Title: A Single-Tube Multiplexed Assay for Detecting ALK, ROS1, and RET Fusions in Lung Cancer
Abstract: Approximately 7% of non–small cell lung carcinomas (NSCLCs) harbor oncogenic fusions involving ALK, ROS1, and RET. Although tumors harboring ALK fusions are highly sensitive to crizotinib, emerging preclinical and clinical data demonstrate that patients with ROS1 or RET fusions may also benefit from inhibitors targeting these kinases. Using a transcript-based method, we designed a combination of 3′ overexpression and fusion-specific detection strategies to detect ALK, ROS1 and RET fusion transcripts in NSCLC tumors. We validated the assay in 295 NSCLC specimens and showed that the assay is highly sensitive and specific. ALK results were 100% concordant with fluorescence in situ hybridization (FISH) (n = 52) and 97.8% concordant with IHC (n = 179) [sensitivity, 96.8% (95% CI 91.0%–98.9%); specificity, 98.8% (95% CI 93.6%–99.8%)]. For ROS1 and RET, we also observed 100% concordance with FISH (n = 46 and n = 15, respectively). We identified seven ROS1 and 14 RET fusion–positive tumors and confirmed the fusion status by RT-PCR and FISH. One RET fusion involved a novel partner, cutlike homeobox 1 gene (CUX1), yielding an in-frame CUX1-RET fusion. ROS1 and RET fusions were significantly enriched in tumors without KRAS/EGFR/ALK alterations. ALK/ROS1/RET/EGFR/KRAS alterations were mutually exclusive. As a single-tube assay, this test shows promise as a more practical and cost-effective screening modality for detecting rare but targetable fusions in NSCLC. Approximately 7% of non–small cell lung carcinomas (NSCLCs) harbor oncogenic fusions involving ALK, ROS1, and RET. Although tumors harboring ALK fusions are highly sensitive to crizotinib, emerging preclinical and clinical data demonstrate that patients with ROS1 or RET fusions may also benefit from inhibitors targeting these kinases. Using a transcript-based method, we designed a combination of 3′ overexpression and fusion-specific detection strategies to detect ALK, ROS1 and RET fusion transcripts in NSCLC tumors. We validated the assay in 295 NSCLC specimens and showed that the assay is highly sensitive and specific. ALK results were 100% concordant with fluorescence in situ hybridization (FISH) (n = 52) and 97.8% concordant with IHC (n = 179) [sensitivity, 96.8% (95% CI 91.0%–98.9%); specificity, 98.8% (95% CI 93.6%–99.8%)]. For ROS1 and RET, we also observed 100% concordance with FISH (n = 46 and n = 15, respectively). We identified seven ROS1 and 14 RET fusion–positive tumors and confirmed the fusion status by RT-PCR and FISH. One RET fusion involved a novel partner, cutlike homeobox 1 gene (CUX1), yielding an in-frame CUX1-RET fusion. ROS1 and RET fusions were significantly enriched in tumors without KRAS/EGFR/ALK alterations. ALK/ROS1/RET/EGFR/KRAS alterations were mutually exclusive. As a single-tube assay, this test shows promise as a more practical and cost-effective screening modality for detecting rare but targetable fusions in NSCLC. Lung cancer is the leading cause of cancer-related mortality worldwide, with non–small cell lung carcinoma (NSCLC) accounting for 85% of all lung cancer cases. Recent advances in the identification of a subset of patients with specific genomic alterations and the successful clinical translation of targeted therapies provide a strong rationale for the development of robust screening modalities to identify such patients. Fusions with ALK (anaplastic lymphoma kinase) occur in approximately 5% of NSCLC cases. The DNA rearrangement leads to expression of a constitutively active kinase protein. Tumors harboring ALK rearrangement rely specifically on the chimeric oncoprotein for progression and are sensitive to ALK inhibitors, such as crizotinib, a US Food and Drug Administration–approved drug for the treatment of ALK fusion–positive NSCLC.1Kwak E.L. Bang Y.J. Camidge D.R. Shaw A.T. Solomon B. Maki R.G. Ou S.H. Dezube B.J. Janne P.A. Costa D.B. Varella-Garcia M. Kim W.H. Lynch T.J. Fidias P. Stubbs H. Engelman J.A. Sequist L.V. Tan W. Gandhi L. Mino-Kenudson M. Wei G.C. Shreeve S.M. Ratain M.J. Settleman J. Christensen J.G. Haber D.A. Wilner K. Salgia R. Shapiro G.I. Clark J.W. Iafrate A.J. Anaplastic lymphoma kinase inhibition in non-small-cell lung cancer.N Engl J Med. 2010; 363: 1693-1703Crossref PubMed Scopus (3829) Google Scholar ROS1 (c-ros oncogene 1) is a receptor tyrosine kinase. ROS1 fusions may play a role in the tumorigenesis of glioblastoma and cholangiocarcinoma and have been found in 1% to 2% of NSCLCs. There are 12 ROS1 fusions with seven different partners identified in NSCLC.2Chin L.P. Soo R.A. Soong R. Ou S.H. Targeting ROS1 with anaplastic lymphoma kinase inhibitors: a promising therapeutic strategy for a newly defined molecular subset of non-small-cell lung cancer.J Thorac Oncol. 2012; 7: 1625-1630Crossref PubMed Scopus (114) Google Scholar, 3Gu T.L. Deng X. Huang F. Tucker M. Crosby K. Rimkunas V. Wang Y. Deng G. Zhu L. Tan Z. Hu Y. Wu C. Nardone J. MacNeill J. Ren J. Reeves C. Innocenti G. Norris B. Yuan J. Yu J. Haack H. Shen B. Peng C. Li H. Zhou X. Liu X. Rush J. Comb M.J. Survey of tyrosine kinase signaling reveals ROS kinase fusions in human cholangiocarcinoma.PLoS One. 2011; 6: e15640Crossref PubMed Scopus (254) Google Scholar, 4Li C. Fang R. Sun Y. Han X. Li F. Gao B. Iafrate A.J. Liu X.Y. Pao W. Chen H. Ji H. Spectrum of oncogenic driver mutations in lung adenocarcinomas from East Asian never smokers.PLoS One. 2011; 6: e28204Crossref PubMed Scopus (186) Google Scholar, 5Lipson D. Capelletti M. Yelensky R. Otto G. Parker A. Jarosz M. Curran J.A. Balasubramanian S. Bloom T. Brennan K.W. Donahue A. Downing S.R. Frampton G.M. Garcia L. Juhn F. Mitchell K.C. White E. White J. Zwirko Z. Peretz T. Nechushtan H. Soussan-Gutman L. Kim J. Sasaki H. Kim H.R. Park S.I. Ercan D. Sheehan C.E. Ross J.S. Cronin M.T. Janne P.A. Stephens P.J. Identification of new ALK and RET gene fusions from colorectal and lung cancer biopsies.Nat Med. 2012; 18: 382-384Crossref PubMed Scopus (716) Google Scholar, 6Rikova K. Guo A. Zeng Q. Possemato A. Yu J. Haack H. Nardone J. Lee K. Reeves C. Li Y. Hu Y. Tan Z. Stokes M. Sullivan L. Mitchell J. Wetzel R. Macneill J. Ren J.M. Yuan J. Bakalarski C.E. Villen J. Kornhauser J.M. Smith B. Li D. Zhou X. Gygi S.P. Gu T.L. Polakiewicz R.D. Rush J. Comb M.J. Global survey of phosphotyrosine signaling identifies oncogenic kinases in lung cancer.Cell. 2007; 131: 1190-1203Abstract Full Text Full Text PDF PubMed Scopus (1924) Google Scholar, 7Rimkunas V.M. Crosby K.E. Li D. Hu Y. Kelly M.E. Gu T.L. Mack J.S. Silver M.R. Zhou X. Haack H. Analysis of receptor tyrosine kinase ROS1-positive tumors in non-small cell lung cancer: identification of a FIG-ROS1 fusion.Clin Cancer Res. 2012; 18: 4449-4457Crossref PubMed Scopus (248) Google Scholar, 8Takeuchi K. Soda M. Togashi Y. Suzuki R. Sakata S. Hatano S. Asaka R. Hamanaka W. Ninomiya H. Uehara H. Lim Choi Y. Satoh Y. Okumura S. Nakagawa K. Mano H. Ishikawa Y. RET, ROS1 and ALK fusions in lung cancer.Nat Med. 2012; 18: 378-381Crossref PubMed Scopus (1040) Google Scholar A recent clinical study demonstrated that patients with NSCLC with ROS1 fusions may benefit from crizotinib treatment.9Bergethon K. Shaw A.T. Ou S.H. Katayama R. Lovly C.M. McDonald N.T. Massion P.P. Siwak-Tapp C. Gonzalez A. Fang R. Mark E.J. Batten J.M. Chen H. Wilner K.D. Kwak E.L. Clark J.W. Carbone D.P. Ji H. Engelman J.A. Mino-Kenudson M. Pao W. Iafrate A.J. ROS1 rearrangements define a unique molecular class of lung cancers.J Clin Oncol. 2012; 30: 863-870Crossref PubMed Scopus (1272) Google Scholar RET (rearranged during transfection) is also a receptor tyrosine kinase that has been shown mutated (point mutations and fusions) in thyroid cancer. Several recent cancer genome sequencing studies identified RET fusions in 1% to 2% of NSCLC,10Pao W. Hutchinson K.E. Chipping away at the lung cancer genome.Nat Med. 2012; 18: 349-351Crossref PubMed Scopus (166) Google Scholar, 11Seo J.S. Ju Y.S. Lee W.C. Shin J.Y. Lee J.K. Bleazard T. Lee J. Jung Y.J. Kim J.O. Shin J.Y. Yu S.B. Kim J. Lee E.R. Kang C.H. Park I.K. Rhee H. Lee S.H. Kim J.I. Kang J.H. Kim Y.T. The transcriptional landscape and mutational profile of lung adenocarcinoma.Genome Res. 2012; 22: 2109-2119Crossref PubMed Scopus (468) Google Scholar most frequently involving KIF5B and CCDC6 as fusion partners. Recent preclinical data have shown that clinically available tyrosine kinase inhibitors with anti-RET activity, such as sunitinib, sorafenib, and vandetanib, may offer potential treatments for RET fusion–positive tumors.5Lipson D. Capelletti M. Yelensky R. Otto G. Parker A. Jarosz M. Curran J.A. Balasubramanian S. Bloom T. Brennan K.W. Donahue A. Downing S.R. Frampton G.M. Garcia L. Juhn F. Mitchell K.C. White E. White J. Zwirko Z. Peretz T. Nechushtan H. Soussan-Gutman L. Kim J. Sasaki H. Kim H.R. Park S.I. Ercan D. Sheehan C.E. Ross J.S. Cronin M.T. Janne P.A. Stephens P.J. Identification of new ALK and RET gene fusions from colorectal and lung cancer biopsies.Nat Med. 2012; 18: 382-384Crossref PubMed Scopus (716) Google Scholar Indeed, early clinical data from three RET fusion–positive patients treated with cabozantinib, a RET inhibitor, showed quite promising results.12Drilon A. Wang L. Hasanovic A. Suehara Y. Lipson D. Stephens P. Ross J. Miller V. Ginsberg M. Zakowski M.F. Kris M.G. Ladanyi M. Rizvi N. Response to cabozantinib in patients with RET fusion-positive lung adenocarcinomas.Cancer Discov. 2013; 3: 630-635Crossref PubMed Scopus (410) Google Scholar Current methods for detecting ALK, ROS1, and RET fusions include fluorescence in situ hybridization (FISH), immunohistochemical (IHC) analysis, and RT-PCR, with each test offering its own advantages and disadvantages. FISH, the current US Food and Drug Administration–approved companion diagnostic test for detecting ALK fusions for crizotinib treatment, is complex and has limitations in terms of cost and throughput, making it impractical for screening large numbers of patients for the detection of rare but potentially clinically relevant oncogenic fusions. To explore a single-tube and more practical screening modality, we developed and evaluated the performance of a transcript-based assay to simultaneously detect the presence of ALK, ROS1, and RET fusions in NSCLC clinical specimens. NSCLC specimens were obtained from Samsung Medical Center (SMC) and Yonsei Cancer Center (YCC) (Seoul, Republic of Korea) with previous full informed consent from the patient and with approvals from SMC and YCC ethical committees/internal review boards. A total of 295 surgically resected lung adenocarcinoma samples were analyzed as four cohorts. Set 1 (n = 94) was enriched for ALK fusion–positive patients as detected by IHC and wild type for KRAS and EGFR. Set 2 (n = 85) was negative for ALK fusion (also by IHC) and also wild type for EGFR and KRAS. FISH data for ALK were available for 52 individuals in sets 1 and 2. Set 3 (n = 84) consisted of never-smokers with lung adenocarcinoma unselected for ALK, EGFR, and KRAS mutation status. Set 4 patients (n = 32) were never-smokers with lung adenocarcinoma previously characterized for ROS1 fusion by FISH.13Kim H.R. Lim S.M. Kim H.J. Hwang S.K. Park J.K. Shin E. Bae M.K. Ou S.H. Wang J. Jewell S.S. Kang D.R. Soo R.A. Haack H. Kim J.H. Shim H.S. Cho B.C. The frequency and impact of ROS1 rearrangement on clinical outcomes in never smokers with lung adenocarcinoma.Ann Oncol. 2013; 24: 2364-2370Crossref PubMed Scopus (99) Google Scholar Sets 1 to 3 were obtained from SMC and set 4 from YCC. All the patients were Korean in ethnicity. ALK FISH and IHC tests for sets 1 and 2 and ROS1 FISH tests for set 4 have been described in previous publications.13Kim H.R. Lim S.M. Kim H.J. Hwang S.K. Park J.K. Shin E. Bae M.K. Ou S.H. Wang J. Jewell S.S. Kang D.R. Soo R.A. Haack H. Kim J.H. Shim H.S. Cho B.C. The frequency and impact of ROS1 rearrangement on clinical outcomes in never smokers with lung adenocarcinoma.Ann Oncol. 2013; 24: 2364-2370Crossref PubMed Scopus (99) Google Scholar, 14Lira M.E. Kim T.M. Huang D. Deng S. Koh Y. Jang B. Go H. Lee S.H. Chung D.H. Kim W.H. Schoenmakers E.F. Choi Y.L. Park K. Ahn J.S. Sun J.M. Ahn M.J. Kim D.W. Mao M. Multiplexed gene expression and fusion transcript analysis to detect ALK fusions in lung cancer.J Mol Diagn. 2013; 15: 51-61Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar ROS1 FISH and RET FISH tests for the tumors selected from sets 2 and 3 were performed using ZytoLight SPEC ROS1 and RET dual-color break-apart probes (ZytoVision GmbH, Bremerhaven, Germany) according to the manufacturer's instructions. EGFR and KRAS mutation status was determined as follows: sets 1 and 2, Sanger sequencing; set 3, the MassARRAY system (Sequenom Inc., San Diego, CA); and set 4, PNAClamp mutation detection kits (Panagene Inc., Daejeon, Republic of Korea). Control lung cancer cell line HCC78 (ROS1 positive)6Rikova K. Guo A. Zeng Q. Possemato A. Yu J. Haack H. Nardone J. Lee K. Reeves C. Li Y. Hu Y. Tan Z. Stokes M. Sullivan L. Mitchell J. Wetzel R. Macneill J. Ren J.M. Yuan J. Bakalarski C.E. Villen J. Kornhauser J.M. Smith B. Li D. Zhou X. Gygi S.P. Gu T.L. Polakiewicz R.D. Rush J. Comb M.J. Global survey of phosphotyrosine signaling identifies oncogenic kinases in lung cancer.Cell. 2007; 131: 1190-1203Abstract Full Text Full Text PDF PubMed Scopus (1924) Google Scholar was obtained from Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (Braunschweig Germany); control lung cancer cell lines NCI-H3122 (ALK positive) and A549 (ALK, ROS1, and RET wild type)14Lira M.E. Kim T.M. Huang D. Deng S. Koh Y. Jang B. Go H. Lee S.H. Chung D.H. Kim W.H. Schoenmakers E.F. Choi Y.L. Park K. Ahn J.S. Sun J.M. Ahn M.J. Kim D.W. Mao M. Multiplexed gene expression and fusion transcript analysis to detect ALK fusions in lung cancer.J Mol Diagn. 2013; 15: 51-61Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar, 15Lee H.J. Seol H.S. Kim J.Y. Chun S.M. Suh Y.A. Park Y.S. Kim S.W. Choi C.M. Park S.I. Kim D.K. Kim Y.H. Jang S.J. ROS1 receptor tyrosine kinase, a druggable target, is frequently overexpressed in non-small cell lung carcinomas via genetic and epigenetic mechanisms.Ann Surg Oncol. 2012; 20: 200-208Crossref PubMed Scopus (39) Google Scholar, 16Matsubara D. Kanai Y. Ishikawa S. Ohara S. Yoshimoto T. Sakatani T. Oguni S. Tamura T. Kataoka H. Endo S. Murakami Y. Aburatani H. Fukayama M. Niki T. Identification of CCDC6-RET fusion in the human lung adenocarcinoma cell line, LC-2/ad.J Thorac Oncol. 2012; 7: 1872-1876Crossref PubMed Scopus (74) Google Scholar were obtained from ATCC (Manassas, VA). The probe sets were custom designed and synthesized by NanoString Technologies (Seattle, WA). Hybridization, sample cleanup, and digital reporter counts were performed according to the manufacturer's protocol. RNA samples from sets 1, 2, and 4 were prepared from two to three formalin-fixed, paraffin-embedded (FFPE) tissue slide sections (10 μm thick) as described previously.14Lira M.E. Kim T.M. Huang D. Deng S. Koh Y. Jang B. Go H. Lee S.H. Chung D.H. Kim W.H. Schoenmakers E.F. Choi Y.L. Park K. Ahn J.S. Sun J.M. Ahn M.J. Kim D.W. Mao M. Multiplexed gene expression and fusion transcript analysis to detect ALK fusions in lung cancer.J Mol Diagn. 2013; 15: 51-61Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar RNA samples from set 3 were obtained from fresh frozen tissues using the RNeasy mini kit (Qiagen Inc., Valencia, CA). Concentration was assessed by spectrophotometry using the NanoDrop 8000 (Thermo Scientific, Wilmington, DE). Total RNA was hybridized to a multiplexed mixture of custom-designed capture and reporter probes complementary to ALK, ROS1, and RET target sequences (Table 1). For FFPE-derived (degraded) and fresh frozen (intact) RNA, 500 and 250 ng of RNA were used, respectively. Hybridization, cleanup, imaging, and counting were processed according to a previous publication.14Lira M.E. Kim T.M. Huang D. Deng S. Koh Y. Jang B. Go H. Lee S.H. Chung D.H. Kim W.H. Schoenmakers E.F. Choi Y.L. Park K. Ahn J.S. Sun J.M. Ahn M.J. Kim D.W. Mao M. Multiplexed gene expression and fusion transcript analysis to detect ALK fusions in lung cancer.J Mol Diagn. 2013; 15: 51-61Abstract Full Text Full Text PDF PubMed Scopus (58) Google ScholarTable 1ALK, ROS1, and RET NanoString Target SequencesAssay typeReporterProbe locationAccession No.∗Accessed at http://www.ncbi.nlm.nih.gov/genbank.Target sequence3′/5′ALK 5′-1ALK exon 1NG_009445.15′-GCGCAGCGCGGGGGCTGGGATTCACGCCCAGAAGTTCAGCAGGCAGACAGTCCGAAGCCTTCCCGCAGCGGAGAGATAGCTTGAGGGTGCGCAAGACGGC-3′3′/5′ALK 5′-2ALK exon 1NG_009445.15′-CTACTCGCGCCTGCAGAGGAAGAGTCTGGCAGTTGACTTCGTGGTGCCCTCGCTCTTCCGTGTCTACGCCCGGGACCTACTGCTGCCACCATCCTCCTCG-3′3′/5′ALK 5′-3ALK exon 5NG_009445.15′-ACAGTGCTCCAGGGAAGAATCGGGCGTCCAGACAACCCATTTCGAGTGGCCCTGGAATACATCTCCAGTGGAAACCGCAGCTTGTCTGCAGTGGACTTCT-3′3′/5′ALK 5′-4ALK exon 18NG_009445.15′-TAAAAGTGATGGAAGGCCACGGGGAAGTGAATATTAAGCATTATCTAAACTGCAGTCACTGTGAGGTAGACGAATGTCACATGGACCCTGAAAGCCACAA-3′3′/5′ALK 3′-1ALK exon 22/23NG_009445.15′-AGACGCTGCCTGAAGTGTGCTCTGAACAGGACGAACTGGATTTCCTCATGGAAGCCCTGATCATCAGCAAATTCAACCACCAGAACATTGTTCGCTGCAT-3′3′/5′ALK 3′-2ALK exon 26/27NG_009445.15′-CAGAGGCCTTCATGGAAGGAATATTCACTTCTAAAACAGACACATGGTCCTTTGGAGTGCTGCTATGGGAAATCTTTTCTCTTGGATATATGCCATACCC-3′3′/5′ALK 3′-3ALK exon 29NG_009445.15′-TTGTGGAACCCAACGTACGGCTCCTGGTTTACAGAGAAACCCACCAAAAAGAATAATCCTATAGCAAAGAAGGAGCCACACGACAGGGGTAACCTGGGGC-3′3′/5′ALK 3′-4Exon 29 (3′ UTR)NG_009445.15′-GTCGCACACTCACTTCTCTTCCTTGGGATCCCTAAGACCGTGGAGGAGAGAGAGGCAATGGCTCCTTCACAAACCAGAGACCAAATGTCACGTTTTGTTT-3′3′/5′ROS1 5′-1ROS1 exon 1 (5′ UTR)NM_002944.25′-ACAAACAAAGCAAAATCCATCAGCTACTCCTCCAATTGAAGTGATGAAGCCCAAATAATTCATATAGCAAAATGGAGAAAATTAGACCGGCCATCTAAAA-3′3′/5′ROS1 5′-2ROS1 exon 18/19NM_002944.25′-TCAAGAAATAGGTCAGAAAACCAGTGTCTCTGTTTTGGAACCAGCCAGATTTAATCAGTTCACAATTATTCAGACATCCCTTAAGCCCCTGCCAGGGAAC-3′3′/5′ROS1 5′-3ROS1 exon 24NM_002944.25′-GCACCTCTACTTTGCACTGAAAGAATCACAAAATGGAATGCAAGTATTTGATGTTGATCTTGAACACAAGGTGAAATATCCCAGAGAGGTGAAGATTCAC-3′3′/5′ROS1 5′-4ROS1 exon 29/30NM_002944.25′-CTCTAAGACAAAGTGAATTTCCAAATGGAAGGCTCACTCTCCTTGTTACTAGACTGTCTGGTGGAAATATTTATGTGTTAAAGGTTCTTGCCTGCCACTC-3′3′/5′ROS1 3′-1ROS1 exon37NM_002944.25′-GGAGAAGATTGAATTCCTGAAGGAGGCACATCTGATGAGCAAATTTAATCATCCCAACATTCTGAAGCAGCTTGGAGTTTGTCTGCTGAATGAACCCCAA-3′3′/5′ROS1 3′-2ROS1 exon 40NM_002944.25′-ACCTTGTAGACCTGTGTGTAGATATTTCAAAAGGCTGTGTCTACTTGGAACGGATGCATTTCATTCACAGGGATCTGGCAGCTAGAAATTGCCTTGTTTC-3′3′/5′ROS1 3′-3ROS1 exon 41/42NM_002944.25′-GAAATTGTCCTGATGATCTGTGGAATTTAATGACCCAGTGCTGGGCTCAAGAACCCGACCAAAGACCTACTTTTCATAGAATTCAGGACCAACTTCAGTT-3′3′/5′ROS1 3′-4ROS1 exon 43 (3′ UTR)NM_002944.25′-AGAGAGTTGAGATAAACACTCTCATTCAGTAGTTACTGAAAGAAAACTCTGCTAGAATGATAAATGTCATGGTGGTCTATAACTCCAAATAAACAATGCA-3′3′/5′RET 5′-1RET exon 1-2NM_020630.45′-GCTGCTGCTGCCGCTGCTAGGCAAAGTGGCATTGGGCCTCTACTTCTCGAGGGATGCTTACTGGGAGAAGCTGTATGTGGACCAGGCGGCCGGCACGCCC-3′3′/5′RET 5′-2RET exon 2-3NM_020630.45′-TCAGTGTCCGCAACCGCGGCTTTCCCCTGCTCACCGTCTACCTCAAGGTCTTCCTGTCACCCACATCCCTTCGTGAGGGCGAGTGCCAGTGGCCAGGCTG-3′3′/5′RET 5′-3RET exon 6-7NM_020630.45′-CGTGAGCAGGAGGGCTCGCCGATTTGCCCAGATCGGGAAAGTCTGTGTGGAAAACTGCCAGGCATTCAGTGGCATCAACGTCCAGTACAAGCTGCATTCC-3′3′/5′RET 5′-4RET exon 11NM_020630.45′-TGCGACGAGCTGTGCCGCACGGTGATCGCAGCCGCTGTCCTCTTCTCCTTCATCGTCTCGGTGCTGCTGTCTGCCTTCTGCATCCACTGCTACCACAAGT-3′3′/5′RET 3′-1RET exon 14-15NM_020630.45′-AGGGGATGCAGTATCTGGCCGAGATGAAGCTCGTTCATCGGGACTTGGCAGCCAGAAACATCCTGGTAGCTGAGGGGCGGAAGATGAAGATTTCGGATTT-3′3′/5′RET 3′-2RET exon 15-16-17NM_020630.45′-AGGAGCCAGGGTCGGATTCCAGTTAAATGGATGGCAATTGAATCCCTTTTTGATCATATCTACACCACGCAAAGTGATGTATGGTCTTTTGGTGTCCTGC-3′3′/5′RET 3′-3RET exon 18NM_020630.45′-AAGACCTGGAGAAGATGATGGTTAAGAGGAGAGACTACTTGGACCTTGCGGCGTCCACTCCATCTGACTCCCTGATTTATGACGACGGCCTCTCAGAGGA-3′3′/5′RET 3′-4RET exon 19 UTRNM_020630.45′-TTTCCCTTACCCACCTTCAGGACGGTTGTCACTTATGAAGTCAGTGCTAAAGCTGGAGCAGTTGCTTTTTGAAAGAACATGGTCTGTGGTGCTGTGGTCT-3′FusionFusion_ALKe20EML4-ALK_E13:A20PFUS_001.15′-ATATGGAGCAAAACTACTGTAGAGCCCACACCTGGGAAAGGACCTAAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAG-3′FusionFusion_ALKe20EML4-ALK_E20:A20PFUS_002.15′-GACAACAAGTATATAATGTCTAACTCGGGAGACTATGAAATATTGTACTTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAG-3′FusionFusion_ALKe20EML4-ALK_E6:A20PFUS_003.15′-AAAGTTACCAAAACTGCAGACAAGCATAAAGATGTCATCATCAACCAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAG-3′FusionFusion_ALKe20EML4-ALK_E2:A20PFUS_006.15′-ATCTCTGAAGATCATGTGGCCTCAGTGAAAAAATCAGTCTCAAGTAAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAG-3′FusionFusion_ALKe20EML4-ALK_E18:A20PFUS_008.15′-ATCCACACAGACGGGAATGAACAGCTCTCTGTGATGCGCTACTCAATAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAG-3′FusionFusion_ALKe20KIF5B-ALK_K24:A20PFUS_013.15′-GCAGTCAGGTCAAAGAATATGGCCAGAAGAGGGCATTCTGCACAGATTGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAG-3′FusionFusion_ALKe20TFG-ALK_T5:A20PFUS_016.15′-CAGCAGCCACCATATACAGGAGCTCAGACTCAAGCAGGTCAGATTGAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAG-3′FusionFusion_ALKe20KIF5B-ALK_K17:A20PFUS_031.15′-TTGGAGGAATCTGTCGATGCCCTCAGTGAAGAACTAGTCCAGCTTCGAGCACAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGC-3′FusionFusion_ROS1e32SLC34A2-ROS1_S4:R32PFUS_020.15′-GTGTGCTCCCTGGATATTCTTAGTAGCGCCTTCCAGCTGGTTGGAGCTGGAGTCCCAAATAAACCAGGCATTCCCAAATTACTAGAAGGGAGTAA-3′FusionFusion_ROS1e32CD74-ROS_C6:R32PFUS_030.15′-AATGAGCAGGCACTCCTTGGAGCAAAAGCCCACTGACGCTCCACCGAAAGCTGGAGTCCCAAATAAACCAGGCATTCCCAAATTACTAGAAGGGAGTAAA-3′FusionFusion_ROS1e32SDC4-ROS1_S2:R32PFUS_024.15′-GCCCGGGCAGGAATCTGATGACTTTGAGCTGTCTGGCTCTGGAGATCTGGCTGGAGTCCCAAATAAACCAGGCATTCCCAAATTACTAGAAGGGAGTAAA-3′FusionFusion_ROS1e32SLC34A2-ROS1_S13del2046:R32PFUS_034.15′-CAAGGCTCCTGAGACCTTTGATAACATAACCATTAGCAGAGAGGCTCAGGCTGGAGTCCCAAATAAACCAGGCATTCCCAAATTACTAGAAGGGAGTAAA-3′FusionSLC34A2-ROS1 V2SLC34A2-ROS1_S4:R34PFUS_021.15′-TTTTCGTGTGCTCCCTGGATATTCTTAGTAGCGCCTTCCAGCTGGTTGGAGATGATTTTTGGATACCAGAAACAAGTTTCATACTTACTATTATAGTTGG-3′FusionEZR-ROS1EZR-ROS1_E10:R34PFUS_032.15′-AAGGAGGAGTTGATGCTGCGGCTGCAGGACTATGAGGAGAAGACAAAGAAGGCAGAGAGAGATGATTTTTGGATACCAGAAACAAGTTTCATACTTACTA-3′FusionSDC4-ROS1SDC4-ROS1_S4:R34PFUS_033.15′-GGTGTCAATGTCCAGCACTGTGCAGGGCAGCAACATCTTTGAGAGAACGGAGGTCCTGGCAGATGATTTTTGGATACCAGAAACAAGTTTCATACTTACT-3′FusionFIG-ROS1 V1GOPC-ROS1_G8:R35PFUS_023.15′-CCCTGGTGCTAGTTGCAAAGACACAAGTGGGGAAATCAAAGTATTACAAGTCTGGCATAGAAGATTAAAGAATCAAAAAAGTGCCAAGGAAGGGGTGACA-3′FusionTPM3-ROS1TPM3-ROS1_T8:R35PFUS_035.15′-AGTTTGCTGAGAGATCGGTAGCCAAGCTGGAAAAGACAATTGATGACCTGGAAGTCTGGCATAGAAGATTAAAGAATCAAAAAAGTGCCAAGGAAGGGGT-3′FusionLRIG3-ROS1LRIG3-ROS1_L16:R35PFUS_027.15′-AGTTTGTCACATCTTCAGGTGCTGGATTTTTCTTACCACAACATGACAGTAGTGTCTGGCATAGAAGATTAAAGAATCAAAAAAGTGCCAAGGAAGGGGT-3′FusionFIG-ROS1 V2GOPC-ROS1_G4:R36PFUS_022.15′-TATGGGGCGAGACTAGCTGCCAAGTACTTGGATAAGGAACTGGCAGGAAGTACTCTTCCAACCCAAGAGGAGATTGAAAATCTTCCTGCCTTCCCTCGGG-3′FusionFusion_RETe12KIF5B-RET_K15:R12PFUS_028.15′-AAGACCTTGCAGAAATAGGAATTGCTGTGGGAAATAATGATGTAAAGGAGGATCCAAAGTGGGAATTCCCTCGGAAGAACTTGGTTCTTGGAAAAACTCT-3′FusionFusion_RETe12KIF5B-RET_K16:R12PFUS_025.15′-AAGAAAATGAAAAGGAGTTAGCAGCATGTCAGCTTCGTATCTCTCAAGAGGATCCAAAGTGGGAATTCCCTCGGAAGAACTTGGTTCTTGGAAAAACTCT-3′FusionFusion_RETe12KIF5B-RET_K22:R12PFUS_026.15′-ACCTGCGCAAACTCTTTGTTCAGGACCTGGCTACAAGAGTTAAAAAGGAGGATCCAAAGTGGGAATTCCCTCGGAAGAACTTGGTTCTTGGAAAAACTCT-3′FusionFusion_RETe12KIF5B-RET_K23:R12PFUS_029.15′-CCTTTCTTGAAAATAATCTTGAACAGCTCACTAAAGTGCACAAACAGGAGGATCCAAAGTGGGAATTCCCTCGGAAGAACTTGGTTCTTGGAAAAACTCT-3′FusionFusion_RETe12CCDC6-RET_C1:R12PFUS_039.15′-GGAGGAGAACCGCGACCTGCGCAAAGCCAGCGTGACCATCGAGGATCCAAAGTGGGAATTCCCTCGGAAGAACTTGGTTCTTGGAAAAAC-3′FusionKIF5B-RETe8KIF5B-RET_K24:R8PFUS_036.15′-CAGTCAGGTCAAAGAATATGGCCAGAAGAGGGCATTCTGCACAGATTGATGTGGCCGAGGAGGCGGGCTGCCCCCTGTCCTGTGCAGTCAGCAAGAGA-3′FusionFusion_RETe11KIF5B-RET_K15:R11PFUS_037.15′-AGACCTTGCAGAAATAGGAATTGCTGTGGGAAATAATGATGTAAAGATCCACTGTGCGACGAGCTGTGCCGCACGGTGATCGCAGCCGCTGTCCTC-3′FusionFusion_RETe11KIF5B-RET_K24:R11PFUS_038.15′-GTCAGGTCAAAGAATATGGCCAGAAGAGGGCATTCTGCACAGATTGATCCACTGTGCGACGAGCTGTGCCGCACGGTGATCGCAGCCGCTGTCCTC-3′EndogenousGAPDHGAPDH exon 1-2NM_002046.35′-TCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCGCTCAGACACCATGGGGAAGGTGAAGGTCGGAGTCAACGGATTT-3′EndogenousOAZ1OAZ1 exon 2-3NM_004152.25′-GGTGGGCGAGGGAATAGTCAGAGGGATCACAATCTTTCAGCTAACTTATTCTACTCCGATGATCGGCTGAATGTAACAGAGGAACTAACGTCCAACGACA-3′EndogenousPOLR2APOLR2A exon 20-21NM_000937.25′-TTCCAAGAAGCCAAAGACTCCTTCGCTTACTGTCTTCCTGTTGGGCCAGTCCGCTCGAGATGCTGAGAGAGCCAAGGATATTCTGTGCCGTCTGGAGCAT-3′EndogenousGUSBGUSB exon 4-5NM_000181.15′-CGGTCGTGATGTGGTCTGTGGCCAACGAGCCTGCGTCCCACCTAGAATCTGCTGGCTACTACTTGAAGATGGTGATCGCTCACACCAAATCCTTGGACCC-3′GAPDH, glyceraldehydes-3-phosphate dehydrogenase; GUSB, glucuronidase beta; OAZ1, ornithine decarboxylase antizyme 1; POLR2A, polymerase (RNA) II (DNA directed) polypeptide A; UTR, untranslated region.∗ Accessed at http://www.ncbi.nlm.nih.gov/genbank. Open table in a new tab GAPDH, glyceraldehydes-3-phosphate dehydrogenase; GUSB, glucuronidase beta; OAZ1, ornithine decarboxylase antizyme 1; POLR2A, polymerase (RNA) II (DNA directed) polypeptide A; UTR, untranslated region. Data were normalized in two steps as described in a previous publication.14Lira M.E. Kim T.M. Huang D. Deng S. Koh Y. Jang B. Go H. Lee S.H. Chung D.H. Kim W.H. Schoenmakers E.F. Choi Y.L. Park K. Ahn J.S. Sun J.M. Ahn M.J. Kim D.W. Mao M. Multiplexed gene expression and fusion transcript analysis to detect ALK fusions in lung cancer.J Mol Diagn. 2013; 15: 51-61Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar Technical background was determined from the eight ERCC-negative control probes. Means and SDs were calculated from the negative controls, and a background threshold (B) was defined as the mean plus 2 SD. A target with a normalized intensity value above this threshold was scored as "present." A biological background (B5) was defined as follows for 5′ probes of individual genes based on the median of all 5′ probe intensity for that gene across all samples and their SD:B5=median+2×SMAD(1) where SMAD = 1.4826*MAD is the SD calculated from the median absolute deviation (MAD) from median for normally distributed data. It is a more robust measure of variability than the sample SD. Normalized intensity from sample replicates was averaged to obtain an averaged patient intensity for each probe and patient. To summarize the 3′ overexpression, we defined a 3′ overexpression score (ie, the ALK 3′/5′ ratio) for each patient and gene as follows:R35=3′/5′=E3max(A5,Bt)(2) where E3 is the geometric mean of 3′ probe expression of individual genes (ALK, ROS1, or RET), and A5 is the median of the corresponding 5′ probe expression; Bt is the maximum of the technical and biological background threshold defined previously herein [Bt = max(B,B5)]. The 3′ probes usually have higher intensity and tend to follow a log-normal distribution, whereas the 5′ probes have lower intensity and are more normally distributed. For this reason we used the geometric mean for 3′ probes and the median for 5′ probes. Using background threshold Bt to floor the denominator prevents an extremely small 5′ expression value that could artificially inflate the score. We defined a fusion probe background in a similar manner. For each fusion probe a background threshold was defined as the median normalized intensity plus 2 SDs or B, whichever was larger:FB=max(B,median+2×SMAD)(3) where SMAD = 1.4826*MAD. Fusion prediction for individual samples was made based on both the 3′/5′ ratio (R35) and fusion probe expression (F). A fusion is detected if the 3′/5′ ratio is larger than a prespecified threshold or if at least one fusion probe is above a threshold. Percentage concordance was calculated between two platforms, and its 95% CI was computed using the Wilson score method. The Cohen kappa statistic was also calculated for concordance analysis. Data were analyzed using standard R software version 2.13.1 (http://www.r-project.org). Concordance analysis was conducted using SAS software version 9.2 (SAS Institute, Inc., Cary, NC). The precise ALK, ROS1, and RET fusion variants were determined by RT-PCR, followed by Sanger sequencing. The RNA UltraSense one-step RT-PCR kit (Life Technologies, Carlsbad, CA) was used to generate RT-PCR products, modifying the protocol such that the RT-PCR reaction was performed in two steps. First-strand cDNA was initially synthesized using gene-specific primers (Table 2). cDNA was subdivided into different PCR reactions using the appropriate fusion variant primers, and PCR products were separated on a 2% E-Gel SizeSelect agarose gel (Invitrogen, Carlsbad, CA). In reactions producing a PCR product of the expected size, the amplicons were gel purified and sequenced using a 3700 ABI Prism sequencer (Applied Biosystems, Foster City, CA).Table 2RT-PCR/Sanger Sequencing PrimersFusion variantPCR forward primerSequenceRT-PCR reverse primerSequenceEML4-ALK; E2:A20EML4 exon 25′-AAGATCATGTGGCCTCAGTG-3′ALK exon 20R5′-CTTGCTCAGCTTGTACTCAGG-3′EML4-ALK; E6:A20EML4 exon 65′-CTGCAGACAAGCATAAAGATG-3′ALK exon 20R5′-CTTGCTCAGCTTGTACTCAGG-3′EML4-ALK; E13:A20EML4 exon 135′-GACTCGGTGGAGTCATGC-3′ALK exon 20R5′-CTTGCTCAGCTTGTACTCAGG-3′EML4-ALK; E18:A20EML4 exon 185′-AGGTGGTTTGTTCTGGATGC-3′ALK exon 20R5′-CTTGCTCAGCTTGTACTCAGG-3′EML4-ALK; E20:A20EML4 exon 205′-CAGATATGGAAGGTGCACTG-3′ALK exon 20R5′-CTTGCTCAGCTTGTACTCAGG-3′TFG-ALK; T5:A20TFG exon 5F5′-TCTACTCAGGTTATGGCAGCAA-3′ALK exon 20R5′-CTTGCTCAGCTTGTACTCAGG-3′KIF5B-ALK; K17:A20KIF5B exon 17F5′-CCTTCAAAATGTGGAACAAAA-3′ALK exon 20R5′-CTTGCTCAGCTTGTACTCAGG-3′KIF5B-ALK; K24:A20KIF5B exon 24F5′-TGAAAGCTTTGGAATCAGCA-3′ALK exon 20R5′-CTTGCTCAGCTTGTACTCAGG-3′SLC34A2-ROS1; S4:R32SLC34A2 exon 4F5′-CTTCTCGGATTTCTCTACTTTTTC-3′ROS1 exon 32R5′-TCTTCAGCTTTCTCCCACTG-3′SLC34A2-ROS1; S13del2046:R32SLC34A2 S13del2046F5′-GCAGGATGTCCCTGTCAAG-3′ROS1 exon 32R5′-TCTTCAGCTTTCTCCCACTG-3′CD74-ROS1; C6:R32CD74 exon 6F5′-CATTGGCTCCTGTTTGAAATG-3′ROS1 exon 32R5′-TCTT