Publication Information

{'id': 'https://openalex.org/W2129937334', 'doi': 'https://doi.org/10.1194/jlr.m200367-jlr200', 'title': 'Regulation of the angiopoietin-like protein 3 gene by LXR', 'display_name': 'Regulation of the angiopoietin-like protein 3 gene by LXR', 'publication_year': 2003, 'publication_date': '2003-01-01', 'ids': {'openalex': 'https://openalex.org/W2129937334', 'doi': 'https://doi.org/10.1194/jlr.m200367-jlr200', 'mag': '2129937334', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/12518032'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1194/jlr.m200367-jlr200', 'pdf_url': 'http://www.jlr.org/article/S0022227520327231/pdf', 'source': {'id': 'https://openalex.org/S11400418', 'display_name': 'Journal of Lipid Research', 'issn_l': '0022-2275', 'issn': ['0022-2275', '1539-7262'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'doaj'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jlr.org/article/S0022227520327231/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5077771536', 'display_name': 'Rebecca Kaplan', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I1285764155', 'display_name': 'Merck & Co., Inc., Rahway, NJ, USA (United States)', 'ror': 'https://ror.org/02891sr49', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I1285764155']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Rebecca Kaplan', 'raw_affiliation_strings': ['Departments of Atherosclerosis and Endocrinology, Merck Research Laboratories, Rahway, New Jersey 07065'], 'affiliations': [{'raw_affiliation_string': 'Departments of Atherosclerosis and Endocrinology, Merck Research Laboratories, Rahway, New Jersey 07065', 'institution_ids': ['https://openalex.org/I1285764155']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5107252172', 'display_name': 'Theresa Zhang', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I1285764155', 'display_name': 'Merck & Co., Inc., Rahway, NJ, USA (United States)', 'ror': 'https://ror.org/02891sr49', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I1285764155']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Theresa Zhang', 'raw_affiliation_strings': ['Bioinformatics, Merck Research Laboratories, Rahway, New Jersey 07065'], 'affiliations': [{'raw_affiliation_string': 'Bioinformatics, Merck Research Laboratories, Rahway, New Jersey 07065', 'institution_ids': ['https://openalex.org/I1285764155']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5111819817', 'display_name': 'Melba Hernandez', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I1285764155', 'display_name': 'Merck & Co., Inc., Rahway, NJ, USA (United States)', 'ror': 'https://ror.org/02891sr49', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I1285764155']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Melba Hernandez', 'raw_affiliation_strings': ['Departments of Atherosclerosis and Endocrinology, Merck Research Laboratories, Rahway, New Jersey 07065'], 'affiliations': [{'raw_affiliation_string': 'Departments of Atherosclerosis and Endocrinology, Merck Research Laboratories, Rahway, New Jersey 07065', 'institution_ids': ['https://openalex.org/I1285764155']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5041903352', 'display_name': 'Frank Xiaodong Gan', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I1285764155', 'display_name': 'Merck & Co., Inc., Rahway, NJ, USA (United States)', 'ror': 'https://ror.org/02891sr49', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I1285764155']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Frank Xiaodong Gan', 'raw_affiliation_strings': ['Departments of Atherosclerosis and Endocrinology, Merck Research Laboratories, Rahway, New Jersey 07065'], 'affiliations': [{'raw_affiliation_string': 'Departments of Atherosclerosis and Endocrinology, Merck Research Laboratories, Rahway, New Jersey 07065', 'institution_ids': ['https://openalex.org/I1285764155']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5076210539', 'display_name': 'Samuel D. Wright', 'orcid': 'https://orcid.org/0000-0001-5583-0595'}, 'institutions': [{'id': 'https://openalex.org/I1285764155', 'display_name': 'Merck & Co., Inc., Rahway, NJ, USA (United States)', 'ror': 'https://ror.org/02891sr49', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I1285764155']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Samuel D. Wright', 'raw_affiliation_strings': ['Departments of Atherosclerosis and Endocrinology, Merck Research Laboratories, Rahway, New Jersey 07065'], 'affiliations': [{'raw_affiliation_string': 'Departments of Atherosclerosis and Endocrinology, Merck Research Laboratories, Rahway, New Jersey 07065', 'institution_ids': ['https://openalex.org/I1285764155']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5053116098', 'display_name': 'M. Gerard Waters', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I1285764155', 'display_name': 'Merck & Co., Inc., Rahway, NJ, USA (United States)', 'ror': 'https://ror.org/02891sr49', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I1285764155']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'M.Gerard Waters', 'raw_affiliation_strings': ['Departments of Atherosclerosis and Endocrinology, Merck Research Laboratories, Rahway, New Jersey 07065'], 'affiliations': [{'raw_affiliation_string': 'Departments of Atherosclerosis and Endocrinology, Merck Research Laboratories, Rahway, New Jersey 07065', 'institution_ids': ['https://openalex.org/I1285764155']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5109126437', 'display_name': 'Tian‐Quan Cai', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I1285764155', 'display_name': 'Merck & Co., Inc., Rahway, NJ, USA (United States)', 'ror': 'https://ror.org/02891sr49', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I1285764155']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Tian-Quan Cai', 'raw_affiliation_strings': ['Departments of Atherosclerosis and Endocrinology, Merck Research Laboratories, Rahway, New Jersey 07065'], 'affiliations': [{'raw_affiliation_string': 'Departments of Atherosclerosis and Endocrinology, Merck Research Laboratories, Rahway, New Jersey 07065', 'institution_ids': ['https://openalex.org/I1285764155']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 6.814, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 117, 'citation_normalized_percentile': {'value': 0.99993, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 96, 'max': 97}, 'biblio': {'volume': '44', 'issue': '1', 'first_page': '136', 'last_page': '143'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T13430', 'display_name': 'Lipid metabolism and disorders', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2705', 'display_name': 'Cardiology and Cardiovascular Medicine'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T13430', 'display_name': 'Lipid metabolism and disorders', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2705', 'display_name': 'Cardiology and Cardiovascular Medicine'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T11618', 'display_name': 'Cholesterol and Lipid Metabolism', 'score': 0.9985, 'subfield': {'id': 'https://openalex.org/subfields/2746', 'display_name': 'Surgery'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T12465', 'display_name': 'Cancer, Lipids, and Metabolism', 'score': 0.9974, 'subfield': {'id': 'https://openalex.org/subfields/1306', 'display_name': 'Cancer Research'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [], 'concepts': [{'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.430113}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.42559218}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.35324454}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.33539063}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.31729135}], 'mesh': [], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1194/jlr.m200367-jlr200', 'pdf_url': 'http://www.jlr.org/article/S0022227520327231/pdf', 'source': {'id': 'https://openalex.org/S11400418', 'display_name': 'Journal of Lipid Research', 'issn_l': '0022-2275', 'issn': ['0022-2275', '1539-7262'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://doaj.org/article/d19e1c5fb9d748a3b3ddbc679836b59a', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306401280', 'display_name': 'DOAJ (DOAJ: Directory of Open Access Journals)', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': None, 'host_organization_name': None, 'host_organization_lineage': [], 'host_organization_lineage_names': [], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1194/jlr.m200367-jlr200', 'pdf_url': 'http://www.jlr.org/article/S0022227520327231/pdf', 'source': {'id': 'https://openalex.org/S11400418', 'display_name': 'Journal of Lipid Research', 'issn_l': '0022-2275', 'issn': ['0022-2275', '1539-7262'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'score': 0.71, 'display_name': 'Good health and well-being', 'id': 'https://metadata.un.org/sdg/3'}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 29, 'referenced_works': ['https://openalex.org/W1570388980', 'https://openalex.org/W1577442809', 'https://openalex.org/W1589910824', 'https://openalex.org/W1607230014', 'https://openalex.org/W1967286688', 'https://openalex.org/W1970614272', 'https://openalex.org/W1988422919', 'https://openalex.org/W2003840075', 'https://openalex.org/W2024851295', 'https://openalex.org/W2033200911', 'https://openalex.org/W2038352589', 'https://openalex.org/W2039307052', 'https://openalex.org/W2040417680', 'https://openalex.org/W2048397414', 'https://openalex.org/W2058804806', 'https://openalex.org/W2061864595', 'https://openalex.org/W2070575980', 'https://openalex.org/W2095786854', 'https://openalex.org/W2106882534', 'https://openalex.org/W2119343066', 'https://openalex.org/W2124615340', 'https://openalex.org/W2133867463', 'https://openalex.org/W2142890842', 'https://openalex.org/W2144322830', 'https://openalex.org/W2152215024', 'https://openalex.org/W2153673003', 'https://openalex.org/W2157038552', 'https://openalex.org/W2158714788', 'https://openalex.org/W4253237243'], 'related_works': ['https://openalex.org/W4387497383', 'https://openalex.org/W4229748205', 'https://openalex.org/W2948807893', 'https://openalex.org/W2778153218', 'https://openalex.org/W2748952813', 'https://openalex.org/W2527526854', 'https://openalex.org/W2062208111', 'https://openalex.org/W2034625591', 'https://openalex.org/W1976181487', 'https://openalex.org/W1531601525'], 'abstract_inverted_index': {'Angiopoietins': [0, 196, 4386], 'are': [1, 197, 395, 585, 763, 776, 1080, 1452, 1599, 2619, 2771, 2803, 3365, 3432, 3535, 3546, 3555, 3803, 4266, 4271, 4366, 4387, 4741, 4890, 5104], 'members': [2, 198, 777, 4388], 'of': [3, 50, 76, 84, 94, 106, 110, 116, 125, 144, 157, 171, 199, 246, 272, 280, 290, 302, 306, 312, 321, 340, 353, 367, 398, 485, 512, 543, 549, 596, 633, 652, 661, 672, 714, 738, 749, 778, 793, 800, 834, 873, 891, 898, 932, 975, 1018, 1043, 1066, 1075, 1110, 1114, 1148, 1177, 1194, 1208, 1233, 1252, 1257, 1271, 1344, 1351, 1448, 1469, 1521, 1551, 1560, 1587, 1604, 1644, 1658, 1683, 1718, 1738, 1820, 1837, 1848, 1882, 1960, 2044, 2047, 2053, 2083, 2100, 2156, 2160, 2172, 2176, 2214, 2246, 2255, 2296, 2304, 2310, 2329, 2332, 2338, 2352, 2438, 2451, 2459, 2463, 2471, 2534, 2546, 2567, 2585, 2646, 2698, 2706, 2733, 2834, 2870, 2874, 2911, 2915, 2924, 2932, 2942, 2950, 2957, 2962, 2974, 2997, 3008, 3024, 3054, 3064, 3074, 3081, 3117, 3121, 3133, 3157, 3171, 3178, 3195, 3225, 3284, 3293, 3321, 3333, 3383, 3394, 3464, 3473, 3477, 3528, 3532, 3566, 3582, 3588, 3632, 3653, 3659, 3706, 3731, 3736, 3746, 3749, 3754, 3769, 3785, 3824, 3863, 3893, 3914, 3919, 3932, 3949, 3964, 3985, 3999, 4020, 4024, 4061, 4067, 4079, 4086, 4107, 4129, 4133, 4152, 4160, 4169, 4189, 4218, 4238, 4287, 4311, 4347, 4360, 4381, 4389, 4419, 4479, 4512, 4521, 4555, 4575, 4589, 4598, 4672, 4677, 4710, 4729, 4747, 4759, 4761, 4765, 4768, 4778, 4812, 4816, 4850, 4864, 4875, 4911, 4930, 4935, 4944, 4954, 4966, 4973, 4976, 5012, 5055, 5080, 5097, 5113, 5127, 5158, 5172, 5188, 5202, 5248, 5258, 5286, 5290, 5322, 5327, 5335, 5380, 5393, 5402, 5422, 5427], 'the': [4, 25, 43, 51, 70, 91, 111, 117, 123, 141, 158, 167, 172, 200, 221, 239, 247, 266, 287, 307, 313, 319, 337, 354, 363, 368, 411, 416, 510, 634, 723, 736, 750, 779, 798, 832, 871, 880, 896, 930, 1047, 1064, 1166, 1239, 1249, 1287, 1338, 1358, 1363, 1372, 1380, 1384, 1413, 1518, 1531, 1547, 1556, 1561, 1568, 1588, 1602, 1736, 1770, 1808, 1828, 1849, 1857, 1883, 1920, 1925, 1961, 1967, 1991, 2013, 2045, 2054, 2080, 2084, 2097, 2101, 2134, 2144, 2157, 2161, 2173, 2177, 2186, 2196, 2211, 2215, 2236, 2244, 2251, 2269, 2285, 2311, 2339, 2370, 2387, 2520, 2562, 2593, 2624, 2649, 2699, 2776, 2832, 2978, 2995, 3004, 3022, 3079, 3176, 3193, 3212, 3228, 3233, 3238, 3245, 3261, 3275, 3285, 3294, 3300, 3303, 3310, 3322, 3329, 3334, 3346, 3361, 3381, 3384, 3403, 3409, 3415, 3456, 3465, 3474, 3486, 3503, 3512, 3564, 3567, 3583, 3593, 3635, 3673, 3683, 3707, 3739, 3757, 3825, 3829, 3897, 3912, 3915, 3920, 3933, 3940, 3950, 3960, 3965, 3969, 3982, 3986, 3997, 4010, 4021, 4058, 4080, 4105, 4108, 4118, 4127, 4134, 4161, 4166, 4170, 4197, 4213, 4219, 4248, 4288, 4304, 4308, 4312, 4348, 4369, 4384, 4390, 4424, 4483, 4517, 4530, 4648, 4723, 4762, 4912, 4916, 4933, 4950, 4971, 5084, 5122, 5135, 5140, 5199, 5328, 5398, 5406], 'vascular': [5, 201, 437, 4391], 'endothelial': [6, 202, 4392], 'growth': [7, 203, 400, 4393], 'factor': [8, 129, 204, 325, 4315, 4341, 4394], 'family.': [9, 205], 'One': [10, 206, 444, 2301], 'family': [11, 207, 397, 445, 4395, 4481], 'member,': [12, 208, 446], 'angiopoietin-like': [13, 209, 5470], 'protein': [14, 210, 448, 489, 1199, 1645, 4292, 4559, 5163, 5471, 5486], '3': [15, 211, 449, 1950, 5472], '(Angpt1111111175),': [16, 212], 'was': [17, 146, 213, 342, 451, 502, 731, 1369, 1393, 1402, 1514, 1544, 1565, 1825, 1864, 1885, 1933, 1983, 1993, 2010, 2039, 2065, 2117, 2166, 2183, 2203, 2229, 2288, 3701, 4570, 4665, 5142], 'recently': [18, 214, 4571], 'shown': [19, 215, 861, 946, 3047, 3491, 3627, 3781, 3974], 'to': [20, 28, 74, 102, 216, 224, 270, 298, 454, 504, 839, 911, 947, 1072, 1136, 1379, 1480, 1484, 1487, 1516, 1530, 1607, 1614, 2142, 2195, 2205, 2231, 2242, 2268, 2279, 2293, 2345, 2349, 2540, 2544, 2673, 2994, 3190, 3222, 3414, 3592, 3608, 3670, 3990, 4173, 4212, 4838, 4867, 4958, 4963, 5107, 5195, 5254, 5333, 5405, 5417], 'be': [21, 217, 455, 820, 948, 1162, 1226, 2538, 3013, 3220, 4259, 4754, 4939, 4959, 5108, 5196, 5415], 'predominantly': [22, 218], 'expressed': [23, 219, 456, 490, 4560], 'in': [24, 33, 66, 69, 90, 220, 229, 262, 265, 286, 421, 425, 436, 457, 492, 509, 535, 546, 552, 575, 663, 669, 701, 716, 760, 785, 797, 870, 879, 895, 923, 1112, 1143, 1206, 1212, 1273, 1296, 1313, 1337, 1357, 1362, 1454, 1505, 1567, 1583, 2250, 2260, 2361, 2402, 2415, 2542, 2596, 2621, 2639, 2648, 2675, 2696, 2773, 2806, 2830, 2872, 2913, 2929, 2968, 2977, 2999, 3010, 3030, 3048, 3078, 3119, 3129, 3175, 3207, 3216, 3380, 3397, 3408, 3455, 3492, 3511, 3537, 3551, 3628, 3644, 3650, 3975, 4026, 4049, 4072, 4144, 4196, 4246, 4273, 4303, 4368, 4383, 4471, 4529, 4562, 4584, 4595, 4625, 4641, 4749, 4775, 4785, 4814, 4845, 4979, 5129, 5134, 5139, 5170, 5176, 5190, 5228, 5245, 5288, 5391, 5397, 5424, 5463], 'liver': [26, 52, 222, 248, 459, 881, 1025, 1139, 2650, 2668, 2943, 2979, 2989, 3259, 3830, 4290, 4531, 4841, 4917, 5062, 5329, 5476], 'and': [27, 87, 184, 223, 283, 381, 432, 498, 599, 606, 677, 774, 818, 825, 882, 941, 987, 1013, 1051, 1138, 1211, 1259, 1310, 1319, 1334, 1401, 1428, 1439, 1450, 1458, 1471, 1598, 1620, 1639, 1660, 1725, 1749, 1807, 1854, 1871, 1924, 1972, 1990, 2000, 2015, 2050, 2071, 2089, 2112, 2130, 2137, 2191, 2235, 2284, 2335, 2366, 2378, 2382, 2397, 2419, 2479, 2500, 2524, 2615, 2745, 2767, 2937, 3044, 3051, 3271, 3336, 3352, 3430, 3436, 3450, 3479, 3494, 3544, 3548, 3585, 3606, 3647, 3692, 3776, 3799, 3875, 3882, 3901, 4002, 4076, 4103, 4112, 4147, 4199, 4235, 4250, 4264, 4317, 4321, 4362, 4371, 4497, 4525, 4601, 4650, 4752, 4783, 4840, 4886, 4988, 5024, 5050, 5088, 5175, 5439, 5447, 5453, 5455, 5458], 'play': [29, 225, 418, 505, 867, 920, 2827, 3377, 5241], 'an': [30, 226, 506, 742, 1314, 1578, 1794, 2207, 2582, 3524, 3662, 4114, 4123, 4489, 4776, 4942, 5111, 5242, 5403, 5411, 5420], 'important': [31, 227, 419, 507, 743, 868, 921, 5243], 'role': [32, 228, 508, 713, 792, 890, 1270, 2811, 2829, 3073, 3170, 3379, 4638, 4746, 5187, 5244], 'regulating': [34, 230, 924, 1274, 2831], 'lipid': [35, 194, 231, 391, 513, 533, 573, 699, 717, 755, 761, 1275, 4027, 4047, 4582, 4623, 4642, 4735, 4750, 5206, 5226], 'metabolism.': [36, 195, 232, 392, 756, 927, 1276], 'In': [37, 233, 909, 3154, 3656, 3676, 4018, 4210, 4961], 'this': [38, 234, 2115, 3538, 3978, 4480, 5117], 'study,': [39, 235], 'we': [40, 236, 1230, 1236, 3020, 3231, 3327, 3388, 3570, 3955, 4056, 4720], 'show': [41, 176, 237, 373], 'that': [42, 133, 177, 238, 329, 374, 753, 846, 862, 875, 917, 1063, 1238, 1241, 1343, 2575, 2682, 3201, 3309, 3345, 3664, 3766, 3782, 4009, 4065, 4094, 4125, 4154, 4182, 4204, 4255, 4365, 4469, 4573, 4667, 4770, 5124, 5238, 5256], 'Angptl3': [44, 67, 88, 107, 118, 145, 178, 240, 263, 284, 303, 314, 341, 375, 531, 544, 571, 662, 697, 715, 739, 1224, 1242, 1253, 1522, 1622, 1662, 2049, 2068, 2146, 2163, 2216, 2252, 2535, 2647, 2669, 2835, 2951, 2975, 2990, 3009, 3028, 3134, 3205, 3229, 3234, 3305, 3338, 3385, 3568, 3577, 3708, 3740, 3758, 3770, 3921, 3951, 3970, 3988, 4025, 4045, 4068, 4099, 4110, 4136, 4140, 4171, 4183, 4201, 4220, 4252, 4373, 4382, 4505, 4576, 4590, 4621, 4640, 4668, 4730, 4748, 5189, 5203, 5224, 5239, 5350, 5412], 'gene': [45, 241, 981, 1022, 1798, 2739, 3797, 3869, 3952, 4111, 4188, 4275, 4874, 4884, 5018, 5059], 'is': [46, 179, 242, 376, 741, 1200, 1243, 2671, 2992, 3316, 3490, 3498, 3520, 3604, 3771, 3943, 4014, 4070, 4142, 4148, 4184, 4194, 4207, 4294, 4343, 4577, 4658, 4870, 5119, 5164, 5236, 5252], 'a': [47, 58, 63, 78, 103, 186, 243, 254, 259, 274, 299, 383, 396, 458, 486, 593, 600, 648, 666, 712, 728, 746, 848, 1174, 1228, 1265, 1269, 1279, 1506, 1572, 1641, 1872, 1973, 1986, 1997, 2072, 2090, 2120, 2154, 2294, 2327, 2347, 2445, 2556, 2578, 2640, 2655, 2686, 2828, 2841, 2883, 2947, 2969, 3130, 3267, 3353, 3378, 3575, 3601, 3645, 3678, 3697, 3702, 3724, 3924, 3957, 4130, 4185, 4344, 4378, 4421, 4464, 4486, 4493, 4498, 4513, 4556, 4592, 4636, 4655, 4726, 4733, 4745, 4862, 4871, 4947, 4974], 'direct': [48, 244, 851, 3016, 3223, 4186, 4675, 4872], 'target': [49, 245, 835, 1589, 2708, 4187, 4873], 'X': [53, 153, 249, 349, 769, 815, 1026, 1140, 3831, 3833, 4842, 4918, 4920, 5063, 5330, 5477], 'receptor': [54, 250, 412, 781, 1141, 2627, 2701, 2779, 4351, 4843, 5331, 5478], '(LXR).': [55, 251], 'Mice': [56, 252, 2426], 'fed': [57, 253, 2428, 2551, 2577, 2654], 'high': [59, 255], 'cholesterol': [60, 256, 801, 877, 899, 912, 1258, 2498, 2547, 2591, 2677, 2693, 3082, 3179, 3801, 4780, 4865, 4888], 'diet': [61, 257, 2432, 2559, 2580, 2636, 2658, 2688], 'exhibited': [62, 258], 'significant': [64, 260, 2930, 2948], 'increase': [65, 105, 261, 301, 668, 2949, 2973, 3132, 3649, 4594, 4777, 4943, 4953, 4970, 5112, 5392], 'expression': [68, 264, 740, 833, 1023, 1799, 2533, 2584, 2645, 2670, 2705, 2833, 2991, 3029, 3194, 3798, 4066, 4276, 4380, 4429, 4528, 4885, 4972, 5060], 'liver.': [71, 92, 267, 288, 1844, 4385], 'Oral': [72, 268, 2955], 'administration': [73, 269, 4078, 4588, 5257], 'mice': [75, 271, 554, 584, 664, 1144, 1170, 1210, 2405, 2441, 2476, 2549, 2576, 2622, 2653, 2684, 2774, 2838, 2925, 2958, 3011, 4073, 4846, 5130, 5174], 'T0901317,': [77, 273, 2840, 3062, 3723], 'synthetic': [79, 275, 2842, 3725, 4092], 'LXR-selective': [80, 276, 2843, 3726], 'agonist,': [81, 277, 3680], 'increases': [82, 278, 4098, 5131, 5247, 5426], 'levels': [83, 279, 548, 671, 1074, 1256, 1520, 2802, 2945, 4583, 4597, 4671, 5207, 5395], 'plasma': [85, 281, 550, 673, 1076, 2933, 4581, 4786, 5141, 5205, 5249, 5428], 'lipids': [86, 282, 551], 'mRNA': [89, 285, 1596, 1850, 1863, 2536, 2801, 2944, 2952, 2976, 4069], 'Treatment': [93, 289, 3730], 'HepG2': [95, 139, 291, 335, 1277, 2256, 3031, 3034, 3055, 3217, 3572, 4087, 4145], 'cells': [96, 292, 1327, 1374, 1606, 2257, 2281, 2305, 2371, 2691, 3035, 3056, 3141, 3218, 3573, 3611, 3633, 3719, 3732, 4088, 4146], 'with': [97, 293, 403, 813, 1082, 1145, 1299, 1332, 1348, 1395, 1827, 1856, 2041, 2067, 2109, 2153, 2222, 2263, 2321, 2386, 2422, 2429, 2434, 2447, 2505, 2555, 2561, 2565, 2652, 2685, 2692, 2839, 2882, 2926, 2959, 3041, 3057, 3144, 3302, 3368, 3574, 3617, 3634, 3722, 3733, 3751, 4089, 4744, 4847], 'LXR': [98, 160, 168, 191, 294, 356, 364, 388, 826, 952, 1069, 1083, 1272, 2628, 2702, 2780, 2825, 2998, 3025, 3067, 3150, 3164, 3202, 3226, 3609, 3636, 3775, 3910, 4081, 4097, 4115, 4156, 4175, 4205, 4214, 4773, 4876, 4936, 4951, 4967, 5098, 5259], 'selective': [99, 295, 1146, 4174, 4848], 'agonists': [100, 296, 953, 1084, 1142, 3026, 4844, 4937, 5099, 5260], 'led': [101, 297], 'dose-dependent': [104, 300, 3131], 'mRNA.': [108, 304, 1523, 3135], 'Analysis': [109, 305, 2941, 3918], 'DNA': [112, 308, 1715, 2060, 2334, 2350, 4284], 'sequence': [113, 309, 1716, 1741, 1744, 3272, 3307, 3331, 3370, 3483], 'just': [114, 310], '5′': [115, 311, 1817, 1846, 1880, 1922, 1969, 2055, 2081, 2098, 2174, 2212, 3247, 3250, 3295, 3332, 3487, 3496, 3589, 3961], 'transcriptional': [119, 315, 2810, 3240, 3767, 3783, 3947, 4059, 4727], 'start': [120, 316, 3241, 3278, 3314, 3417, 3467, 3506, 3516, 3935], 'site': [121, 162, 317, 358, 2076, 2093, 2169, 2209, 3242, 3279, 3315, 3468, 3963], 'revealed': [122, 318, 711, 1686, 2946, 3344, 4635], 'presence': [124, 320, 3913], 'several': [126, 322, 3786, 4223], 'potential': [127, 323, 4022, 4224, 4240, 4637], 'transcription': [128, 324, 865, 1408, 1763, 1813, 3206, 3277, 3313, 3395, 3416, 3424, 3466, 3505, 3533, 3934, 4229, 4268, 4309, 4340, 4737], 'binding': [130, 161, 326, 357, 838, 1198, 1760, 3392, 3405, 3421, 3445, 3530, 4225, 4241, 4285, 4523, 5162], 'sites,': [131, 327], 'including': [132, 328, 603, 772, 2710, 3426, 3788, 4231, 4983], 'for': [134, 330, 1016, 1165, 1268, 1460, 1473, 1581, 1762, 1797, 1812, 2233, 2380, 2491, 2552, 2812, 2964, 3038, 3289, 3390, 3423, 3447, 3614, 3696, 3946, 4016, 4227, 4377, 4423, 4467, 4579, 4639, 4722, 4756, 4941, 4949, 5053, 5110, 5436, 5450, 5461], 'LXR.': [135, 331, 1247, 4190], 'When': [136, 332, 3689], 'transfected': [137, 333, 3571], 'into': [138, 334, 2004, 2119, 2210, 3959], 'cells,': [140, 336, 1278], 'promoter': [142, 338, 841, 2046, 2164, 3475, 3584, 3603, 3651, 3684, 3709, 3741, 3759, 3827, 3922, 3971, 3989, 4106, 4141, 4172, 4221, 4374, 4914], 'activity': [143, 339, 3652, 3685, 3742, 3760, 4128, 4680], 'significantly': [147, 343, 3191, 3671], 'induced': [148, 344, 2805, 3214, 4149], 'by': [149, 182, 189, 345, 379, 386, 726, 733, 765, 822, 837, 854, 951, 983, 1024, 1046, 1068, 1246, 1383, 1412, 1422, 1442, 1546, 1687, 1767, 1953, 2019, 2029, 2132, 2168, 2290, 2465, 2519, 2741, 2836, 3015, 3243, 3249, 3500, 3523, 3686, 3743, 3761, 3774, 3805, 3828, 3871, 3896, 3909, 3953, 4074, 4077, 4150, 4427, 4653, 4660, 4708, 4731, 4892, 4915, 4932, 5020, 5061, 5083, 5121, 5324, 5378], 'LXR-': [150, 346], 'or': [151, 347, 659, 2317, 2435, 2454, 2473, 2560, 2689, 2703, 3061, 3624, 3640, 3996, 4091, 4157, 4176, 5349], 'retinoid': [152, 348, 814], 'receptor-selective': [154, 350], 'agonists.': [155, 351, 4178], 'Mutation': [156, 352, 542, 4159], 'predicted': [159, 355, 3454, 3536], '(DR4': [163, 359], 'element)': [164, 360], 'completely': [165, 361, 3980, 4164], 'abolished': [166, 362, 3981, 4165], 'agonist-mediated': [169, 365, 4952], 'activation': [170, 366, 2697, 2996, 3948, 4965, 5326], 'promoter.Together,': [173], 'these': [174, 371, 709, 863, 3198, 3398, 4005, 4239, 4633], 'studies': [175, 372, 710, 859, 2680, 3779, 4634], 'transcriptionally': [180, 377, 3772], 'regulated': [181, 378, 764, 1245, 3773, 3804, 4891], 'LXR,': [183, 380, 3428, 3668, 3954, 4732], 'reveals': [185, 382], 'novel': [187, 384, 1266, 4345], 'mechanism': [188, 385, 725, 1267, 4760], 'which': [190, 387, 591, 727, 2589, 3065, 3147, 3160, 3438, 4270, 4654, 5409], 'may': [192, 389, 1070, 1263, 2537, 2694, 3376, 4258, 4375, 4669, 4938, 4968, 5240], 'regulate': [193, 390, 831, 4670], 'promoter.': [369, 3235, 4137], 'Together,': [370, 3197], 'The': [393, 791, 889, 1391, 1655, 1845, 1861, 1879, 1980, 2008, 2181, 2199, 2314, 2634, 3072, 3169, 3263, 3342, 3482, 3514, 4191, 4283, 4358, 5185, 5430], 'angiopoietins': [394, 417], 'secreted': [399], 'factors.': [401], 'Together': [402], 'their': [404], 'respective': [405], 'endothelium-specific': [406], 'surface': [407], 'receptors,': [408, 985, 1049, 2743, 3873, 3899, 5022, 5086], 'such': [409, 1227, 3600, 4509, 5101], 'as': [410, 1342, 1410, 1577, 1601, 2573, 3260, 3280, 3502, 4510], 'tyrosine': [413], 'kinase': [414], 'Tie2,': [415], 'roles': [420, 869, 922], 'angiogenesis': [422], '[as': [423, 783], 'reviewed': [424, 784], 'ref.': [426, 786], '(1Loughna': [427], 'S.': [428, 479, 1098, 1100, 2858, 2860, 2899, 2901, 3105, 3107, 4397, 4442, 4458, 4549, 4800, 4802, 5274, 5276], 'Sato': [429, 4459], 'T.N.': [430, 4460], 'Angiopoietin': [431], 'Tie': [433], 'signaling': [434], 'pathways': [435], 'development.Matrix': [438], 'Biol.': [439, 806, 904, 1028, 1053, 1153, 2815, 3087, 3184, 3835, 3903, 4713, 4855, 4922, 5065, 5090, 5343, 5383], '2001;': [440, 1055, 3905, 4326, 5092], '20:': [441], '319-325Google': [442], 'Scholar)].': [443, 810], 'Angiopoietin-like': [447], '(Angptl3),': [450], 'previously': [452], 'found': [453, 503, 3550, 4572], 'specific': [460, 840, 2069, 2813], 'manner': [461], '(2Conklin': [462, 4532], 'D.': [463, 465, 4448, 4533, 4535, 5434], 'Gilbertson': [464, 4534], 'Taft': [466, 4536], 'D.W.': [467, 4537], 'Maurer': [468, 4538], 'M.F.': [469, 4539], 'Whitmore': [470, 4540], 'T.E.': [471, 4409, 4541], 'Smith': [472, 4542], 'D.L.': [473, 4405, 4543], 'Walker': [474, 4544], 'K.M.': [475, 4545], 'Chen': [476, 1775, 4546], 'L.H.': [477, 4547], 'Wattler': [478, 4548], 'Nehls': [480, 4550], 'M.': [481, 520, 522, 560, 562, 629, 643, 686, 688, 1102, 1670, 1699, 1788, 2862, 2903, 3109, 4034, 4036, 4551, 4610, 4612, 4684, 4686, 4804, 5213, 5215, 5278, 5354, 5356], 'Lewis': [482, 4552], 'K.B.': [483, 4553], 'Identification': [484, 4554], 'mammalian': [487, 4557], 'angiopoietin-related': [488, 4558], 'specifically': [491, 4561], 'liver.Genomics.': [493, 4563], '1999;': [494, 4564], '62:': [495, 4565], '477-482Google': [496, 4566], 'Scholar),': [497, 2921, 3127, 3188, 3840, 3881, 4055, 5234], 'more': [499, 3713], 'recently,': [500, 4663], 'it': [501, 4569, 4664, 5235], 'regulation': [511, 737, 799, 872, 897, 1017, 1065, 1232, 2541, 3080, 3177, 3382, 3768, 3784, 4060, 4728, 5054], 'metabolism': [514, 534, 574, 700, 762, 2618, 2770, 4028, 4048, 4624, 5227], '(3Koishi': [515, 555, 681, 4029, 4605, 5208], 'R.': [516, 556, 682, 1005, 1778, 4030, 4606, 4692, 5042, 5209, 5362], 'Ando': [517, 557, 683, 4031, 4607, 4689, 5210, 5359], 'Y.': [518, 558, 684, 961, 1035, 2719, 3817, 3849, 3885, 4032, 4608, 4690, 4904, 4998, 5072, 5211, 5360], 'Ono': [519, 559, 685, 4033, 4609, 4683, 5212, 5353], 'Shimamura': [521, 561, 687, 4035, 4611, 4685, 5214, 5355], 'Yasumo': [523, 563, 689, 4037, 4613, 5216], 'H.': [524, 528, 530, 564, 568, 570, 690, 694, 696, 1088, 1181, 1780, 2848, 2889, 3095, 4038, 4042, 4044, 4614, 4618, 4620, 4698, 4702, 4790, 5145, 5217, 5221, 5223, 5264, 5368, 5372], 'Fujiwara': [525, 565, 691, 4039, 4615, 5218], 'T.': [526, 566, 613, 692, 1786, 4040, 4616, 4682, 4696, 4700, 5219, 5304, 5306, 5352, 5366, 5370], 'Horikoshi': [527, 567, 693, 4041, 4617, 5220], 'Furukawa': [529, 569, 695, 4043, 4619, 4701, 5222, 5371], 'regulates': [532, 572, 698, 4046, 4622, 5225], 'mice.Nat.': [536, 576, 702, 4050, 4626, 5229], 'Genet.': [537, 577, 703, 4051, 4627, 5230], '2002;': [538, 578, 704, 1030, 1155, 4052, 4628, 4715, 4857, 5067, 5231, 5345, 5385], '30:': [539, 579, 705, 4053, 4629, 5232], '151-157Google': [540, 580, 706, 4054, 4630, 5233], 'Scholar).': [541, 581, 657, 707, 908, 1058, 1158, 1220, 1654, 1758, 2633, 2820, 2880, 4357, 4477, 4567, 4631, 4718, 4860, 4927, 5095, 5184], 'results': [545, 3137, 3199, 3764, 4006, 4774], 'low': [547, 4580, 5339], 'KK/San': [553, 4585, 5407], 'These': [582, 3374, 3763], 'hypolipidemic': [583], 'derived': [586], 'from': [587, 619, 1286, 1371, 1465, 1841, 2079, 2096, 2393, 2408, 2508, 3256, 3299, 4506], 'KK': [588], 'obese': [589], 'mice,': [590, 4586], 'display': [592], 'multigenic': [594], 'syndrome': [595], 'moderate': [597], 'obesity': [598], 'diabetic': [601, 631, 649], 'phenotype': [602], 'hyperinsulin-emia,': [604], 'hyperglycemia,': [605], 'hyperlipidemia': [607], '(4Kondo': [608], 'K.': [609, 611, 615, 645, 1039, 3791, 3889, 4688, 4694, 4878, 5076, 5358, 5364], 'Nozawa': [610], 'Tomita': [612], 'Ezaki': [614], 'Inbred': [616], 'strains': [617], 'resulted': [618, 2638, 2928, 2967, 3128, 3643], 'Japanese': [620], 'mice.Bull.': [621], 'Exp.': [622], 'Anim.': [623], '1957;': [624], '6:': [625], '107-112Google': [626], 'Scholar,': [627, 641, 993, 1033, 1120, 1695, 2751, 2785, 3091, 3813, 4299, 4329, 4434, 4822, 4900, 5030, 5070, 5296], '5Nakamura': [628], 'A': [630, 1929, 2034, 2150, 2219, 2809, 3526], 'strain': [632, 651], 'mouse.Proc.': [635], 'Jpn.': [636], 'Acad.': [637], '1962;': [638], '38:': [639], '348-352Google': [640], '6Nakamura': [642], 'Yamada': [644], 'Studies': [646], 'on': [647, 1254, 1985, 3018, 3027, 3227, 5100, 5204], '(KK)': [650], 'mice.Diabetologia.': [653], '1967;': [654], '3:': [655], '212-221Google': [656], 'Administration': [658, 4767, 5401], 'overexpression': [660, 5126], 'elicited': [665, 4591], 'rapid': [667, 4593], 'circulating': [670, 1178, 1255, 4596, 4955, 5114], 'cholesterol,': [674, 2496, 2935, 4599], 'triglycerides': [675, 2938, 5487], '(TG),': [676], 'non-esterified': [678], 'fatty': [679, 925, 938, 1019, 4603, 4980, 4985, 5056], 'acids': [680], 'While': [708], 'metabolism,': [718, 913, 4643, 4751, 4982], 'they': [719, 4644], 'did': [720, 4645], 'not': [721, 3152, 3162, 3470, 3666, 4646], 'address': [722, 4647], 'molecular': [724, 4651], 'hyperlipidemic': [729, 4656, 4763, 5192], 'response': [730, 842, 1135, 2543, 3984, 4116, 4168, 4215, 4657, 4837, 5193], 'mediated': [732, 3014, 4659], 'Angptl3.': [734, 1234, 3196, 3291, 3481, 4062, 4661, 4766], 'Understanding': [735], 'step': [744], 'toward': [745], 'better': [747], 'comprehension': [748], 'physiological': [751], 'network': [752], 'comprises': [754], 'Many': [757], 'genes': [758, 836, 874, 2709, 3787, 4306, 4977, 5103], 'involved': [759, 4272, 4978], 'nuclear': [766, 780, 795, 893, 2625, 2700, 2777, 3076, 3173, 4291, 4314], 'receptors.': [767], 'Liver': [768, 2487], 'receptors': [770, 796, 816, 894, 3077, 3174], '(LXRs),': [771], 'LXRα': [773], 'LXRβ,': [775], 'superfamily': [782], '(7Repa': [787, 885, 3068, 3165], 'J.J.': [788, 886, 955, 1037, 1092, 2713, 2789, 2852, 2893, 3069, 3099, 3166, 3843, 3887, 4794, 4992, 5074, 5268], 'Mangelsdorf': [789, 887, 972, 1040, 1103, 2612, 2730, 2764, 2794, 2863, 2904, 3070, 3110, 3167, 3860, 3890, 4805, 5009, 5077, 5279], 'D.J.': [790, 888, 973, 1041, 1104, 1636, 2601, 2613, 2731, 2753, 2765, 2795, 2864, 2905, 3071, 3111, 3168, 3861, 3891, 4806, 5010, 5078, 5280], 'orphan': [794, 892, 3075, 3172], 'homeostasis.Annu.': [802, 900, 3083, 3180], 'Rev.': [803, 901, 3084, 3181], 'Cell': [804, 902, 3085, 3182], 'Dev.': [805, 903, 989, 1116, 2747, 2876, 2917, 3086, 3123, 3183, 3877, 4353, 4818, 5026, 5292], '2000;': [807, 905, 990, 1117, 1692, 1721, 1803, 2748, 2817, 2877, 2918, 3088, 3124, 3185, 3810, 3837, 3878, 4819, 4897, 4924, 5027, 5293], '16:': [808, 906, 1722, 3089, 3186], '459-481Google': [809, 907, 3090, 3187], 'LXRs': [811, 830, 918, 1111, 2871, 2912, 3118, 4813, 5287], 'heterodimerize': [812], '(RXRs)': [817], 'can': [819, 3203], 'activated': [821, 950], 'both': [823, 3063, 4247, 5389], 'RXR': [824, 3679, 4177], 'ligands.': [827], 'Upon': [828], 'activation,': [829, 3610], 'elements': [843], '(termed': [844], 'LXREs)': [845], 'contain': [847], 'hexameric': [849], 'nucleotide': [850], 'repeat': [852], 'separated': [853], 'four': [855], 'bases': [856], '(DR4).': [857], 'Recent': [858, 2679], 'have': [860, 3780], 'ligand-activated': [864], 'factors': [866, 1764, 1814, 3396, 3534, 4230, 4310], 'govern': [876], 'homeostasis': [878], 'peripheral': [883], 'tissues': [884], 'addition': [910, 3156, 3658, 4211, 4962], 'accumulating': [914], 'evidence': [915], 'suggests': [916, 3308], 'also': [919, 2637, 3148, 3453, 3521, 4208, 4244, 4969], 'acid': [926, 939, 1020, 2598, 2617, 2769, 3622, 4604, 4981, 4986, 5057, 5482], 'For': [928], 'example,': [929], 'expressions': [931], 'sterol': [933, 977, 1149, 1195, 2735, 3865, 4851, 5014, 5159, 5483], 'regulatory': [934, 978, 1150, 1196, 2736, 3866, 4852, 5015, 5160, 5484], 'element-binding': [935, 979, 1151, 2737, 3867, 4853, 5016, 5485], 'protein-1c': [936, 980, 2738, 3868, 5017], '(SREBP-1c),': [937], 'synthase,': [940, 4987], 'lipoprotein': [942, 1044, 3894, 4678, 4711, 4989, 5081, 5341, 5381], 'lipase': [943, 1045, 3895, 4679, 4990, 5082], 'were': [944, 1294, 1328, 1360, 1431, 1440, 1463, 1527, 1591, 1612, 1663, 1765, 1851, 2027, 2238, 2258, 2282, 2306, 2319, 2364, 2372, 2400, 2406, 2413, 2420, 2427, 2442, 2477, 2482, 2489, 2503, 2517, 2550, 3036, 3138, 3142, 3452, 3612, 3694, 3716, 3720, 4243], 'all': [945], 'strongly': [949, 4007], '(8Repa': [954, 2712, 3842, 4991], 'Liang': [956, 2714, 3844, 4993], 'G.': [957, 1122, 2715, 3845, 4824, 4994], 'Ou': [958, 2716, 3846, 4995], 'J.': [959, 1124, 1630, 2717, 3847, 4411, 4450, 4826, 4996], 'Bashmakov': [960, 2718, 3848, 4997], 'Lobaccaro': [962, 2608, 2720, 2760, 2790, 3850, 4999], 'J.M.': [963, 2609, 2721, 2761, 2791, 3851, 5000], 'Shimomura': [964, 1184, 2722, 3852, 5001, 5148], 'I.': [965, 1185, 1668, 1711, 1782, 1790, 2723, 3853, 5002, 5149], 'Shan': [966, 1107, 2724, 2867, 2908, 3114, 3854, 4809, 5003, 5283], 'B.': [967, 1108, 2725, 2868, 2909, 3115, 3855, 4810, 5004, 5284], 'Brown': [968, 1131, 1188, 2726, 3856, 4833, 5005, 5152], 'M.S.': [969, 1132, 1189, 2727, 3857, 4834, 5006, 5153], 'Goldstein': [970, 1129, 1190, 2728, 3858, 4831, 5007, 5154], 'J.L.': [971, 1007, 1130, 1191, 2729, 3859, 4832, 5008, 5044, 5155], 'Regulation': [974, 1042, 2732, 3862, 3892, 5011, 5079], 'mouse': [976, 1621, 1661, 1843, 2734, 3258, 3290, 3301, 3335, 3480, 3545, 3864, 4200, 4249, 4370, 5013], '(SREBP-1c)': [982, 2740, 3870, 5019], 'oxysterol': [984, 1048, 2626, 2742, 2778, 3663, 3872, 3898, 5021, 5085], 'LXRalpha': [986, 1050, 2744, 3874, 3900, 5023, 5087], 'LXRbeta.Genes': [988, 2746, 3876, 5025], '14:': [991, 1118, 2749, 2878, 2919, 3125, 3879, 4820, 5028, 5294], '2819-2830Google': [992, 2750, 3880, 5029], '9Joseph': [994, 5031], 'S.B.': [995, 5032], 'Laffitte': [996, 5033], 'B.A.': [997, 2607, 2759, 5034], 'Patel': [998, 5035], 'P.H.': [999, 5036], 'Watson': [1000, 5037], 'M.A.': [1001, 5038], 'Matsukuma': [1002, 5039], 'K.E.': [1003, 5040], 'Walczak': [1004, 5041], 'Collins': [1006, 5043], 'Osborne': [1008, 5045], 'T.F.': [1009, 5046], 'Tontonoz': [1010, 5047], 'P.': [1011, 3815, 4902, 5048, 5443], 'Direct': [1012, 5049], 'indirect': [1014, 5051], 'mechanisms': [1015, 5052], 'synthase': [1021, 5058], 'receptors.J.': [1027, 5064], 'Chem.': [1029, 1054, 1154, 2816, 3836, 3904, 4714, 4856, 4923, 5066, 5091, 5344, 5384], '277:': [1031, 1156, 4475, 4716, 4858, 5068, 5346, 5386], '11019-11025Google': [1032, 5069], '10Zhang': [1034, 5071], 'Repa': [1036, 1091, 2788, 2851, 2892, 3098, 3886, 4793, 5073, 5267], 'Gauthier': [1038, 3888, 5075], 'LXRbeta.J.': [1052, 3902, 5089], '276:': [1056, 3906, 5093], '43018-43024Google': [1057, 3907, 5094], 'It': [1059, 5251], 'has': [1060, 5410], 'been': [1061], 'suggested': [1062], 'SREBP-1c': [1067, 1160, 1172, 3841, 5128], 'contribute': [1071], 'increased': [1073, 1548, 2583, 2704, 3682, 3738, 3756], 'TG': [1077, 1168, 1179, 4784, 4956, 5132, 5137, 5394], 'when': [1078, 3140, 3718], 'animals': [1079], 'treated': [1081, 1394, 1605, 3143, 3613, 3721], '(11Schultz': [1085, 2845, 2886, 4787, 5261], 'J.R.': [1086, 1701, 2846, 2887, 3093, 4788, 5262], 'Tu': [1087, 2847, 2888, 3094, 4789, 5263], 'Luk': [1089, 2849, 2890, 3096, 4791, 5265], 'A.': [1090, 1703, 2787, 2793, 2850, 2891, 3097, 4403, 4792, 5266, 5298], 'Medina': [1093, 2853, 2894, 3100, 4795, 5269], 'J.C.': [1094, 2854, 2895, 3101, 4796, 5270], 'Li': [1095, 2855, 2896, 3102, 4797, 5271], 'L.': [1096, 1674, 2856, 2897, 3103, 4798, 5272], 'Schwendner': [1097, 2857, 2898, 3104, 4799, 5273], 'Wang': [1099, 2859, 2900, 3106, 3818, 4801, 4905, 5275], 'Thoolen': [1101, 2861, 2902, 3108, 4803, 5277], 'Lustig': [1105, 2865, 2906, 3112, 4807, 5281], 'K.D.': [1106, 2866, 2907, 3113, 4808, 5282], 'Role': [1109, 2869, 2910, 3116, 4811, 5285], 'control': [1113, 1580, 2342, 2873, 2914, 3120, 4815, 5289], 'lipogenesis.Genes': [1115, 2875, 2916, 3122, 4817, 5291], '2831-2838Google': [1119, 2879, 2920, 3126, 4821, 5295], '12Liang': [1121, 4823], 'Yang': [1123, 4825], 'Horton': [1125, 1182, 4827, 5146], 'J.D.': [1126, 1183, 1728, 4828, 5147], 'Hammer': [1127, 1186, 2610, 2762, 4829, 5150], 'R.E.': [1128, 1187, 2611, 2763, 4830, 5151], 'Diminished': [1133, 4835], 'hepatic': [1134, 4836], 'fasting/refeeding': [1137, 4839], 'deficiency': [1147, 4849], 'protein-1c.J.': [1152, 4854], '9520-9528Google': [1157, 4859], 'However,': [1159, 4946, 5116], 'cannot': [1161], 'solely': [1163], 'responsible': [1164, 4578, 4940, 5109], 'elevated': [1167], 'because': [1169], 'overexpressing': [1171], 'had': [1173, 2581], 'reduced': [1175, 5143], 'level': [1176, 5133, 5138], '(13Shimano': [1180, 5144], 'Isoform': [1192, 5156], '1c': [1193, 5157], 'element': [1197, 2159, 3927, 3942, 3967, 4013, 4163, 4193, 5161], 'less': [1201, 5165], 'active': [1202, 4143, 5166], 'than': [1203, 5167], 'isoform': [1204, 5168], '1a': [1205, 5169], 'livers': [1207, 5171], 'transgenic': [1209, 5173], 'cultured': [1213, 1326, 1373, 5177], 'cells.J.': [1214, 5178], 'Clin.': [1215, 5179], 'Invest.': [1216, 5180], '1997;': [1217, 1651, 4474, 5181], '99:': [1218, 5182], '846-854Google': [1219, 5183], 'To': [1221, 2530, 3001, 3209, 3562, 3597, 3937], 'determine': [1222, 1517, 2531, 3002, 3210], 'if': [1223, 2532, 2824, 3003, 3211, 3599, 3939], 'might': [1225], 'factor,': [1229], 'studied': [1231, 3021, 3232, 4057], 'Here': [1235, 4719], 'report': [1237, 2885, 4721], 'discovery': [1240], 'indeed': [1244, 3944], 'Given': [1248, 5198], 'profound': [1250, 3714, 5200], 'effect': [1251, 5201], 'TG,': [1260, 4600], 'our': [1261], 'findings': [1262, 4740], 'offer': [1264], 'human': [1280, 1619, 1659, 2048, 2058, 2145, 2162, 3304, 3312, 3337, 3435, 3478, 3543, 3576, 3987, 4109, 4135, 4198, 4251, 4305, 4372], 'hepatocellular': [1281], 'carcinoma': [1282], 'cell': [1283], 'line': [1284], 'obtained': [1285], 'American': [1288], 'Type': [1289], 'Culture': [1290], 'Collection': [1291], '(Rockville,': [1292], 'MD),': [1293], 'maintained': [1295, 2414], 'MEM': [1297], 'medium': [1298, 1340, 1346, 2292, 2363], '10%': [1300], 'heat': [1301], 'inactivated': [1302], 'fetal': [1303, 5473], 'calf': [1304, 5474], 'serum': [1305, 5475], '(FCS),': [1306], 'non-essential': [1307], 'amino': [1308], 'acids,': [1309], 'sodium': [1311], 'pyruvate': [1312], 'atmosphere': [1315], 'containing': [1316], '5%': [1317], 'CO2': [1318], '95%': [1320], 'air': [1321], 'at': [1322, 2326, 2528], '37°C.': [1323], 'Before': [1324], 'assay,': [1325], 'trypsinized,': [1329], 'washed': [1330], 'once': [1331, 2444], 'PBS,': [1333], 'then': [1335, 1865, 1886, 1901, 1913, 1948], 'resuspended': [1336], 'assay': [1339, 1365, 2291, 2362, 2506, 4124], '(same': [1341], 'complete': [1345, 2286], 'but': [1347, 3712], 'only': [1349, 3552], '0.5%': [1350], 'FCS).': [1352], 'All': [1353, 2024, 2395, 2515], 'test': [1354, 2358, 3598, 3938, 5418], 'compounds': [1355, 2359], 'used': [1356, 1515, 2230, 5416], 'experiments': [1359], 'diluted': [1361], 'same': [1364, 1569, 2563], 'medium.': [1366], 'Total': [1367], 'RNA': [1368, 1392, 1584, 1839, 1859, 2492, 3255], 'extracted': [1370], 'using': [1375, 1405, 1433, 1571, 1594, 1665, 1834, 1868, 1917, 1957, 1996, 2012, 2185, 2374, 3253], 'TRIZOL': [1376], 'reagent': [1377, 2266], 'according': [1378, 1529, 2194, 2267], 'protocol': [1381], 'provided': [1382, 2028, 2421], 'manufacturer': [1385, 1414], '(Life': [1386, 2224], 'Technologies,': [1387, 2225], 'Grand': [1388], 'Island,': [1389], 'NY).': [1390, 2411], 'DNase': [1396], '(Ambion,': [1397], 'Inc.,': [1398, 2127, 2226], 'Austin,': [1399], 'TX)': [1400], 'reverse': [1403, 1407, 1866, 2102], 'transcribed': [1404, 1867], 'TaqMan': [1406, 1429, 1511, 1524, 1536], 'reagents': [1409, 2025], 'described': [1411], '(Applied': [1415, 1437, 1534], 'Biosystems,': [1416, 1535], 'Foster': [1417], 'City,': [1418], 'CA)': [1419, 1833, 2064], 'before': [1420], 'analysis': [1421, 1513, 2571, 3273, 4217], 'real-time': [1423], 'quantitative': [1424, 1476, 1510], 'RT-PCR.': [1425], 'Oligonucleotide': [1426], 'primers': [1427, 1451, 1470, 2070], 'probes': [1430, 1449, 1459, 1472], 'designed': [1432, 2204], 'Primer': [1434, 1478, 1482], 'Express': [1435], 'software': [1436], 'Biosystems)': [1438], 'synthesized': [1441], 'Qiagen': [1443], 'Operon': [1444], '(Alameda,': [1445], 'CA).': [1446], 'Sequences': [1447], 'listed': [1453, 2026], 'Table': [1455], '1.': [1456], 'Primers': [1457], '18S': [1461, 1562, 1595], 'rRNA': [1462, 1563], 'purchased': [1464, 2392, 2407], 'Applied': [1466], 'Biosystems.TABLE': [1467], '1Sequences': [1468], 'real': [1474], 'time': [1475, 4725], 'PCRGeneSpeciesForward': [1477], '(5′': [1479, 1483, 1486], '3′)Reverse': [1481], '3′)Probe': [1485], '3′)Angptl3HumanACCATTTATAAC': [1488], 'AGAGGTGAACAT': [1489], 'ACAAGCCTGATATAACA': [1490], 'TCACAGTAGACA': [1491], 'TGAAAATGTATGCCATCAG': [1492], 'ACCCAGCAACTCT': [1493], 'CAAngptl3MouseGATTTGCTATGT': [1494], 'TGGATGATGTCAACTTATGGACAAAA': [1495], 'TCTTTAAGTCCA': [1496], 'TGAATTTTAGCGAATG': [1497], 'GCCTCCTGCAGCTCYP7AMouseCAAAACCTCCAA': [1498], 'TCTGTCATGAGAGCGTTAGATATC': [1499], 'CGGCTTCAAAAGGGATGTATGC': [1500], 'CTTCTGCTACCGA': [1501], 'GTGAT': [1502], 'Open': [1503], 'table': [1504], 'new': [1507, 1642], 'tab': [1508], 'Real-time': [1509], 'PCR': [1512, 1525, 1538, 1824, 1918, 1931, 1963, 1965, 1981, 2570, 3252, 3269], 'relative': [1519], 'reactions': [1526, 1570], 'performed': [1528, 1566, 1613, 1826, 2184, 2259, 2401], "manufacturer's": [1532, 2197, 2270], 'instructions': [1533, 2271], 'Universal': [1537], 'Master': [1539], 'Mix).': [1540], 'Target': [1541], 'cDNA': [1542, 1821, 1884], 'amplification': [1543, 1557, 1819], 'detected': [1545], 'fluorescent': [1549], 'signal': [1550, 4487], 'FAM': [1552], '(reporter': [1553], 'dye)': [1554], 'during': [1555], 'cycles.': [1558], 'Amplification': [1559], 'transcript': [1564], 'different': [1573], 'reporter': [1574, 2037, 2333], 'dye,': [1575], 'VIC,': [1576], 'internal': [1579, 2341], 'variations': [1582], 'amounts.': [1585], 'Levels': [1586], 'mRNAs': [1590], 'subsequently': [1592], 'normalized': [1593], 'levels,': [1597], 'presented': [1600], 'ratio': [1603, 2351], 'untreated': [1608], 'cells.': [1609, 3032], 'BLAST': [1610, 1638], 'searches': [1611], 'identify': [1615], 'genomic': [1616, 1656, 2059, 3306, 3330], 'sequences': [1617, 1657, 1685], 'encoding': [1618, 4307], '(14Altschul': [1623], 'S.F.': [1624], 'Madden': [1625], 'T.L.': [1626], 'Schaffer': [1627], 'A.A.': [1628], 'Zhang': [1629, 1631], 'Z.': [1632], 'Miller': [1633], 'W.': [1634, 2605, 2757], 'Lipman': [1635], 'Gapped': [1637], 'PSI-BLAST:': [1640], 'generation': [1643], 'database': [1646, 1772], 'search': [1647], 'programs.Nucleic': [1648], 'Acids': [1649, 1753, 1801], 'Res.': [1650, 1691, 1754, 1802, 3808, 4895], '25:': [1652], '3389-3402Google': [1653], 'compared': [1664, 2651, 3328], 'mVISTA': [1666], '(15Dubchak': [1667], 'Brudno': [1669, 1698], 'Loots': [1671], 'G.G.': [1672], 'Pachter': [1673, 1708], 'Mayor': [1675], 'C.': [1676, 1697, 4413, 4438, 4446], 'Rubin': [1677, 1704], 'E.M.': [1678, 1705], 'Frazer': [1679, 1706], 'K.A.': [1680, 1707], 'Active': [1681], 'conservation': [1682], 'noncoding': [1684], 'three-way': [1688], 'species': [1689, 3554], 'comparisons.Genome': [1690], '10:': [1693], '1304-1306Google': [1694], '16Mayor': [1696], 'Schwartz': [1700], 'Poliakov': [1702], 'L.S.': [1709], 'Dubchak': [1710], 'VISTA:': [1712], 'visualizing': [1713], 'global': [1714], 'alignments': [1717], 'arbitrary': [1719], 'length.Bioinformatics.': [1720], '1046-1047Google': [1723], 'Scholar)': [1724, 1806, 3908, 5348, 5388], 'ClustalW': [1726], '(17Thompson': [1727], 'Higgins': [1729], 'D.G.': [1730], 'Gibson': [1731], 'T.J.': [1732, 4456], 'CLUSTAL': [1733], 'W:': [1734], 'improving': [1735], 'sensitivity': [1737], 'progressive': [1739], 'multiple': [1740], 'alignment': [1742], 'through': [1743, 2484], 'weighting,': [1745], 'position-specific': [1746], 'gap': [1747], 'penalties': [1748], 'weight': [1750, 1810], 'matrix': [1751], 'choice.Nucleic': [1752], '1994;': [1755], '22:': [1756], '4673-4680Google': [1757], 'Putative': [1759], 'sites': [1761, 2018, 3393, 3406, 3422, 3446, 3507, 3531, 4226, 4242, 4257, 4364], 'identified': [1766, 3274, 3407, 3923, 4011, 4113, 4222], 'searching': [1768], 'against': [1769], 'TRANSFAC': [1771], '(18Wingender': [1773], 'E.': [1774, 4335], 'X.': [1776], 'Hehl': [1777], 'Karas': [1779], 'Liebich': [1781], 'Matys': [1783], 'V.': [1784, 4407], 'Meinhardt': [1785], 'Pruss': [1787], 'Reuter': [1789], 'Schacherer': [1791], 'F.': [1792, 5320], 'TRANSFAC:': [1793], 'integrated': [1795], 'system': [1796, 2188], 'regulation.Nucleic': [1800], '28:': [1804], '316-319Google': [1805], 'positional': [1809], 'matrices': [1811], 'constructed': [1815], 'internally.': [1816], 'Rapid': [1818], 'ends': [1822, 1847], '(RACE)': [1823], 'GeneRacer': [1829, 1858, 1921, 1968], 'kit': [1830], '(Invitrogen,': [1831], 'Carlsbad,': [1832], '3.5': [1835], 'μg': [1836], 'total': [1838, 2328, 2495, 2934, 3254, 4779], 'purified': [1840, 1995], 'C57Bl/6J': [1842, 3257], 'dephosphorylated,': [1852], 'decapped,': [1853], 'ligated': [1855, 1862], 'oligo.': [1860], 'SuperScript': [1869], 'II': [1870, 2074, 2111], 'gene-specific': [1873, 1927, 1975], 'primer': [1874, 1971, 1976, 2086, 2103], '5′-CAGAATCAAATGATGAAAGGTCTGGAT': [1875], '-3′': [1876], '(Qiagen': [1877, 1978], 'Operon).': [1878, 1979], 'end': [1881, 2082, 2099, 3497], 'amplified': [1887], '(hot': [1888, 1935], 'start,': [1889, 1936], '94°C': [1890, 1902, 1937], '30': [1891, 1894, 1903, 1906, 1938, 1941], 's,': [1892, 1895, 1904, 1907, 1939, 1942], '68°C': [1893, 1943, 1949], '70°C': [1896, 1908, 1914], '1': [1897, 1909, 1944, 1958, 3734, 3747, 5469], 'min,': [1898, 1910, 1945], '5': [1899, 2297], 'cycles;': [1900, 1912, 1947], '66°C': [1905], '20': [1911], '10': [1915, 1955, 2455, 2960, 3752], 'min)': [1916, 1956], 'SuperMix,': [1919, 1966], 'primer,': [1923], 'aforementioned': [1926], 'primer.': [1928], 'second': [1930], 'reaction': [1932, 3264], 'run': [1934, 1984], '55°C': [1940], '25': [1946], 'min': [1951], 'followed': [1952], '15°C': [1954], 'ul': [1959], 'original': [1962], 'reaction,': [1964], 'nested': [1970, 1974], '5′-GTCTGGATCCACTCTGGATGCAATT-3′': [1977], 'product': [1982, 3297, 3489], '1%': [1987], 'agarose': [1988], 'gel': [1989], 'band': [1992], 'excised,': [1994], 'SNAP': [1998], 'column,': [1999], 'TOPO': [2001], 'TA': [2002], 'cloned': [2003, 2118, 4102], 'pCR': [2005], '4-TOPO': [2006], 'vector.': [2007], 'plasmid': [2009], 'sequenced': [2011, 2239], 'T3': [2014], 'T7': [2016], 'priming': [2017], 'ACGT,': [2020], 'Inc.': [2021], '(Northbrook,': [2022], 'IL).': [2023], 'Invitrogen,': [2030], 'unless': [2031], 'otherwise': [2032], 'stated.': [2033], 'firefly': [2035, 2381], 'luciferase': [2036, 2384, 3594], 'construct': [2038, 2152, 3579], 'generated': [2040, 3298], '953': [2042], 'bp': [2043, 2052, 3282, 3319, 3348, 3355, 3411, 3459, 3581, 3587, 3930], '49': [2051, 3318, 3586], 'UTR.': [2056], 'Briefly,': [2057], '(CLONTECH,': [2061], 'Palo': [2062], 'Alto,': [2063], 'PCR-amplified': [2066], 'Bgl': [2073, 2110], 'restriction': [2075, 2092, 2108, 2220], '8': [2077, 2094], 'nucleotides': [2078, 2095], 'forward': [2085], '(Dexter-10F:': [2087], '5′-GATCGATCAGATCTGGGAGGCCAAGGTAAAAGAA-3′)': [2088], 'HindIII': [2091], '(Dexter-10R:': [2104], '5′-GATCGATCAAGCTTTTTTATC': [2105], 'TTGATTTTCAATTTCAAG-3′).': [2106], 'After': [2107, 2468], 'Hind': [2113], 'III,': [2114], 'fragment': [2116], 'similarly': [2121], 'digested': [2122], 'pGL3': [2123], 'Basic': [2124], 'vector': [2125, 2139], '(Promega,': [2126, 2189], 'Madison,': [2128], 'WI)': [2129], 'confirmed': [2131], 'sequencing': [2133], 'entire': [2135], 'insert': [2136], 'nearby': [2138], '(ACGT,': [2140, 2240], 'Inc.)': [2141, 2190, 2241, 2325], 'create': [2143], 'promoter-Luciferase': [2147], '(hpAngptl3-Luc)': [2148], 'construct.': [2149], 'similar': [2151], 'mutation': [2155, 3958, 3979, 4574], 'DR4': [2158, 2179, 2217, 3916, 3926, 3941, 3966, 4012, 4119, 4162, 4192], '(hpAngptl3/DR4Mut-Luc)': [2165], 'created': [2167], 'directed': [2170], 'mutagenesis': [2171, 2182], 'half-site': [2175, 2213], 'hpAngptl3': [2178], 'element.': [2180, 2218, 3917, 4120], 'GeneEditor': [2187], 'mutagenic': [2192, 2200], 'oligonucleotide': [2193], 'instructions.': [2198], 'oligonucleotide,': [2201], '5′-TCTAACTCAATGTGGAAGAGGGCCCCATTCGTGCAAGTTAACAC-3′,': [2202], 'introduce': [2206], 'ApaI': [2208, 2223], 'digestion': [2221], 'Bethesda,': [2227], 'MD)': [2228], 'screen': [2232], 'mutants': [2234], 'clones': [2237], 'confirm': [2243], 'lack': [2245, 4511, 4520], 'any': [2247], 'additional': [2248], 'mutations': [2249], 'sequence.': [2253], 'Transfections': [2254], '96-well': [2261, 2312], 'plates': [2262], 'FuGENE': [2264, 2348], '6': [2265], '(Roche': [2272], 'Diagnostics': [2273], 'Corp.,': [2274], 'Indianapolis,': [2275], 'IN).': [2276], 'Immediately': [2277], 'prior': [2278], 'transfection,': [2280, 2357], 'trypsinized': [2283], 'media': [2287], 'replaced': [2289], 'concentration': [2295], '×': [2298], '105': [2299], 'cells/ml.': [2300], 'hundred': [2302], 'microliters': [2303], 'added': [2307], 'per': [2308, 2343], 'well': [2309, 2344], 'plates.': [2313], 'constructs,': [2315], 'hpAngptl3-Luc': [2316], 'hpAngptl3/DR4mut-Luc,': [2318], 'co-transfected': [2320], 'phRL-null': [2322], '(Renilla,': [2323], 'Promega,': [2324], '37.5': [2330], 'ng': [2331, 2337], '12.5': [2336], 'Renilla': [2340, 2383], 'maintain': [2346], '3:1.': [2353], 'Six': [2354], 'hours': [2355], 'after': [2356], 'suspended': [2360], 'added,': [2365], '42': [2367, 3615], 'h': [2368, 3040, 3616], 'later': [2369], 'harvested': [2373], 'Passive': [2375], 'Lysis': [2376], 'Buffer': [2377], 'assayed': [2379], 'activities': [2385], 'Dual-Luciferase': [2388], 'Reporter': [2389], 'Assay': [2390], 'System': [2391], 'Promega.': [2394], 'transfections': [2396], 'subsequent': [2398], 'steps': [2399], 'triplicate.': [2403], 'C57BL/6J': [2404], 'Taconic': [2409], '(Germantown,': [2410], 'Animals': [2412], 'normal': [2416, 2430, 2557, 2656], 'light': [2417, 4019], 'cycle,': [2418], 'water': [2423], 'ad': [2424], 'libitum.': [2425], 'chow': [2431, 2558, 2657], 'either': [2433, 2448], 'without': [2436], '4%': [2437, 2566], 'cholesterol.': [2439, 2568], 'Compound-treated': [2440], 'dosed': [2443], 'day': [2446], 'vehicle': [2449], '(0.5%': [2450], 'methylcellulose': [2452], 'solution)': [2453], 'mpk': [2456, 2961], '(mg': [2457], 'compound/kg': [2458], 'animal': [2460], 'body': [2461], 'weight/day)': [2462], 'T0901317': [2464, 2927, 2963, 3005, 3737, 3750, 5438], 'oral': [2466, 2922], 'gavage.': [2467], '7': [2469, 2553, 2965], 'days': [2470, 2554, 2966], 'feeding': [2472, 2683], 'gavage': [2474], 'dosing,': [2475], 'euthanized': [2478], 'blood': [2480], 'samples': [2481, 2488], 'taken': [2483], 'cardiac': [2485], 'puncture.': [2486], 'collected': [2490], 'analyses.': [2493], 'Plasma': [2494], 'HDL': [2497], '(HDL-C),': [2499], 'triglyceride': [2501, 4706, 5376], 'concentrations': [2502], 'determined': [2504], 'kits': [2507], 'Sigma': [2509], 'Chemical': [2510], 'Co.': [2511], '(St.': [2512], 'Louis,': [2513], 'MO).': [2514], 'procedures': [2516], 'approved': [2518], 'Institutional': [2521], 'Animal': [2522], 'Care': [2523], 'Research': [2525], 'Advisory': [2526], 'Committee': [2527], 'Merck.': [2529], 'subject': [2539], 'perturbations': [2545], 'homeostasis,': [2548], 'supplemented': [2564], 'Quantitative': [2569], 'showed,': [2572], 'expected,': [2574], 'high-cholesterol': [2579, 2635, 2687], 'CYP7A': [2586, 2711], '(Fig.': [2587, 2665, 2939, 2953, 2986, 3372, 3728], '1),': [2588], 'encodes': [2590], '7α-hydroxylase,': [2592], 'rate-limiting': [2594], 'enzyme': [2595], 'bile': [2597, 2616, 2768], 'synthesis': [2599], '(19Peet': [2600], 'Turley': [2602, 2754], 'S.D.': [2603, 2755], 'Ma': [2604, 2756], 'Janowski': [2606, 2758], 'Cholesterol': [2614, 2766], 'impaired': [2620, 2772], 'lacking': [2623, 2775], 'alpha.Cell.': [2629, 2781], '1998;': [2630, 2782], '93:': [2631, 2783], '693-704Google': [2632, 2784], '3.4': [2641], '±': [2642, 2971], '0.3-fold': [2643], 'higher': [2644], '(P': [2659, 2980], '<': [2660, 2981], '0.01,': [2661, 2982], 'n': [2662, 2983], '=': [2663, 2984], '5)': [2664, 2985], '1).': [2666], 'Thus,': [2667, 2988, 4928], 'responsive': [2672, 2993, 3607], 'alterations': [2674], 'dietary': [2676], 'intake.': [2678], 'reported': [2681, 4666], 'loading': [2690], 'result': [2695, 5390], 'its': [2707, 3495], '19Peet': [2752], '20Venkateswaran': [2786], 'Bronson': [2792], 'Edwards': [2796], 'P.A.': [2797], 'Human': [2798], 'white/murine': [2799], 'ABC8': [2800], 'highly': [2804, 3366], 'lipid-loaded': [2807], 'macrophages.': [2808], 'oxysterols.J.': [2814], '275:': [2818, 3838, 4925], '14700-14707Google': [2819], 'We': [2821, 3236, 4063, 4101, 4121], 'thus': [2822, 3387, 4742, 5105], 'asked': [2823], 'could': [2826, 3012, 3219, 5414], 'treating': [2837], 'agonist': [2844, 3727, 4082], 'Consistent': [2881], 'previous': [2884], 'treatment': [2923, 2956, 3053, 3631, 4085, 4151, 4934], 'elevations': [2931], 'HDL-C,': [2936], '2A).': [2940], '2B).': [2954, 2987], '5.0': [2970], '1.1-fold': [2972], 'vivo.': [3000], 'treatment-induced': [3006], 'changes': [3007], 'effects': [3017, 3215], 'hepatocytes,': [3019], 'impact': [3023], 'Cultured': [3033], 'incubated': [3037], '∼16': [3039], 'various': [3042, 3618], 'oxy-sterols': [3043], 'T0901317.': [3045, 3625, 4083], 'As': [3046, 3626, 3973], 'Fig.': [3049, 3629, 3976], '3A': [3050], '3B,': [3052], '22(R)-hydroxycholesterol': [3058], '(OH': [3059], 'Ch)': [3060], 'activate': [3066, 3163, 3204, 3667, 4096, 4155, 4772], '11Schultz': [3092], 'Similar': [3136, 3711], 'observed': [3139, 3717], '25-OH': [3145, 3641, 3993], 'Ch,': [3146, 3159, 3639, 3642, 3661, 3992, 3994], 'activates': [3149], '(data': [3151, 3469], 'shown).': [3153], 'contrast,': [3155, 3657], '22(S)-OH': [3158, 3660], 'does': [3161, 3665], 'failed': [3189, 3669], 'change': [3192], 'suggest': [3200, 3765, 4008], 'hepatocytes.': [3208], 'LXR-agonist': [3213, 5404], 'due': [3221], 'action': [3224], 'gene,': [3230, 3386], 'located': [3237, 3317], 'putative': [3239, 3276, 3311, 3391, 3404, 3420, 3444, 3504, 3529, 3925], 'identifying': [3244], 'full': [3246], 'UTR': [3248, 3590], 'RACE': [3251, 3296, 3488], 'template.': [3262], 'produced': [3265], 'essentially': [3266], 'single': [3268, 3698], 'product,': [3270], '51': [3281], 'upstream': [3283, 3320, 3359, 3463, 3931], 'initiation': [3286, 3323, 3362], 'methionine': [3287, 3324, 3363], 'codon': [3288, 3364, 3517], 'Comparison': [3292], 'codon.': [3325], 'Next': [3326], 'open': [3339], 'reading': [3340], 'frames.': [3341], 'comparison': [3343], '500': [3347], 'region': [3349, 3356, 3412, 3460, 3476], 'adjacent': [3350, 3413], 'to,': [3351], '150': [3354, 3458], '∼2.5': [3357], 'kb': [3358, 3462], 'of,': [3360], 'conserved': [3367, 3399, 3433, 3457, 3541, 4195, 4245, 4367], '>75%': [3369], 'identity': [3371], '4).': [3373], 'regions': [3375], 'searched': [3389], 'sequences.': [3400], 'Figure': [3401, 3559], '5shows': [3402], '400': [3410], 'sites.': [3418], 'Several': [3419, 4502], 'factors,': [3425, 4269], 'HNF-1,': [3427, 4232, 4262], 'NFκB,': [3429, 4234], 'C/EBP,': [3431], 'between': [3434, 3542], 'mouse,': [3437, 5408], 'merit': [3439], 'further': [3440, 4757], 'experimental': [3441], 'verification.': [3442], 'Similarly,': [3443], 'HNF-3,': [3448], 'HNF-4,': [3449, 4233, 4263], 'C/EBP': [3451, 4265, 4293], '2.5': [3461], 'shown).Fig.': [3471], '5Analysis': [3472], 'segment': [3484], 'overlapping': [3485], 'italic,': [3493], 'marked': [3499, 3522], 'arrow': [3501], '(i.e.,': [3508, 3518], 'position': [3509], '+1': [3510], 'sequences).': [3513], 'translational': [3515], 'ATG)': [3519], 'arrow.': [3525], 'number': [3527, 4975], 'region.': [3539], 'Those': [3540], 'boxed,': [3547], 'those': [3549, 4256], 'one': [3553], 'underlined.View': [3556], 'Large': [3557], 'Image': [3558], 'ViewerDownload': [3560], '(PPT)': [3561], 'study': [3563], 'function': [3565], 'promoter,': [3569], 'promoter-luciferase': [3578], '(953': [3580], 'fused': [3591], 'coding': [3595], 'sequence).': [3596], 'truncated': [3602, 4131, 4139], 'functional': [3605, 4320], 'oxysterols,': [3619], '9-cis': [3620, 5480], 'retinoic': [3621, 5481], '(9-RA),': [3623], '6A,': [3630, 3977], 'agonists,': [3637], '22(R)-OH': [3638, 3690, 3991, 4000], '4-': [3646], '3-fold': [3648], 'Angptl3,': [3654], 'respectively.': [3655], 'alter': [3672], 'Angptl3-promoter': [3674], 'activity.': [3675, 3710], 'addition,': [3677], '9-RA,': [3681, 3995], 'about': [3687], '5-fold.': [3688], 'Ch': [3691, 4001], '9-RA': [3693, 3755], 'combined': [3695], 'treatment,': [3699], 'there': [3700], 'synergistic': [3703], '∼15-fold': [3704], 'induction': [3705, 4929], 'inductions': [3715], '6B).': [3729], 'μM': [3735, 3748, 3753], '24-fold.': [3744], 'Cotreatment': [3745], '45-fold.': [3762], 'RXR.': [3777, 4158], 'Earlier': [3778], 'ABCA1': [3789, 4931], '(21Schwartz': [3790, 4877], 'Lawn': [3792, 4879], 'R.M.': [3793, 4880], 'Wade': [3794, 4881], 'D.P.': [3795, 4882], 'ABC1': [3796, 3826, 4883, 4913], 'ApoA-I-mediated': [3800, 4887], 'efflux': [3802, 4866, 4889], 'LXR.Biochem.': [3806, 4893], 'Biophys.': [3807, 4894], 'Commun.': [3809, 4896], '274:': [3811, 4898], '794-802Google': [3812, 4899], '22Costet': [3814, 4901], 'Luo': [3816, 4903], 'N.': [3819, 4454, 4906], 'Tall': [3820, 4907], 'A.R.': [3821, 4908], 'Sterol-dependent': [3822, 4909], 'transactivation': [3823, 4910], 'receptor/retinoid': [3832, 4919], 'receptor.J.': [3834, 4921], '28240-28245Google': [3839, 4926], 'LPL': [3883], '(10Zhang': [3884], 'requires': [3911], '(5′-AGGTTACATTCGTGCA-3′)': [3928], '123': [3929], 'site.': [3936], 'necessary': [3945, 4015], 'introduced': [3956], 'half': [3962], 'within': [3968, 4516], '(5′-GGGCCCCATTCGTGCA-3′).': [3972], 'inducible': [3983, 4167], 'combination': [3998], '9-RA.': [4003], 'Therefore,': [4004], 'LXR-responsiveness.': [4017], 'importance': [4023], 'showed': [4064], 'upregulated': [4071], 'cholesterol-feeding': [4075], 'Furthermore,': [4084], 'natural': [4090, 4465], 'agents': [4093, 4153, 4769], 'selectively': [4095, 4771], 'expression.': [4100], 'analyzed': [4104], 'element,': [4117, 4216], 'developed': [4122], 'measures': [4126], 'version': [4132], 'This': [4138], 'Our': [4179, 4739], 'data': [4180], 'indicate': [4181], 'promoters,': [4202, 4253], 'suggesting': [4203, 4254], 'responsiveness': [4206], 'conserved.': [4209], 'other': [4228, 4507], 'C/EBP.': [4236], 'Some': [4237], 'biologically': [4260], 'relevant.': [4261], 'liver-restricted': [4267], 'live-specific': [4274], '(23Landschulz': [4277], 'W.H.': [4278], 'Johnson': [4279], 'P.F.': [4280, 4401, 4440], 'McKnight': [4281], 'S.L.': [4282], 'domain': [4286], 'rat': [4289], 'bipartite.Science.': [4295], '1989;': [4296], '243:': [4297], '1681-1688Google': [4298], '24Ryffel': [4300], 'G.U.': [4301], 'Mutations': [4302], 'hepatocyte': [4313], '(HNF)1': [4316], 'HNF4': [4318], 'families:': [4319], 'pathological': [4322], 'consequences.J.': [4323], 'Mol.': [4324], 'Endocrinol.': [4325], '27:': [4327], '11-29Google': [4328], '25Sladek': [4330], 'F.M.': [4331], 'Zhong': [4332], 'W.M.': [4333], 'Lai': [4334], 'Darnell': [4336], 'Jr.,': [4337], 'J.E.': [4338], 'Liver-enriched': [4339], 'HNF-4': [4342], 'member': [4346], 'steroid': [4349], 'hormone': [4350], 'superfamily.Genes': [4352], '1990;': [4354], '4:': [4355], '2353-2365Google': [4356], 'identification': [4359], 'HNF-1': [4361], 'c/EBP': [4363], 'account': [4376], 'restricted': [4379], '(26Davis': [4396], 'Aldrich': [4398, 4451], 'T.H.': [4399, 4452], 'Jones': [4400, 4439], 'Acheson': [4402], 'Compton': [4404, 4447], 'Jain': [4406], 'Ryan': [4408], 'Bruno': [4410], 'Radziejewski': [4412, 4445], 'Maisonpierre': [4414], 'P.C.': [4415, 4436], 'Yancopoulos': [4416, 4461], 'G.D.': [4417, 4462], 'Isolation': [4418], 'angiopoietin-1,': [4420], 'ligand': [4422], 'TIE2': [4425], 'receptor,': [4426], 'secretion-trap': [4428], 'cloning.Cell.': [4430], '1996;': [4431], '87:': [4432], '1161-1169Google': [4433], '27Maisonpierre': [4435], 'Suri': [4437], 'Bartunkova': [4441], 'Wiegand': [4443], 'S.J.': [4444], 'McClain': [4449], 'Papadopoulos': [4453], 'Daly': [4455], 'Davis': [4457], 'Angiopoietin-2,': [4463], 'antagonist': [4466], 'Tie2': [4468], 'disrupts': [4470], 'vivo': [4472], 'angiogenesis.Science.': [4473], '55-60Google': [4476], 'Members': [4478], 'share': [4482], 'following': [4484], 'characteristics:': [4485], 'peptide,': [4488, 4496], 'extended': [4490], 'helical': [4491], 'domain,': [4492, 4519], 'short': [4494], 'linker': [4495], 'globular': [4499], 'fibrinogen-like': [4500, 4518], 'domain.': [4501], 'features': [4503], 'distinguish': [4504], 'angiopoietins,': [4508], 'cysteine-based': [4514], 'motif': [4515], 'calcium': [4522], 'motif,': [4524], 'almost': [4526], 'exclusive': [4527], 'Interestingly,': [4568], 'whereas': [4587], 'free': [4602], 'Although': [4632], 'cellular': [4649], 'mechanism(s)': [4652, 4948], 'Very': [4662], 'VLDL-TG': [4673], 'via': [4674], 'inhibition': [4676, 4709, 5379], '(28Shimizugawa': [4681, 5351], 'Yoshida': [4687, 5357], 'Koishi': [4691, 5361], 'Ueda': [4693, 5363], 'Inaba': [4695, 5365], 'Minekura': [4697, 5367], 'Kohama': [4699, 5369], 'ANGPTL3': [4703, 5373], 'decreases': [4704, 5374], 'VLDL': [4705, 5375, 5399], 'clearance': [4707, 5377], 'lipase.J.': [4712, 5382], '33742-33748Google': [4717, 5387], 'first': [4724], 'critical': [4734], 'sensing': [4736], 'factor.': [4738], 'consistent': [4743], 'will': [4753], 'useful': [4755], 'elucidation': [4758], 'responses': [4764], '(mainly': [4781], 'HDL-C)': [4782], 'ABCA1,': [4861, 4964], 'mediator': [4863], 'apolipoprotein': [4868], 'A-I,': [4869], 'HDL-C.': [4945], 'remains': [4957, 5194], 'elucidated.': [4960], 'SREBP-1c,': [4984], 'Effects': [5096], 'lipogenesis': [5102, 5323], 'believed': [5106], 'TG.': [5115], 'interpretation': [5118], 'complicated': [5120], 'fact': [5123], 'although': [5125], 'liver,': [5136], 'exact': [5186], 'LXR-mediated': [5191, 5246, 5425], 'tested.': [5197], 'possible': [5237], 'lipids.': [5250, 5429], 'interesting': [5253], 'note': [5255], '29Grefhorst': [5297], 'Elzinga': [5299], 'B.M.': [5300], 'Voshol': [5301], 'P.J.': [5302], 'Plösch': [5303], 'Kok': [5305], 'Bloks': [5307], 'V.W.': [5308], 'van': [5309], 'der': [5310], 'Sluijs': [5311], 'F.H.': [5312], 'Havekes': [5313], 'L.M.': [5314], 'Romijn': [5315], 'J.A.': [5316], 'Ver-kade': [5317], 'H.J.': [5318], 'Kuipers': [5319], 'Stimulation': [5321], 'pharmacological': [5325], 'leads': [5332], 'production': [5334], 'large,': [5336], 'triglyceride-rich': [5337], 'very': [5338], 'density': [5340], 'particles.J.': [5342], '34182-34190Google': [5347], 'largely': [5396], 'fraction.': [5400], 'mutation,': [5413], 'definitively': [5419], 'involvement': [5421], 'Angplt3': [5423], 'authors': [5431], 'thank': [5432], 'Alan': [5433], 'Adams': [5435], 'providing': [5437], 'valuable': [5440, 5451], 'comments;': [5441, 5454], 'Carl': [5442], 'Sparrow,': [5444], 'Jeffrey': [5445], 'Yuan,': [5446], 'Erik': [5448], 'Lund': [5449], 'discussions': [5452], 'Qiu': [5456], 'Guo': [5457], 'Denise': [5459], 'Milot': [5460], 'help': [5462], 'tissue': [5464], 'preparation.': [5465], 'ATP-binding': [5466], 'cassette': [5467], 'transporter': [5468], 'hydroxycholesterol': [5479]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2129937334', 'counts_by_year': [{'year': 2024, 'cited_by_count': 4}, {'year': 2023, 'cited_by_count': 6}, {'year': 2022, 'cited_by_count': 7}, {'year': 2021, 'cited_by_count': 14}, {'year': 2020, 'cited_by_count': 9}, {'year': 2019, 'cited_by_count': 5}, {'year': 2018, 'cited_by_count': 5}, {'year': 2017, 'cited_by_count': 3}, {'year': 2016, 'cited_by_count': 2}, {'year': 2015, 'cited_by_count': 2}, {'year': 2014, 'cited_by_count': 4}, {'year': 2013, 'cited_by_count': 4}, {'year': 2012, 'cited_by_count': 2}], 'updated_date': '2024-12-13T14:24:20.002932', 'created_date': '2016-06-24'}