Publication Information

{'id': 'https://openalex.org/W2144126736', 'doi': 'https://doi.org/10.1074/jbc.m101890200', 'title': "The Latency-associated Nuclear Antigen of Kaposi's Sarcoma-associated Herpesvirus Transactivates the Telomerase Reverse Transcriptase Promoter", 'display_name': "The Latency-associated Nuclear Antigen of Kaposi's Sarcoma-associated Herpesvirus Transactivates the Telomerase Reverse Transcriptase Promoter", 'publication_year': 2001, 'publication_date': '2001-06-01', 'ids': {'openalex': 'https://openalex.org/W2144126736', 'doi': 'https://doi.org/10.1074/jbc.m101890200', 'mag': '2144126736', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/11313352'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m101890200', 'pdf_url': 'http://www.jbc.org/article/S0021925820785935/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820785935/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5085330501', 'display_name': 'Jason S. Knight', 'orcid': 'https://orcid.org/0000-0003-0995-9771'}, 'institutions': [], 'countries': [], 'is_corresponding': False, 'raw_author_name': 'Jason S. Knight', 'raw_affiliation_strings': ['‡Medical Scientist Training Program,the'], 'affiliations': [{'raw_affiliation_string': '‡Medical Scientist Training Program,the', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5054804283', 'display_name': 'Murray A. Cotter', 'orcid': None}, 'institutions': [], 'countries': [], 'is_corresponding': False, 'raw_author_name': 'Murray A. Cotter', 'raw_affiliation_strings': ['¶Cell and Molecular Biology Graduate Program, and the', '‡Medical Scientist Training Program,the'], 'affiliations': [{'raw_affiliation_string': '‡Medical Scientist Training Program,the', 'institution_ids': []}, {'raw_affiliation_string': '¶Cell and Molecular Biology Graduate Program, and the', 'institution_ids': []}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5032066345', 'display_name': 'Erle S. Robertson', 'orcid': 'https://orcid.org/0000-0002-6088-2979'}, 'institutions': [{'id': 'https://openalex.org/I27837315', 'display_name': 'University of Michigan–Ann Arbor', 'ror': 'https://ror.org/00jmfr291', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I27837315']}], 'countries': ['US'], 'is_corresponding': True, 'raw_author_name': 'Erle S. Robertson', 'raw_affiliation_strings': ['**Department of Microbiology and Immunology and the Comprehensive Cancer and Geriatrics Center, University of Michigan Medical Center CCGC 3217, Ann Arbor, Michigan 48109-0934', '¶Cell and Molecular Biology Graduate Program, and the', '‡Medical Scientist Training Program,the'], 'affiliations': [{'raw_affiliation_string': '‡Medical Scientist Training Program,the', 'institution_ids': []}, {'raw_affiliation_string': '¶Cell and Molecular Biology Graduate Program, and the', 'institution_ids': []}, {'raw_affiliation_string': '**Department of Microbiology and Immunology and the Comprehensive Cancer and Geriatrics Center, University of Michigan Medical Center CCGC 3217, Ann Arbor, Michigan 48109-0934', 'institution_ids': ['https://openalex.org/I27837315']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': ['https://openalex.org/A5032066345'], 'corresponding_institution_ids': ['https://openalex.org/I27837315'], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 7.476, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 103, 'citation_normalized_percentile': {'value': 0.915705, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 96, 'max': 97}, 'biblio': {'volume': '276', 'issue': '25', 'first_page': '22971', 'last_page': '22978'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10981', 'display_name': 'Cytomegalovirus and herpesvirus research', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2713', 'display_name': 'Epidemiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10981', 'display_name': 'Cytomegalovirus and herpesvirus research', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2713', 'display_name': 'Epidemiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T10625', 'display_name': 'Herpesvirus Infections and Treatments', 'score': 0.9996, 'subfield': {'id': 'https://openalex.org/subfields/2713', 'display_name': 'Epidemiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T10685', 'display_name': 'Viral-associated cancers and disorders', 'score': 0.9995, 'subfield': {'id': 'https://openalex.org/subfields/2730', 'display_name': 'Oncology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/kaposis-sarcoma-associated-herpesvirus', 'display_name': "Kaposi's sarcoma-associated herpesvirus", 'score': 0.61379397}, {'id': 'https://openalex.org/keywords/transcription', 'display_name': 'Transcription', 'score': 0.45898}, {'id': 'https://openalex.org/keywords/telomerase-rna-component', 'display_name': 'Telomerase RNA component', 'score': 0.4448985}], 'concepts': [{'id': 'https://openalex.org/C125593758', 'wikidata': 'https://www.wikidata.org/wiki/Q15315135', 'display_name': 'Telomerase reverse transcriptase', 'level': 4, 'score': 0.8376615}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.6568842}, {'id': 'https://openalex.org/C94581717', 'wikidata': 'https://www.wikidata.org/wiki/Q331839', 'display_name': 'Telomerase', 'level': 3, 'score': 0.6338521}, {'id': 'https://openalex.org/C156719811', 'wikidata': 'https://www.wikidata.org/wiki/Q28774', 'display_name': 'Reverse transcriptase', 'level': 4, 'score': 0.62203074}, {'id': 'https://openalex.org/C2780797929', 'wikidata': 'https://www.wikidata.org/wiki/Q983850', 'display_name': "Kaposi's sarcoma-associated herpesvirus", 'level': 5, 'score': 0.61379397}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.5953285}, {'id': 'https://openalex.org/C75934600', 'wikidata': 'https://www.wikidata.org/wiki/Q419245', 'display_name': 'Ribonucleoprotein', 'level': 4, 'score': 0.5516025}, {'id': 'https://openalex.org/C179926584', 'wikidata': 'https://www.wikidata.org/wiki/Q207714', 'display_name': 'Transcription (linguistics)', 'level': 2, 'score': 0.45898}, {'id': 'https://openalex.org/C177336024', 'wikidata': 'https://www.wikidata.org/wiki/Q14872779', 'display_name': 'Telomere', 'level': 3, 'score': 0.44624066}, {'id': 'https://openalex.org/C34558173', 'wikidata': 'https://www.wikidata.org/wiki/Q18031947', 'display_name': 'Telomerase RNA component', 'level': 5, 'score': 0.4448985}, {'id': 'https://openalex.org/C104292427', 'wikidata': 'https://www.wikidata.org/wiki/Q899781', 'display_name': 'Protein subunit', 'level': 3, 'score': 0.43539226}, {'id': 'https://openalex.org/C159047783', 'wikidata': 'https://www.wikidata.org/wiki/Q7215', 'display_name': 'Virology', 'level': 1, 'score': 0.34963444}, {'id': 'https://openalex.org/C67705224', 'wikidata': 'https://www.wikidata.org/wiki/Q11053', 'display_name': 'RNA', 'level': 3, 'score': 0.3218383}, {'id': 'https://openalex.org/C2522874641', 'wikidata': 'https://www.wikidata.org/wiki/Q808', 'display_name': 'Virus', 'level': 2, 'score': 0.20301062}, {'id': 'https://openalex.org/C552990157', 'wikidata': 'https://www.wikidata.org/wiki/Q7430', 'display_name': 'DNA', 'level': 2, 'score': 0.17911538}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.12156269}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.10895574}, {'id': 'https://openalex.org/C41895202', 'wikidata': 'https://www.wikidata.org/wiki/Q8162', 'display_name': 'Linguistics', 'level': 1, 'score': 0.0}, {'id': 'https://openalex.org/C138885662', 'wikidata': 'https://www.wikidata.org/wiki/Q5891', 'display_name': 'Philosophy', 'level': 0, 'score': 0.0}, {'id': 'https://openalex.org/C2780727368', 'wikidata': 'https://www.wikidata.org/wiki/Q1928978', 'display_name': 'Viral disease', 'level': 3, 'score': 0.0}, {'id': 'https://openalex.org/C2776409557', 'wikidata': 'https://www.wikidata.org/wiki/Q149348', 'display_name': 'Herpesviridae', 'level': 4, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D015654', 'descriptor_name': 'Herpesvirus 6, Human', 'qualifier_ui': 'Q000276', 'qualifier_name': 'immunology', 'is_major_topic': True}, {'descriptor_ui': 'D009687', 'descriptor_name': 'Nuclear Proteins', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D011401', 'descriptor_name': 'Promoter Regions, Genetic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D012313', 'descriptor_name': 'RNA', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D012514', 'descriptor_name': 'Sarcoma, Kaposi', 'qualifier_ui': 'Q000821', 'qualifier_name': 'virology', 'is_major_topic': True}, {'descriptor_ui': 'D019098', 'descriptor_name': 'Telomerase', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D015533', 'descriptor_name': 'Transcriptional Activation', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D000956', 'descriptor_name': 'Antigens, Viral', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002460', 'descriptor_name': 'Cell Line', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002471', 'descriptor_name': 'Cell Transformation, Neoplastic', 'qualifier_ui': 'Q000276', 'qualifier_name': 'immunology', 'is_major_topic': False}, {'descriptor_ui': 'D002471', 'descriptor_name': 'Cell Transformation, Neoplastic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002472', 'descriptor_name': 'Cell Transformation, Viral', 'qualifier_ui': 'Q000276', 'qualifier_name': 'immunology', 'is_major_topic': False}, {'descriptor_ui': 'D002472', 'descriptor_name': 'Cell Transformation, Viral', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004273', 'descriptor_name': 'DNA, Neoplasm', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D004273', 'descriptor_name': 'DNA, Neoplasm', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015654', 'descriptor_name': 'Herpesvirus 6, Human', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009687', 'descriptor_name': 'Nuclear Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012514', 'descriptor_name': 'Sarcoma, Kaposi', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016329', 'descriptor_name': 'Sp1 Transcription Factor', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D016329', 'descriptor_name': 'Sp1 Transcription Factor', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019098', 'descriptor_name': 'Telomerase', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015533', 'descriptor_name': 'Transcriptional Activation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014407', 'descriptor_name': 'Tumor Cells, Cultured', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m101890200', 'pdf_url': 'http://www.jbc.org/article/S0021925820785935/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/11313352', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m101890200', 'pdf_url': 'http://www.jbc.org/article/S0021925820785935/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'display_name': 'Good health and well-being', 'id': 'https://metadata.un.org/sdg/3', 'score': 0.43}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 71, 'referenced_works': ['https://openalex.org/W1516272650', 'https://openalex.org/W1523189699', 'https://openalex.org/W1547608553', 'https://openalex.org/W1563899879', 'https://openalex.org/W1578101184', 'https://openalex.org/W1604210388', 'https://openalex.org/W1611840803', 'https://openalex.org/W1654953809', 'https://openalex.org/W1673837423', 'https://openalex.org/W1787380229', 'https://openalex.org/W1892268352', 'https://openalex.org/W1964228845', 'https://openalex.org/W1967478094', 'https://openalex.org/W1972008542', 'https://openalex.org/W1974538337', 'https://openalex.org/W1988718547', 'https://openalex.org/W1991952124', 'https://openalex.org/W1996593524', 'https://openalex.org/W2000535756', 'https://openalex.org/W2000971601', 'https://openalex.org/W2002761352', 'https://openalex.org/W2002900144', 'https://openalex.org/W2007460406', 'https://openalex.org/W2008451606', 'https://openalex.org/W2010882280', 'https://openalex.org/W2021489383', 'https://openalex.org/W2025853381', 'https://openalex.org/W2026856852', 'https://openalex.org/W2029735450', 'https://openalex.org/W2030976397', 'https://openalex.org/W2032438721', 'https://openalex.org/W2035499819', 'https://openalex.org/W2039709545', 'https://openalex.org/W2041699201', 'https://openalex.org/W2046268297', 'https://openalex.org/W2055369067', 'https://openalex.org/W2063271191', 'https://openalex.org/W2066410692', 'https://openalex.org/W2069744703', 'https://openalex.org/W2074356440', 'https://openalex.org/W2076825355', 'https://openalex.org/W2081651119', 'https://openalex.org/W2084033679', 'https://openalex.org/W208570163', 'https://openalex.org/W2090825699', 'https://openalex.org/W2098190927', 'https://openalex.org/W2103725178', 'https://openalex.org/W2106882164', 'https://openalex.org/W2110980603', 'https://openalex.org/W2113655514', 'https://openalex.org/W2115346781', 'https://openalex.org/W2132477621', 'https://openalex.org/W2134447274', 'https://openalex.org/W2142843429', 'https://openalex.org/W2143318037', 'https://openalex.org/W2143384363', 'https://openalex.org/W2144326983', 'https://openalex.org/W2146670318', 'https://openalex.org/W2154191201', 'https://openalex.org/W2159163386', 'https://openalex.org/W2175722093', 'https://openalex.org/W2294769548', 'https://openalex.org/W2312580646', 'https://openalex.org/W2336241188', 'https://openalex.org/W2339858708', 'https://openalex.org/W2340370018', 'https://openalex.org/W2380829838', 'https://openalex.org/W2410723119', 'https://openalex.org/W2414978414', 'https://openalex.org/W4231673260', 'https://openalex.org/W4238245790'], 'related_works': ['https://openalex.org/W3028684203', 'https://openalex.org/W2594118695', 'https://openalex.org/W2319007677', 'https://openalex.org/W2153802149', 'https://openalex.org/W2121324028', 'https://openalex.org/W2114551234', 'https://openalex.org/W2073119209', 'https://openalex.org/W2046651431', 'https://openalex.org/W2020016778', 'https://openalex.org/W1549402393'], 'abstract_inverted_index': {'Telomerase': [0, 22, 202, 224, 607, 639], 'is': [1, 25, 43, 203, 227, 245, 588, 608, 640, 720, 824, 896, 910, 972, 1037, 1140, 1237, 1347, 1364, 1376, 1956, 2009, 2046, 2220, 2268, 2397, 2577, 2584, 2814, 2843, 2972, 3837, 4119, 4431], 'a': [2, 78, 109, 125, 204, 280, 311, 327, 437, 609, 825, 1721, 1875, 1971, 2010, 2116, 2265, 2312, 2327, 2398, 2450, 2456, 2644, 2650, 2844, 2849, 2890, 2973, 3091, 3200, 3411, 3422, 3488, 3501, 3509, 3567, 3823, 3955, 4063, 4219, 4269, 4294], 'multi-subunit': [3, 205], 'ribonucleoprotein': [4, 206, 610], 'holoenzyme': [5, 207], 'that': [6, 56, 103, 184, 208, 258, 305, 386, 613, 901, 2267, 2271, 2439, 2640, 2665, 2728, 2819, 3319, 3326, 3353, 4016, 4106, 4160, 4305, 4316, 4336, 4410, 4428], 'stabilizes': [7, 209], 'telomere': [8, 210, 617], 'length': [9, 211, 482, 618], 'through': [10, 50, 212, 252, 1350, 1814, 2658], 'the': [11, 18, 26, 33, 40, 46, 51, 69, 74, 90, 93, 133, 136, 148, 185, 192, 196, 213, 220, 228, 235, 242, 248, 253, 271, 276, 292, 295, 335, 338, 350, 387, 394, 398, 430, 442, 593, 620, 903, 978, 982, 1143, 1226, 1351, 1357, 1374, 1433, 1437, 1520, 1525, 1536, 1539, 1658, 1704, 1712, 1716, 1797, 1880, 1884, 1890, 2041, 2047, 2121, 2203, 2274, 2409, 2589, 2668, 2702, 2738, 2749, 2809, 2822, 2982, 3161, 3254, 3290, 3308, 3331, 3335, 3354, 3651, 3666, 3688, 3722, 3732, 3814, 3841, 3844, 3855, 3867, 3980, 3983, 4004, 4010, 4021, 4026, 4030, 4033, 4075, 4090, 4093, 4099, 4107, 4110, 4114, 4123, 4131, 4139, 4158, 4161, 4168, 4175, 4278, 4285, 4289, 4320, 4328, 4344, 4347, 4383, 4414, 4435, 4447], 'addition': [12, 214, 621], 'of': [13, 20, 28, 36, 39, 48, 53, 77, 92, 99, 135, 198, 215, 222, 230, 238, 241, 250, 255, 279, 294, 301, 337, 400, 433, 436, 441, 483, 573, 582, 622, 822, 874, 981, 1146, 1228, 1345, 1353, 1419, 1440, 1538, 1662, 1715, 1730, 1742, 1790, 1810, 2276, 2314, 2326, 2408, 2588, 2627, 2638, 2646, 2737, 2743, 2938, 3130, 3136, 3143, 3182, 3266, 3289, 3297, 3334, 3539, 3687, 3800, 3811, 3835, 3846, 3857, 3885, 3954, 3982, 3991, 4003, 4018, 4032, 4070, 4092, 4109, 4125, 4141, 4146, 4171, 4284, 4319, 4338, 4373, 4382, 4395, 4438], 'new': [14, 216, 623], 'repeat': [15, 217, 440, 624, 908], 'sequence': [16, 163, 218, 365, 443, 625, 909, 3680, 3695], 'to': [17, 86, 131, 140, 166, 219, 288, 333, 342, 368, 488, 590, 615, 837, 891, 1222, 1428, 1534, 1670, 1691, 1701, 1708, 1711, 1860, 1959, 1966, 1969, 2209, 2252, 2270, 2310, 2700, 2732, 3176, 3324, 3351, 3400, 3421, 3451, 3454, 3584, 3685, 3731, 3816, 3859, 3896, 3949, 4001, 4085, 4101, 4122, 4166, 4226, 4327, 4402, 4434], 'ends': [19, 221, 432], 'chromosomes.': [21, 223], 'reverse': [23, 41, 119, 225, 243, 321, 406, 2321], 'transcriptase': [24, 42, 120, 226, 244, 322, 407], 'subunit': [27, 229], 'this': [29, 104, 116, 231, 306, 318, 4147, 4429], 'complex': [30, 194, 232, 396, 612], 'responsible': [31, 233, 1141], 'for': [32, 89, 234, 291, 1142, 2586, 2652, 2897, 3058, 3073, 3207, 3304, 3363, 3395, 3560, 3597, 3622, 3825, 3988], 'enzymatic': [34, 236, 1144], 'activity': [35, 237, 1046, 1145, 1537, 1816, 2899, 3246, 3328, 4148, 4232, 4274, 4308, 4421], 'telomerase.': [37, 239], 'Expression': [38, 240], 'regulated': [44, 246, 1349, 3839], 'at': [45, 247, 429, 3087, 3108, 3166, 3196, 3214, 3224, 3392, 3487, 3500, 3563, 3586, 3594, 3619, 3840, 4343], 'level': [47, 249], 'transcription': [49, 54, 176, 251, 256, 378, 1354, 4019, 4027, 4342], 'action': [52, 254, 1352], 'factors': [55, 257, 1355, 2648], 'target': [57, 259, 2701], 'its': [58, 260], 'promoter.': [59, 261, 1359, 1435, 1706, 2740], 'Most': [60, 262], "Kaposi's": [61, 70, 100, 263, 272, 302, 408, 410, 1960], 'sarcoma': [62, 101, 264, 303, 409, 1961], 'tumor': [63, 265, 1423, 1694, 2049, 2669], 'cells': [64, 266, 577, 643, 658, 832, 842, 887, 1380, 2206, 2248, 2259, 2278, 2362, 2797, 2802, 2885, 2965, 3015, 3046, 3064, 3105, 3120, 3155, 3173, 3211, 3221, 3233, 3518, 3801, 3898, 3908, 3946, 4059, 4393], 'are': [65, 267, 533, 881, 1047, 2202, 2798, 2894], 'latently': [66, 268, 3802], 'infected': [67, 269, 1963, 2359, 3803, 3907], 'with': [68, 270, 579, 644, 840, 888, 1231, 1519, 1524, 1962, 2052, 2108, 2256, 2643, 2851, 3027, 3079, 3095, 3113, 3124, 3149, 3160, 3187, 3204, 3239, 3258, 3294, 3371, 3430, 3440, 3444, 3521, 3536, 3549, 3556, 3572, 3577, 3603, 3608, 3629, 3700, 3721, 3804, 4061, 4074, 4353], 'sarcoma-associated': [71, 273, 411], 'herpesvirus,': [72, 274], 'and': [73, 154, 190, 275, 356, 392, 486, 495, 655, 827, 1224, 1234, 1242, 1370, 1422, 1430, 1523, 1530, 1739, 1796, 1803, 1873, 1889, 2020, 2115, 2213, 2455, 2501, 2532, 2583, 2629, 2748, 2875, 2893, 3013, 3041, 3103, 3133, 3169, 3227, 3236, 3286, 3368, 3388, 3398, 3436, 3448, 3526, 3534, 3542, 3547, 3631, 3650, 3703, 3819, 3888, 3899, 4028, 4149, 4190, 4195, 4203, 4222, 4265, 4315, 4357, 4368, 4427, 4454], 'constitutive': [75, 277], 'expression': [76, 278, 1227, 1344, 2751, 3138, 3831, 3834, 3850, 3861, 4066, 4072, 4095, 4337, 4360, 4372, 4394], 'viral-encoded': [79, 281], 'latency-associated': [80, 137, 144, 186, 282, 339, 346, 388, 413], 'nuclear': [81, 138, 145, 187, 200, 283, 340, 347, 389, 402, 414, 2529, 3746], 'antigen': [82, 105, 139, 146, 188, 284, 307, 341, 348, 390, 415], 'has': [83, 285, 1667, 1698, 2104, 2307, 2350, 2436, 2696, 3879], 'been': [84, 286, 877, 1426, 1668, 1699, 2106, 2250, 2308, 2352, 2698, 2754, 3880], 'shown': [85, 287, 1427, 1533, 1669, 1700, 2251, 2309, 2664, 2699, 3339, 3450, 4225], 'be': [87, 289, 3317, 3452, 4303], 'important': [88, 290, 2585], 'maintenance': [91, 293, 2587], 'viral': [94, 296, 2581, 2590, 2656], 'episome.': [95, 297], 'The': [96, 143, 298, 345, 571, 820, 894, 970, 1136, 1343, 1417, 1787, 2431, 2624, 2741, 2786, 2929, 3154, 3192, 3276, 3337, 3345, 3359, 3415, 3426, 3504, 3552, 3641, 3677, 3692, 3797, 3874, 3998], 'proliferative': [97, 299, 2625, 3798], 'nature': [98, 300, 2626, 3799], 'suggests': [102, 304], 'may': [106, 308], 'also': [107, 309, 1858, 2039, 2351, 2697], 'play': [108, 310], 'critical': [110, 312], 'role': [111, 313, 2651, 3824], 'in': [112, 151, 168, 195, 314, 353, 370, 397, 642, 723, 730, 883, 1044, 1366, 1378, 1517, 1879, 2211, 2216, 2264, 2273, 2279, 2358, 2654, 3018, 3049, 3067, 3090, 3140, 3179, 3199, 3272, 3282, 3343, 3434, 3566, 3725, 3827, 3870, 3882, 3906, 4081, 4113, 4144, 4184, 4272, 4297, 4310, 4377, 4390, 4398, 4422, 4443, 4451], 'viral-mediated': [113, 169, 315, 371], 'oncogenesis.': [114, 316], 'In': [115, 317, 1220, 3715, 3890, 3942, 4211, 4262, 4365], 'study': [117, 319, 2210, 3892, 3944], 'telomerase': [118, 320, 405, 719, 823, 875, 892, 984, 1045, 1147, 1232, 1672, 2898, 4209, 4231, 4279], 'promoter': [121, 150, 160, 323, 352, 362, 1363, 1375, 1541, 3690, 3869, 4006, 4023, 4112, 4280, 4322, 4385, 4416, 4420], 'elements': [122, 324], 'cloned': [123, 325, 4008, 4282], 'into': [124, 326, 4009, 4056], 'luciferase': [126, 328, 2745, 3255, 3298, 3327, 3364, 3863, 4012, 4034, 4273, 4286, 4355], 'reporter': [127, 329, 2746, 3132, 3259, 3273, 3283, 3864, 4013, 4077, 4086, 4356], 'plasmid': [128, 330, 3125, 4361], 'were': [129, 331, 1515, 2789, 2879, 2966, 3016, 3047, 3065, 3085, 3106, 3121, 3156, 3174, 3194, 3212, 3222, 3234, 3268, 3278, 3321, 3347, 3357, 3366, 3406, 3519, 3532, 3545, 3554, 3575, 3606, 3626, 3633, 3643, 3659, 3698, 3772, 3947, 4182, 4223, 4351], 'analyzed': [130, 332], 'determine': [132, 334], 'ability': [134, 336, 3856], 'regulate': [141, 343, 3860], 'transcription.': [142, 344], 'transactivated': [147, 349], 'full-length': [149, 351], '293T,': [152, 354, 3011, 3101, 4191, 4201], '293,': [153, 355, 2319, 3009, 3099, 4199], 'BJAB': [155, 199, 357, 401, 2842, 2874, 3045, 3210, 3517, 3541, 3745, 4290, 4369, 4455], 'cell': [156, 358, 725, 1240, 1245, 1368, 2050, 2119, 2200, 2218, 2675, 2733, 2812, 2846, 2877, 2931, 2978, 3402, 3446, 3877, 3986, 4117, 4151, 4177, 4186, 4267, 4291, 4313, 4349, 4370, 4425, 4456], 'lines.': [157, 359], 'Furthermore,': [158, 360], 'truncation': [159, 361], 'studies': [161, 363, 1518, 1872, 3884], 'implicated': [162, 364, 1808], 'from': [164, 366, 905, 2791, 2848, 2881, 2981, 3683, 3711, 3862], '−130': [165, 367], '+5': [167, 369, 4002], 'activation.': [170, 372], 'This': [171, 373, 4051], 'region': [172, 374, 3999], 'contains': [173, 375], 'five': [174, 376, 4185], 'Sp1': [175, 377, 1522, 3656, 3668, 3705], 'factor-binding': [177, 379], 'sites.': [178, 380], 'Electrophoretic': [179, 381, 3767], 'mobility': [180, 382, 3768], 'shift': [181, 383, 3769], 'assays': [182, 384, 1675, 4181], 'indicated': [183, 385], 'targets': [189, 391, 2040], 'affects': [191, 393], 'Sp1-DNA': [193, 395], 'context': [197, 399], 'extracts.': [201, 403], 'human': [404, 416, 419, 575, 886, 979, 1663, 1862, 1891, 2799, 2940, 3441, 3581], 'herpesvirus': [412, 1863, 1887], 'embryonic': [417, 2800], 'kidney': [418, 2801], 'immunodeficiency': [420], 'virus': [421, 1695, 1894, 2016], 'phosphate-buffered': [422, 3240], 'saline': [423, 3241], 'fluorescein': [424], 'isothiocyanate': [425], 'Telomeric': [426], 'DNA,': [427], 'found': [428], 'distal': [431], 'chromosomes,': [434], 'consists': [435], '6-base': [438], 'pair': [439, 3743], 'TTAGGG': [444], '(1Moyzis': [445], 'R.K.': [446], 'Buckingham': [447], 'J.M.': [448], 'Cram': [449], 'L.S.': [450], 'Dani': [451], 'M.': [452, 666, 676, 706, 710, 734, 1015, 1081, 1083, 1085, 1099, 1103, 1105, 1155, 1199, 1250, 1254, 1263, 1302, 1308, 1310, 1323, 1325, 1331, 1382, 1392, 1394, 1494, 1545, 1553, 1557, 1615, 1621, 1635, 1643, 1645, 1927, 2146, 2415, 2473, 2905, 2944, 3475, 4238], 'Deaven': [453], 'L.L.': [454], 'Jones': [455], 'M.D.': [456, 782, 852, 952], 'Meyne': [457], 'J.': [458, 677, 807, 930, 948, 1013, 1107, 1122, 1193, 1333, 1390, 1500, 1574, 1577, 1754, 1774, 1846, 1904, 1925, 1987, 1998, 2028, 2130, 2168, 2233, 2297, 2338, 2341, 2373, 2386, 2420, 2471, 2514, 2548, 2549, 2568, 2679, 2792, 2864, 2954, 3471, 3756, 3759, 3789, 3919, 3932, 3966, 3969], 'Ratliff': [459], 'R.L.': [460, 748, 1277, 1822], 'Wu': [461], 'J.R.': [462], 'Proc.': [463, 540, 688, 1940, 2486], 'Natl.': [464, 689, 1941, 2487], 'Acad.': [465, 690, 1756, 1942, 2488], 'Sci.': [466, 559, 691, 1943, 2489], 'U.': [467, 692, 1944, 2490], 'S.': [468, 664, 674, 693, 704, 754, 805, 950, 1077, 1097, 1126, 1163, 1248, 1283, 1304, 1319, 1384, 1473, 1543, 1570, 1596, 1611, 1633, 1945, 2085, 2087, 2491, 2565, 2862, 3473], 'A.': [469, 694, 1019, 1327, 1498, 1841, 1946, 1985, 2065, 2492], '1988;': [470], '85:': [471], '6622-6626Crossref': [472], 'PubMed': [473, 506, 520, 548, 566, 602, 634, 698, 768, 797, 815, 867, 924, 965, 1007, 1031, 1069, 1112, 1187, 1215, 1297, 1338, 1484, 1508, 1564, 1588, 1652, 1686, 1764, 1782, 1829, 1852, 1913, 1950, 2003, 2033, 2077, 2098, 2153, 2173, 2194, 2238, 2302, 2346, 2391, 2426, 2496, 2520, 2555, 2573, 2605, 2619, 2690, 2720, 2781, 2837, 2869, 2924, 2959, 3005, 3465, 3482, 3764, 3794, 3937, 3974, 4257], 'Scopus': [474, 507, 521, 549, 567, 603, 635, 699, 769, 798, 816, 868, 925, 966, 1008, 1032, 1070, 1113, 1188, 1216, 1298, 1339, 1485, 1509, 1565, 1589, 1653, 1687, 1765, 1783, 1830, 1853, 1914, 1951, 2004, 2034, 2078, 2099, 2174, 2239, 2392, 2427, 2497, 2521, 2556, 2606, 2620, 2691, 2721, 2782, 2838, 2870, 2925, 2960, 3466, 3483, 3938, 4258], '(1883)': [475], 'Google': [476, 509, 523, 551, 569, 605, 637, 682, 701, 716, 771, 800, 818, 870, 927, 968, 1010, 1034, 1072, 1092, 1115, 1134, 1190, 1218, 1260, 1300, 1316, 1341, 1400, 1415, 1458, 1487, 1511, 1567, 1591, 1606, 1628, 1655, 1689, 1767, 1785, 1832, 1855, 1916, 1953, 2006, 2036, 2080, 2101, 2154, 2176, 2195, 2241, 2303, 2347, 2394, 2429, 2499, 2523, 2558, 2574, 2608, 2622, 2693, 2723, 2770, 2784, 2840, 2872, 2927, 2962, 3006, 3468, 3485, 3765, 3795, 3940, 3975, 4049, 4260], 'Scholar).': [477, 524, 570, 606, 638, 717, 819, 871, 969, 1035, 1135, 1219, 1342, 1416, 1656, 1786, 1856, 1954, 2007, 2037, 2102, 2196, 2242, 2304, 2348, 2395, 2430, 2524, 2575, 2623, 2694, 2724, 2785, 2841, 2873, 2928, 2963, 3007, 3766, 3796, 3941, 3976, 4050, 4261], 'Telomeres': [478], 'have': [479, 876, 1425, 2249, 2753, 4206, 4227], 'an': [480, 897, 973, 1443, 1811, 2441, 2445, 2815, 3636, 3646, 3740, 4378], 'average': [481], '5–15': [484], 'kilobases': [485], 'function': [487], 'prevent': [489], 'chromosome': [490, 493, 496, 583, 2593], 'degradation,': [491], 'end-to-end': [492], 'fusions,': [494], 'loss': [497], '(2Greider': [498, 626], 'C.W.': [499, 512, 556, 627, 919, 958, 1128], 'Annu.': [500, 628], 'Rev.': [501, 629], 'Biochem.': [502, 558, 630], '1996;': [503, 560, 631, 695, 1131, 1683, 1947, 2000, 2493, 3002, 3761], '65:': [504, 632], '337-365Crossref': [505, 633], '(909)': [508, 636], 'Scholar,': [510, 552, 683, 702, 772, 801, 928, 1011, 1073, 1093, 1116, 1191, 1261, 1317, 1401, 1459, 1488, 1568, 1592, 1607, 1629, 1768, 1833, 1917, 2081, 2155, 2177, 2559, 2609, 2771, 3469], '3Greider': [511], 'Cell.': [513, 759, 1022, 1288], '1991;': [514], '67:': [515], '645-647Abstract': [516], 'Full': [517, 563, 763, 765, 812, 1026, 1028, 1292, 1294, 1583, 1585, 1761, 1779], 'Text': [518, 564, 764, 766, 813, 1027, 1029, 1293, 1295, 1584, 1586, 1762, 1780], 'PDF': [519, 565, 767, 814, 1030, 1296, 1587, 1763, 1781], '(79)': [522], 'Additionally,': [525, 2305, 2525], 'telomeres': [526, 572, 2888, 4217], 'can': [527, 4412], 'induce': [528], 'cellular': [529, 1040, 2647, 3829], 'senescence': [530], 'when': [531, 1042, 4277], 'they': [532], 'critically': [534], 'shortened': [535], '(4Chiu': [536], 'C.P.': [537, 940], 'Harley': [538, 779, 849, 953, 1178], 'C.B.': [539, 780, 850, 954, 1179], 'Soc.': [541], 'Exp.': [542, 2918, 4251], 'Biol.': [543, 1578], 'Med.': [544, 1775, 1999, 2029, 2073, 2169, 2234, 2387, 2716, 3933], '1997;': [545, 713, 760, 809, 1004, 1023, 1066, 1184, 1257, 1289, 2388, 2423, 2921, 3934, 4254], '214:': [546], '99-106Crossref': [547], '(175)': [550], '5Autexier': [553], 'C.': [554, 685, 1407, 1450, 1492, 1594, 1600, 2055, 2063, 2377, 2542, 2714, 2762, 3923, 4041], 'Greider': [555, 918, 957, 1127], 'Trends': [557], '21:': [561, 1506], '387-391Abstract': [562], '(150)': [568], 'most': [574], 'somatic': [576], 'shorten': [578], 'each': [580], 'cycle': [581], 'replication': [584, 2594], 'because': [585], 'DNA': [586, 3126, 3657, 3669, 3737, 4172, 4439], 'polymerase': [587, 1869, 2355, 3903], 'unable': [589], 'completely': [591], 'replicate': [592], 'lagging': [594], 'strand': [595], '(6Watson': [596], 'J.D.': [597], 'Nature.': [598, 1682, 2094, 2686], '1972;': [599], '239:': [600], '197-201Crossref': [601], '(52)': [604], 'enzyme': [611], 'functions': [614], 'stabilize': [616], 'via': [619, 4020], 'active': [641, 722, 1361], 'high': [645, 1788], 'regenerative': [646], 'capacity': [647], 'such': [648, 1735, 4015], 'as': [649, 727, 729, 831, 1442, 1736, 1861, 1883, 2633, 2635, 3057, 3072, 3249, 3528, 3750, 3774, 3806, 3808, 4128], 'lymphocytes,': [650], 'hematopoietic': [651], 'progenitor': [652], 'cells,': [653, 1372, 2316], 'keratinocytes,': [654], 'uterine': [656], 'endometrial': [657], '(7Hiyama': [659], 'K.': [660, 1201, 1613, 1631, 2830, 2901, 2946, 4234], 'Hirai': [661], 'Y.': [662, 1572, 1617, 1639, 1896, 1937, 1993, 2025, 2159, 2189, 2483, 2546, 2915, 4248], 'Kyoizumi': [663], 'Akiyama': [665], 'Hiyama': [667], 'E.': [668, 944, 1197, 1898, 2093, 2134, 2157, 2179, 2226, 3000, 3758, 3778, 3780, 3786], 'Piatyszek': [669, 775, 845, 1119], 'M.A.': [670, 776, 846, 913, 1120, 1749], 'Shay': [671, 791, 861, 1123, 1176], 'J.W.': [672, 792, 803, 862, 1124, 1177, 1747, 2163, 2230, 2994], 'Ishioka': [673], 'Yamakido': [675], 'Immunol.': [678], '1995;': [679, 921, 962, 2030, 2074, 2150, 2170, 2191, 2235, 3791], '155:': [680], '3711-3715PubMed': [681], '8Harle-Bachor': [684], 'Boukamp': [686], 'P.': [687, 742, 1271, 1843, 1991, 2136, 2140, 2712], '93:': [696, 1948, 2494], '6476-6481Crossref': [697], '(468)': [700], '9Kyo': [703], 'Takakura': [705, 1080, 1098, 1249, 1322, 1544, 1614, 1634], 'Kohama': [707, 1251], 'T.': [708, 990, 1052, 1079, 1095, 1205, 1207, 1252, 1306, 1321, 1386, 1547, 1549, 1609, 1637, 2903, 2909, 2952, 4236, 4242], 'Inoue': [709, 1082, 1104, 1253, 1309, 1328, 1330, 1393, 1556, 1620, 1644], 'Cancer': [711, 1087, 1129, 1255, 1311, 1395, 1410, 1453, 1601, 1623, 2765, 4044], 'Res.': [712, 1088, 1130, 1256, 1312, 1396, 1411, 1454, 1560, 1602, 1624, 1648, 2766, 2920, 4045, 4253], '57:': [714, 1258], '610-614PubMed': [715, 1259], 'Moreover,': [718, 4389], 'typically': [721, 1726], 'tumor-derived': [724], 'lines': [726, 1369, 2201, 2219, 2878, 4314, 4350, 4426, 4457], 'well': [728, 2634, 3807], 'malignant': [731], 'tissues': [732], '(10Meyerson': [733], 'Counter': [735, 1264], 'C.M.': [736, 1265], 'Eaton': [737, 1266], 'E.N.': [738, 1267], 'Ellisen': [739, 1268], 'L.W.': [740, 1269], 'Steiner': [741, 1270], 'Caddle': [743, 1272], 'S.D.': [744, 1273, 1845], 'Ziaugra': [745, 1274], 'L.': [746, 988, 1050, 1153, 1275, 1475, 1977, 2132, 2148, 2292, 2826, 2988], 'Beijersbergen': [747, 1276], 'Davidoff': [749, 1278], 'M.J.': [750, 1279], 'Liu': [751, 1280], 'Q.': [752, 1281, 1467], 'Bacchetti': [753, 804, 1125, 1282], 'Haber': [755, 1284], 'D.A.': [756, 1285], 'Weinberg': [757, 1286], 'R.A.': [758, 1287, 1461, 1479, 1921, 2069, 2467], '90:': [761, 1290], '785-795Abstract': [762, 1291], '(1666)': [770, 1299], '11Kim': [773], 'N.W.': [774, 844, 1165], 'Prowse': [777, 847], 'K.R.': [778, 848], 'West': [781, 851, 951], 'Ho': [783, 853], 'P.L.': [784, 854, 1405, 1448, 2760, 4039], 'Coviello': [785, 855], 'G.M.': [786, 856, 2561], 'Wright': [787, 857, 1174], 'W.E.': [788, 858, 1175], 'Weinrich': [789, 859, 935], 'S.L.': [790, 860, 936, 1149], 'Science.': [793, 863, 920, 961, 1003, 1065, 1909, 2601], '1994;': [794, 864, 1849, 1910], '266:': [795, 865, 1911], '2011-2015Crossref': [796, 866], '(6585)': [799, 869], '12Shay': [802], 'Eur.': [806], 'Cancer.': [808, 1108, 1334, 2865, 2955], '33:': [810], '787-791Abstract': [811], '(2418)': [817], 'activation': [821, 4083, 4100, 4298, 4318, 4381, 4400, 4449], 'common': [826, 2539], 'perhaps': [828], 'necessary': [829], 'step': [830], 'move': [833], 'beyond': [834], 'replicative': [835], 'crisis': [836], 'immortality': [838], 'associated': [839, 2051, 2107], 'cancer': [841, 1371], '(11Kim': [843], 'Three': [872], 'subunits': [873], 'identified.': [878], 'Two': [879], 'components': [880], 'expressed': [882, 2579, 4127], 'virtually': [884], 'all': [885, 1532], 'no': [889, 1693, 4230], 'correlation': [890, 2014], 'activity.': [893, 4210, 4388], 'first': [895], 'RNA': [898], 'component,': [899, 976, 1138], 'hTR,': [900], 'provides': [902], 'template': [904], 'which': [906, 2045], 'additional': [907, 4379], 'constructed': [911], '(13Blasco': [912], 'Funk': [914, 931], 'W.': [915, 994, 1056, 2681], 'Villeponteau': [916, 959], 'B.': [917, 960, 1772, 2294], '269:': [922, 963], '1267-1270Crossref': [923], '(356)': [926], '14Feng': [929], 'W.D.': [932], 'Wang': [933], 'S.S.': [934], 'Avilion': [937], 'A.A.': [938, 1118], 'Chiu': [939], 'Adams': [941, 1470], 'R.R.': [942, 1471], 'Chang': [943, 1936, 1992, 2024, 2158, 2188, 2482], 'Allsopp': [945], 'R.C.,': [946], 'Yu,': [947], 'Le': [949], 'Andrews': [955, 1172], 'W.H.': [956, 1173], '1236-1241Crossref': [964], '(2087)': [967], 'second': [971], 'integral': [974], 'protein': [975, 2401, 2435, 2704, 3417, 3495], 'TP1,': [977, 1225], 'homologue': [980], 'Tetrahymena': [983], 'P80': [985], 'gene': [986, 1660, 1696, 3830, 3996, 4035], '(15Harrington': [987, 1049], 'McPhail': [989, 1051], 'Mar': [991, 1053], 'V.': [992, 1054, 1818], 'Zhou': [993, 1055], 'Oulton': [995, 1057], 'R.': [996, 1058, 1151, 1171, 1502, 1989, 2286, 2332, 2417, 2828, 2832, 2911, 3960, 4244], 'Bass': [997, 1059], 'M.B.': [998, 1060], 'Arruda': [999, 1061], 'I.': [1000, 1062, 1403, 1446, 2758, 4037], 'Robinson': [1001, 1063], 'M.O.': [1002, 1064, 2683], '275:': [1005, 1067], '973-977Crossref': [1006, 1068], '(631)': [1009, 1071], '16Nakayama': [1012], 'Saito': [1014, 1198], 'Nakamura': [1016, 1202], 'H.': [1017, 1075, 1101, 1195, 1203, 1329, 1388, 1465, 1551, 1555, 1619, 1641, 2544, 2907, 4240], 'Matsuura': [1018], 'Ishikawa': [1020, 1208], 'F.': [1021, 1209, 1902, 2948, 2950], '88:': [1024, 3003], '875-884Abstract': [1025], '(373)': [1033], 'Neither': [1036], 'down-regulated': [1038, 1238], 'during': [1039, 1239, 1244, 2367, 2580, 2592, 3913], 'differentiation': [1041, 1241], 'decreases': [1043], 'observed': [1048, 1365, 1516, 3355, 4132, 4276, 4450], '17Ito': [1074], 'Kyo': [1076, 1096, 1303, 1383, 1610, 1632], 'Kanaya': [1078, 1305, 1320, 1385, 1548, 1636], 'Namiki': [1084, 1102], 'Clin.': [1086, 1622, 2421], '1998;': [1089, 1109, 1212, 1313, 2095, 2343, 3971], '4:': [1090], '1603-1608PubMed': [1091], '18Kanaya': [1094], 'Ito': [1100, 1200], 'Int.': [1106, 1332, 2863, 2953], '78:': [1110], '539-543Crossref': [1111], '(111)': [1114], '19Avilion': [1117], 'Gupta': [1121], '56:': [1132], '645-650PubMed': [1133], 'third': [1137], 'hTERT,1': [1139], '(20Weinrich': [1148], 'Pruzan': [1150], 'Ma': [1152], 'Ouellette': [1154], 'Tesmer': [1156], 'V.M.': [1157], 'Holt': [1158], 'S.E.': [1159], 'Bodnar': [1160], 'A.G.': [1161], 'Lichtsteiner': [1162, 1472, 1595], 'Kim': [1164, 1575], 'Trager': [1166], 'J.B.': [1167], 'Taylor': [1168], 'R.D.': [1169], 'Carlos': [1170], 'Morin': [1180, 1476], 'G.B.': [1181, 1477, 2858], 'Nat.': [1182, 1210, 1503, 2072, 2715], 'Genet.': [1183, 1211, 1504], '17:': [1185], '498-502Crossref': [1186], '(862)': [1189], '21Nakayama': [1192], 'Tahara': [1194, 1196, 2906, 4239], 'Nakanishi': [1204], 'Ide': [1206, 2908, 4241], '18:': [1213, 1482], '65-68Crossref': [1214], '(591)': [1217], 'contrast': [1221], 'hTR': [1223], 'hTERT': [1229, 1235, 1346, 1358, 1362, 1434, 1540, 1705, 2739, 3689, 3836, 3849, 3868, 4005, 4022, 4076, 4111, 4321, 4345, 4384, 4415, 4419], 'correlates': [1230], 'activity,': [1233], 'mRNA': [1236, 2330, 3958], 'up-regulated': [1243], 'immortalization': [1246, 2734], '(9Kyo': [1247], '10Meyerson': [1262], 'Scholar,22Takakura': [1301], 'Tanaka': [1307, 1324], '58:': [1314], '1558-1561PubMed': [1315], '23Kyo': [1318], 'Yamashita': [1326], '1999;': [1335, 1397, 1412, 1455, 1481, 1505, 1580, 2299, 2517, 2570, 2602, 2616, 2687, 2767, 2778, 3462, 3479, 4046], '80:': [1336], '804-809Crossref': [1337], '(103)': [1340], 'likely': [1348, 2730], 'targeting': [1356], 'An': [1360], 'telomerase-positive': [1367, 4424], 'whereas': [1373], 'repressed': [1377], 'telomerase-negative': [1379], '(24Takakura': [1381], 'Hirano': [1387], 'Takeda': [1389], 'Yutsudo': [1391, 1552], '59:': [1398, 1413, 1456, 2768, 4047], '551-557PubMed': [1399], '25Horikawa': [1402], 'Cable': [1404, 1447, 2759, 4038], 'Afshari': [1406, 1449, 2761, 4040], 'Barrett': [1408, 1451, 2763, 4042], 'J.C.': [1409, 1452, 2764, 4043], '826-830PubMed': [1414, 1457, 2769, 4048], 'products': [1418], 'known': [1420], 'oncogenes': [1421], 'suppressors': [1424], 'activate': [1429, 1671, 1703, 4413], 'repress,': [1431], 'respectively,': [1432], 'Following': [1436], 'initial': [1438], 'identification': [1439], 'Myc': [1441, 3590], 'activator': [1444], '(25Horikawa': [1445, 2757, 4036], '26Greenberg': [1460], "O'Hagan": [1462], 'R.C.': [1463], 'Deng': [1464, 2506], 'Xiao': [1466], 'Hann': [1468], 'S.R.': [1469, 3788], 'Chin': [1474], 'DePinho': [1478], 'Oncogene.': [1480], '1219-1226Crossref': [1483], '(359)': [1486], '27Wu': [1489], 'K.J.': [1490], 'Grandori': [1491], 'Amacker': [1493], 'Simon-Vermot': [1495], 'N.': [1496, 1996, 2026, 2166, 2231, 2384, 3930], 'Polack': [1497], 'Lingner': [1499], 'Dalla-Favera': [1501], '220-224Crossref': [1507], '(775)': [1510], 'Scholar),': [1512, 1690], 'further': [1513, 4340], 'effects': [1514, 3994], 'transactivator': [1521], 'repressors': [1526], 'WT1,': [1527], 'Mad1,': [1528], 'p53,': [1529, 2671], 'MZF-2,': [1531], 'modulate': [1535], '(28Kyo': [1542], 'Taira': [1546], 'Itoh': [1550, 1640], 'Ariga': [1554], 'Nucleic': [1558, 1646], 'Acids': [1559, 1647], '2000;': [1561, 1603, 1625, 1649, 2552, 2717], '28:': [1562, 1650, 1759], '669-677Crossref': [1563], '(432)': [1566], '29Oh': [1569], 'Song': [1571], 'Yim': [1573], 'T.K.': [1576], 'Chem.': [1579], '274:': [1581], '37473-37478Abstract': [1582], '(132)': [1590], '30Gunes': [1593], 'Vasserot': [1597], 'A.P.': [1598], 'Englert': [1599], '60:': [1604], '2116-2121PubMed': [1605], '31Kanaya': [1608], 'Hamada': [1612], 'Kitagawa': [1616, 1638], 'Harada': [1618], '6:': [1626, 2718], '1239-1247PubMed': [1627], '32Fujimoto': [1630], 'Takahashi': [1642], '2557-2562Crossref': [1651], '(100)': [1654], 'Although': [1657], 'E6': [1659], 'product': [1661, 1697], 'papillomavirus': [1664], 'type': [1665, 2806], '16': [1666], 'by': [1673, 1868, 2320, 2354, 2403, 2537, 2735, 2804, 2889, 2935, 2968, 3111, 3158, 3270, 3307, 3408, 3492, 3508, 3661, 3853, 3902, 3952, 4130, 4218], 'functional': [1674], '(33Klingelhutz': [1676], 'A.J.': [1677], 'Foster': [1678], 'S.A.': [1679, 2710], 'McDougall': [1680], 'J.K.': [1681], '380:': [1684], '79-82Crossref': [1685], '(706)': [1688], 'date': [1692], 'specifically': [1702], 'Prior': [1707], 'cases': [1709], 'related': [1710], 'AIDS': [1713], 'epidemic': [1714], 'early': [1717], '1980s,': [1718], 'KS': [1719, 1791, 2053, 2280, 2628], 'was': [1720, 1865, 2663, 2933, 3247, 3292, 3302, 3329, 3418, 3428, 3437, 3506, 3681, 3709, 3719, 3738, 3748, 3851, 3894, 3900, 4007, 4054, 4164, 4275, 4281, 4323, 4458], 'relatively': [1722], 'rare': [1723, 2117], 'skin': [1724], 'neoplasm': [1725], 'afflicting': [1727], 'elderly': [1728], 'men': [1729, 1741, 1795], 'Mediterranean': [1731], 'descent,': [1732], 'immunosuppressed': [1733], 'individuals': [1734, 1964], 'transplant': [1737], 'recipients,': [1738], 'young': [1740], 'sub-Saharan': [1743], 'African': [1744, 2854], 'countries': [1745], '(34Tappero': [1746], 'Conant': [1748], 'Wolfe': [1750], 'S.F.': [1751], 'Berger': [1752], 'T.G.': [1753], 'Am.': [1755, 1773], 'Dermatol.': [1757], '1993;': [1758], '371-395Abstract': [1760], '(280)': [1766], '35DiGiovanna': [1769], 'J.J.': [1770, 1919, 2071, 2089, 2465], 'Safai': [1771], '1981;': [1776], '71:': [1777], '779-783Abstract': [1778], '(128)': [1784], 'prevalence': [1789, 1799], 'among': [1792, 1800], 'HIV-infected': [1793, 1801], 'homosexual': [1794], 'low': [1798], 'hemophiliacs': [1802], 'intravenous': [1804], 'drug': [1805], 'users': [1806], 'strongly': [1807, 1957], 'transmission': [1809], 'infectious': [1812], 'agent': [1813], 'sexual': [1815], '(36Beral': [1817], 'Peterman': [1819], 'T.A.': [1820], 'Berkelman': [1821], 'Jaffe': [1823], 'H.W.': [1824], 'Lancet.': [1825], '1990;': [1826], '335:': [1827, 2001], '123-128Abstract': [1828], '(968)': [1831], '37Katz': [1834], 'M.H.': [1835], 'Hessol': [1836], 'N.A.': [1837], 'Buchbinder': [1838], 'S.P.': [1839], 'Hirozawa': [1840], "O'Malley": [1842], 'Holmberg': [1844], 'Infect.': [1847, 2515], 'Dis.': [1848, 2516], '170:': [1850], '198-202Crossref': [1851], '(92)': [1854], 'KSHV,': [1857], 'referred': [1859], '8,': [1864], 'subsequently': [1866, 3279, 3438], 'identified': [1867], 'chain': [1870, 2323, 2356, 3904], 'reaction-based': [1871], 'designated': [1874], 'γ-herpesvirus': [1876], 'placing': [1877], 'it': [1878, 2662], 'same': [1881, 3360], 'family': [1882], 'primate': [1885], 'Rhadinovirus': [1886], 'saimiri': [1888], 'Lymphocryptovirus': [1892], 'Epstein-Barr': [1893, 2852], '(38Chang': [1895], 'Cesarman': [1897, 2092, 2225, 2999], 'Pessin': [1899], 'M.S.': [1900], 'Lee': [1901], 'Culpepper': [1903], 'Knowles': [1905, 2164, 2186, 2227, 2997], 'D.M.': [1906, 2165, 2187, 2228, 2998], 'Moore': [1907, 1938, 1994, 2160, 2180, 2484], 'P.S.': [1908, 1939, 1995, 2023, 2161, 2181, 2485], '1865-1869Crossref': [1912], '(5015)': [1915], '39Russo': [1918, 2464], 'Bohenzky': [1920, 2466], 'Chien': [1922, 2468], 'M.C.': [1923, 2469], 'Chen': [1924, 2470], 'Yan': [1926, 2472], 'Maddalena': [1928, 2474], 'D.': [1929, 1933, 2138, 2334, 2336, 2340, 2419, 2475, 2479, 2917, 3962, 3964, 3968, 4250], 'Parry': [1930, 1990, 2476], 'J.P.': [1931, 2144, 2477], 'Peruzzi': [1932, 2478], 'Edelman': [1934, 2480], 'I.S.': [1935, 2481], '14862-14867Crossref': [1949, 2495], '(1313)': [1952, 2498], 'KSHV': [1955, 2038, 2103, 2214, 2306, 2349, 2410, 3805, 3886, 3893, 3950], 'linked': [1958], 'converting': [1965], 'seropositivity': [1967], 'prior': [1968], 'expressing': [1970], 'disease': [1972, 2021, 2114], 'phenotype': [1973, 2266], '(40Gao': [1974], 'S.J.': [1975, 2503], 'Kingsley': [1976], 'Hoover': [1978], 'D.R.': [1979], 'Spira': [1980], 'T.J.': [1981], 'Rinaldo': [1982], 'C.R.': [1983], 'Saah': [1984], 'Phair': [1986], 'Detels': [1988], 'Engl.': [1997, 2027, 2167, 2232, 2385, 3931], '233-241Crossref': [2002], '(513)': [2005], 'There': [2008], 'greater': [2011], 'than': [2012], '90%': [2013], 'between': [2015], 'nucleic': [2017], 'acid': [2018, 2433, 2447], 'detection': [2019, 2325, 3512, 3953], '(41Moore': [2022], '332:': [2031, 2171], '1181-1185Crossref': [2032], '(1089)': [2035], 'endothelial-derived': [2042], 'spindle': [2043, 2277], 'cell,': [2044], 'primary': [2048, 2126], '(42Boshoff': [2054], 'Schulz': [2056, 2566], 'T.F.': [2057, 2567], 'Kennedy': [2058], 'M.M.': [2059], 'Graham': [2060], 'A.K.': [2061], 'Fisher': [2062], 'Thomas': [2064], 'McGee': [2066], 'J.O.': [2067], 'Weiss': [2068], "O'Leary": [2070, 2088], '1:': [2075], '1274-1278Crossref': [2076], '(636)': [2079], '43Flore': [2082], 'O.': [2083, 2511], 'Rafii': [2084], 'Ely': [2086], 'Hyjek': [2090], 'E.M.': [2091], '394:': [2096], '588-589Crossref': [2097], '(354)': [2100], 'since': [2105], 'other': [2109, 2630], 'malignancies': [2110], 'including': [2111, 2317], 'multifocal': [2112], "Castleman's": [2113], 'B': [2118, 2845, 3445], 'lymphoma,': [2120], 'body': [2122, 2975], 'cavity-based': [2123, 2198, 2976], 'lymphoma': [2124, 2128, 2856], 'or': [2125, 3524, 3589, 3614, 4174, 4229, 4362], 'effusion': [2127], '(44Soulier': [2129], 'Grollet': [2131], 'Oksenhendler': [2133], 'Cacoub': [2135], 'Cazals-Hatem': [2137], 'Babinet': [2139], "d'Agay": [2141], 'M.F.': [2142], 'Clauvel': [2143], 'Raphael': [2145], 'Degos': [2147], 'Blood.': [2149, 2190, 3001], '86:': [2151, 2192], '1276-1280Crossref': [2152], '45Cesarman': [2156], 'Said': [2162, 2229, 2993], '1186-1191Crossref': [2172], '(2515)': [2175], '46Cesarman': [2178], 'Rao': [2182], 'P.H.': [2183], 'Inghirami': [2184], 'G.': [2185, 2860, 3782], '2708-2714Crossref': [2193], 'Body': [2197], 'lymphoma-derived': [2199, 2977], 'only': [2204], 'KSHV-infected': [2205], 'easily': [2207], 'amenable': [2208], 'culture,': [2212], 'infection': [2215, 2255, 3951], 'these': [2217, 4311, 4423], 'predominantly': [2221], 'latent': [2222, 2254], '(47Nador': [2223], 'R.G.': [2224, 2992], '333:': [2236], '943Crossref': [2237], '(146)': [2240], 'More': [2243], 'recently,': [2244], 'human-derived': [2245], 'microvascular': [2246], 'endothelial': [2247], 'support': [2253, 3979], 'KSHV.': [2257], 'These': [2258, 3977, 4103, 4407], 'undergo': [2260], 'morphological': [2261], 'changes': [2262], 'resulting': [2263], 'similar': [2269, 4180], 'seen': [2272], 'formation': [2275], '(48Moses': [2281], 'A.V.': [2282], 'Fish': [2283], 'K.N.': [2284], 'Ruhl': [2285], 'Smith': [2287], 'P.P.': [2288], 'Strussenberg': [2289], 'J.G.': [2290], 'Zhu': [2291], 'Chandran': [2293], 'Nelson': [2295], 'J.A.': [2296], 'Virol.': [2298, 2342, 2551, 2569, 3760, 3790, 3970], '73:': [2300, 2571], '6892-6902Crossref': [2301], 'infect': [2311], 'variety': [2313, 2645], 'cultured': [2315], 'HEK': [2318, 2360, 2795, 2810, 2816, 3008, 3010, 3098, 3100, 3871, 3875, 3984, 4057, 4115, 4188, 4198, 4200, 4263, 4366, 4391, 4452], 'transcription-polymerase': [2322], 'reaction': [2324, 2357, 3905], 'spliced': [2328, 3956], 'late': [2329, 3957], '(49Renne': [2331, 3959], 'Blackbourn': [2333, 3961], 'Whitby': [2335, 3963], 'Levy': [2337, 3965], 'Ganem': [2339, 2418, 3967], '72:': [2344, 3972], '5182-5188Crossref': [2345, 3973], 'detected': [2353, 3901], '293': [2361, 2796, 3872, 3876, 3897, 3945, 3985, 4058, 4116, 4189, 4266, 4392], 'but': [2363, 3078, 3909], 'not': [2364, 3910, 4154, 4432], 'uninfected': [2365, 3911], 'ones': [2366, 3912], 'serial': [2368, 3914], 'passage': [2369, 3915], '(50Foreman': [2370, 3916], 'K.E.': [2371, 3917], 'Friborg': [2372, 3918], 'Kong': [2374, 2680, 3920], 'W.P.': [2375, 3921], 'Woffendin': [2376, 3922], 'Polverini': [2378, 3924], 'P.J.': [2379, 3925], 'Nickoloff': [2380, 3926], 'B.J.': [2381, 3927], 'Nabel': [2382, 2684, 3928], 'G.J.': [2383, 2685, 3929], '336:': [2389, 3935], '163-171Crossref': [2390, 3936], '(172)': [2393, 3939], 'LANA': [2396, 2434, 2526, 2576, 2639, 2653, 2666, 2695, 2729, 3455, 3585, 3718, 3812, 3826, 3847, 3858, 3993, 4065, 4071, 4094, 4126, 4142, 4339, 4359, 4374, 4396, 4411], 'highly': [2399], 'immunogenic': [2400], 'encoded': [2402], 'open': [2404], 'reading': [2405], 'frame': [2406], '73': [2407], 'genome': [2411], '(51Kedes': [2412], 'D.H.': [2413], 'Lagunoff': [2414], 'Renne': [2416], 'Invest.': [2422], '100:': [2424], '2606-2610Crossref': [2425], '(255)': [2428], '1162-amino': [2432], 'definable': [2437], 'domains': [2438, 3810], 'include': [2440], 'amino-terminal': [2442], 'proline-rich': [2443], 'region,': [2444], '∼100-amino': [2446], 'acidic': [2448], 'domain,': [2449, 2454], 'large': [2451], 'glutamine-rich': [2452], 'repetitive': [2453], 'leucine': [2457], 'zipper': [2458], 'motif': [2459], '(see': [2460], 'Fig.': [2461], '1;': [2462], 'Refs.': [2463], 'Scholar': [2500], '52Gao': [2502], 'Zhang': [2504], 'Y.J.': [2505], 'J.H.': [2507], 'Rabkin': [2508], 'C.S.': [2509], 'Flore': [2510], 'Jenson': [2512], 'H.B.': [2513], '180:': [2518], '1466-1476Crossref': [2519], '(67)': [2522], 'possesses': [2527], 'potential': [2528, 3815, 3992], 'localization': [2530], 'signals': [2531], 'numerous': [2533], 'phosphorylation': [2534], 'sites': [2535], 'recognized': [2536], 'several': [2538], 'kinases': [2540], '(53Lim': [2541], 'Sohn': [2543], 'Gwack': [2545], 'Choe': [2547], 'Gen.': [2550], '81:': [2553], '2645-2652Crossref': [2554], '(107)': [2557], '54Platt': [2560], 'Simpson': [2562], 'G.R.': [2563], 'Mittnacht': [2564], '9789-9795Crossref': [2572], 'constitutively': [2578], 'latency': [2582], 'episome': [2591], '(55Ballestas': [2595], 'M.E.': [2596], 'Chatis': [2597], 'P.A.': [2598], 'Kaye': [2599], 'K.M.': [2600], '284:': [2603], '641-644Crossref': [2604], '(603)': [2607], '56Cotter': [2610, 2772], 'M.A.,': [2611, 2773, 3457], 'II': [2612, 2774, 3165, 3458], 'Robertson': [2613, 2775, 3459, 3476], 'E.S.': [2614, 2776, 3460, 3477, 3754], 'Virology.': [2615, 2777, 2833, 3461, 3478], '264:': [2617, 2779, 3463], '254-264Crossref': [2618, 2780, 3464], '(300)': [2621, 2783, 3467], 'KSHV-associated': [2631], 'diseases': [2632], 'structural': [2636, 3809], 'motifs': [2637], 'potentially': [2641], 'interact': [2642], 'suggest': [2649, 3822], 'mediating': [2655], 'oncogenesis': [2657], 'transcriptional': [2659, 3842], 'regulation.': [2660], 'Recently,': [2661], 'antagonizes': [2667], 'suppressor': [2670], 'thereby': [2672], 'protecting': [2673], 'against': [2674], 'death': [2676, 4152], '(57Friborg': [2677], 'Jr.,': [2678], 'Hottiger': [2682], '402:': [2688], '889-894Crossref': [2689], '(583)': [2692], 'retinoblastoma': [2703], 'regulating': [2705, 3828], 'E2F': [2706], 'responsive': [2707], 'promoters': [2708], '(58Radkov': [2709], 'Kellam': [2711], 'Boshoff': [2713], '1121-1127Crossref': [2719], '(431)': [2722], 'Here,': [2725], 'we': [2726], 'show': [2727], 'contributes': [2731], 'transactivation': [2736, 4108], 'preparation': [2742], 'pGL3B-hTERT': [2744, 2787], 'constructs': [2747, 2788, 3865], 'pA3M-LANA': [2750, 3525], 'construct': [2752, 4014, 4078, 4087, 4096], 'described': [2755, 3529, 3775], 'previously': [2756, 3449, 3751, 3776, 4224], 'obtained': [2790, 2880, 2980], 'Carl': [2793], 'Barrett.': [2794], 'transformed': [2803], 'adenovirus': [2805], '5': [2807, 3128, 3215, 3396], 'DNA;': [2808], '293T': [2811, 4264, 4367, 4453], 'line': [2813, 2818, 2932, 2979, 3878, 3987, 4118, 4178, 4292], '293-derived': [2817], 'stably': [2820], 'expresses': [2821], 'SV40': [2823], 'T-antigen': [2824], '(59Aiello': [2825], 'Guilfoyle': [2827], 'Huebner': [2829], 'Weinmann': [2831], '1979;': [2834], '94:': [2835], '460-469Crossref': [2836], '(84)': [2839], 'derived': [2847], 'patient': [2850], 'virus-negative': [2853], "Burkitt's": [2855], '(60Clements': [2857], 'Klein': [2859], 'Povey': [2861], '1975;': [2866], '16:': [2867], '125-133Crossref': [2868], '(80)': [2871], 'Rat-1': [2876, 4193, 4204], 'Elliott': [2882], 'Kieff.': [2883], 'SUSM-1': [2884, 2930, 2964, 3014, 3104, 4196, 4213], 'maintain': [2886, 4215], 'their': [2887, 4216], 'telomerase-independent': [2891, 4220], 'mechanism': [2892, 4221], 'consequently': [2895], 'negative': [2896], '(61Nakabayashi': [2900, 4233], 'Ogata': [2902, 4235], 'Fujii': [2904, 4237], 'Wadhwa': [2910, 4243], 'Kaul': [2912, 4245], 'S.C.': [2913, 4246], 'Mitsui': [2914, 4247], 'Ayusawa': [2916, 4249], 'Cell': [2919, 4252], '235:': [2922, 4255], '345-353Crossref': [2923, 4256], '(50)': [2926, 4259], 'prepared': [2934, 3269, 3362, 3546, 3660, 3749], 'mutagen': [2936], 'treatment': [2937], 'fetal': [2939, 3029, 3081, 3151, 3189], 'diploid': [2941], 'fibroblasts': [2942, 4205, 4214], '(62Namba': [2943], 'Nishitani': [2945], 'Hyodoh': [2947], 'Fukushima': [2949], 'Kimoto': [2951], '1985;': [2956], '35:': [2957], '275-280Crossref': [2958], '(109)': [2961], 'provided': [2967], 'Masayoshi': [2969], 'Namba.': [2970], 'BC-3': [2971, 3063, 3544], 'KSHV-positive': [2974], 'American': [2983], 'Type': [2984], 'Culture': [2985], 'Collection': [2986], '(63Arvanitakis': [2987], 'Mesri': [2989], 'E.A.': [2990], 'Nador': [2991], 'Asch': [2995], 'A.S.': [2996], '2648-2654Crossref': [3004], 'Rat-1,': [3012, 3102], 'grown': [3017, 3048, 3066, 3086], "Dulbecco's": [3019, 3059, 3074, 3144, 3183], 'modified': [3020, 3060, 3075, 3145, 3184], "Eagle's": [3021, 3061, 3076, 3146, 3185], 'medium': [3022, 3051, 3069, 3077, 3147, 3186], '(Life': [3023, 3053, 3115, 3242, 3672], 'Technologies,': [3024, 3054, 3116, 3243, 3673], 'Inc.)': [3025, 3055], 'supplemented': [3026, 3056, 3071, 3094, 3148, 3203], '10%': [3028, 3150, 3188], 'bovine': [3030, 3082, 3152, 3190], 'serum,': [3031, 3442], '2': [3032, 3598], 'mm': [3033, 3377], 'glutamine,': [3034], '25': [3035, 3038], 'units/ml': [3036], 'penicillin,': [3037], 'μg/ml': [3039, 3043], 'streptomycin,': [3040], '10': [3042, 3118, 3134, 3180, 3219, 3305], 'gentamicin.': [3044], 'RPMI': [3050, 3068], '1640': [3052, 3070], 'medium.': [3062], '20%': [3080, 3389, 3557], 'serum.': [3083, 3153, 3191], 'Cells': [3084, 3531], '37': [3088, 3197], '°C': [3089, 3198, 3394], 'humidified': [3092, 3201], 'environment': [3093, 3202], '5%': [3096, 3205, 3431], 'CO2.': [3097], 'collected': [3107, 3213], '70%': [3109], 'confluency': [3110], 'trypsinization': [3112], 'trypsin-EDTA': [3114], 'Inc.).': [3117, 3244, 3314], 'million': [3119, 3220], 'resuspended,': [3122], 'along': [3123, 4060], '(generally': [3127], 'μg': [3129, 3135], 'pGL3-Basic': [3131, 4011, 4306], 'pA3M': [3137, 3523], 'construct),': [3139], '400': [3141], 'μl': [3142, 3265, 3288, 3296], 'transfected': [3157, 3223, 3520, 3540, 4055, 4173, 4352], 'electroporation': [3159], 'Bio-Rad': [3162], 'Gene': [3163], 'Pulser': [3164], '210': [3167], 'V': [3168, 3226], '975': [3170, 3228], 'microfarads.': [3171, 3229], 'Transfected': [3172], 'transferred': [3175, 3420], '100-mm': [3177], 'plates': [3178, 3193], 'ml': [3181], 'incubated': [3195, 3527, 3555, 3576, 3607], 'CO2': [3206], '20': [3208, 3231], 'h.': [3209, 3599, 3624], '×': [3216], '105': [3217], 'cells/ml.': [3218], '220': [3225], 'At': [3230], 'h,': [3232], 'harvested': [3235, 3533], 'washed': [3237, 3535, 3627], 'once': [3238], 'Luciferase': [3245], 'determined': [3248], 'per': [3250], "manufacturer's": [3251, 3733], 'instructions': [3252], 'using': [3253, 3645], 'assay': [3256, 3299, 3365, 3770], 'system': [3257], 'lysis': [3260, 3274, 3284], 'buffer': [3261, 3375], '(Promega).': [3262], 'Briefly,': [3263], '200': [3264, 3381], 'lysates': [3267, 3277, 3320, 3361], 'freeze/thaw': [3271], 'buffer.': [3275], 'diluted': [3280, 3323], '1:10': [3281], 'buffer,': [3285], '40': [3287], 'dilution': [3291, 3490, 3588, 3621], 'mixed': [3293, 3369], '100': [3295], 'reagent.': [3300], 'Luminescence': [3301], 'measured': [3303], 's': [3306], 'Opticomp': [3309], 'I': [3310], 'luminometer': [3311], '(MGM': [3312], 'Instruments,': [3313], 'It': [3315, 4301], 'should': [3316, 4302], 'emphasized': [3318], 'always': [3322, 4324], 'ensure': [3325, 3352], 'within': [3330], 'linear': [3332], 'range': [3333], 'assay.': [3336], 'results': [3338], 'represent': [3340], 'experiments': [3341, 3346], 'performed': [3342, 3773, 4183], 'triplicate.': [3344], 'repeated': [3348], 'multiple': [3349], 'times': [3350], 'trends': [3356], 'reproducible.': [3358], 'aliquoted': [3367], '1:1': [3370, 3550], '2×': [3372], 'SDS': [3373], 'gel-loading': [3374], '(100': [3376], 'Tris·Cl,': [3378], 'pH': [3379], '6.8,': [3380], 'mmdithiothreitol,': [3382], '4%': [3383], 'SDS,': [3384], '0.2%': [3385], 'bromphenol': [3386], 'blue,': [3387], 'glycerol),': [3390], 'placed': [3391], '95': [3393], 'min,': [3397], 'spun': [3399], 'remove': [3401], 'debris.': [3403], 'Soluble': [3404], 'proteins': [3405, 3632], 'fractionated': [3407, 3416], 'electrophoresis': [3409], 'on': [3410, 3635, 3848, 3995], '6%': [3412], 'SDS-polyacrylamide': [3413], 'gel.': [3414], 'then': [3419], '0.45-μm': [3423], 'nitrocellulose': [3424], 'membrane.': [3425], 'membrane': [3427], 'blocked': [3429], 'dry': [3432], 'milk': [3433], 'PBS': [3435], 'blotted': [3439], 'adsorbed': [3443], 'extracts,': [3447], 'reactive': [3453, 3583], '(56Cotter': [3456], '64Callahan': [3470], 'Pai': [3472], 'Cotter': [3474], '262:': [3480], '18-30Crossref': [3481], '(31)': [3484], 'Scholar)': [3486], '1:50': [3489], 'followed': [3491], 'horseradish': [3493], 'peroxidase-linked': [3494], 'A': [3496], '(Amersham': [3497, 3514], 'Pharmacia': [3498, 3515], 'Biotech)': [3499], '1:5000': [3502], 'dilution.': [3503], 'blot': [3505], 'visualized': [3507, 3634], 'standard': [3510], 'chemiluminescence': [3511], 'protocol': [3513], 'Biotech).': [3516], 'either': [3522, 3580, 3609, 4167, 4358], 'above.': [3530], 'PBS.': [3537], 'Slides': [3538, 3625], 'nontransfected': [3543], 'fixed': [3548], 'acetone:methanol.': [3551], 'slides': [3553, 3574, 3605], 'goat': [3558, 3611, 3616], 'serum': [3559, 3582], '30': [3561], 'min': [3562], 'room': [3564], 'temperature': [3565], 'humidity': [3568], 'chamber.': [3569], 'After': [3570, 3600], 'washing': [3571, 3601], 'PBS,': [3573, 3604, 3630], 'specific': [3578], 'antibody,': [3579], '1:100': [3587], 'mouse': [3591, 3706], 'monoclonal': [3592, 3707], 'IgG': [3593, 3708], '1:500': [3595], 'dilution,': [3596], 'thoroughly': [3602, 3628], 'FITC-conjugated': [3610, 3615], 'anti-human': [3612], 'antibody': [3613, 3618], 'anti-mouse': [3617], '1:1000': [3620], '1': [3623], 'Olympus': [3637, 3647], 'BX60': [3638], 'fluorescent': [3639], 'microscope.': [3640], 'photographs': [3642], 'captured': [3644], 'digital': [3648], 'camera': [3649], 'Esprit': [3652], 'program': [3653], 'version': [3654], '1.2.': [3655], 'probes': [3658], 'annealing': [3662], 'complementary': [3663], 'oligonucleotides': [3664], 'containing': [3665, 3866], 'GC-rich': [3667], 'binding': [3670], 'site': [3671], 'Inc.': [3674], 'custom': [3675], 'primers).': [3676], 'wild-type': [3678], 'probe': [3679, 3694], 'taken': [3682], '−119': [3684], '−98': [3686], '(GCGCGGACCCCGCCCCGTCCCG).': [3691], 'mutant': [3693], 'wasGCGCGGACCCCGAACCGTCCCG.': [3696], 'Probes': [3697], 'end-labeled': [3699], 'terminal': [3701], 'transferase': [3702], '[α-32P]dGTP.': [3704], 'purchased': [3710], 'Santa': [3712], 'Cruz': [3713], 'Biotechnology.': [3714], 'vitro': [3716, 3726], 'translated': [3717], 'made': [3720], 'TNT': [3723], 'quick-coupled': [3724], 'translation': [3727, 4031], 'kit': [3728], '(Promega)': [3729], 'according': [3730], 'recommendations.': [3734], 'Nonspecific': [3735], 'competitor': [3736], 'TLBR1,': [3739], 'unrelated': [3741], '31-base': [3742], 'probe.': [3744], 'extract': [3747], 'detailed': [3752], '(65Robertson': [3753], 'Lin': [3755], 'Kieff': [3757, 3785], '70:': [3762], '3068-3074Crossref': [3763], 'reactions': [3771], '(66Johannsen': [3777], 'Koh': [3779], 'Mosialos': [3781], 'Tong': [3783], 'X.': [3784], 'Grossman': [3787], '69:': [3792], '253-262Crossref': [3793], 'having': [3813], 'mediate': [3817], 'protein-protein': [3818], 'protein-DNA': [3820], 'interactions': [3821], '(Fig.1).': [3832], 'Because': [3833], 'primarily': [3838], 'level,': [3843], 'effect': [3845, 4430], 'investigated': [3852], 'testing': [3854], 'cells.': [3873], 'employed': [3881], 'previous': [3883], 'infectivity': [3887], 'propagation.': [3889], 'one': [3891], 'cytotoxic': [3895], 'another': [3943], 'susceptible': [3948], 'data': [3978, 4104, 4408], 'use': [3981], 'preliminary': [3989], 'examination': [3990], 'expression.': [3997], '−1665': [4000], 'initiation': [4017], 'would': [4024], 'drive': [4025], 'ultimately': [4029], 'reporter,': [4052], 'pGL3B-TRTP,': [4053], 'pA3M-LANA,': [4062], 'Myc-tagged': [4064], 'vector.': [4067], 'Initial': [4068], 'cotransfection': [4069], 'vector': [4073, 4331, 4363], 'consistently': [4079, 4097, 4375], 'resulted': [4080, 4143, 4376, 4397], '4.5-fold': [4082], 'relative': [4084, 4326, 4401], 'alone.': [4088], 'Increasing': [4089], 'concentration': [4091], 'augmented': [4098], '7-fold.': [4102], 'indicate': [4105, 4409], 'directly': [4120], 'proportional': [4121], 'quantity': [4124], 'demonstrated': [4129], 'dose-response': [4133], 'relationship': [4134], '(Fig.': [4135, 4404], '2).': [4136], 'Further': [4137], 'increasing': [4138], 'amounts': [4140], 'abrogation': [4145], 'increased': [4150], '(data': [4153], 'shown).': [4155], 'To': [4156, 4334], 'assess': [4157], 'possibility': [4159], 'above': [4162], 'response': [4163], 'due': [4165, 4433], 'total': [4169, 4436], 'amount': [4170, 4437], 'particular': [4176], 'employed,': [4179], 'lines,': [4187, 4268, 4371], 'BJAB,': [4192, 4202], 'fibroblasts,': [4194], 'fibroblasts.': [4197], 'significant': [4207], 'endogenous': [4208, 4418], 'contrast,': [4212], 'little': [4228], '15-fold': [4270], 'increase': [4271, 4296], 'upstream': [4283], 'gene.': [4287], 'Similarly,': [4288], 'showed': [4293], '20-fold': [4295], '(Fig.3': [4299], 'A).': [4300], 'noted': [4304], 'background': [4307, 4387, 4403], 'differed': [4309], 'three': [4312], 'fold': [4317], 'calculated': [4325], 'appropriate': [4329], 'pGL3-Basic/pA3M': [4330], 'alone': [4332], 'control.': [4333, 4364], 'demonstrate': [4335], 'augments': [4341], 'promoter,': [4346], 'aforementioned': [4348], 'pGL3B-TRTP': [4354], '1.5–2-fold': [4380], 'over': [4386, 4417], '5–7-fold': [4399], '3': [4405], 'B).': [4406], 'transfected.': [4440], 'As': [4441], 'discussed': [4442], 'more': [4444], 'detail': [4445], 'below,': [4446], 'modest': [4448], 'expec': [4459]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2144126736', 'counts_by_year': [{'year': 2022, 'cited_by_count': 3}, {'year': 2021, 'cited_by_count': 2}, {'year': 2020, 'cited_by_count': 1}, {'year': 2019, 'cited_by_count': 2}, {'year': 2017, 'cited_by_count': 1}, {'year': 2016, 'cited_by_count': 3}, {'year': 2015, 'cited_by_count': 3}, {'year': 2014, 'cited_by_count': 3}, {'year': 2013, 'cited_by_count': 4}, {'year': 2012, 'cited_by_count': 2}], 'updated_date': '2024-12-14T01:34:30.711577', 'created_date': '2016-06-24'}