Publication Information

{'id': 'https://openalex.org/W2141809016', 'doi': 'https://doi.org/10.1074/jbc.274.29.20489', 'title': 'SIP1, a Novel Zinc Finger/Homeodomain Repressor, Interacts with Smad Proteins and Binds to 5′-CACCT Sequences in Candidate Target Genes', 'display_name': 'SIP1, a Novel Zinc Finger/Homeodomain Repressor, Interacts with Smad Proteins and Binds to 5′-CACCT Sequences in Candidate Target Genes', 'publication_year': 1999, 'publication_date': '1999-07-01', 'ids': {'openalex': 'https://openalex.org/W2141809016', 'doi': 'https://doi.org/10.1074/jbc.274.29.20489', 'mag': '2141809016', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/10400677'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.29.20489', 'pdf_url': 'http://www.jbc.org/article/S0021925819726787/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819726787/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5104227900', 'display_name': 'Kristin Verschueren', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I99464096', 'display_name': 'KU Leuven', 'ror': 'https://ror.org/05f950310', 'country_code': 'BE', 'type': 'education', 'lineage': ['https://openalex.org/I99464096']}], 'countries': ['BE'], 'is_corresponding': False, 'raw_author_name': 'Kristin Verschueren', 'raw_affiliation_strings': ['Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium.'], 'affiliations': [{'raw_affiliation_string': 'Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium.', 'institution_ids': ['https://openalex.org/I99464096']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5031906919', 'display_name': 'Jacques Remacle', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I2802017950', 'display_name': 'Vlaams Instituut voor Biotechnologie', 'ror': 'https://ror.org/03xrhmk39', 'country_code': 'BE', 'type': 'facility', 'lineage': ['https://openalex.org/I2802017950']}], 'countries': ['BE'], 'is_corresponding': False, 'raw_author_name': 'Jacques E. Remacle', 'raw_affiliation_strings': ['Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium, the'], 'affiliations': [{'raw_affiliation_string': 'Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium, the', 'institution_ids': ['https://openalex.org/I2802017950']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5019595938', 'display_name': 'Clara Collart', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I99464096', 'display_name': 'KU Leuven', 'ror': 'https://ror.org/05f950310', 'country_code': 'BE', 'type': 'education', 'lineage': ['https://openalex.org/I99464096']}, {'id': 'https://openalex.org/I2802017950', 'display_name': 'Vlaams Instituut voor Biotechnologie', 'ror': 'https://ror.org/03xrhmk39', 'country_code': 'BE', 'type': 'facility', 'lineage': ['https://openalex.org/I2802017950']}], 'countries': ['BE'], 'is_corresponding': False, 'raw_author_name': 'Clara Collart', 'raw_affiliation_strings': ['Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium, the', 'Laboratory of Molecular Biology (CELGEN), University of Leuven, Herestraat 49, B-3000 Leuven, Belgium, the'], 'affiliations': [{'raw_affiliation_string': 'Laboratory of Molecular Biology (CELGEN), University of Leuven, Herestraat 49, B-3000 Leuven, Belgium, the', 'institution_ids': ['https://openalex.org/I99464096']}, {'raw_affiliation_string': 'Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium, the', 'institution_ids': ['https://openalex.org/I2802017950']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5081713339', 'display_name': 'H Kraft', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I2802017950', 'display_name': 'Vlaams Instituut voor Biotechnologie', 'ror': 'https://ror.org/03xrhmk39', 'country_code': 'BE', 'type': 'facility', 'lineage': ['https://openalex.org/I2802017950']}, {'id': 'https://openalex.org/I99464096', 'display_name': 'KU Leuven', 'ror': 'https://ror.org/05f950310', 'country_code': 'BE', 'type': 'education', 'lineage': ['https://openalex.org/I99464096']}], 'countries': ['BE'], 'is_corresponding': False, 'raw_author_name': 'Harry Kraft', 'raw_affiliation_strings': ['Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium, the', 'Laboratory of Molecular Biology (CELGEN), University of Leuven, Herestraat 49, B-3000 Leuven, Belgium, the'], 'affiliations': [{'raw_affiliation_string': 'Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium, the', 'institution_ids': ['https://openalex.org/I2802017950']}, {'raw_affiliation_string': 'Laboratory of Molecular Biology (CELGEN), University of Leuven, Herestraat 49, B-3000 Leuven, Belgium, the', 'institution_ids': ['https://openalex.org/I99464096']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5109313169', 'display_name': 'Betty S. Baker', 'orcid': None}, 'institutions': [], 'countries': ['GB'], 'is_corresponding': False, 'raw_author_name': 'Betty S. Baker', 'raw_affiliation_strings': ['Division of Developmental Biology, National Institute for Medical Research, The Ridgeway, London NW7 1AA, United Kingdom, and the'], 'affiliations': [{'raw_affiliation_string': 'Division of Developmental Biology, National Institute for Medical Research, The Ridgeway, London NW7 1AA, United Kingdom, and the', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5052680960', 'display_name': 'Przemko Tylżanowski', 'orcid': 'https://orcid.org/0000-0003-0769-559X'}, 'institutions': [{'id': 'https://openalex.org/I2802017950', 'display_name': 'Vlaams Instituut voor Biotechnologie', 'ror': 'https://ror.org/03xrhmk39', 'country_code': 'BE', 'type': 'facility', 'lineage': ['https://openalex.org/I2802017950']}], 'countries': ['BE'], 'is_corresponding': False, 'raw_author_name': 'Przemko Tylzanowski', 'raw_affiliation_strings': ['Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium, the'], 'affiliations': [{'raw_affiliation_string': 'Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium, the', 'institution_ids': ['https://openalex.org/I2802017950']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5110198950', 'display_name': 'L Nelles', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I2802017950', 'display_name': 'Vlaams Instituut voor Biotechnologie', 'ror': 'https://ror.org/03xrhmk39', 'country_code': 'BE', 'type': 'facility', 'lineage': ['https://openalex.org/I2802017950']}], 'countries': ['BE'], 'is_corresponding': False, 'raw_author_name': 'Luc Nelles', 'raw_affiliation_strings': ['Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium, the'], 'affiliations': [{'raw_affiliation_string': 'Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium, the', 'institution_ids': ['https://openalex.org/I2802017950']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5043690450', 'display_name': 'Gunther Wuytens', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I2802017950', 'display_name': 'Vlaams Instituut voor Biotechnologie', 'ror': 'https://ror.org/03xrhmk39', 'country_code': 'BE', 'type': 'facility', 'lineage': ['https://openalex.org/I2802017950']}, {'id': 'https://openalex.org/I99464096', 'display_name': 'KU Leuven', 'ror': 'https://ror.org/05f950310', 'country_code': 'BE', 'type': 'education', 'lineage': ['https://openalex.org/I99464096']}], 'countries': ['BE'], 'is_corresponding': False, 'raw_author_name': 'Gunther Wuytens', 'raw_affiliation_strings': ['Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium, the', 'Laboratory of Molecular Biology (CELGEN), University of Leuven, Herestraat 49, B-3000 Leuven, Belgium, the'], 'affiliations': [{'raw_affiliation_string': 'Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium, the', 'institution_ids': ['https://openalex.org/I2802017950']}, {'raw_affiliation_string': 'Laboratory of Molecular Biology (CELGEN), University of Leuven, Herestraat 49, B-3000 Leuven, Belgium, the', 'institution_ids': ['https://openalex.org/I99464096']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5110322195', 'display_name': 'Ming-Tsan Su', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I27837315', 'display_name': 'University of Michigan–Ann Arbor', 'ror': 'https://ror.org/00jmfr291', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I27837315']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Ming-Tsan Su', 'raw_affiliation_strings': ['Department of Biology University of Michigan Ann Arbor Michigan 48109-1048'], 'affiliations': [{'raw_affiliation_string': 'Department of Biology University of Michigan Ann Arbor Michigan 48109-1048', 'institution_ids': ['https://openalex.org/I27837315']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5106441010', 'display_name': 'Rolf Bodmer', 'orcid': 'https://orcid.org/0000-0001-9087-1210'}, 'institutions': [{'id': 'https://openalex.org/I27837315', 'display_name': 'University of Michigan–Ann Arbor', 'ror': 'https://ror.org/00jmfr291', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I27837315']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Rolf Bodmer', 'raw_affiliation_strings': ['Department of Biology University of Michigan Ann Arbor Michigan 48109-1048'], 'affiliations': [{'raw_affiliation_string': 'Department of Biology University of Michigan Ann Arbor Michigan 48109-1048', 'institution_ids': ['https://openalex.org/I27837315']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5044946533', 'display_name': 'James C. Smith', 'orcid': 'https://orcid.org/0000-0003-2413-9392'}, 'institutions': [], 'countries': ['GB'], 'is_corresponding': False, 'raw_author_name': 'James C. Smith', 'raw_affiliation_strings': ['Division of Developmental Biology, National Institute for Medical Research, The Ridgeway, London NW7 1AA, United Kingdom, and the'], 'affiliations': [{'raw_affiliation_string': 'Division of Developmental Biology, National Institute for Medical Research, The Ridgeway, London NW7 1AA, United Kingdom, and the', 'institution_ids': []}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5029424457', 'display_name': 'Danny Huylebroeck', 'orcid': 'https://orcid.org/0000-0003-4862-1079'}, 'institutions': [{'id': 'https://openalex.org/I2802017950', 'display_name': 'Vlaams Instituut voor Biotechnologie', 'ror': 'https://ror.org/03xrhmk39', 'country_code': 'BE', 'type': 'facility', 'lineage': ['https://openalex.org/I2802017950']}, {'id': 'https://openalex.org/I99464096', 'display_name': 'KU Leuven', 'ror': 'https://ror.org/05f950310', 'country_code': 'BE', 'type': 'education', 'lineage': ['https://openalex.org/I99464096']}], 'countries': ['BE'], 'is_corresponding': False, 'raw_author_name': 'Danny Huylebroeck', 'raw_affiliation_strings': ['Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium, the', 'Laboratory of Molecular Biology (CELGEN), University of Leuven, Herestraat 49, B-3000 Leuven, Belgium, the'], 'affiliations': [{'raw_affiliation_string': 'Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium, the', 'institution_ids': ['https://openalex.org/I2802017950']}, {'raw_affiliation_string': 'Laboratory of Molecular Biology (CELGEN), University of Leuven, Herestraat 49, B-3000 Leuven, Belgium, the', 'institution_ids': ['https://openalex.org/I99464096']}]}], 'institution_assertions': [], 'countries_distinct_count': 3, 'institutions_distinct_count': 3, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 9.732, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 492, 'citation_normalized_percentile': {'value': 0.999971, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 99, 'max': 100}, 'biblio': {'volume': '274', 'issue': '29', 'first_page': '20489', 'last_page': '20498'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T11501', 'display_name': 'TGF-β signaling in diseases', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T11501', 'display_name': 'TGF-β signaling in diseases', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T13157', 'display_name': 'Cancer-related gene regulation', 'score': 0.9856, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T13426', 'display_name': 'Kruppel-like factors research', 'score': 0.9855, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/two-hybrid-screening', 'display_name': 'Two-hybrid screening', 'score': 0.4510953}, {'id': 'https://openalex.org/keywords/smad2-protein', 'display_name': 'Smad2 Protein', 'score': 0.44952384}], 'concepts': [{'id': 'https://openalex.org/C2781080636', 'wikidata': 'https://www.wikidata.org/wiki/Q700000', 'display_name': 'SMAD', 'level': 3, 'score': 0.8909131}, {'id': 'https://openalex.org/C24284526', 'wikidata': 'https://www.wikidata.org/wiki/Q204785', 'display_name': 'Zinc finger', 'level': 4, 'score': 0.67501044}, {'id': 'https://openalex.org/C158448853', 'wikidata': 'https://www.wikidata.org/wiki/Q425218', 'display_name': 'Repressor', 'level': 4, 'score': 0.5996319}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.5620786}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.54685986}, {'id': 'https://openalex.org/C174851938', 'wikidata': 'https://www.wikidata.org/wiki/Q1337844', 'display_name': 'Two-hybrid screening', 'level': 3, 'score': 0.4510953}, {'id': 'https://openalex.org/C2909521502', 'wikidata': 'https://www.wikidata.org/wiki/Q14903945', 'display_name': 'Smad2 Protein', 'level': 4, 'score': 0.44952384}, {'id': 'https://openalex.org/C62478195', 'wikidata': 'https://www.wikidata.org/wiki/Q828130', 'display_name': 'Signal transduction', 'level': 2, 'score': 0.39218837}, {'id': 'https://openalex.org/C86339819', 'wikidata': 'https://www.wikidata.org/wiki/Q407384', 'display_name': 'Transcription factor', 'level': 3, 'score': 0.3776978}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.37578186}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.3556853}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.1972301}], 'mesh': [{'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D018398', 'descriptor_name': 'Homeodomain Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D012097', 'descriptor_name': 'Repressor Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D015534', 'descriptor_name': 'Trans-Activators', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D029867', 'descriptor_name': 'Xenopus Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D000595', 'descriptor_name': 'Amino Acid Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001483', 'descriptor_name': 'Base Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001665', 'descriptor_name': 'Binding Sites', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019556', 'descriptor_name': 'COS Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D003001', 'descriptor_name': 'Cloning, Molecular', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018076', 'descriptor_name': 'DNA, Complementary', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015536', 'descriptor_name': 'Down-Regulation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018398', 'descriptor_name': 'Homeodomain Proteins', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D018398', 'descriptor_name': 'Homeodomain Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D018398', 'descriptor_name': 'Homeodomain Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008969', 'descriptor_name': 'Molecular Sequence Data', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011401', 'descriptor_name': 'Promoter Regions, Genetic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011485', 'descriptor_name': 'Protein Binding', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012097', 'descriptor_name': 'Repressor Proteins', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D012097', 'descriptor_name': 'Repressor Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D012097', 'descriptor_name': 'Repressor Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017386', 'descriptor_name': 'Sequence Homology, Amino Acid', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015534', 'descriptor_name': 'Trans-Activators', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014981', 'descriptor_name': 'Xenopus', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016335', 'descriptor_name': 'Zinc Fingers', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.29.20489', 'pdf_url': 'http://www.jbc.org/article/S0021925819726787/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/10400677', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.29.20489', 'pdf_url': 'http://www.jbc.org/article/S0021925819726787/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 63, 'referenced_works': ['https://openalex.org/W147085018', 'https://openalex.org/W1512393880', 'https://openalex.org/W1515719112', 'https://openalex.org/W1529816420', 'https://openalex.org/W1532921008', 'https://openalex.org/W1533133582', 'https://openalex.org/W1589859980', 'https://openalex.org/W1609684706', 'https://openalex.org/W1663371441', 'https://openalex.org/W1816605246', 'https://openalex.org/W1837535311', 'https://openalex.org/W1837658913', 'https://openalex.org/W1904018663', 'https://openalex.org/W1944789371', 'https://openalex.org/W1971443128', 'https://openalex.org/W1984522602', 'https://openalex.org/W1989307537', 'https://openalex.org/W1989722096', 'https://openalex.org/W1992618022', 'https://openalex.org/W1993101827', 'https://openalex.org/W2007444505', 'https://openalex.org/W2010206624', 'https://openalex.org/W2011687097', 'https://openalex.org/W2025853097', 'https://openalex.org/W2028506574', 'https://openalex.org/W2039458025', 'https://openalex.org/W2041750289', 'https://openalex.org/W2053404076', 'https://openalex.org/W2057161685', 'https://openalex.org/W2059437327', 'https://openalex.org/W2060655627', 'https://openalex.org/W2070539534', 'https://openalex.org/W2079236445', 'https://openalex.org/W2080846435', 'https://openalex.org/W2085414120', 'https://openalex.org/W2086660631', 'https://openalex.org/W2093306666', 'https://openalex.org/W2093417867', 'https://openalex.org/W2095950934', 'https://openalex.org/W2096590212', 'https://openalex.org/W2098097317', 'https://openalex.org/W2100522747', 'https://openalex.org/W2102551026', 'https://openalex.org/W2102681982', 'https://openalex.org/W2102868284', 'https://openalex.org/W2104302625', 'https://openalex.org/W2104593996', 'https://openalex.org/W2125411982', 'https://openalex.org/W2125655548', 'https://openalex.org/W2128652512', 'https://openalex.org/W2142250806', 'https://openalex.org/W2143659718', 'https://openalex.org/W2145589640', 'https://openalex.org/W2150073419', 'https://openalex.org/W2164615751', 'https://openalex.org/W2166749754', 'https://openalex.org/W2188384605', 'https://openalex.org/W2205083200', 'https://openalex.org/W2390784421', 'https://openalex.org/W4235438234', 'https://openalex.org/W4248951783', 'https://openalex.org/W612249073', 'https://openalex.org/W638406814'], 'related_works': ['https://openalex.org/W3134845195', 'https://openalex.org/W2600290844', 'https://openalex.org/W2585223803', 'https://openalex.org/W2163997162', 'https://openalex.org/W2091701190', 'https://openalex.org/W2080444640', 'https://openalex.org/W2076713693', 'https://openalex.org/W2069025901', 'https://openalex.org/W2052096221', 'https://openalex.org/W2036018577'], 'abstract_inverted_index': {'Activation': [0, 191, 796], 'of': [1, 13, 22, 24, 49, 73, 77, 98, 117, 143, 157, 180, 192, 204, 213, 215, 240, 264, 268, 289, 308, 334, 348, 371, 383, 401, 442, 651, 662, 672, 753, 777, 797, 869, 881, 896, 1007, 1168, 1369, 1377, 1522, 1528, 1592, 1606, 1612, 1678, 1691, 1751, 1760, 1854, 1863, 1886, 1903, 2017, 2071, 2139, 2191, 2225, 2237, 2254, 2269, 2274, 2286, 2377, 2400, 2408, 2421, 2427, 2449, 2482, 2493, 2562, 2569, 2742, 2829, 2879, 2952, 2956, 3223, 3255, 3396, 3416, 3422, 3459, 3511, 3539, 3542, 3554, 3577, 3602, 3610, 3617, 3625, 3714, 3721, 3732, 3741, 3758, 3892, 3921, 3945, 3966, 4060, 4071, 4075, 4091, 4121, 4124, 4198, 4295, 4303, 4358, 4364], 'transforming': [2, 170, 193, 361, 733], 'growth': [3, 171, 194, 362, 389, 734, 1644], 'factor': [4, 172, 195, 363, 390, 735, 1626, 1858], 'β': [5, 173, 196, 364, 736], 'receptors': [6, 197], 'causes': [7, 198], 'the': [8, 20, 38, 46, 74, 93, 111, 118, 141, 166, 188, 199, 211, 229, 237, 265, 284, 302, 309, 332, 357, 379, 384, 402, 433, 538, 611, 616, 653, 660, 676, 754, 775, 791, 808, 818, 866, 879, 1008, 1020, 1065, 1375, 1384, 1510, 1519, 1597, 1604, 1610, 1624, 1683, 1692, 1729, 1761, 1789, 1844, 1851, 1855, 1875, 2004, 2026, 2052, 2054, 2066, 2094, 2134, 2140, 2170, 2175, 2192, 2205, 2238, 2240, 2270, 2300, 2339, 2351, 2385, 2401, 2415, 2419, 2422, 2480, 2483, 2500, 2507, 2536, 2713, 2830, 2864, 2870, 2900, 2947, 2953, 2957, 2979, 3033, 3064, 3150, 3219, 3279, 3292, 3313, 3406, 3457, 3505, 3508, 3512, 3519, 3522, 3547, 3586, 3611, 3615, 3626, 3635, 3651, 3712, 3719, 3755, 3779, 3815, 3864, 3870, 3889, 3948, 3974, 4055, 4063, 4072, 4087, 4097, 4156, 4162, 4167, 4182, 4292, 4361], 'phosphorylation': [9, 200, 4302], 'and': [10, 186, 201, 377, 447, 452, 534, 540, 571, 610, 628, 640, 645, 657, 675, 686, 793, 810, 865, 889, 894, 1062, 1078, 1158, 1380, 1389, 1602, 1627, 1641, 1726, 1749, 1894, 1977, 2024, 2033, 2086, 2131, 2136, 2162, 2220, 2231, 2338, 2367, 2379, 2396, 2451, 2485, 2526, 2555, 2586, 2669, 2686, 2712, 2736, 2754, 2790, 2840, 2889, 2928, 2938, 2970, 2975, 2983, 3063, 3101, 3103, 3120, 3282, 3291, 3306, 3319, 3383, 3388, 3447, 3544, 3585, 3597, 3711, 3786, 3856, 3861, 3942, 3954, 3959, 3969, 4047, 4080, 4111, 4286, 4298, 4366], 'nuclear': [11, 202], 'translocation': [12, 203], 'Smad': [14, 66, 205, 257, 434, 679, 2502, 3665, 4049, 4293], 'proteins,': [15, 206, 2832, 3826], 'which': [16, 34, 108, 136, 169, 207, 225, 299, 327, 360, 427, 543, 1382, 2403, 3608, 3634, 3644, 4021, 4166], 'then': [17, 208, 2556], 'participate': [18, 209], 'in': [19, 52, 61, 89, 113, 121, 140, 183, 187, 210, 243, 252, 280, 304, 312, 331, 374, 378, 428, 445, 465, 588, 631, 643, 680, 782, 817, 878, 1060, 1064, 1374, 1535, 1646, 1769, 1788, 1840, 2010, 2021, 2354, 2384, 2441, 2460, 2497, 2506, 2512, 2521, 2566, 2683, 2726, 2748, 2756, 2813, 2863, 2946, 2962, 2967, 3149, 3258, 3289, 3332, 3348, 3367, 3419, 3452, 3521, 3546, 3563, 3607, 3633, 3650, 3844, 3888, 3919, 3947, 3973, 4034, 4114, 4127, 4192, 4201, 4305, 4371], 'regulation': [21, 142, 212, 333, 1167], 'expression': [23, 116, 179, 214, 307, 370, 2020, 2070, 3135, 3239, 3609, 4123], 'target': [25, 181, 216, 372, 1054, 1169], 'genes.': [26, 217, 3600], 'We': [27, 218, 3905], 'describe': [28, 219], 'a': [29, 70, 133, 220, 261, 324, 528, 545, 574, 606, 783, 900, 1013, 1154, 1829, 1867, 1952, 2000, 2062, 2075, 2409, 2833, 2841, 2877, 3117, 3198, 3202, 3475, 3552, 3557, 3564, 3631, 3739, 3830, 3837, 3853, 3912, 3943, 4032, 4094, 4195, 4202, 4265, 4271, 4282], 'novel': [30, 221], 'Smad-interacting': [31, 159, 222, 350, 765, 1832, 3727, 4131], 'protein,': [32, 223, 3195, 3528], 'SIP1,': [33, 126, 224, 317, 1888, 2355, 3895, 4020, 4138], 'was': [35, 226, 1835, 1848, 1956, 1993, 2029, 2059, 2183, 2202, 2213, 2246, 2290, 2296, 2336, 2341, 2391, 2432, 2591, 2696, 2873, 3161, 3201, 3309, 3516, 3561, 3639, 3750, 4039, 4067, 4118], 'identified': [36, 227, 439, 683, 1898, 3605], 'using': [37, 228, 1837, 1914, 2093, 2204, 2362, 2473, 2600, 2701, 3154, 3474, 3568, 3582, 4054], 'yeast': [39, 53, 230, 244, 1856, 2293, 2305, 3548, 4056, 4115, 4128], 'two-hybrid': [40, 231, 1838, 2294, 2508, 3506, 3723, 4057], 'system.': [41, 232, 4058], 'Although': [42, 233], 'SIP1': [43, 68, 84, 101, 234, 259, 275, 292, 1962, 1989, 2001, 2027, 2055, 2695, 3139, 3225, 3248, 3265, 3308, 3764], 'interacts': [44, 235, 1631], 'with': [45, 58, 236, 249, 604, 668, 1176, 1518, 1599, 1632, 1738, 1741, 1785, 1975, 1999, 2151, 2158, 2257, 2281, 2299, 2465, 2548, 2552, 2559, 2598, 2666, 2671, 2774, 2800, 2876, 2899, 2914, 2932, 3097, 3115, 3126, 3134, 3232, 3238, 3317, 3413, 3662, 4062, 4141, 4155, 4161, 4207, 4264], 'MH2': [47, 238, 541, 794, 811, 1520, 1590, 1763, 1846, 2087, 2176, 2181, 3513, 4064, 4163, 4268, 4362], 'domain': [48, 239, 748, 764, 868, 1521, 1591, 1764, 1773, 1847, 1853, 1878, 2088, 2182, 2353, 3514, 3638, 3653, 3839, 3911, 4065, 4089, 4158, 4164, 4269], 'receptor-regulated': [50, 241, 565, 663, 798], 'Smads': [51, 60, 242, 251, 436, 460, 552, 566, 602, 625, 638, 655, 664, 674, 779, 799, 1152, 1593, 1731], 'andin': [54, 245], 'vitro,': [55, 114, 246, 305], 'its': [56, 103, 247, 294, 1793, 3532], 'interaction': [57, 248, 789, 1175, 1517, 4108], 'full-length': [59, 100, 250, 291, 3247, 3307, 4112, 4125], 'mammalian': [62, 253, 2022, 2721, 2865, 4306], 'cells': [63, 185, 254, 376, 2023, 2438, 2457, 2595, 2745, 2854, 2862, 3131, 3146, 3236, 3946, 3968, 4307], 'requires': [64, 255], 'receptor-mediated': [65, 256], 'activation.': [67, 258], 'is': [69, 129, 260, 320, 1889, 3295, 3658, 3836, 3917, 3961, 4017, 4022, 4205], 'new': [71, 162, 262, 353], 'member': [72, 263], 'δEF1/Zfh-1': [75, 266], 'family': [76, 267, 416], 'two-handed': [78, 269], 'zinc': [79, 105, 270, 296, 395, 407, 744, 760], 'finger/homeodomain': [80, 271], 'proteins.': [81, 272, 435, 3140, 3728], 'Like': [82, 273], 'δEF1,': [83, 128, 274, 319], 'binds': [85, 276, 3217], 'to': [86, 110, 131, 164, 277, 301, 322, 355, 615, 622, 803, 813, 1012, 1163, 1509, 1530, 1595, 1619, 1682, 1728, 1734, 1745, 1791, 1850, 1874, 1959, 2061, 2222, 2311, 2479, 2532, 3089, 3165, 3218, 3325, 3386, 3408, 3442, 3456, 3518, 3642, 3660, 3767, 3778, 3814, 3869, 3903, 3908, 4041, 4085, 4093, 4137, 4181, 4188, 4290, 4299], '5′-CACCT': [87, 278], 'sequences': [88, 279, 1070, 1981], 'different': [90, 281, 458, 882, 1742, 4048], 'promoters,': [91, 282], 'including': [92, 283, 1982, 2003, 3940], 'Xenopus': [94, 123, 285, 314, 770, 1378, 3343, 3397], 'brachyury': [95, 286, 742], 'promoter.': [96, 287], 'Overexpression': [97, 288], 'either': [99, 290, 3116], 'or': [102, 293, 665, 1173, 1503, 1512, 3125, 3228, 3246, 3894], 'C-terminal': [104, 295, 535, 581, 743, 2397], 'finger': [106, 297, 396, 408, 745, 761], 'cluster,': [107, 298], 'bind': [109, 300, 874, 1383, 3901], 'Xbra2promoter': [112, 303], 'prevented': [115, 306], 'endogenousXbra': [119, 310], 'gene': [120, 149, 311, 340, 454, 758, 1613, 1693, 1752], 'early': [122, 313, 3443], 'embryos.': [124, 315, 3575], 'Therefore,': [125, 316, 1828, 4037], 'like': [127, 318, 3827], 'likely': [130, 321], 'be': [132, 138, 323, 329, 554], 'transcriptional': [134, 325, 1537, 1617], 'repressor,': [135, 326], 'may': [137, 328], 'involved': [139, 330, 3918], 'at': [144, 335, 578, 2065, 2418, 2652, 2674, 2806, 2908, 2920, 2935, 3405, 3858], 'least': [145, 336], 'one': [146, 337, 1885], 'immediate': [147, 338, 883], 'response': [148, 339, 884, 1371], 'for': [150, 341, 1079, 1831, 1961, 2014, 2388, 2655, 2803, 2860, 2905, 2917, 3210, 3241, 3449, 3478, 3848, 3963], 'activin-dependent': [151, 342], 'signal': [152, 343], 'transduction': [153, 344], 'pathways.': [154, 345, 647], 'The': [155, 346, 551, 564, 1004, 1589, 1970, 1987, 2178, 2292, 2304, 2424, 2541, 2589, 2648, 2950, 2972, 3015, 3192, 3729, 3833], 'identification': [156, 347], 'this': [158, 349, 589, 805, 1772, 2255, 2963, 3583, 3715, 3910, 4142], 'protein': [160, 351, 634, 741, 766, 3123, 3632, 3784], 'opens': [161, 352], 'routes': [163, 354], 'investigate': [165, 356], 'mechanisms': [167, 358], 'by': [168, 359, 421, 440, 527, 594, 1899, 1995, 2166, 2185, 2360, 2375, 2393, 2406, 2434, 2535, 2662, 2681, 2690, 2733, 2788, 2798, 2810, 2821, 2897, 2912, 2926, 3105, 3311, 3347], 'members': [174, 365], 'exert': [175, 366, 417, 814], 'their': [176, 367, 418, 561, 579, 666, 1516, 3898, 4354], 'effects': [177, 368, 420, 4373], 'on': [178, 369, 560, 1051, 2343, 2528, 2752, 3531], 'genes': [182, 373, 885, 3613], 'responsive': [184, 375], 'vertebrate': [189, 380, 459, 3780], 'embryo.': [190, 381], 'Ligands': [382], 'TGF-β': [385, 646, 901], '1The': [386], 'abbreviations': [387], 'TGF-βtransforming': [388], 'βbHLHbasic': [391], 'helix-loop-helixBMPbone': [392], 'morphogenetic': [393, 633, 740], 'proteinbrabrachyuryCZFC-terminal': [394], 'clusterDBDDNA-binding': [397], 'domainGSTglutathione': [398], 'S-transferaseLacZβ-galactosidase': [399], 'product': [400, 752], 'E.': [403, 755, 1123, 1182, 1224, 1393, 1435, 1540, 1695, 2522, 4239], 'coli': [404, 756, 2523], 'LacZ': [405, 757, 3545, 3598], 'geneNZFN-terminal': [406], 'clusterSBDSmad-binding': [409], 'domainSIPSmad-interacting': [410], 'proteinPCRpolymerase': [411], 'chain': [412, 768], 'reactionXXenopusdpcdays': [413], 'post': [414, 772], 'coitum': [415, 773], 'biological': [419, 1794, 4372], 'activating': [422], 'serine/threonine': [423], 'kinase': [424, 3100], 'receptor': [425], 'complexes,': [426], 'turn': [429], 'activate': [430], 'intracellular': [431], 'mediators,': [432], 'were': [437, 1897, 2091, 2153, 2164, 2358, 2371, 2404, 2439, 2458, 2471, 2510, 2519, 2543, 2557, 2650, 2660, 2679, 2688, 2731, 2746, 2786, 2793, 2819, 2848, 2855, 2895, 2924, 2941, 2986, 3087, 3095, 3112, 3142, 3230, 3345, 3365, 3411, 3440, 3769, 4051, 4172], 'initially': [438], 'means': [441, 2376, 2407], 'genetic': [443], 'studies': [444, 1050, 1368], 'Drosophila': [446, 1061, 3787, 4296], 'Caenorhabditis': [448], 'elegans': [449], 'as': [450, 684, 887, 1057, 1071, 1951, 2504, 2824, 2857, 2943, 3147, 3197, 3270, 3272, 3424, 3619, 3621, 3852], 'Mad': [451, 4179], 'Sma': [453], 'products,': [455], 'respectively.': [456], 'Nine': [457], 'have': [461, 1067, 1756, 1776], 'been': [462, 682, 801, 1364, 1496, 4186, 4288], 'isolated': [463, 2203, 3571, 3751], '(reviewed': [464], 'Refs.': [466], '1Heldin': [467], 'C.H.': [468, 690, 821, 982, 2626, 3668], 'Miyazono': [469, 691, 822, 2627, 3669], 'K.': [470, 692, 823, 1086, 1265, 1338, 1340, 1350, 1476, 1571, 1653, 1655, 1665, 1799, 1922, 2102, 2604, 2617, 2628, 2995, 3019, 3021, 3172, 3670, 3792, 3985], 'ten': [471, 693, 824, 960, 983, 2618, 3671], 'Dijke': [472, 694, 825, 961, 984, 2619, 3672], 'P.': [473, 695, 826, 930, 962, 985, 1813, 1936, 2116, 2620, 2624, 3673], 'Nature.': [474, 696, 827, 1093, 1212, 1233, 1289, 1353, 1423, 1444, 1668, 3674], '1997;': [475, 697, 828, 919, 1094, 1234, 1250, 1445, 1461, 1820, 1943, 2123, 3675, 3993], '390:': [476, 698, 829, 3676], '465-471Crossref': [477, 699, 830, 3677], 'PubMed': [478, 494, 506, 520, 700, 716, 728, 831, 847, 859, 922, 949, 972, 999, 1043, 1097, 1117, 1142, 1201, 1216, 1237, 1253, 1278, 1293, 1311, 1330, 1357, 1412, 1427, 1448, 1464, 1489, 1559, 1584, 1672, 1714, 1823, 1946, 2046, 2126, 2328, 2643, 3012, 3028, 3058, 3084, 3189, 3434, 3469, 3497, 3678, 3694, 3706, 3809, 3935, 3996, 4013, 4224, 4254, 4322, 4348], 'Scopus': [479, 495, 507, 701, 717, 729, 832, 848, 860, 950, 973, 1000, 1044, 1098, 1118, 1143, 1202, 1217, 1238, 1254, 1279, 1294, 1312, 1331, 1358, 1413, 1428, 1449, 1465, 1490, 1560, 1585, 1673, 1715, 1824, 1947, 2047, 2127, 2329, 2644, 3029, 3059, 3435, 3470, 3498, 3679, 3695, 3707, 3936, 3997, 4255, 4349], '(3390)': [480, 702, 833, 3680], 'Google': [481, 497, 509, 521, 703, 719, 731, 834, 850, 862, 923, 952, 975, 1002, 1046, 1100, 1120, 1145, 1204, 1219, 1240, 1256, 1281, 1296, 1314, 1333, 1360, 1415, 1430, 1451, 1467, 1492, 1562, 1587, 1675, 1717, 1826, 1949, 2049, 2129, 2331, 2646, 3013, 3031, 3061, 3085, 3190, 3362, 3381, 3437, 3472, 3500, 3681, 3697, 3709, 3810, 3938, 3999, 4014, 4225, 4257, 4323, 4351], 'Scholar,': [482, 498, 704, 720, 835, 851, 924, 953, 976, 1101, 1121, 1205, 1220, 1241, 1257, 1282, 1297, 1315, 1334, 1416, 1431, 1452, 1468, 1563, 3682, 3698, 4000, 4226, 4324], '2Kretzschmar': [483, 705, 836, 3683], 'M.': [484, 500, 706, 722, 837, 853, 907, 1111, 1211, 1228, 1232, 1247, 1336, 1422, 1439, 1443, 1458, 1651, 3049, 3205, 3483, 3684, 3700, 3952, 4230, 4332], 'Massagué': [485, 707, 838, 1030, 1246, 1457, 3685], 'J.': [486, 708, 839, 905, 911, 966, 968, 988, 1031, 1084, 1809, 1932, 2112, 2997, 3023, 3041, 3043, 3075, 3174, 3355, 3374, 3393, 3686, 3794, 3990], 'Curr.': [487, 709, 840, 3687], 'Opin.': [488, 710, 841, 3688], 'Genet.': [489, 711, 842, 3689], 'Dev.': [490, 502, 712, 724, 843, 855, 1113, 1249, 1307, 1460, 1819, 1942, 2042, 2122, 2639, 3690, 3702, 3931], '1998;': [491, 503, 713, 725, 844, 856, 941, 969, 991, 1035, 1114, 1134, 1193, 1270, 1290, 1308, 1327, 1354, 1404, 1481, 1551, 1576, 1669, 1706, 3691, 3703, 4010], '8:': [492, 714, 845, 2044, 3692], '103-111Crossref': [493, 715, 846, 3693], '(434)': [496, 718, 849, 3696], '3Whitman': [499, 721, 852, 3699], 'Genes': [501, 723, 854, 1112, 1248, 1306, 1459, 2041, 3701], '12:': [504, 726, 857, 1115, 1309, 3704], '2445-2462Crossref': [505, 727, 858, 3705], '(447)': [508, 730, 861, 3708], 'Scholar;': [510], 'Ref.': [511, 1918], '4LeSueur': [512], 'J.A.': [513, 3053, 3072], 'Graff': [514], 'J.M.': [515], 'Development.': [516, 4009], '1999;': [517], '126:': [518], '137-146Crossref': [519], 'Scholar).': [522, 732, 863, 1003, 1047, 1146, 1361, 1493, 1588, 1676, 1718, 1827, 2050, 2332, 2647, 3014, 3191, 3342, 3363, 3403, 3438, 3501, 3824, 3879, 4258, 4352], 'These': [523, 3825, 3880], 'proteins': [524, 1833, 2496, 2518, 2659, 2678, 2730, 2792, 2818, 2940, 3257, 3666, 4050], 'are': [525, 591, 780, 1161, 1732, 2263, 2965, 3267, 3288, 4134], 'characterized': [526, 1890], 'three-domain': [529], 'structure': [530, 1006], 'containing': [531, 2229, 2346, 2446, 2759, 3840], 'conserved': [532, 575, 3842, 3854, 3887, 4283], 'N-terminal': [533, 759], 'domains,': [536, 542], 'called': [537], 'MH1': [539, 792, 809, 867, 4157], 'flank': [544], 'more': [546], 'variable,': [547], 'proline-rich': [548, 3652], 'linker': [549], 'region.': [550], 'can': [553, 872], 'classified': [555], 'into': [556, 2031, 2082, 2248, 2373, 2414, 2738], 'three': [557], 'subgroups': [558], 'based': [559], 'distinct': [562, 815], 'functions.': [563], '(Smad1,': [567], '2,': [568], '3,': [569], '5,': [570, 627], '8)': [572], 'contain': [573, 891, 3829], 'SSXS': [576], 'motif': [577, 590], 'extreme': [580], 'end.': [582], 'Upon': [583], 'ligand': [584, 1500, 1620], 'stimulation,': [585, 1501], 'two': [586, 3612, 3762], 'serines': [587], 'directly': [592, 873, 3902], 'phosphorylated': [593], 'specific': [595, 623, 1166, 3477], 'type': [596, 2974], 'I': [597], 'receptors.': [598], 'Once': [599], 'activated,': [600], 'these': [601, 1148, 1720, 2429, 3603], 'associate': [603], 'Smad4,': [605, 3643], 'common': [607, 677], 'mediator': [608, 678], 'Smad,': [609], 'heteromeric': [612, 1506, 1680], 'complexes': [613, 1508, 1681, 3266, 3274], 'translocate': [614], 'nucleus': [617, 819, 1790], 'where': [618], 'they': [619, 2687], 'mediate': [620, 1596], 'responses': [621, 1618], 'ligands.': [624], '1,': [626], '8': [629], 'act': [630, 642], 'bone': [632, 739], '(BMP)': [635], 'pathways,': [636], 'whereas': [637, 4194], '2': [639, 2579, 2771, 2804, 2906], '3': [641], 'activin': [644], 'A': [648, 2272, 4177], 'third': [649], 'group': [650], 'Smads,': [652], 'inhibitory': [654, 673], '(Smad6': [656], 'Smad7),': [658], 'prevent': [659], 'activation': [661, 1538, 1748], 'heteromerization': [667], 'Smad4.': [669], 'Functional': [670], 'homologues': [671, 2016], 'Drosophilahave': [681], 'Dad': [685], 'Medea,': [687], 'respectively': [688, 1391], '(1Heldin': [689, 820, 3667], 'basic': [737], 'helix-loop-helix': [738], 'cluster': [746, 762], 'DNA-binding': [747, 1022, 1156, 1777, 1852], 'glutathione': [749], 'S-transferase': [750], 'β-galactosidase': [751], 'Smad-binding': [763, 876, 1014, 2352, 4088], 'polymerase': [767, 2364], 'reaction': [769], 'days': [771], 'In': [774, 2051, 4259], 'absence': [776], 'signaling,': [778], 'kept': [781], 'latent': [784], 'conformation': [785], 'through': [786, 1171, 1366, 1515], 'an': [787, 1531, 1904, 1983, 2011, 2223, 2282, 4107], 'intramolecular': [788], 'between': [790, 2133, 4045, 4109], 'domains.': [795], 'has': [800, 1363, 1495, 3776, 4185, 4287], 'proposed': [802, 1497], 'disrupt': [804], 'autoinhibition,': [806], 'allowing': [807], 'domains': [812, 4363], 'functions': [816], 'Smad4': [864, 1082, 1529, 3657, 3716, 4199], 'activated': [870, 1523, 1633, 1725], 'Smad3': [871, 1009, 1080, 1637], 'DNA.': [875, 3904], 'elements': [877, 898, 1372, 3972], 'promoters': [880, 1170, 1376, 1514], 'such': [886, 897, 1056, 2147, 3851], 'JunB': [888], 'PAI-I': [890], '5′-CAGA': [892], 'boxes,': [893], 'multimerization': [895], 'creates': [899], '-inducible': [902], 'enhancer': [903, 3782], '(5Yingling': [904], 'Datto': [906], 'Wong': [908], 'C.': [909, 1125, 1184, 1245, 1263, 1395, 1456, 1474, 1542, 1569, 1697, 1803, 1815, 1926, 1938, 2106, 2118, 2630], 'Frederick': [910], 'Liberati': [912], 'N.': [913, 2606], 'Wang': [914, 1026], 'X.': [915, 1103, 1207, 1222, 1299, 1301, 1418, 1433, 2980], 'Mol.': [916, 939, 1132, 1191, 1268, 1402, 1479, 1549, 1574, 1704, 3006, 3183, 3803], 'Cell.': [917, 940, 1034, 1133, 1192, 1269, 1403, 1480, 1550, 1575, 1705, 3007, 3184, 3490, 3804, 4339], 'Biol.': [918, 989, 3008, 3076, 3185, 3430, 3465, 3805], '17:': [920, 970], '7019-7028Crossref': [921], '6Zawel': [925], 'L.': [926, 1029, 1131, 1190, 1261, 1401, 1472, 1548, 1567, 1703, 1801, 1924, 2038, 2104, 4336], 'Dai': [927], 'J.L.': [928, 1129, 1188, 1399, 1546, 1701, 4338], 'Buckhaults': [929], 'Zhou': [931], 'S.': [932, 955, 957, 964, 980, 1090, 1259, 1325, 1346, 1470, 1565, 1661, 2614, 4330], 'Kinzler': [933, 1264, 1475, 1570], 'K.W.': [934], 'Vogelstein': [935, 1266, 1477, 1572], 'B.': [936, 1267, 1478, 1573], 'Kern': [937, 4248], 'S.E': [938], '1:': [942], '611-617Abstract': [943], 'Full': [944, 946, 994, 996, 1038, 1040, 1137, 1139, 1196, 1198, 1273, 1275, 1407, 1409, 1484, 1486, 1554, 1556, 1579, 1581, 1709, 1711, 3081, 3494, 4343, 4345], 'Text': [945, 947, 995, 997, 1039, 1041, 1138, 1140, 1197, 1199, 1274, 1276, 1408, 1410, 1485, 1487, 1555, 1557, 1580, 1582, 1710, 1712, 3082, 3495, 4344, 4346], 'PDF': [948, 998, 1042, 1141, 1200, 1277, 1411, 1488, 1558, 1583, 1713, 3083, 3496, 4347], '(902)': [951], '7Dennler': [954], 'Itoh': [956, 979], 'Vivien': [958], 'D.': [959, 1319, 1817, 1940, 2120, 2314, 2637, 3039, 3329, 3487, 3812, 3867], 'Huet': [963], 'Gauthier': [965], 'EMBO': [967], '3091-3100Crossref': [971], '(1611)': [974], '8Jonk': [977], 'L.J.': [978], 'Heldin': [981, 2625], 'Kruijer': [986], 'W.': [987], 'Chem.': [990, 3077], '273:': [992], '21145-21152Abstract': [993], '(516)': [1001], 'crystal': [1005], 'MH1domain': [1010], 'bound': [1011, 1178, 2939], 'element': [1015], 'revealed': [1016, 3773], 'that': [1017, 1151, 1498, 1758, 1781, 2148, 2262, 2869, 3774, 3897, 4019, 4133, 4150], '5′-GTCT': [1018], 'represents': [1019], 'minimal': [1021], 'sequence': [1023, 2002, 2426, 2951, 3280, 3510, 4359], '(9Shi': [1024], 'Y.': [1025, 1284, 1348, 1663, 2999, 3003, 3176, 3180, 3796, 3800, 3977, 4008], 'Y.F.': [1027], 'Jayaraman': [1028], 'Pavletich': [1032], 'N.P.': [1033], '94:': [1036], '585-594Abstract': [1037], '(620)': [1045], 'However,': [1048], 'promoter': [1049], 'other': [1052, 1964, 3663, 4130], 'direct': [1053, 1072], 'genes,': [1055], 'vestigial': [1058], 'andtinman': [1059], 'goosecoid': [1063, 1513], 'mouse,': [1066], 'implicated': [1068], 'GC-rich': [1069], 'DNA': [1073, 1640, 1739, 2435, 2724, 3849], 'targets': [1074], 'forMad': [1075], 'and/or': [1076, 1081, 1740], 'Medea': [1077], '(10Kim': [1083], 'Johnson': [1085], 'Chen': [1087], 'H.J.': [1088], 'Carroll': [1089], 'Laughon': [1091], 'A.': [1092, 1317, 1326, 2317, 2612, 2622, 3001, 3047, 3178, 3798, 4243], '388:': [1095], '304-308Crossref': [1096], '(454)': [1099], '11Xu': [1102], 'Yin': [1104], 'Z.': [1105, 3927], 'Hudson': [1106], 'J.B.': [1107, 3485], 'Ferguson': [1108], 'E.L.': [1109], 'Frasch': [1110], '2354-2370Crossref': [1116], '(223)': [1119], '12Labbé': [1122], 'Silvestri': [1124, 1183, 1394, 1541, 1696], 'Hoodless': [1126, 1185, 1396, 1543, 1698], 'P.A.': [1127, 1186, 1397, 1544, 1699, 4326], 'Wrana': [1128, 1187, 1398, 1545, 1700, 4337], 'Attisano': [1130, 1189, 1400, 1547, 1702, 4335], '2:': [1135, 1194, 1271, 1405, 1482, 1552, 1577, 1707], '109-120Abstract': [1136, 1195, 1406, 1553, 1708], '(467)': [1144, 1203, 1414, 1561, 1716], 'Together,': [1147], 'data': [1149, 1721], 'suggest': [1150], 'display': [1153, 4368], 'low': [1155, 1900], 'affinity': [1157], 'specificity': [1159], 'but': [1160], 'able': [1162, 1733], 'achieve': [1164], 'highly': [1165, 3841], 'physical': [1172], 'functional': [1174], 'nearby': [1177], 'transcription': [1179, 1386, 1600, 1625, 1690, 1743, 1786, 1857, 3322], 'factors': [1180, 1387, 1601, 1744, 1787], '(12Labbé': [1181, 1392, 1539, 1694], '13Chen': [1206, 1417], 'Rubock': [1208, 1419], 'M.J.': [1209, 1420, 2608], 'Whitman': [1210, 1231, 1421, 1442], '1996;': [1213, 1424, 4251, 4340], '383:': [1214, 1425], '691-696Crossref': [1215, 1426], '(635)': [1218, 1429], '14Chen': [1221, 1432], 'Weisberg': [1223, 1434], 'Fridmacher': [1225, 1436], 'V.': [1226, 1437], 'Watanabe': [1227, 1438], 'Naco': [1229, 1440], 'G.': [1230, 1441, 1797, 1807, 1920, 1930, 2100, 2110], '389:': [1235, 1446], '85-89Crossref': [1236, 1447], '(497)': [1239, 1450], '15Liu': [1242, 1453], 'F.': [1243, 1454], 'Pouponnot': [1244, 1455], '11:': [1251, 1462], '3157-3167Crossref': [1252, 1463], '(402)': [1255, 1466], '16Zhou': [1258, 1469, 1564], 'Zawel': [1260, 1471, 1566], 'Lengauer': [1262, 1473, 1568], '121-127Abstract': [1272, 1483, 1578], '(213)': [1280, 1491, 1586], '17Zhang': [1283], 'Feng': [1285], 'X.-H.': [1286], 'Derynck': [1287], 'R.': [1288, 2993, 3045, 3170, 3790, 3955, 3983], '394:': [1291, 1355, 1670], '909-913Crossref': [1292], '(699)': [1295], '18Hua': [1298], 'Liu': [1300], 'Ansari': [1302], 'D.O.': [1303], 'Lodish': [1304], 'H.F.': [1305], '3084-3095Crossref': [1310], '(261)': [1313], '19Moustakas': [1316], 'Kardasis': [1318], 'Proc.': [1320], 'Natl.': [1321], 'Acad.': [1322], 'Sci.': [1323], 'U.': [1324], '95:': [1328], '6733-6738Crossref': [1329], '(324)': [1332], '20Kurokawa': [1335], 'Mitani': [1337, 1652], 'Irie': [1339, 1654], 'Matsuyama': [1341, 1656], 'T.': [1342, 1344, 1657, 1659, 3074, 3981, 4002, 4328], 'Takahashi': [1343, 1658], 'Chiba': [1345, 1660], 'Yazaki': [1347, 1662], 'Matsumoto': [1349, 1664], 'Hirai': [1351, 1666], 'H.': [1352, 1667, 1805, 1928, 2040, 2108, 3005, 3182, 3802, 3979, 3987, 3989, 4004, 4006], '92-96Crossref': [1356, 1671], '(307)': [1359, 1674], 'This': [1362, 1525, 1880, 1954, 3525, 4117, 4279], 'exemplified': [1365], 'detailed': [1367], 'activin/TGF-β': [1370], '(ARE)': [1373], 'Mix.2': [1379, 1511], 'mousegoosecoid': [1381], 'forkhead': [1385], 'FAST1': [1388, 1502], 'FAST2,': [1390], 'It': [1494], 'upon': [1499, 4069], 'FAST2': [1504], 'recruit': [1505], 'Smad2/4': [1507], 'Smad2.': [1524], 'promotes': [1526], 'binding': [1527, 1639, 3254, 3783], 'adjacent': [1532], 'site,': [1533], 'resulting': [1534, 2368], 'enhanced': [1536, 2714], 'appear': [1594], 'association': [1598], 'although': [1603], 'majority': [1605], 'documented': [1607], 'interactions': [1608, 1737], 'involve': [1609], 'induction': [1611], 'expression,': [1614], 'some': [1615], 'block': [1616], 'stimulation.': [1621], 'For': [1622, 2019, 2069, 2189, 2491, 2720, 2827], 'example,': [1623], 'oncoprotein': [1628], 'Evi-1': [1629], 'specifically': [1630], 'Smad3,': [1634], 'thereby': [1635], 'preventing': [1636, 2267], 'from': [1638, 1909, 2169, 2198, 2593, 2795, 2851, 2988, 3129, 3144, 3204, 3234, 3261, 3572, 3646, 3754, 4165], 'blocking': [1642], 'TGF-β-induced': [1643], 'arrest': [1645], 'certain': [1647, 3970], 'cell': [1648, 1767, 2564, 2796, 3127, 3259], 'types': [1649, 1768], '(20Kurokawa': [1650], 'Recruitment': [1677], 'Smad3/Smad4': [1679], 'mouse': [1684, 1869, 1911, 2015, 2159, 2200, 3574, 3975, 4025], 'goosecoidpromoter': [1685], 'blocks,': [1686], 'rather': [1687], 'than': [1688, 1965], 'induces,': [1689], 'Overall,': [1719], 'indicate': [1722], 'that,': [1723], 'once': [1724, 2670, 3753], 'targeted': [1727], 'nucleus,': [1730], 'undergo': [1735], 'multiple': [1736], 'cause': [1746, 4189], 'both': [1747, 3594], 'repression': [1750], 'expression.': [1753], 'Previously,': [1754], 'we': [1755, 1779, 1865, 2073, 4103], 'shown': [1757, 2966, 4187], 'overexpression': [1759], 'XenopusSmad1': [1762], 'induces': [1765], 'ventral': [1766], 'Xenopusembryos.': [1770], 'Because': [1771, 3915], 'does': [1774], 'not': [1775, 2251, 2264, 3535, 3655, 3886, 4028, 4078, 4105, 4119, 4135, 4145, 4153], 'capacity,': [1778], 'anticipated': [1780], 'it': [1782, 4016], 'would': [1783], 'interact': [1784, 3661, 4154, 4263], 'elicit': [1792], 'effect': [1795], '(21Meersseman': [1796, 2099], 'Verschueren': [1798, 1921, 2101], 'Nelles': [1800, 1923, 2103], 'Blumenstock': [1802, 1925, 2105], 'Kraft': [1804, 1927, 2107], 'Wuytens': [1806, 1929, 2109], 'Remacle': [1808, 1931, 2111], 'Kozak': [1810, 1933, 2113], 'C.A.': [1811, 1934, 2114, 4234], 'Tylzanowski': [1812, 1935, 2115], 'Niehrs': [1814, 1937, 2117], 'Huylebroeck': [1816, 1939, 2119, 2636], 'Mech.': [1818, 1941, 2121, 2638, 3930], '61:': [1821, 1944, 2124], '127-140Crossref': [1822, 1945, 2125], '(63)': [1825, 1948, 2128], 'search': [1830], '(SIPs)': [1834], 'initiated': [1836], 'screening': [1839, 1902, 2295, 2340], 'yeast.': [1841], 'As': [1842, 1861, 3551], 'bait,': [1843], 'XSmad1': [1845, 2084, 2180, 4113, 4267], 'fused': [1849, 1873, 2060, 2405, 3517, 3640], 'GAL4': [1859, 1876, 3636], '(GAL4DBD).': [1860], 'source': [1862, 3553], 'preys,': [1864], 'used': [1866, 1958, 2387, 2505, 2961, 3196], '12.5-dpc': [1868, 2199, 3573], 'embryo': [1870, 1912], 'cDNA': [1871, 1973, 1998, 2028, 2076, 2172, 2194, 2212, 2402, 3717, 3730], 'library': [1872, 1907, 1955, 2273, 3560], 'transactivation': [1877, 3637], '(GAL4TAD).': [1879], 'screen': [1881, 1960, 2013], 'yielded': [1882, 3589], 'several': [1883], 'SIPs,': [1884], 'which,': [1887], 'here.': [1891], 'Mouse': [1892], 'Smad1': [1893, 4126, 4304, 4365], 'Smad2': [1895, 4367], 'cDNAs': [1896, 1963], 'stringency': [1901], 'oligo-dT-primed': [1905], 'λExlox': [1906], 'made': [1908, 3143], '12-dpc': [1910], '(Novagen),': [1913], 'Smad5': [1915, 2163], '(MLP1.2': [1916], 'clone;': [1917], '21Meersseman': [1919], 'Scholar)': [1950, 2130, 3086, 3382], 'probe.': [1953], 'also': [1957, 2874, 4030], 'th1': [1966, 1976], 'cDNA,': [1967], 'yielding': [1968], 'λExTW6.': [1969], '3.6-kilobase': [1971], 'TW6': [1972, 1997], 'overlapped': [1974], 'contained': [1978], 'additional': [1979, 3763], '3′-coding': [1980], 'in-frame': [1984, 2149, 3641], 'stop': [1985], 'codon.': [1986], 'complete': [1988], 'open': [1990, 2056], 'reading': [1991, 2057], 'frame': [1992, 2058], 'reconstituted': [1994], 'fusing': [1996], 'ATG': [2005], 'translation': [2006], 'initiation': [2007], 'codon,': [2008], 'obtained': [2009, 3346], 'independent': [2012, 2278], 'Zfh-1.': [2018], 'Xenopus,': [2025], 'subcloned': [2030, 2074], 'pCS2': [2032, 3315], 'pCS3': [2034], '(22Rupp': [2035], 'R.A.': [2036, 2319], 'Snider': [2037], 'Weintraub': [2039], '1994;': [2043, 3009, 3186, 3806], '1311-1323Crossref': [2045], '(568)': [2048], 'latter,': [2053], 'Myc6': [2063], 'tag': [2064], 'N': [2067], 'terminus.': [2068], 'SIP1CZF,': [2072, 3304], 'fragment': [2077], 'encoding': [2078, 2174, 3137, 3303], 'amino': [2079, 3647, 3743, 3882, 4100, 4170, 4273], 'acids': [2080, 3883, 4171], '977–1214': [2081], 'pCS3.': [2083], 'full-size': [2085], 'bait': [2089, 2141, 2156, 3527, 3584, 3622, 4143], 'plasmids': [2090, 2157, 3316, 3588], 'constructed': [2092, 3562], 'previously': [2095], 'described': [2096, 2825, 2858, 2944, 3091, 3148, 3425], 'EcoRI-XhoI': [2097], 'inserts': [2098, 2725], 'cloned': [2132, 2372], 'EcoRI': [2135], 'SalI': [2137], 'sites': [2138, 2382, 3287], 'vector': [2142, 3567], 'pGBT-9': [2143], '(Matchmaker': [2144, 2244], 'I,': [2145], 'CLONTECH),': [2146], 'fusions': [2150], 'GAL4DBD': [2152, 3520], 'obtained.': [2154, 2291, 3770], 'Similar': [2155], 'Smad1,': [2160], 'Smad2,': [2161], 'generated': [2165, 2184, 2359, 2392, 2430], 'PCR': [2167, 2361, 2416, 2734], 'starting': [2168], 'respective': [2171], 'fragments': [2173, 2503], 'domain.': [2177], 'G418S': [2179], 'oligonucleotide-directed': [2186], 'mutagenesis': [2187], '(Bio-Rad).': [2188], 'construction': [2190], 'prey': [2193, 2241, 3555, 3587, 3618, 3627, 3735], 'library,': [2195], 'polyadenylated': [2196, 3569], 'RNA': [2197, 3302, 3417, 3570], 'embryos': [2201, 3344], 'Oligotex': [2206], 'mRNA': [2207], 'Kit': [2208], '(Qiagen).': [2209], 'Randomly': [2210], 'primed': [2211, 3559], 'synthesized': [2214], '(Superscript': [2215], 'Choice;': [2216], 'Life': [2217], 'Technologies,': [2218], 'Inc.)': [2219], 'ligated': [2221], 'excess': [2224], 'Sfi': [2226, 2258], 'double-stranded': [2227, 2958], 'adaptors': [2228], 'StuI': [2230], 'BamHI': [2232], 'sites.': [2233], 'To': [2234, 2349, 3502], 'facilitate': [2235], 'cloning': [2236], 'cDNAs,': [2239, 3556, 3628], 'plasmid': [2242, 2256, 3523], 'pACT2': [2243, 3566], 'II,CLONTECH)': [2245], 'modified': [2247, 2443, 2462, 3565, 4266], 'pACT2/Sfi-Sfi': [2249], '(data': [2250, 3654, 4027, 4077, 4144], 'shown).': [2252, 3656, 4146], 'Restriction': [2253], 'generates': [2259], 'sticky': [2260], 'ends': [2261], 'complementary,': [2265], 'thus': [2266], 'self-ligation': [2268], 'vector.': [2271], '3.6': [2275], '×': [2276], '106': [2277], 'recombinant': [2279], 'clones': [2280], 'average': [2283], 'insert': [2284, 3731], 'size': [2285], '1,100': [2287], 'base': [2288], 'pairs': [2289], 'carried': [2297, 3113, 3162], 'out': [2298, 3114, 3163, 3321, 3504], 'Matchmaker': [2301], 'II': [2302], 'kit.': [2303], 'transformations': [2306], 'were,': [2307], 'however,': [2308, 3885], 'performed': [2309, 2896], 'according': [2310, 2478, 2531, 3164, 3324, 3385, 3455], 'Gietz': [2312], '(23Gietz': [2313], 'St': [2315], 'Jean': [2316], 'Woods': [2318], 'Schiestl': [2320], 'R.H.': [2321, 4247], 'Nucleic': [2322], 'Acids': [2323], 'Res.': [2324], '1992;': [2325], '20:': [2326], '1425Crossref': [2327], '(2935)': [2330], 'Yeast': [2333], 'strain': [2334, 3549], 'CG-1945': [2335], 'used,': [2337], 'done': [2342], 'selective': [2344], 'medium': [2345, 2445, 2464], '5': [2347, 3252], 'mm3-amino-1,2,4-triazole.': [2348], 'map': [2350], 'progressive': [2356], 'deletions': [2357], 'Pfu': [2363], '(Pfu;': [2365], 'Stratagene),': [2366], 'amplified': [2369, 2732], 'DNAs': [2370], 'pACT2,': [2374], 'SmaI': [2378], 'XhoI': [2380], 'restriction': [2381, 2411], 'built': [2383, 2413], 'primers': [2386, 2417], 'amplification.': [2389], 'SIP1ΔSBD51': [2390], 'amplifying': [2394], 'N-': [2395], 'segment-encoding': [2398], 'parts': [2399], 'NcoI': [2410], 'site': [2412, 2982, 2985, 3017, 3035, 3066], 'position': [2420, 4086], 'deletion.': [2423], 'correct': [2425], 'all': [2428], 'constructs': [2431, 3136, 3240], 'verified': [2433], 'sequencing.': [2436], 'HEK293T': [2437, 2853], 'maintained': [2440, 3366, 4068], "Dulbecco's": [2442, 2461], "Eagle's": [2444, 2463], '4.5': [2447], 'mg': [2448], 'glucose/ml': [2450], '10%': [2452, 2466, 3368], 'fetal': [2453, 2467], 'bovine': [2454, 2468], 'serum.': [2455, 2469], 'COS1': [2456, 2563, 2594, 2744, 2861, 3130, 3235], 'grown': [2459], 'Cells': [2470], 'transfected': [2472, 2597, 2743, 2852, 3133, 3237], 'Fugene': [2474], '(Roche': [2475], 'Molecular': [2476, 2782], 'Biochemicals)': [2477], 'protocol': [2481], 'manufacturer': [2484], 'collected': [2486, 2925], '30–48': [2487], 'h': [2488, 2805, 2907, 2919], 'after': [2489, 2698], 'transfection.': [2490], 'production': [2492], 'GST-Smad': [2494], 'fusion': [2495, 3194], 'Escherichia': [2498], 'coli,': [2499], 'same': [2501], 'assay': [2509, 3160], 're-cloned': [2511, 2737], 'pGEX-5X-1': [2513, 2727], '(Amersham': [2514, 2538, 2837], 'Pharmacia': [2515, 2539, 2838], 'Biotech).': [2516, 2540], 'GST-fusion': [2517, 2729, 2791, 2831, 3122], 'expressed': [2520, 3119, 4023], '(strain': [2524], 'BL21)': [2525], 'purified': [2527, 2794, 3104, 3121], 'glutathione-Sepharose': [2529, 2801], 'beads': [2530, 2542, 2649, 2802, 2916], 'protocols': [2533], 'provided': [2534], 'supplier': [2537], 'first': [2544, 4052, 4098], 'washed': [2545, 2929], 'four': [2546, 2664, 2811, 2930], 'times': [2547, 2665, 2931], 'phosphate-buffered': [2549, 2672], 'saline': [2550, 2673], 'supplemented': [2551, 2773, 2875], 'protease': [2553, 2587, 2775], 'inhibitors': [2554, 2776, 2881], 'mixed': [2558, 2651], '50': [2560], 'μl': [2561], 'lysate': [2565, 2590], '1': [2567, 2885, 2918, 3414], 'ml': [2568], 'GST': [2570, 2667, 3151], 'buffer': [2571, 2602, 2668, 2758, 2872, 2934], '(50': [2572, 2882], 'mm': [2573, 2580, 2764, 2767, 2883, 2886], 'Tris-HCl,': [2574], 'pH': [2575, 2769], '7.5,': [2576, 2770], '120': [2577], 'mmNaCl,': [2578], 'EDTA,': [2581], '0.1%': [2582], '(v/v)': [2583], 'Nonidet': [2584, 2761], 'P-40,': [2585, 2762], 'inhibitors).': [2588], 'prepared': [2592, 2856, 3310], 'transiently': [2596, 3132], 'pCS3-SIP1': [2599], 'solubilization': [2601, 3155], '(24Verschueren': [2603], 'Dewulf': [2605], 'Goumans': [2607], 'Lonnoy': [2609], 'O.': [2610], 'Feijen': [2611], 'Grimsby': [2613], 'Vande': [2615], 'Spiegle': [2616], 'Morén': [2621], 'Vanscheeuwijck': [2623], 'Mummery': [2629], 'van': [2631], 'den': [2632], 'Eijnden-van': [2633], 'Raaij': [2634], 'A.J.M.': [2635], '1995;': [2640, 3025, 4221, 4319], '52:': [2641], '109-123Crossref': [2642], '(104)': [2645], '4': [2653, 2675, 2807, 2909, 2921, 2936, 3579], '°C': [2654], '16': [2656], 'h.': [2657], 'Unbound': [2658], 'removed': [2661], 'washing': [2663], '°C.': [2676, 2922], 'Bound': [2677], 'harvested': [2680], 'boiling': [2682], 'sample': [2684], 'buffer,': [2685], 'resolved': [2689], 'SDS-polyacrylamide': [2691], 'gel': [2692, 3107], 'electrophoresis.': [2693, 3108], 'Myc-tagged': [2694, 3138, 3242], 'visualized': [2697, 2820, 2942], 'Western': [2699, 2822], 'blotting': [2700, 2823], 'anti-Myc': [2702], 'monoclonal': [2703, 2903], 'antibody': [2704, 2710, 2836, 2846, 2904], '(9E10),': [2705], 'horseradish': [2706, 2842], 'peroxidase-conjugated': [2707, 2843], 'anti-mouse': [2708], 'secondary': [2709, 2845], '(Jackson),': [2711], 'chemiluminescence': [2715], 'kit': [2716], '(New': [2717], 'England': [2718], 'Nuclear).': [2719], 'pull-down': [2722, 2866, 2948, 3152], 'experiments,': [2723, 2867], 'encodingXSmad1': [2728], 'usingPfu,': [2735], 'pCS2.': [2739], 'Cell': [2740, 2784, 3429, 3464], 'pellets': [2741], 'frozen': [2747], 'liquid': [2749], 'nitrogen,': [2750], 'thawed': [2751], 'ice,': [2753], 'solubilized': [2755], 'lysis': [2757, 2815, 2871, 2933], '1%': [2760], '150': [2763], 'NaCl,': [2765], '20': [2766], 'Tris,': [2768], 'mmEDTA,': [2772], '(Protease': [2777], 'Inhibitor': [2778], 'Mixture': [2779], 'Tablets,': [2780], 'Roche': [2781], 'Biochemicals).': [2783], 'lysates': [2785], 'cleared': [2787], 'centrifugation,': [2789], 'extracts': [2797, 3128, 3233, 3260], 'incubation': [2799, 2898, 2913], '°C,': [2808, 2910, 2937], 'followed': [2809, 2911], 'washes': [2812], 'cold': [2814], 'buffer.': [2816, 3156], 'Purified': [2817], 'above.': [2826], 'detection': [2828], 'polyclonal': [2834], 'anti-GST': [2835], 'Biotech)': [2839], 'anti-goat': [2844], '(Jackson)': [2847], 'used.': [2849, 3550], 'Extracts': [2850, 3141], 'above': [2859, 2945], 'except': [2868], 'mixture': [2878], 'phosphatase': [2880], 'NaF,': [2884], 'sodium': [2887], 'pyrophosphate,': [2888], '0.1': [2890], 'μm': [2891], 'okadaic': [2892], 'acid).': [2893], 'Immunoprecipitations': [2894], 'M2': [2901], 'Flag': [2902], 'protein-G': [2915], 'Beads': [2923], 'centrifugation': [2927], 'experiments.': [2949], 'upper': [2954], 'strand': [2955], 'oligonucleotide': [2959], 'probes': [2960, 3226], 'work': [2964], 'Figs.': [2968], '6': [2969], '7.': [2971], 'wild': [2973], 'mutant': [2976, 4184], 'κE2': [2977], 'sequences,': [2978], 'brachyury-binding': [2981], 'MyoD-binding': [2984], 'taken': [2987], 'Sekido': [2989, 3166, 3982], 'et': [2990, 3167], 'al.': [2991, 3168], '(25Sekido': [2992, 3169, 3789], 'Murai': [2994, 3171, 3791], 'Funahashi': [2996, 3173, 3793], 'Kamachi': [2998, 3175, 3795], 'Fujisawa-Sehara': [3000, 3177, 3797], 'Nabeshima': [3002, 3179, 3799], 'Kondoh': [3004, 3181, 3801, 3988, 4005], '14:': [3010, 3187, 3807], '5692Crossref': [3011, 3188, 3808], 'AREB6-binding': [3016], '(26Ikeda': [3018], 'Kawakami': [3020, 3984], 'Eur.': [3022], 'Biochem.': [3024], '233:': [3026], '73-82Crossref': [3027], '(78)': [3030], 'Scholar),': [3032, 3062, 3473, 3710, 3939, 4015], 'Nil-2a-binding': [3034], '(27Williams': [3036], 'T.M.': [3037], 'Moolten': [3038], 'Burlein': [3040], 'Romano': [3042], 'Bhaerman': [3044], 'Godillot': [3046], 'Mellon': [3048], 'Rauscher': [3050], 'F.J.': [3051], 'Kant': [3052], 'Science.': [3054, 4250], '1991;': [3055, 3078, 3431, 3466, 3491, 3932], '254:': [3056], '1791-1794Crossref': [3057], '(171)': [3060], 'GATA2-binding': [3065], '(28Lee': [3067], 'M.E.': [3068, 3925], 'Temizer': [3069], 'D.H.': [3070], 'Clifford': [3071], 'Quertermous': [3073], '266:': [3079], '16188-16192Abstract': [3080], 'identical': [3088, 3766], 'those': [3090, 3145], 'previously.': [3092], 'Double-stranded': [3093], 'oligonucleotides': [3094], 'end-labeled': [3096], 'T4': [3098], 'polynucleotide': [3099], '[γ-32P]ATP': [3102], 'polyacrylamide': [3106], 'Gel': [3109], 'retardation': [3110], 'assays': [3111], 'bacterially': [3118], '(GST-SIP1CZF)': [3124], 'experiments': [3153, 4148], 'Electrophoretic': [3157], 'mobility': [3158], 'shift': [3159], 'GST-PLAG1': [3193], 'negative': [3199], 'control,': [3200], 'gift': [3203], 'Voz': [3206], '(Flanders': [3207], 'Interuniversity': [3208], 'Institute': [3209], 'Biotechnology,': [3211], 'Dept.': [3212], 'VIB-04,': [3213], 'Leuven,': [3214], 'Belgium).Figure': [3215], '7SIP1': [3216], 'Xbra2promoter.': [3220], 'Fifty': [3221], 'pg': [3222], '32P-labeledXbra': [3224], '(WT': [3227], 'D)': [3229], 'incubated': [3231], 'SIP1CZF': [3243], '(lanes': [3244], '1–2)': [3245], '(SIP1FS,': [3249], 'lanes': [3250], '3–4).Lane': [3251], 'shows': [3253], 'endogenous': [3256, 3273], 'mock-transfected': [3262], 'cells.': [3263], 'Specific': [3264], 'indicated': [3268], '(*)': [3269], 'well': [3271, 3620], '(●).': [3275], 'Xbra-WT': [3276], 'probe': [3277, 3476], 'contains': [3278, 3284], '5′-ATCCAGGCCACCTAAAATATAGAATGATAAAGTGACCAGGTGTCAGTTCT,': [3281], 'Xbra-D': [3283], '5′-ATCCAGGCCACCTAAAATATAGAATGATAAAGTGACCAGATGTCAGTTCT.': [3285], 'SIP1-binding': [3286], 'bold,': [3290], 'substituted': [3293], 'nucleotide': [3294], 'underlined.View': [3296], 'Large': [3297], 'Image': [3298], 'Figure': [3299], 'ViewerDownload': [3300], '(PPT)': [3301], 'SIP1TH1,': [3305, 3768, 3828], 'linearizing': [3312], 'appropriate': [3314], 'Asp718': [3318], 'carrying': [3320], 'reactions': [3323], '(29Smith': [3326], 'J.C.': [3327, 3352, 3481], 'Hartley': [3328], 'Cellular': [3330], 'Interactions': [3331], 'Development-a': [3333], 'Practical': [3334], 'Approach.': [3335], 'Oxford': [3336, 3818, 3873], 'University': [3337, 3819, 3874], 'Press,': [3338, 3820, 3875], 'New': [3339, 3821, 3876], 'York1993:': [3340], '181-204Google': [3341], 'vitro': [3349], 'fertilization': [3350], '(30Smith': [3351], 'Slack': [3353], 'J.M.W.': [3354, 3373], 'Embryol.': [3356, 3375], 'Exp.': [3357, 3376, 3991], 'Morphol.': [3358, 3377], '1983;': [3359], '78:': [3360], '299-317PubMed': [3361], 'They': [3364, 3439], 'Normal': [3369, 3394], 'Amphibian': [3370], 'Medium': [3371], '(31Slack': [3372], '1984;': [3378], '80:': [3379], '289-319PubMed': [3380], 'staged': [3384], 'Nieuwkoop': [3387], 'Faber': [3389, 3392], '(32Nieuwkoop': [3390], 'P.D.': [3391], 'Table': [3395], 'laevis.': [3398], 'Daudin,': [3399], 'North': [3400], 'Holland,': [3401], 'Amsterdam1967Google': [3402], 'Embryos': [3404], '2-': [3407], '4-cell': [3409], 'stage': [3410, 3445], 'injected': [3412], 'ng': [3415], 'dissolved': [3418], '14': [3420], 'nl': [3421], 'water': [3423], '(33Harland': [3426, 3461], 'R.M.': [3427, 3462], 'Methods': [3428, 3463], '36:': [3432, 3467], '675-685Crossref': [3433, 3468], '(3)': [3436, 3471], 'cultured': [3441], 'gastrula': [3444], '10.5': [3446], 'processed': [3448], 'whole': [3450], 'mount': [3451], 'situ': [3453], 'hybridization': [3454], 'method': [3458], 'Harland': [3460], 'Xbra': [3479], '(34Smith': [3480], 'Price': [3482], 'Green': [3484], 'Weigel': [3486], 'Herrmann': [3488], 'B.G.': [3489], '67:': [3492], '79-87Abstract': [3493], '(863)': [3499], 'carry': [3503], 'screening,': [3507], 'coding': [3509], 'ofXSmad1': [3515, 4066, 4159], 'pGBT-9.': [3524], 'GAL4DBD-Smad1': [3526], 'when': [3529, 4374], 'tested': [3530], 'own,': [3533], 'did': [3534, 4104, 4152, 4262], 'give': [3536], 'detectable': [3537], 'levels': [3538], 'GAL4-dependent': [3540], 'synthesis': [3541], 'HIS3': [3543], 'random': [3558], 'Screening': [3576], 'about': [3578], 'million': [3580], 'yeasts': [3581], 'approximately': [3590], '500': [3591], 'colonies': [3592, 3604], 'expressing': [3593], 'theHIS3': [3595], 'marker': [3596], 'reporter': [3599], 'Rescreening': [3601], '81': [3606, 3759], 'required': [3614, 3962], 'presence': [3616], 'cDNAs.': [3623], 'One': [3624], 'th72,': [3629], 'encoded': [3630, 3738], 'started': [3645], 'acid': [3648, 4274], '252': [3649], 'known': [3659], 'receptor-activated': [3664], 'isolation': [3713], 'confirmed': [3718], 'feasibility': [3720], 'our': [3722], 'approach': [3724], 'toward': [3725], 'identifying': [3726], 'another': [3733], 'positive': [3734, 3760], 'plasmid,': [3736], 'th1,': [3737], 'polypeptide': [3740], '626': [3742], 'acids,': [3744], 'named': [3745], 'SIP1TH1.': [3746], 'Whereas': [3747], 'th72': [3748], '(Smad4)': [3749], 'only': [3752], 'initial': [3756], 'collection': [3757], 'colonies,': [3761], 'clones,': [3765], 'Sequence': [3771], 'analysis': [3772], 'SIP1TH1': [3775, 4038, 4046, 4061, 4076, 4092, 4110, 4151, 4261], 'similarities': [3777], 'δ-crystallin': [3781], '(δEF1)': [3785], 'Zfh-1': [3788, 3834, 3916], 'Scholar,36Duboule': [3811], 'Guidebook': [3813, 3868], 'Homeobox': [3816, 3871], 'Genes.': [3817, 3872], 'York1994:': [3822, 3877], '27-71Google': [3823, 3878], 'homeodomain': [3831, 3835, 3899], 'sequence.': [3832, 3914], 'canonical': [3838], 'residues': [3843], 'helix': [3845, 3865], '3/4': [3846], 'critical': [3847, 3881], 'binding,': [3850], 'asparagine': [3855], 'arginine': [3857], 'positions': [3859], '10': [3860], '12': [3862], 'within': [3863, 4096], '(36Duboule': [3866], 'are,': [3884], 'corresponding': [3890], 'regions': [3891], 'δEF1': [3893, 3960], 'suggesting': [3896], 'cannot': [3900], 'therefore': [3906], 'prefer': [3907], 'call': [3909], 'homeodomain-like': [3913, 4073], 'patterning': [3920], 'mesoderm-derived': [3922], 'tissues': [3923], '(35Fortini': [3924], 'Lai': [3926], 'Rubin': [3928], 'G.M.': [3929], '34:': [3933], '113-122Crossref': [3934], '(144)': [3937], 'muscle': [3941], 'subset': [3944], 'heart,': [3949], '2M.-T.': [3950], 'Su,': [3951], 'Fujioka,': [3953], 'Bodmer,': [3956], 'unpublished': [3957], 'results.': [3958], 'normal': [3964], 'development': [3965], 'T': [3967], 'skeletal': [3971], '(38Higashi': [3976], 'Moribe': [3978, 4003], 'Takagi': [3980], 'Kikutani': [3986], 'Med.': [3992], '185:': [3994], '1467-1479Crossref': [3995], '(122)': [3998], '39Takagi': [4001], 'Higashi': [4007], '125:': [4011], '21-31Crossref': [4012], 'possible': [4018], 'during': [4024], 'embryogenesis': [4026], 'shown),': [4029, 4079], 'plays': [4031], 'role': [4033], 'embryonic': [4035], 'development.': [4036], 'subjected': [4040], 'further': [4042], 'analysis.': [4043], 'Interaction': [4044, 4059], 'examined': [4053], 'removal': [4070], 'segment': [4074], 'similar': [4081, 4180, 4196], 'approaches': [4082], 'enabled': [4083], 'us': [4084], '(SBD)': [4090], 'region': [4095], '192': [4099], 'acids.': [4101], 'Strikingly,': [4102], 'observe': [4106], '(Fig.1).': [4116], 'because': [4120, 4129], 'inefficient': [4122], 'polypeptides,': [4132], 'related': [4136], 'interacted': [4139], 'efficiently': [4140], 'Additional': [4147], 'showed': [4149], 'nor': [4160], 'last': [4168], '43': [4169], 'deleted': [4173], '(Δ424–466)': [4174], '(Fig.': [4175], '1).': [4176, 4278], 'truncated': [4178], 'Δ424–466': [4183], 'loss-of-function': [4190], 'phenotypes': [4191], 'Drosophila,': [4193], 'truncation': [4197], '(dpc4)': [4200], 'loss-of-heterozygosity': [4203], 'background': [4204], 'associated': [4206], 'pancreatic': [4208], 'carcinomas': [4209], '(40Sekelsky': [4210, 4308], 'J.J.': [4211, 4309], 'Newfeld': [4212, 4310], 'S.J.': [4213, 4311], 'Raftery': [4214, 4312], 'L.A.': [4215, 4313], 'Chartoff': [4216, 4314], 'E.H.': [4217, 4315], 'Gelbart': [4218, 4316], 'W.M.': [4219, 4317], 'Genetics.': [4220, 4318], '139:': [4222, 4320], '1347-1358Crossref': [4223, 4321], '41Hahn': [4227], 'S.A.': [4228], 'Schutte': [4229], 'Hoque': [4231], 'A.T.': [4232], 'Moskaluk': [4233], 'da': [4235], 'Costa': [4236], 'L.T.': [4237], 'Rozenblum': [4238], 'Weinstein': [4240], 'C.L.': [4241], 'Fisher': [4242], 'Yeo': [4244], 'C.J.': [4245], 'Hruban': [4246], 'S.E.': [4249], '271:': [4252], '350-353Crossref': [4253], '(2189)': [4256], 'contrast,': [4260], 'having': [4270], 'single': [4272], 'substitution': [4275], '(G418S,': [4276], 'Fig.': [4277], 'mutation': [4280], 'affects': [4281], 'glycine': [4284], 'residue': [4285], 'reported': [4289], 'render': [4291], 'homologue': [4294], 'inactive': [4297], 'abolish': [4300], 'BMP-dependent': [4301], '42Hoodless': [4325], 'Haerry': [4327], 'Abdollah': [4329], 'Stapleton': [4331], "O'Connor": [4333], 'M.B.': [4334], '85:': [4341], '489-500Abstract': [4342], '(627)': [4350], 'Despite': [4353], 'very': [4355], 'high': [4356], 'degree': [4357], 'similarity,': [4360], 'striking': [4369], 'differences': [4370], 'overexp': [4375]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2141809016', 'counts_by_year': [{'year': 2024, 'cited_by_count': 7}, {'year': 2023, 'cited_by_count': 14}, {'year': 2022, 'cited_by_count': 16}, {'year': 2021, 'cited_by_count': 14}, {'year': 2020, 'cited_by_count': 16}, {'year': 2019, 'cited_by_count': 19}, {'year': 2018, 'cited_by_count': 23}, {'year': 2017, 'cited_by_count': 23}, {'year': 2016, 'cited_by_count': 16}, {'year': 2015, 'cited_by_count': 18}, {'year': 2014, 'cited_by_count': 7}, {'year': 2013, 'cited_by_count': 25}, {'year': 2012, 'cited_by_count': 28}], 'updated_date': '2024-12-10T08:45:38.872284', 'created_date': '2016-06-24'}