is_major_topic': False}, {'descriptor_ui': 'D003110', 'descriptor_name': 'Colonic Neoplasms', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051546', 'descriptor_name': 'Cyclooxygenase 2', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007527', 'descriptor_name': 'Isoenzymes', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D007527', 'descriptor_name': 'Isoenzymes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011401', 'descriptor_name': 'Promoter Regions, Genetic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011451', 'descriptor_name': 'Prostaglandin-Endoperoxide Synthases', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D011451', 'descriptor_name': 'Prostaglandin-Endoperoxide Synthases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011493', 'descriptor_name': 'Protein Kinase C', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D064546', 'descriptor_name': 'Protein Kinase C beta', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012333', 'descriptor_name': 'RNA, Messenger', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D012333', 'descriptor_name': 'RNA, Messenger', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D020133', 'descriptor_name': 'Reverse Transcriptase Polymerase Chain Reaction', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m211424200', 'pdf_url': 'http://www.jbc.org/article/S0021925819323981/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/12480928', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m211424200', 'pdf_url': 'http://www.jbc.org/article/S0021925819323981/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'id': 'https://metadata.un.org/sdg/3', 'score': 0.56, 'display_name': 'Good health and well-being'}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 45, 'referenced_works': ['https://openalex.org/W1500710452', 'https://openalex.org/W1514189093', 'https://openalex.org/W1544157645', 'https://openalex.org/W1546894543', 'https://openalex.org/W1562714701', 'https://openalex.org/W1566365189', 'https://openalex.org/W1586552261', 'https://openalex.org/W1594758412', 'https://openalex.org/W1600640558', 'https://openalex.org/W1967938942', 'https://openalex.org/W1970347121', 'https://openalex.org/W1984757473', 'https://openalex.org/W1990723702', 'https://openalex.org/W1993592556', 'https://openalex.org/W2001258296', 'https://openalex.org/W2008757399', 'https://openalex.org/W2012806802', 'https://openalex.org/W2013548432', 'https://openalex.org/W2014034874', 'https://openalex.org/W2019209562', 'https://openalex.org/W2019501820', 'https://openalex.org/W2033283286', 'https://openalex.org/W2046345325', 'https://openalex.org/W2051686420', 'https://openalex.org/W2056935575', 'https://openalex.org/W2057227614', 'https://openalex.org/W2063014011', 'https://openalex.org/W2074521053', 'https://openalex.org/W2075039358', 'https://openalex.org/W2075582992', 'https://openalex.org/W2089923844', 'https://openalex.org/W2095495874', 'https://openalex.org/W2118972611', 'https://openalex.org/W2129698680', 'https://openalex.org/W2129746956', 'https://openalex.org/W2130389194', 'https://openalex.org/W2134812217', 'https://openalex.org/W2135938816', 'https://openalex.org/W2157795344', 'https://openalex.org/W2159309845', 'https://openalex.org/W2253276860', 'https://openalex.org/W2314805921', 'https://openalex.org/W2415165471', 'https://openalex.org/W4294107304', 'https://openalex.org/W4294216491'], 'related_works': ['https://openalex.org/W4254530876', 'https://openalex.org/W2410295749', 'https://openalex.org/W2353218647', 'https://openalex.org/W2133219962', 'https://openalex.org/W2090727056', 'https://openalex.org/W2010957774', 'https://openalex.org/W2003179917', 'https://openalex.org/W2001668713', 'https://openalex.org/W1994272309', 'https://openalex.org/W1967839773'], 'abstract_inverted_index': {'Elevated': [0, 279], 'expression': [1, 69, 101, 163, 280, 348, 380, 442, 888, 1818, 2150, 2626, 2924, 3162, 3288, 3467, 3527, 3550, 3568, 3615, 3778, 3792, 3938, 3983, 4075, 4152, 4336, 4369, 4416], 'of': [2, 36, 41, 60, 102, 164, 196, 201, 205, 225, 228, 233, 281, 315, 320, 339, 381, 443, 475, 480, 484, 504, 507, 512, 584, 611, 656, 747, 760, 771, 779, 793, 800, 886, 1024, 1081, 1114, 1143, 1208, 1215, 1226, 1274, 1326, 1435, 1441, 1572, 1612, 1631, 1732, 1750, 1763, 1840, 1878, 2122, 2132, 2294, 2297, 2352, 2367, 2370, 2377, 2415, 2441, 2478, 2485, 2511, 2513, 2528, 2558, 2659, 2730, 2745, 2809, 2821, 2830, 2944, 3044, 3056, 3059, 3079, 3163, 3287, 3289, 3327, 3387, 3394, 3427, 3437, 3468, 3504, 3529, 3563, 3609, 3763, 3776, 3779, 3811, 3832, 3863, 3935, 3970, 3981, 4014, 4025, 4043, 4056, 4066, 4076, 4110, 4114, 4124, 4140, 4153, 4249, 4286, 4342, 4352, 4383, 4386, 4403, 4414, 4436], 'protein': [3, 133, 198, 282, 412, 477, 558, 660, 906, 1836, 1881, 1930, 3281, 3376, 3937, 3948, 3965, 3972, 3992, 4094, 4269], 'kinase': [4, 283, 559, 650], 'C': [5, 284, 560, 651], 'βII': [6, 285], '(PKCβII)': [7, 286], 'is': [8, 287, 598, 653, 702, 753, 871, 1238, 1270, 1430, 3169, 3293, 3390, 3470, 3830, 3884, 3920, 3984, 4068, 4082, 4167, 4281], 'an': [9, 288, 2119, 2382, 2736, 2929, 3170, 3808, 4194], 'early': [10, 289, 1206], 'promotive': [11, 290, 3172], 'event': [12, 291, 3173], 'in': [13, 38, 56, 107, 113, 116, 120, 131, 137, 167, 170, 176, 208, 221, 238, 292, 317, 335, 386, 392, 395, 399, 410, 416, 446, 449, 455, 487, 500, 517, 606, 667, 674, 719, 764, 776, 797, 875, 883, 910, 913, 923, 961, 971, 1072, 1077, 1130, 1204, 1242, 1257, 1323, 1329, 1463, 1466, 1505, 1514, 1519, 1550, 1685, 1707, 1715, 1724, 1756, 1835, 1886, 1909, 1965, 1979, 2002, 2016, 2041, 2215, 2246, 2252, 2328, 2422, 2427, 2501, 2649, 2796, 2806, 2843, 3068, 3141, 3165, 3174, 3257, 3298, 3302, 3367, 3440, 3445, 3451, 3462, 3494, 3554, 3743, 3782, 3796, 3866, 3877, 3888, 3892, 3924, 3939, 3955, 3974, 3994, 4032, 4096, 4157, 4174, 4178, 4188, 4289, 4292, 4295, 4299, 4315, 4362, 4365], 'colon': [14, 40, 51, 192, 217, 277, 293, 319, 330, 471, 496, 556, 801, 869, 924, 950, 973, 1140, 1209, 1227, 1327, 3175, 3249, 3617, 4199], 'carcinogenesis': [15, 52, 294, 331, 752, 765, 870, 1033, 1141, 1210, 3176, 4200], '(Gokmen-Polar,': [16, 295], 'Y.,': [17, 296], 'Murray,': [18, 297], 'N.': [19, 71, 298, 350, 1338, 2198, 3624], 'R.,': [20, 72, 299, 351], 'Velasco,': [21, 300], 'M.': [22, 301, 725, 1402, 3688, 3843], 'A.,': [23, 75, 302, 354], 'Gatalica,': [24, 303], 'Z.,': [25, 304], 'and': [26, 47, 85, 115, 134, 149, 169, 172, 191, 203, 231, 258, 269, 305, 326, 364, 394, 413, 428, 448, 451, 470, 482, 510, 537, 548, 618, 646, 671, 722, 919, 1028, 1076, 1126, 1136, 1318, 1331, 1437, 1465, 1501, 1510, 1625, 1635, 1680, 1720, 1739, 1758, 1809, 1833, 1854, 1892, 1918, 1998, 2022, 2097, 2143, 2186, 2223, 2270, 2276, 2339, 2379, 2418, 2448, 2504, 2519, 2699, 2757, 2781, 2857, 2871, 2899, 2946, 2958, 2983, 2998, 3086, 3126, 3270, 3291, 3324, 3539, 3607, 3616, 3750, 3814, 3942, 4103, 4254, 4267, 4294, 4430, 4433], 'Fields,': [27, 86, 306, 365], 'A.': [28, 87, 307, 366, 1296, 1355, 3518, 3585, 3641], 'P.': [29, 88, 308, 367, 2196], '(2001)': [30, 309], 'Cancer': [31, 310, 577, 813, 899, 936, 1395, 3187, 3314, 3681], 'Res.': [32, 311, 814, 900, 937, 1396, 3188, 3315, 3682], '61,': [33, 312], '1375–1381).': [34, 313], 'Expression': [35, 314], 'PKCβII': [37, 98, 118, 140, 189, 215, 247, 316, 377, 397, 419, 468, 494, 526, 887, 905, 946, 955, 960, 1083, 1145, 1199, 1237, 1254, 1269, 1436, 1461, 1945, 2037, 2040, 2095, 3164, 3246, 3292, 3328, 3340, 3350, 3358, 3375, 3428, 3469, 3905, 3923, 3987, 4087, 4149, 4172, 4187, 4256, 4261, 4266, 4287, 4308, 4335, 4343, 4368, 4415], 'the': [39, 100, 142, 180, 239, 255, 318, 379, 421, 459, 518, 534, 607, 708, 744, 758, 780, 791, 798, 884, 914, 962, 1025, 1056, 1078, 1133, 1205, 1213, 1232, 1264, 1271, 1324, 1450, 1619, 1670, 1678, 1682, 1686, 1708, 1712, 1716, 1751, 1975, 2033, 2042, 2130, 2133, 2192, 2240, 2289, 2298, 2315, 2353, 2373, 2461, 2475, 2479, 2486, 2505, 2559, 2565, 2591, 2636, 2716, 2743, 2807, 2826, 2831, 2902, 2959, 2989, 3030, 3057, 3090, 3145, 3152, 3166, 3241, 3299, 3322, 3332, 3384, 3546, 3560, 3610, 3761, 3812, 3833, 3861, 3870, 3933, 3968, 4026, 4074, 4092, 4151, 4175, 4189, 4296, 4304, 4340, 4353, 4412, 4421, 4434, 4437], 'transgenic': [42, 117, 321, 396, 954, 1082, 1144, 4002, 4183, 4255, 4260], 'mice': [43, 119, 322, 398, 956, 1084, 1146, 2038, 2096, 2116, 4185, 4257, 4262], 'leads': [44, 323, 4309], 'to': [45, 50, 58, 147, 324, 329, 337, 426, 751, 949, 965, 1031, 1121, 1139, 1195, 1252, 1770, 1811, 1895, 1927, 2032, 2145, 2226, 2288, 2341, 2450, 2471, 2494, 2544, 2715, 2791, 2817, 2825, 2880, 2921, 2977, 2993, 3259, 3459, 3473, 3485, 3525, 3859, 3931, 4000, 4073, 4086, 4136, 4163, 4197, 4310, 4338, 4360], 'hyperproliferation': [46, 325, 1023, 1135], 'increased': [48, 327, 1137, 3248, 3794, 4195, 4357], 'susceptibility': [49, 328, 1030], 'due,': [53, 332], 'at': [54, 154, 219, 333, 433, 498, 1128, 1677, 1802, 1870, 1924, 1967, 2007, 2234, 2280, 2336, 2347, 2655, 2837, 3360, 3951], 'least': [55, 155, 220, 334, 434, 499, 1129], 'part,': [57, 222, 336, 501, 1131], 'repression': [59, 338, 1071, 1440], 'transforming': [61, 340, 561, 1057], 'growth': [62, 341, 562, 1058, 1122, 3385], 'factor': [63, 342, 563, 1059], 'beta': [64, 343, 564], 'type': [65, 104, 344, 383, 565, 569, 1062], 'II': [66, 345, 566, 1063, 2783], 'receptor': [67, 346, 567, 1061], '(TGF-βRII)': [68, 347, 1064], '(Murray,': [70, 349], 'Davidson,': [73, 352], 'L.': [74, 353, 685, 843, 851, 998, 1006, 1090, 1098, 1171, 1179, 1473, 1481, 1584, 1592, 2072, 2080, 2159, 2167, 2602, 2610, 2669, 2677, 3217, 3225, 3402, 3410, 4225, 4233], 'Chapkin,': [76, 355], 'R.': [77, 356, 690, 3509], 'S.,': [78, 357], 'Gustafson,': [79, 358], 'W.': [80, 359, 847, 1002, 1094, 1175, 1334, 1477, 1530, 1588, 1786, 2076, 2163, 2392, 2606, 2673, 3221, 3406, 3620, 4229], 'C.,': [81, 360], 'Schattenberg,': [82, 361], 'D.': [83, 362, 3841], 'G.,': [84, 363], '(1999)J.': [89, 368], 'Cell': [90, 369, 832, 859, 988, 1014, 1047, 1106, 1160, 1187, 1489, 1600, 2061, 2088, 2175, 2618, 2685, 3206, 3233, 3418, 4214, 4241], 'Biol.,': [91, 370], '145,': [92, 371], '699–711).': [93, 372], 'Here': [94, 373], 'we': [95, 374, 952, 1246, 1447, 3251, 3330, 3710, 3989], 'report': [96, 375], 'that': [97, 214, 376, 493, 613, 700, 774, 868, 957, 1198, 1231, 1428, 1438, 1449, 2970, 3160, 3296, 3336, 3353, 3383, 3393, 3425, 3466, 3488, 3558, 3789, 3829, 3881, 3899, 3917, 4064, 4128, 4148, 4192, 4259, 4279], 'induces': [99, 378, 1498], 'cyclooxygenase': [103, 382, 568], '2': [105, 384, 570, 2238, 2438, 3805], '(Cox-2)': [106, 385], 'rat': [108, 387, 571, 1258, 2290, 2299, 2832, 2962, 3005, 3016], 'intestinal': [109, 388, 572, 1073, 1117, 1259], 'epithelial': [110, 389, 573, 1074, 1118, 1260], '(RIE)': [111, 390], 'cells': [112, 391, 1075, 1119, 1509, 1547, 1574, 1607, 1614, 1627, 1666, 1692, 1760, 1764, 1825, 2188, 2420, 2533, 2700, 2759, 3264, 3355, 3389, 3396, 3439, 3457, 3496, 3535, 3541, 3556, 3755, 3798, 3803, 3868, 3890, 3901, 3944, 3961, 4009, 4098, 4105, 4291, 4331, 4364], 'vitro': [114, 168, 393, 447, 1467], 'vivo.': [121, 400, 4179, 4300], 'Cox-2': [122, 132, 143, 151, 159, 197, 249, 401, 411, 422, 430, 438, 476, 528, 1277, 1429, 1496, 1752, 1816, 1950, 2291, 2300, 2516, 2537, 2550, 2561, 3567, 3614, 3730, 3740, 3764, 3780, 3790, 3827, 3864, 3873, 3882, 3918, 3936, 3947, 3964, 3971, 3982, 3991, 4015, 4050, 4067, 4093, 4115, 4155, 4166, 4268, 4280, 4312, 4322, 4345, 4379, 4418, 4422], 'mRNA': [123, 152, 402, 431, 1753, 1817, 3351, 3359, 3731, 3765, 3791, 3865, 3883, 3906, 3919, 4313], 'increases': [124, 130, 403, 409], 'more': [125, 404, 3886, 3904, 4265], 'than': [126, 405, 3364, 3891, 3907, 4142, 4270], '10-fold': [127, 406], 'with': [128, 407, 968, 1556, 1615, 1669, 1695, 1765, 1829, 1904, 1935, 1991, 2283, 2309, 2381, 2534, 2630, 2882, 3295, 3499, 3760, 3801, 3967, 4029, 4039, 4333], 'corresponding': [129, 408], 'PGE2': [135, 414, 2408, 2457, 2488, 4141], 'production': [136, 415, 4109], 'RIE/PKCβII': [138, 177, 209, 417, 456, 488, 1506, 1573, 1759, 2758, 3333, 3354, 3388, 3452, 3495, 3540, 3555, 3751, 3783, 3797, 3867, 3889, 3900, 3960, 4097, 4129, 4158], 'cells.': [139, 178, 210, 418, 457, 489, 1262, 1507, 3501, 3784, 3894, 3909, 3926, 3957, 3976, 4034, 4144, 4159, 4317], 'activates': [141, 420], 'promoter': [144, 423, 2517, 2538, 2541, 2551, 2562, 4346, 4380, 4419], 'by': [145, 153, 263, 424, 432, 542, 603, 873, 1124, 1211, 1236, 1268, 1610, 1761, 1868, 2105, 2141, 2191, 2314, 2358, 2525, 2794, 3151, 3244, 3552, 3572, 3767, 3922, 4306, 4358], '2-': [146, 425, 4359], '3-fold': [148, 427, 4361], 'stabilizes': [150, 429], '4-fold.': [156, 435], 'The': [157, 436, 698, 1748, 1900, 1987, 2010, 2136, 2305, 2350, 2483, 2624, 2728, 2787, 2996, 3042, 3100, 3734, 3875, 4350], 'selective': [158, 437], 'inhibitor': [160, 439, 1462, 1856], 'Celecoxib': [161, 275, 440, 554, 1698, 1721, 2104], 'restores': [162, 173, 441, 452, 1502], 'TGF-βRII': [165, 444, 1115, 1442, 1499, 1954, 2149], 'both': [166, 445, 644, 2865, 3083, 4288], 'vivo': [171, 450, 1464, 3303], 'TGFβ-mediated': [174, 453], 'transcription': [175, 207, 454, 486, 2795], 'Likewise,': [179, 458], 'ω-3': [181, 266, 460, 545, 1452, 1671], 'fatty': [182, 267, 461, 546, 1454, 1672], 'acid': [183, 185, 462, 464, 576, 1455, 1457, 1673, 2847], 'eicosapentaenoic': [184, 463, 575, 1456], '(EPA),': [186, 465, 1458], 'which': [187, 264, 466, 543, 1974, 3245, 3258, 3371, 3824, 3997, 4046, 4307, 4366], 'inhibits': [188, 467, 1495], 'activity': [190, 469, 610, 2518, 2552, 2729, 4117, 4347, 4351, 4435], 'carcinogenesis,': [193, 472, 951, 3250], 'causes': [194, 473], 'inhibition': [195, 474, 1113, 1123], 'expression,': [199, 478, 878, 1497, 1500, 3329, 3988], 're-expression': [200, 479], 'TGF-βRII,': [202, 481], 'restoration': [204, 483], 'TGF-β1-mediated': [206, 485], 'Our': [211, 242, 490, 521, 1193, 1424, 3156], 'data': [212, 243, 491, 522, 1426, 2991, 3876, 3913, 4277], 'demonstrate': [213, 492, 1427, 4147, 4258, 4278], 'promotes': [216, 495], 'cancer,': [218, 497], 'through': [223, 502, 643, 769, 1240], 'induction': [224, 503, 3980, 4065], 'Cox-2,': [226, 505], 'suppression': [227, 506], 'TGF-β': [229, 251, 508, 530, 1125, 1216, 1503, 2520, 2585], 'signaling,': [230, 509], 'establishment': [232, 511], 'a': [234, 245, 260, 513, 524, 539, 582, 599, 654, 703, 713, 880, 1066, 1201, 1220, 1249, 1282, 1431, 1459, 1616, 1745, 2247, 2284, 2359, 2451, 2536, 2545, 2656, 2721, 2777, 2818, 2893, 2940, 3050, 3253, 3723, 3819, 3826, 4052, 4070, 4083, 4112, 4169, 4282, 4321, 4334, 4367, 4377], 'TGF-β-resistant,': [235, 514], 'hyperproliferative': [236, 515, 1221], 'state': [237, 516], 'colonic': [240, 256, 519, 535, 963, 1026, 1079, 1134, 2043, 2137, 3167, 3300, 4176, 4190, 4250, 4297], 'epithelium.': [241, 520], 'define': [244, 523], 'procarcinogenic': [246, 525], '→': [248, 250, 527, 529], 'signaling': [252, 531, 718], 'axis': [253, 532], 'within': [254, 533, 2474], 'epithelium,': [257, 536], 'provide': [259, 538, 3914], 'molecular': [261, 540, 3242], 'mechanism': [262, 541, 4305], 'dietary': [265, 544], 'acids': [268, 547], 'nonsteroidal': [270, 549], 'antiinflammatory': [271, 550], 'agents': [272, 551], 'such': [273, 552], 'as': [274, 553, 581, 1065, 1281, 1524, 1744, 1780, 1819, 2151, 2386, 2509, 2594, 2661, 2735, 2742, 2975, 3003, 3104, 3149, 4051], 'suppress': [276, 555], 'carcinogenesis.': [278, 557], 'prostaglandin': [574], 'has': [578, 1320, 1575, 3429], 'been': [579, 1321, 1576], 'described': [580, 1526, 1577, 1781, 1820, 2152, 2387, 2595, 2662, 3150], 'disease': [583], 'aberrant': [585, 716, 916], 'signal': [586, 2355, 3736], 'transduction': [587], '(1Weinstein': [588, 620], 'I.B.': [589, 621], 'Environ.': [590, 622], 'Health': [591, 623], 'Perspect.': [592, 624], '1991;': [593, 625], '93:': [594, 626, 1357, 3643], '175-179Google': [595, 627], 'Scholar).': [596, 637, 697, 742, 864, 904, 941, 1019, 1052, 1111, 1192, 1423, 1545, 1605, 1662, 2093, 2180, 2204, 2407, 2584, 2623, 2690, 3238, 3319, 4246], 'Carcinogenesis': [597], 'multistep': [600], 'process': [601], 'characterized': [602, 1055, 2046], 'progressive': [604], 'changes': [605, 639, 874, 1241, 3444], 'amounts': [608], 'or': [609, 1959, 2468, 2531, 2539, 2645, 3277, 3435, 3492, 4400], 'proteins': [612], 'regulate': [614], 'cellular': [615, 705, 1233, 1776, 1880, 3323, 3447, 3475], 'proliferation,': [616, 669], 'differentiation,': [617, 670], 'survival': [619], 'Scholar,': [628, 818, 837, 1165, 1300, 1359, 1382, 1400, 2066, 3192, 3211, 3589, 3645, 3668, 3686, 4219], '2Fearon': [629], 'E.R.': [630], 'Vogelstein': [631], 'B.': [632, 1410, 3696], 'Cell.': [633, 1419, 3705], '1990;': [634], '61:': [635, 816, 902, 939, 3190, 3317], '759-767Google': [636], 'These': [638, 1020, 2964, 4035, 4061, 4145, 4276, 4374], 'can': [640, 3569], 'be': [641, 767, 3570, 4018], 'mediated': [642, 1239], 'genetic': [645], 'epigenetic': [647], 'mechanisms.': [648], 'Protein': [649], '(PKC)1': [652], 'family': [655], 'ubiquitously': [657], 'expressed': [658, 2508, 2741, 3356, 3950, 3962, 3973, 4010, 4095, 4263], 'serine/threonine': [659], 'kinases': [661], 'whose': [662, 3549], 'members': [663], 'play': [664], 'central': [665], 'roles': [666], 'cell': [668, 2211, 2647, 2707, 3254, 3334], 'apoptosis': [672, 3436], '(reviewed': [673], 'Ref.': [675], '3Murray': [676], 'N.R.': [677, 806, 820, 839, 892, 929, 976, 994, 1035, 1086, 1148, 1167, 1469, 1580, 2049, 2068, 2155, 2598, 2665, 3180, 3194, 3213, 3307, 3398, 4202, 4221], 'Thompson': [678, 854, 1009, 1101, 1182, 1484, 1539, 1595, 1795, 2083, 2170, 2401, 2613, 2680, 3228, 3413, 4236], 'L.J.': [679], 'Fields': [680, 811, 829, 856, 897, 934, 985, 1011, 1044, 1103, 1157, 1184, 1486, 1597, 2058, 2085, 2172, 2615, 2682, 3185, 3203, 3230, 3312, 3415, 4211, 4238], 'A.P.': [681, 812, 830, 857, 898, 935, 986, 1012, 1045, 1104, 1158, 1185, 1487, 1598, 2059, 2086, 2173, 2616, 2683, 3186, 3204, 3231, 3313, 3416, 4212, 4239], 'Parker': [682], 'P.J.': [683, 1388, 3674], 'Dekker': [684], 'Molecular': [686], 'Biology': [687], 'Intelligence': [688], 'Unit.': [689], 'G.': [691], 'Landes': [692], 'Press,': [693], 'Austin,': [694], 'TX1997:': [695], '97-120Google': [696], 'discovery': [699], 'PKC': [701, 717, 749, 762, 795, 876, 4078], 'major': [704], 'target': [706, 1067, 1255, 1434, 2813, 2956, 3045, 3084, 4055, 4170, 4285], 'for': [707, 715, 1068, 1132, 1565, 1681, 1711, 1736, 1815, 1859, 1874, 1970, 1983, 2004, 2018, 2110, 2148, 2237, 2244, 2333, 2437, 2456, 2711, 2772, 2840, 2954, 3082, 3110, 3117, 3123, 3130, 3133, 3348, 3729, 3986, 4108, 4171], 'tumor-promoting': [709], 'phorbol': [710, 1283, 3573], 'esters': [711, 3574], 'suggested': [712], 'role': [714, 759, 792, 1203], 'tumor': [720], 'initiation': [721], 'progression': [723], '(4Castagna': [724], 'Takai': [726], 'Y.': [727, 735, 804, 890, 927, 3178, 3305], 'Kaibuchi': [728], 'K.': [729, 731, 1289, 3578], 'Sano': [730], 'Kikkawa': [732], 'U.': [733, 1294, 1353, 3516, 3583, 3639], 'Nishizuka': [734], 'J.': [736, 831, 845, 858, 987, 1000, 1013, 1046, 1092, 1105, 1159, 1173, 1186, 1311, 1340, 1363, 1475, 1488, 1536, 1586, 1599, 1643, 1792, 2060, 2074, 2087, 2161, 2174, 2398, 2604, 2617, 2671, 2684, 3205, 3219, 3232, 3404, 3417, 3600, 3626, 3649, 3847, 4213, 4227, 4240], 'Biol.': [737, 833, 860, 989, 1015, 1048, 1107, 1161, 1188, 1312, 1490, 1601, 2062, 2089, 2176, 2619, 2686, 3207, 3234, 3419, 3601, 4215, 4242], 'Chem.': [738, 1313, 3602], '1982;': [739], '257:': [740], '7847-7851Google': [741], 'However,': [743], 'relative': [745], 'contribution': [746], 'individual': [748, 761, 2371], 'isozymes': [750, 763, 796], 'not': [754, 2976, 3268, 3471, 3478, 4048, 4059, 4069, 4407], 'well': [755, 3759], 'understood.': [756], 'Ultimately,': [757], 'will': [766], 'understood': [768], 'identification': [770], 'downstream': [772], 'targets': [773, 1266], 'participate': [775], 'specific': [777, 794, 1432, 2452, 3728, 3985, 4084], 'aspects': [778], 'transformed': [781, 3269], 'phenotype.': [782], 'We': [783, 865, 1053, 1229, 3380, 3717, 4160, 4180, 4301], 'have': [784, 866, 1247, 4181], 'focused': [785, 3711], 'our': [786, 3712, 3719, 4040], 'recent': [787, 3157], 'efforts': [788], 'on': [789, 1444, 1862, 2129, 2412, 2755, 2928, 3076, 3433, 3714, 4344, 4417], 'deciphering': [790], 'development': [799], 'cancer': [802, 1328, 3618], '(5Gokmen-Polar': [803, 889, 926, 3177, 3304], 'Murray': [805, 891, 928, 3179, 3306], 'Velasco': [807, 893, 930, 3181, 3308], 'M.A.': [808, 894, 931, 3182, 3309], 'Gatalica': [809, 895, 932, 3183, 3310], 'Z.': [810, 896, 933, 3184, 3311], '2001;': [815, 901, 938, 3189, 3316, 3519], '1375-1381Google': [817, 903, 940, 3191, 3318], '6Murray': [819, 3193], 'Davidson': [821, 848, 977, 1003, 1036, 1095, 1149, 1176, 1478, 1589, 2050, 2077, 2164, 2607, 2674, 3195, 3222, 3407, 4203, 4230], 'L.A.': [822, 849, 978, 1004, 1037, 1096, 1150, 1177, 1479, 1590, 2051, 2078, 2165, 2608, 2675, 3196, 3223, 3408, 4204, 4231], 'Chapkin': [823, 852, 979, 1007, 1038, 1099, 1151, 1180, 1482, 1593, 2052, 2081, 2168, 2611, 2678, 3197, 3226, 3411, 4205, 4234], 'R.S.': [824, 853, 980, 1008, 1039, 1100, 1152, 1181, 1483, 1594, 2053, 2082, 2169, 2612, 2679, 3198, 3227, 3412, 4206, 4235], 'Gustafson': [825, 981, 1040, 1153, 2054, 3199, 4207], 'W.C.': [826, 982, 1041, 1154, 2055, 3200, 4208], 'Schattenberg': [827, 983, 1042, 1155, 2056, 3201, 4209], 'D.G.': [828, 984, 1043, 1156, 2057, 3202, 4210], '1999;': [834, 990, 1049, 1162, 2063, 3208, 3853, 4216], '145:': [835, 991, 1050, 1163, 2064, 3209, 4217], '699-711Google': [836, 992, 1051, 1164, 2065, 3210, 4218], '7Murray': [838, 1166, 2067, 3212, 4220], 'Weems': [840, 995, 1087, 1168, 1470, 1581, 2069, 2156, 2599, 2666, 3214, 3399, 4222], 'C.': [841, 996, 1088, 1169, 1471, 1582, 2070, 2157, 2576, 2600, 2667, 3215, 3400, 3511, 4223], 'Chen': [842, 997, 1089, 1170, 1472, 1583, 2071, 2158, 2601, 2668, 3216, 3401, 4224], 'Leon': [844, 999, 1091, 1172, 1474, 1585, 2073, 2160, 2603, 2670, 3218, 3403, 4226], 'Yu': [846, 1001, 1093, 1174, 1476, 1529, 1587, 1785, 2075, 2162, 2391, 2605, 2672, 3220, 3405, 4228], 'Jamieson': [850, 1005, 1097, 1178, 1480, 1591, 2079, 2166, 2609, 2676, 3224, 3409, 4232], 'E.A.': [855, 1010, 1102, 1183, 1485, 1540, 1596, 1796, 2084, 2171, 2402, 2614, 2681, 3229, 3414, 4237], '2002;': [861, 1016, 1108, 1189, 1491, 1602, 2090, 2177, 2620, 2687, 3235, 3420, 4243], '157:': [862, 1017, 1109, 1190, 1492, 1603, 2091, 2178, 2621, 2688, 3236, 3421, 4244], '915-920Google': [863, 1018, 1110, 1191, 1493, 1604, 2092, 2179, 2622, 2689, 3237, 3422, 4245], 'shown': [867], 'accompanied': [872], 'isozyme': [877], 'including': [879], 'dramatic': [881], 'increase': [882], 'level': [885, 3762, 3934], 'levels': [907, 947, 966, 3361, 3954, 3993, 4013, 4139, 4314], 'are': [908, 920, 2740, 3265, 3489, 4037], 'elevated': [909, 922, 945, 959, 3161, 3777, 4311], 'preneoplastic': [911], 'lesions': [912], 'colon,': [915], 'crypt': [917], 'foci,': [918], 'further': [921], 'tumors': [925, 974], 'To': [942, 2364, 3239, 3320, 3977, 4089, 4409], 'determine': [943, 2922, 4164], 'whether': [944, 3979, 4091, 4165], 'contribute': [948], 'developed': [953, 4182], 'express': [958, 3272, 3372, 3825, 3902], 'epithelium': [964, 1027, 1080, 2044, 2138, 3168, 3301, 4177, 4191, 4251, 4298], 'comparable': [967, 3966, 4028], 'those': [969, 3365, 4030], 'observed': [970, 3297, 3366, 4019, 4031], 'carcinogen-induced': [972, 1032], '(6Murray': [975, 1034, 1147, 2048, 4201], 'Scholar,7Murray': [993], 'animals': [1021], 'exhibit': [1022, 4193], 'enhanced': [1029], 'recently': [1054], 'β': [1060], 'PKCβII-mediated': [1069, 1439, 3261], 'transcriptional': [1070, 2521, 2586, 4054], '(7Murray': [1085, 1468, 1579, 2154, 2597, 2664, 3397], 'PKCβII-induced': [1112], 'renders': [1116], 'insensitive': [1120], 'accounts,': [1127], 'sensitivity': [1138, 4196], 'characteristic': [1142], 'studies': [1194, 3158], 'date': [1196], 'indicate': [1197, 3880, 4063], 'plays': [1200], 'critical': [1202], 'stages': [1207], 'inducing': [1212], 'loss': [1214], 'responsiveness,': [1217], 'thereby': [1218], 'imposing': [1219], 'phenotype,': [1222], 'two': [1223], 'prominent': [1224], 'characteristics': [1225], 'cancer.': [1228], 'reasoned': [1230], 'phenotype': [1234], 'induced': [1235, 1267, 3491, 3571, 3921, 4150], 'gene': [1243, 1265, 1285, 2292, 2923, 4325], 'expression.': [1244, 4088], 'Thus,': [1245], 'initiated': [1248], 'genomic': [1250, 1433, 2979, 3325, 4284], 'analysis': [1251, 1814, 2147, 2409, 2752, 3503, 3713, 3721, 3787, 3897, 3928, 4042, 4123, 4248], 'identify': [1253, 3486, 4049], 'genes': [1256, 2957, 3085, 3487], '(RIE-1)': [1261], 'Among': [1263, 3545], 'inducible': [1272, 3561], 'form': [1273, 3460, 3562], 'cyclooxygenase,': [1275, 3564], 'Cox-2.': [1276, 1445, 3565], 'was': [1278, 1734, 1742, 1754, 1778, 2139, 2189, 2213, 2307, 2356, 2375, 2410, 2466, 2490, 2553, 2628, 2693, 2733, 2753, 2770, 2789, 2835, 3047, 3523, 3557, 3793, 3857, 3929, 3949, 4099, 4326, 4356, 4371, 4425], 'originally': [1279], 'cloned': [1280, 2563], 'ester-inducible': [1284], '(8Hla': [1286, 3575], 'T.': [1287, 1532, 1788, 2394, 2572, 2578, 3576], 'Neilson': [1288, 3577], 'Proc.': [1290, 1349, 3512, 3579, 3635], 'Natl.': [1291, 1350, 3513, 3580, 3636], 'Acad.': [1292, 1351, 3514, 3581, 3637], 'Sci.': [1293, 1352, 3515, 3582, 3638], 'S.': [1295, 1354, 1394, 2574, 3517, 3584, 3640, 3680], '1992;': [1297, 3586], '89:': [1298, 3587], '7384-7388Google': [1299, 3588], '9Jones': [1301, 3590], 'D.A.': [1302, 1336, 3591, 3622], 'Carlton': [1303, 3592], 'D.P.': [1304, 3593], 'McIntyre': [1305, 1341, 3594, 3627], 'T.M.': [1306, 1342, 3595, 3628], 'Zimmerman': [1307, 1343, 3596, 3629], 'G.A.': [1308, 1344, 3597, 3630], 'Prescott': [1309, 1347, 3598, 3633], 'S.M.': [1310, 1348, 3599, 3634], '1993;': [1314, 3603], '268:': [1315, 3604], '9049-9054Google': [1316, 3605], 'Scholar),': [1317, 1494, 3423, 3606, 3709, 3856], 'it': [1319], 'implicated': [1322], 'etiology': [1325], 'rodents': [1330], 'humans': [1332], '(10Kutchera': [1333, 3619], 'Jones': [1335, 3621], 'Matsunami': [1337, 3623], 'Groden': [1339, 3625], 'White': [1345, 3631], 'R.L.': [1346, 3632], '1996;': [1356, 1420, 3642, 3706], '4816-4820Google': [1358, 3644], '11Sheng': [1360, 3646], 'G.G.': [1361, 1641, 3647], 'Shao': [1362, 1535, 1642, 1791, 2397, 3648, 3846], 'Sheng': [1364, 1533, 1634, 1644, 1789, 2395, 3650, 3844], 'H.': [1365, 1408, 1645, 2570, 3651, 3694], 'Hooton': [1366, 1646, 3652], 'E.B.': [1367, 1647, 3653], 'Isakson': [1368, 1648, 3654], 'P.C.': [1369, 1649, 3655], 'Morrow': [1370, 1650, 3656], 'J.D.': [1371, 1651, 3657], 'Coffey': [1372, 1652, 3658], 'R.J.': [1373, 1653, 3659], 'DuBois': [1374, 1654, 3660], 'R.N.': [1375, 1655, 3661, 3849], 'Beauchamp': [1376, 1537, 1656, 1793, 2399, 3662, 3838], 'R.D.': [1377, 1538, 1657, 1794, 2400, 3663, 3839], 'Gastroenterology.': [1378, 1658, 3664], '1997;': [1379, 1659, 3665], '113:': [1380, 1660, 3666], '1883-1891Google': [1381, 1661, 3667], '12Kargman': [1383, 3669], 'S.L.': [1384, 1406, 3670, 3692], "O'Neill": [1385, 3671], 'G.P.': [1386, 3672], 'Vickers': [1387, 3673], 'Evans': [1389, 1415, 3675, 3701], 'J.F.': [1390, 1416, 3676, 3702], 'Mancini': [1391, 3677], 'J.A.': [1392, 3678], 'Jothy': [1393, 3679], '1995;': [1397, 3683], '55:': [1398, 3684], '2556-2559Google': [1399, 3685], '13Oshima': [1401, 3687], 'Dinchuk': [1403, 3689], 'J.E.': [1404, 3690], 'Kargman': [1405, 3691], 'Oshima': [1407, 3693], 'Hancock': [1409, 3695], 'Kwong': [1411, 3697], 'E.': [1412, 3698], 'Trzaskos': [1413, 3699], 'J.M.': [1414, 3700], 'Taketo': [1417, 3703], 'M.M.': [1418, 3704], '87:': [1421, 3707], '803-809Google': [1422, 3708], 'present': [1425], 'depends': [1443], 'Finally,': [1446], 'show': [1448], 'chemopreventive': [1451], 'polyunsaturated': [1453], 'known': [1460], 'responsiveness': [1504], 'RIE-1': [1508, 1613, 1757, 2756, 3263, 3395, 3438, 3500, 3534, 3746, 3802, 3925, 3956, 4033, 4143, 4290, 4316, 4330, 4363], 'derivatives': [1511], 'were': [1512, 1548, 1563, 1608, 1628, 1667, 1693, 1722, 1826, 1884, 1902, 1933, 1977, 1989, 2012, 2025, 2045, 2100, 2117, 2127, 2242, 2324, 2446, 2499, 2507, 2523, 2588, 2701, 2709, 2799, 2815, 2862, 2890, 2919, 2952, 2966, 2986, 3002, 3066, 3074, 3103, 3139, 3449, 3455, 3483, 3998, 4106, 4392], 'grown': [1513], '5%': [1515, 1905, 2433], 'fetal': [1516, 1558, 2434], 'bovine': [1517, 1559, 2435], 'serum': [1518, 2436], "Dulbecco's": [1520, 1551, 2428], 'modified': [1521, 1552, 2429], "Eagle's": [1522, 1553, 2430], 'medium': [1523, 1554, 1710, 2431, 2443, 2465, 2692], 'previously': [1525, 1782, 2047, 2153, 2388, 2596, 2663, 3381], '(14Ko': [1527, 1783, 2389], 'T.C.': [1528, 1784, 2390], 'Sakai': [1531, 1787, 2393], 'H.M.': [1534, 1790, 2396, 3845], 'Oncogene.': [1541, 1797, 2403], '1998;': [1542, 1798, 2404], '16:': [1543, 1799, 2405], '3445-3454Google': [1544, 1800, 2406], 'HEK293': [1546, 3369], 'maintained': [1549], 'supplemented': [1555], '10%': [1557, 1887], 'serum.': [1560], 'Mid-log-phase': [1561], 'cultures': [1562], 'used': [1564, 1735, 1743, 2734, 2771, 2920, 2953, 3001, 3484, 3524, 3858, 3930], 'all': [1566, 1737, 2955, 3069], 'experiments': [1567, 4375], 'unless': [1568], 'otherwise': [1569], 'specified.': [1570], 'Construction': [1571], 'elsewhere': [1578], 'RIE/PKCι': [1606, 3995, 4008, 4044], 'produced': [1609], 'infection': [1611], 'retrovirus': [1617], 'containing': [1618, 2219, 2249, 2432, 2939, 4397], 'full-length': [1620, 3872], 'human': [1621, 3027, 3339, 3349, 3357, 3368, 4003, 4378], 'PKCι': [1622, 4004, 4057], 'cDNA.': [1623], 'RIE/H-Ras': [1624, 2532], 'RIE/Cox-2': [1626, 2187, 2419, 3908, 4104], 'generous': [1629], 'gifts': [1630], 'Drs.': [1632], 'Hongmiao': [1633], 'Ray': [1636], 'DuBois,': [1637], 'Vanderbilt': [1638], 'University': [1639], '(11Sheng': [1640], 'In': [1663, 1689, 3958], 'some': [1664, 1690, 2115], 'experiments,': [1665], 'incubated': [1668, 1694, 1903, 1934, 1990], 'EPA': [1674, 1719], '(Cayman': [1675], 'Biochemicals)': [1676], 'concentrations': [1679], 'times': [1683, 1713, 1804, 1982, 2015, 2327], 'indicated': [1684, 1714, 3788], 'figure': [1687, 1717], 'legends.': [1688, 1718], 'cases,': [1691], '25': [1696, 1766, 2869], 'μm': [1697, 1767], '(UTMB': [1699], 'Pharmacy)': [1700], 'and/or': [1701], '120': [1702], 'pm': [1703], 'TGF-β1': [1704], '(BD': [1705], 'Biosciences)': [1706, 2030, 2459], 'culture': [1709, 2425, 2442, 2514, 4125, 4293], 'solubilized': [1723], 'dimethyl': [1725], 'sulfoxide': [1726], '(Me2SO).': [1727], 'A': [1728, 3344], 'final': [1729, 2887], 'Me2SO': [1730, 1741], 'concentration': [1731], '0.1%': [1733, 1740, 1852, 2256, 2331], 'treatments,': [1738], 'diluent': [1746, 2123], 'control.': [1747, 2738], 'stability': [1749], 'determined': [1755, 2554], 'treatment': [1762], '5,6-dichlorobenzimidazole': [1768], 'riboside': [1769, 1807], 'inhibit': [1771], 'RNA': [1772, 1777, 2182, 2206, 2368, 2767, 2804, 3062, 3081, 3530, 3781], 'polymerase': [1773, 2805], 'II.': [1774], 'Total': [1775, 2181, 2205, 2706, 2766], 'isolated': [1779, 2140, 2190], 'Scholar)': [1801, 3522], 'various': [1803], 'after': [1805, 1973, 2697, 2703, 4021], 'dichlorobenzimidazole': [1806], 'exposure': [1808], 'subjected': [1810, 2144, 2449], 'real-time': [1812, 3345, 3725, 3815], 'RT-PCR': [1813, 3072, 3093, 3346, 3726, 3770, 3816, 3896], 'below.': [1821], 'For': [1822, 4318], 'immunoblot': [1823, 2146], 'analysis,': [1824], 'washed': [1827, 1978, 2013, 2325, 2863], 'twice': [1828, 2108], 'ice-cold': [1830], 'phosphate-buffered': [1831], 'saline': [1832], 'lysed': [1834], 'lysis': [1837], 'buffer': [1838], 'consisting': [1839, 2293, 4382], '50': [1841, 2263, 2876], 'mm': [1842, 1847, 1911, 1916, 2261, 2264], 'Tris-HCl': [1843, 1912], 'pH': [1844, 1913, 2266, 2849], '7.4,': [1845, 1914, 2267], '150': [1846, 1915], 'NaCl,': [1848, 1917, 2262, 2853, 2868, 2875], '0.5%': [1849], 'Nonidet': [1850], 'P-40,': [1851], 'SDS,': [1853, 2257], 'protease': [1855], 'mixture': [1857], '(Sigma)': [1858], '30': [1860, 3111], 'min': [1861, 1985, 2020, 2335, 3132], 'ice.': [1863], 'After': [1864, 2232, 2321], 'removing': [1865], 'particulate': [1866], 'matter': [1867], 'centrifugation': [1869], '10,000': [1871], '×': [1872], 'g': [1873], '20': [1875, 1921, 2334, 3077], 'min,': [1876], 'aliqouts': [1877], 'total': [1879], '(50': [1882, 2444], 'μg)': [1883, 2208, 2769], 'electrophoresed': [1885, 2214], 'acrylamide': [1888], 'Tris-glycine': [1889], 'gels': [1890, 2218], '(Invitrogen)': [1891], 'electrophoretically': [1893, 2224], 'transferred': [1894, 2225], 'polyvinylidene': [1896], 'difluoride': [1897], 'membrane': [1898], '(Bio-Rad).': [1899], 'membranes': [1901, 1976, 1988, 2011, 2228, 2241, 2323], 'nonfat': [1906], 'dried': [1907], 'milk': [1908], '10': [1910, 3118], '0.05%': [1919], 'Tween': [1920, 2859], '(TBST)': [1922], 'overnight': [1923, 2279], '4': [1925, 2556, 4384], '°C': [1926, 2236, 2282, 2338, 2839, 3109, 3116, 3122, 3129], 'block': [1928], 'excess': [1929], 'sites.': [1931], 'Membranes': [1932], 'rabbit': [1936], 'polyclonal': [1937], 'antibodies': [1938], 'against': [1939, 2988], 'PKCβI': [1940, 3274, 3290], '(Santa': [1941, 1946, 1955, 1961], 'Cruz;': [1942, 1947, 1956, 1962], '1:2,000': [1943], 'dilution),': [1944, 1949, 1953, 1958], '1:6,000': [1948], '(Cayman;': [1951], '1:1,000': [1952, 1957], 'actin': [1960], '1:10,000': [1963], 'dilution)': [1964, 2001], 'TBST': [1966, 1980, 2003, 2017], 'room': [1968, 2008], 'temperature': [1969], '3': [1971, 2111, 2695, 4006], 'h,': [1972, 2239], 'three': [1981, 2014, 2326], '15': [1984, 2019, 3124], 'each.': [1986], 'horseradish': [1992], 'peroxidase-conjugated': [1993], 'goat': [1994], 'anti-rabbit': [1995], 'antibody': [1996], '(Kirkegaard': [1997], 'Perry': [1999], 'Laboratories,1:125,000': [2000], '1': [2005, 2851, 3131, 3283, 3342, 3378], 'h': [2006, 2696, 2842], 'temperature.': [2009], 'each,': [2021], 'antigen-antibody': [2023], 'complexes': [2024], 'detected': [2026, 3766], 'using': [2027, 2555, 2590, 2652, 2720, 2760, 2776, 2801, 2864, 2892, 2901, 2925, 2968, 3049, 3089, 3144, 3722, 4395], 'chemiluminescence': [2028], '(Amersham': [2029, 2319, 2458], 'according': [2031, 2714, 2824], "manufacturer's": [2034, 2462, 2717, 2827], 'instructions.': [2035, 2463], 'Transgenic': [2036, 2094], 'expressing': [2039, 3869], 'nontransgenic': [2098, 4253, 4272], 'littermates': [2099, 4273], 'administered': [2101, 2118], '6': [2102], 'mg/kg': [2103], 'oral': [2106], 'gavage': [2107], 'daily': [2109], 'days.': [2112, 2439], 'As': [2113, 3818], 'controls,': [2114], 'equivalent': [2120], 'volume': [2121], '(0.5%': [2124], 'carboxylmethylcellulose).': [2125], 'Mice': [2126], 'terminated': [2128], 'morning': [2131], 'fourth': [2134], 'day.': [2135], 'scraping': [2142], 'from': [2183, 2209, 2303, 2491, 2635, 3392, 3532, 3739, 3745, 4252], 'RIE-1,': [2184, 2416, 2529, 2643, 3940, 4101, 4428], 'RIE/PKCβII,': [2185, 2417, 2530, 2644, 3941, 4102, 4429], 'guanidinium-thiocyanate-phenol-chloroform': [2193], 'method': [2194, 2318, 3148], '(15Chomczynski': [2195], 'Sacchi': [2197], 'Anal.': [2199], 'Biochem.': [2200], '1987;': [2201], '162:': [2202], '156-159Google': [2203], '(10': [2207, 2885], 'each': [2210, 2502], 'line': [2212, 3335], '1%': [2216], 'agarose': [2217], '0.66': [2220], 'm': [2221, 2845, 2852, 2855, 2874], 'formaldehyde': [2222], 'nitrocellulose': [2227], '(Intermountain': [2229], 'Scientific': [2230], 'Corp).': [2231], 'incubation': [2233], '80': [2235, 2348], 'prehybridized': [2243], '2h': [2245], 'solution': [2248], '50%': [2250], 'formamide': [2251], '5×': [2253, 2258], "Denhardt's": [2254], 'solution,': [2255], 'SSPE': [2259], '(750': [2260], 'NaH2PO4': [2265], '5': [2268], 'mmEDTA),': [2269], '100': [2271], 'μg/ml': [2272, 2886], 'single-stranded': [2273], 'sperm': [2274], 'DNA': [2275, 2793], 'then': [2277], 'hybridized': [2278], '42': [2281], 'radiolabeled': [2285], 'cDNA': [2286, 2301, 2774, 2788], 'probe': [2287, 2306, 2385, 2984, 2999, 3547, 3741], '0.81': [2295], 'kb': [2296, 2557, 4385, 4399, 4402], 'excised': [2302], 'PCB7-cox2.': [2304], 'labeled': [2308], '[α-32P]dCTP': [2310], '(800': [2311], 'Ci/mm,': [2312], 'PerkinElmer)': [2313], 'random': [2316], 'priming': [2317], 'Biosciences).': [2320], 'hybridization,': [2322], '0.1×': [2329], 'SSPE,': [2330], 'SDS': [2332], '55': [2337], 'exposed': [2340], 'Eastman': [2342], 'Kodak': [2343], 'X-Omat': [2344], 'AR': [2345], 'film': [2346], '°C.': [2349], 'intensity': [2351], 'autoradiographic': [2354], 'quantified': [2357], 'Lynx': [2360], 'densitometer': [2361], '(Applied': [2362, 3098, 3154], 'Imaging).': [2363], 'verify': [2365], 'equivalency': [2366], 'loading': [2369], 'samples,': [2372], 'blot': [2374, 3786], 'stripped': [2376], 'radioactivity': [2378], 'rehybridized': [2380], '18S': [2383], 'rRNA': [2384], 'conducted': [2411], 'equal': [2413], 'numbers': [2414], 'cultured': [2421], '100-mm': [2423], 'tissue': [2424], 'plates': [2426, 2651], 'Aliquots': [2440], 'μl)': [2445], 'collected': [2447, 2891], 'enzyme-linked': [2453], 'immunosorbent': [2454, 4121], 'assay': [2455, 2480, 2713, 2942, 3347, 3727, 4122], 'following': [2460], 'Culture': [2464], 'diluted': [2467], 'concentrated': [2469], 'appropriately': [2470], 'achieve': [2472], 'values': [2473, 3055, 3138], 'linear': [2476], 'range': [2477, 2484], '(50–6400': [2481], 'pg/ml).': [2482], 'standard': [2487, 2749], 'curve': [2489], '2.5': [2492], 'pg': [2493, 2510], '320': [2495], 'pg/well.': [2496], 'Triplicate': [2497], 'samples': [2498], 'analyzed': [2500, 2900, 3140], 'experiment,': [2503], 'results': [2506, 4036, 4062, 4146, 4391], 'PGE2/ml': [2512], 'medium.': [2515], 'responses': [2522, 2587], 'assessed': [2524, 2589, 4303], 'transient': [2526], 'transfection': [2527], 'either': [2535, 3490], 'TGF-β-responsive': [2540], 'construct': [2542, 4381], 'linked': [2543], 'luciferase': [2546, 2633, 2732], 'reporter': [2547, 2567, 2593, 4324, 4355, 4424, 4438], 'gene,': [2548], 'respectively.': [2549], 'mouse': [2560], 'into': [2564, 2640, 4329, 4427], 'PGL3': [2566], 'plasmid': [2568], '(16Inoue': [2569], 'Nanayama': [2571], 'Hara': [2573], 'Yokoyama': [2575], 'Tanabe': [2577], 'FEBS': [2579], 'Lett.': [2580], '1994;': [2581], '350:': [2582], '51-54Google': [2583], '3TP-Luc': [2592], 'appropriate': [2625], 'vector': [2627, 4337, 4370], 'cotransfected': [2629, 4328], 'TK-pRL': [2631], '(Renilla': [2632], 'transcribed': [2634], 'HSV': [2637], 'TK': [2638], 'promoter)': [2639], '70–80%': [2641], 'confluent': [2642], 'RIE/H-ras': [2646], 'lines': [2648], '6-well': [2650], 'Tfx-50': [2653], '(Promega)': [2654, 2719], 'DNA:liposome': [2657], 'ratio': [2658], '1:3': [2660], 'Fresh': [2691], 'added': [2694], 'transfection,': [2698], 'harvested': [2702], '24': [2704], 'h.': [2705], 'extracts': [2708], 'prepared': [2710], 'dual-luciferase': [2712], 'instructions': [2718], 'Monolight': [2722], '2010': [2723], 'Luminometer': [2724], '(Analytical': [2725], 'Luminescence': [2726], 'Laboratory).': [2727], 'Renilla': [2731], 'internal': [2737], 'Results': [2739], 'mean': [2744, 2819, 3735], 'triplicate': [2746], 'determinations': [2747], '±': [2748], 'deviation.': [2750], 'Gene-profiling': [2751], 'performed': [2754, 2836, 3075], 'RG-U34A': [2761, 2833], 'Gene': [2762, 2894, 2904, 3481], 'Chips®': [2763, 3482], 'microarrays': [2764, 2834, 3505, 3744], '(Affymetrix).': [2765], '(25': [2768], 'first-strand': [2773], 'synthesis': [2775], 'T7–(dT)24': [2778], 'oligomer': [2779], '(5′-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG-dT24–3′)': [2780], 'SuperScript': [2782], 'reverse': [2784, 2911, 3013, 3024, 3039, 3106], 'transcriptase': [2785], '(Invitrogen).': [2786], 'converted': [2790], 'double-stranded': [2792], 'vitro.': [2797], 'cRNAs': [2798], 'synthesized': [2800], 'bacteriophage': [2802], 'T7': [2803], 'presence': [2808], 'biotinylated': [2810], 'nucleotides.': [2811], 'Biotin-labeled': [2812], 'RNAs': [2814], 'fragmented': [2816], 'size': [2820], '200': [2822], 'bases': [2823], 'protocol.': [2828], 'Hybridization': [2829], '45': [2838], '16': [2841], '0.1': [2844], '2-morpholinoethanesulfonic': [2846], '(MES)': [2848], '6.6,': [2850], '0.02': [2854], 'EDTA,': [2856], '0.01%': [2858], '20.': [2860], 'Microarrays': [2861], 'nonstringent': [2866], '(1m': [2867], '°C)': [2870, 2877], 'stringent': [2872], '(1': [2873], 'conditions': [2878], 'prior': [2879], 'staining': [2881], 'phycoerythrin-labeled': [2883], 'streptavidin': [2884], 'concentration).': [2888], 'Data': [2889], 'Array': [2895], 'Scanner': [2896], '(Hewlett': [2897], 'Packard)': [2898], 'Affymetrix': [2903, 3480], 'Chip': [2905], 'Analysis': [2906], 'Suite': [2907], '5.0': [2908], 'software.': [2909], 'Real-time': [2910, 3895], 'transcriptase-polymerase': [2912], 'chain': [2913], 'reaction': [2914], '(real': [2915], 'time': [2916, 3769], 'RT-PCR)': [2917], 'assays': [2918, 2965], 'TaqMan': [2926, 2947, 3091], 'technology': [2927], 'Applied': [2930, 2936], 'Biosystems': [2931, 2937], '7000': [2932], 'sequence': [2933, 4405], 'detection': [2934], 'system.': [2935], 'Assays-By-Design': [2938], '20×': [2941], 'mix': [2943, 3095], 'primers': [2945, 2969], 'MGB': [2948], 'probes': [2949], '(FAMTM': [2950], 'dye-labeled)': [2951], 'endogenous': [2960, 3087, 3374], 'control,': [2961, 3821], 'β-actin.': [2963], 'designed': [2967], 'span': [2971], 'exon-exon': [2972], 'junctions': [2973], 'so': [2974], 'detect': [2978], 'DNA.': [2980], 'All': [2981], 'primer': [2982, 2997, 3011, 3014, 3022, 3025, 3037, 3040], 'sequences': [2985, 3000], 'searched': [2987], 'Celera': [2990], 'base': [2992], 'confirm': [2994], 'specificity.': [2995], 'follows:': [3004, 3105], 'PAI1-probe': [3006], 'spanning': [3007, 3018, 3029], 'exon8': [3008, 3019], 'CCAACAGAGACAATCC,': [3009], 'forward': [3010, 3021, 3036], 'ACCGATCCTTTCTCTTTGTGGTT,': [3012], 'CATCAGCTGGCCCATGAAG;': [3015], 'Cox-2-probe': [3017], 'CCCAGCAACCCGG,': [3020], 'GAGTCATTCACCA-GACAGATTGCT,': [3023], 'GTACAGCGATTGGAACATTCCTT;': [3026], 'PKCβII-probe': [3028], 'PKCβI/PKCβII': [3031], 'alternative': [3032], 'splice': [3033], 'junction': [3034], 'TCGCCCACAAGCT,': [3035], 'AAACTTGAACGCAAAGAGATCCA,': [3038], 'ATCGGTCGAAGTTTTCAGCATT.': [3041], 'efficiency': [3043], 'amplification': [3046, 3052], 'validated': [3048], 'reference': [3051], 'reaction.': [3053], 'Absolute': [3054], 'slope': [3058], 'log': [3060], 'input': [3061, 3080], 'amount': [3063, 3969], 'versus': [3064], 'ΔCT': [3065], '<0.1': [3067], 'experiments.': [3070], 'One-step': [3071], 'reactions': [3073], 'ng': [3078], 'controls': [3088], 'one-step': [3092], 'master': [3094], 'reagent': [3096], 'kit': [3097], 'Biosystems).': [3099, 3155], 'cycling': [3101], 'parameters': [3102], 'transcription,': [3107], '48': [3108], 'min;': [3112, 3119], 'AmpliTaq': [3113], 'activation,': [3114], '95': [3115, 3121], 'denaturation,': [3120], 's;': [3125], 'annealing/extension,': [3127], '60': [3128], '40': [3134], 'cycles.': [3135], 'Duplicate': [3136], 'CT': [3137], 'Microsoft': [3142], 'Excel': [3143], 'comparative': [3146], 'CT(ΔΔCT)': [3147], 'manufacturer': [3153], 'demonstrated': [3159, 3352, 3382, 4127], 'early,': [3171], 'elucidate': [3240], 'mechanisms': [3243], 'mediates': [3247], 'established': [3252], 'model': [3255], 'system': [3256], 'explore': [3260], 'signaling.': [3262], 'immortalized': [3266], 'but': [3267, 3275, 4080, 4389], 'consequently': [3271], 'abundant': [3273, 3338, 3373, 3887, 3963], 'little': [3276], 'no': [3278, 3430, 3443], 'detectable': [3279], 'PKCBII': [3280], '(Fig.': [3282, 3341, 3377, 3804, 4005], 'A).': [3284, 3343, 3733, 3946, 4349], 'This': [3285], 'pattern': [3286], 'consistent': [3294, 4038, 4390], 'assess': [3321, 3932, 3978, 4090, 4339, 4411], 'effects': [3326], 'created': [3331], 'expresses': [3337], 'somewhat': [3362], 'lower': [3363], 'cells,': [3370, 3453, 3823, 3996, 4045, 4130, 4133, 4432], 'B).': [3379, 4007], 'rate': [3386], 'indistinguishable': [3391], 'indicating': [3424, 3465], 'overexpression': [3426], 'significant': [3431, 4283], 'effect': [3432, 4341, 4413], 'proliferation': [3434], 'culture.': [3441], 'Similarly,': [3442], 'gross': [3446], 'morphology': [3448], 'noted': [3450], 'nor': [3454], 'these': [3456, 3912], 'able': [3458], 'colonies': [3461], 'soft': [3463], 'agar,': [3464], 'sufficient': [3472], 'cause': [3474], 'transformation': [3476], '(data': [3477, 4058, 4406], 'shown).': [3479, 4060, 4408], 'inhibited': [3493], 'when': [3497, 3799], 'compared': [3498, 3800], 'Significance': [3502], '(17Tusher': [3506], 'V.': [3507], 'Tibshirami': [3508], 'Chu': [3510], '98:': [3520], '5116-5121Google': [3521], 'compare': [3526, 3860], 'profiles': [3528], 'extracted': [3531], 'control': [3533], '(n': [3536, 3542, 3747, 3752], '=': [3537, 3543, 3748, 3753], '7)': [3538, 3749], '3).': [3544], 'sets': [3548, 3742], 'changed': [3551], '>2.0-fold': [3553], 'encoding': [3559], 'Because': [3566], 'because': [3608], 'strong': [3611], 'association': [3612], 'between': [3613], 'this': [3715, 4319], 'gene.': [3716], 'confirmed': [3718, 3898], 'microarray': [3720, 3813, 4041], 'quantitative': [3724], '(Fig.2': [3732], 'intensities': [3737], 'obtained': [3738, 4394], '3)': [3754], '(gray': [3756], 'bars)': [3757], 'correlated': [3758], 'real': [3768], '(black': [3771], 'bars),': [3772], 'providing': [3773, 3807], 'independent': [3774, 3809], 'confirmation': [3775, 3810], 'Northern': [3785], '>10-fold': [3795], 'B),': [3806], 'data.': [3817], 'positive': [3820], 'RIE/Cox2': [3822, 3893, 3943, 3975, 4132], 'transgene': [3828], 'deleted': [3831], '3′-untranslated': [3834], 'region': [3835], "(18O'Mahony": [3836], 'C.A.': [3837], 'Albo': [3840], 'Tsujii': [3842], 'Dubois': [3848], 'Berger': [3850], 'D.H.': [3851], 'Surgery.': [3852], '126:': [3854], '364-370Google': [3855], 'abundance': [3862], 'endogenous,': [3871], 'transcript.': [3874], 'Fig.2': [3878], 'B': [3879], 'even': [3885], '1.4-fold': [3903], 'Taken': [3910], 'together,': [3911], 'conclusive': [3915], 'evidence': [3916], 'Immunoblot': [3927, 4247], '(Fig.3': [3945, 4118, 4274], 'nearly': [3952], 'undetectable': [3953], 'contrast,': [3959], 'assayed': [3990, 4107], 'engineered': [3999], 'overexpress': [4001], 'very': [4011, 4022], 'low': [4012], '(which': [4016], 'could': [4017], 'only': [4020], 'long': [4023], 'exposures': [4024], 'immunoblots)': [4027], 'did': [4047], 'potential': [4053], 'general': [4071], 'response': [4072, 4085], 'any': [4077], 'isozyme,': [4079], 'rather': [4081], 'functional,': [4100], 'PGE2,': [4111], 'product': [4113], 'enzyme': [4116, 4156], 'C).': [4119], 'Enzyme-linked': [4120], 'supernatants': [4126], 'like': [4131], 'secreted': [4134], '3-': [4135], '4-fold': [4137], 'higher': [4138], 'active': [4154], 'next': [4161, 4302], 'wished': [4162], 'also': [4168, 4393], 'regulation': [4173], 'PCKβII': [4184], 'overexpressing': [4186], 'azoxymethane-mediated': [4198], 'significantly': [4264], 'their': [4271], 'D).': [4275], 'purpose,': [4320], 'promoter/luciferase': [4323, 4423], 'transiently': [4327], 'along': [4332], '(Fig.4': [4348], 'Cox-2/luciferase': [4354], 'simultaneously': [4372], 'introduced.': [4373], 'utilized': [4376], '5′-flanking': [4387, 4404], 'sequence,': [4388], 'promoters': [4396], '7': [4398], '1.4': [4401], 'independently': [4410], 'activity,': [4420], 'transfected': [4426], 'RIE/Ras': [4431], 'w': [4439]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2146103904', 'counts_by_year': [{'year': 2023, 'cited_by_count': 2}, {'year': 2022, 'cited_by_count': 1}, {'year': 2020, 'cited_by_count': 2}, {'year': 2019, 'cited_by_count': 2}, {'year': 2018, 'cited_by_count': 1}, {'year': 2017, 'cited_by_count': 1}, {'year': 2016, 'cited_by_count': 3}, {'year': 2015, 'cited_by_count': 1}, {'year': 2014, 'cited_by_count': 2}, {'year': 2013, 'cited_by_count': 1}, {'year': 2012, 'cited_by_count': 3}], 'updated_date': '2024-12-12T23:49:04.199140', 'created_date': '2016-06-24'}