Publication Information

{'id': 'https://openalex.org/W2122434534', 'doi': 'https://doi.org/10.1074/jbc.274.7.3919', 'title': 'Evidence That a Phosphatidylinositol 3,4,5-Trisphosphate-binding Protein Can Function in Nucleus', 'display_name': 'Evidence That a Phosphatidylinositol 3,4,5-Trisphosphate-binding Protein Can Function in Nucleus', 'publication_year': 1999, 'publication_date': '1999-02-01', 'ids': {'openalex': 'https://openalex.org/W2122434534', 'doi': 'https://doi.org/10.1074/jbc.274.7.3919', 'mag': '2122434534', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/9933577'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.7.3919', 'pdf_url': 'http://www.jbc.org/article/S0021925819878596/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819878596/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5101508358', 'display_name': 'Kenichi Tanaka', 'orcid': 'https://orcid.org/0000-0003-3538-3163'}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Kenichi Tanaka', 'raw_affiliation_strings': ['Laboratory of Biological Chemistry, Department of Applied Biological Chemistry, Graduate School of Agriculture and Life Science, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, the'], 'affiliations': [{'raw_affiliation_string': 'Laboratory of Biological Chemistry, Department of Applied Biological Chemistry, Graduate School of Agriculture and Life Science, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, the', 'institution_ids': ['https://openalex.org/I74801974']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5108513747', 'display_name': 'Kaori Horiguchi', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Kaori Horiguchi', 'raw_affiliation_strings': ['Laboratory of Biological Chemistry, Department of Applied Biological Chemistry, Graduate School of Agriculture and Life Science, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, the'], 'affiliations': [{'raw_affiliation_string': 'Laboratory of Biological Chemistry, Department of Applied Biological Chemistry, Graduate School of Agriculture and Life Science, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, the', 'institution_ids': ['https://openalex.org/I74801974']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5055943723', 'display_name': 'Toshinori Yoshida', 'orcid': 'https://orcid.org/0000-0003-2476-7794'}, 'institutions': [], 'countries': [], 'is_corresponding': False, 'raw_author_name': 'Toshinori Yoshida', 'raw_affiliation_strings': ['Toxicology Division, Institute of Environmental Toxicology, 4321 Uchimoriya-cho, Mitsukaido-shi, Ibaraki 303-0043, the'], 'affiliations': [{'raw_affiliation_string': 'Toxicology Division, Institute of Environmental Toxicology, 4321 Uchimoriya-cho, Mitsukaido-shi, Ibaraki 303-0043, the', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5003967145', 'display_name': 'Makio Takeda', 'orcid': 'https://orcid.org/0000-0001-6768-6682'}, 'institutions': [], 'countries': [], 'is_corresponding': False, 'raw_author_name': 'Makio Takeda', 'raw_affiliation_strings': ['Toxicology Division, Institute of Environmental Toxicology, 4321 Uchimoriya-cho, Mitsukaido-shi, Ibaraki 303-0043, the'], 'affiliations': [{'raw_affiliation_string': 'Toxicology Division, Institute of Environmental Toxicology, 4321 Uchimoriya-cho, Mitsukaido-shi, Ibaraki 303-0043, the', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5046438104', 'display_name': 'H. Fujisawa', 'orcid': None}, 'institutions': [], 'countries': [], 'is_corresponding': False, 'raw_author_name': 'Hideki Fujisawa', 'raw_affiliation_strings': ['Toxicology Division, Institute of Environmental Toxicology, 4321 Uchimoriya-cho, Mitsukaido-shi, Ibaraki 303-0043, the'], 'affiliations': [{'raw_affiliation_string': 'Toxicology Division, Institute of Environmental Toxicology, 4321 Uchimoriya-cho, Mitsukaido-shi, Ibaraki 303-0043, the', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5105933591', 'display_name': 'Ken’ichi Takeuchi', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I4210098918', 'display_name': 'Tokyo Metropolitan Institute of Medical Science', 'ror': 'https://ror.org/00vya8493', 'country_code': 'JP', 'type': 'facility', 'lineage': ['https://openalex.org/I4210098918']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Kenichi Takeuchi', 'raw_affiliation_strings': ['Department of Inflammation Research, The Tokyo Metropolitan Institute of Medical Science, 3-18-22 Honkomagome, Bunkyo-ku, Tokyo, 113-8613, and the'], 'affiliations': [{'raw_affiliation_string': 'Department of Inflammation Research, The Tokyo Metropolitan Institute of Medical Science, 3-18-22 Honkomagome, Bunkyo-ku, Tokyo, 113-8613, and the', 'institution_ids': ['https://openalex.org/I4210098918']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5030056540', 'display_name': 'Masato Umeda', 'orcid': 'https://orcid.org/0000-0001-5654-4363'}, 'institutions': [{'id': 'https://openalex.org/I4210098918', 'display_name': 'Tokyo Metropolitan Institute of Medical Science', 'ror': 'https://ror.org/00vya8493', 'country_code': 'JP', 'type': 'facility', 'lineage': ['https://openalex.org/I4210098918']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Masato Umeda', 'raw_affiliation_strings': ['Department of Inflammation Research, The Tokyo Metropolitan Institute of Medical Science, 3-18-22 Honkomagome, Bunkyo-ku, Tokyo, 113-8613, and the'], 'affiliations': [{'raw_affiliation_string': 'Department of Inflammation Research, The Tokyo Metropolitan Institute of Medical Science, 3-18-22 Honkomagome, Bunkyo-ku, Tokyo, 113-8613, and the', 'institution_ids': ['https://openalex.org/I4210098918']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5002411009', 'display_name': 'Sigeaki Kato', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Sigeaki Kato', 'raw_affiliation_strings': ['Institute of Molecular and Cellular Biosciences,#R#the University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, Japan'], 'affiliations': [{'raw_affiliation_string': 'Institute of Molecular and Cellular Biosciences,#R#the University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, Japan', 'institution_ids': ['https://openalex.org/I74801974']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5090726734', 'display_name': 'Sayoko Ihara', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Sayoko Ihara', 'raw_affiliation_strings': ['Laboratory of Biological Chemistry, Department of Applied Biological Chemistry, Graduate School of Agriculture and Life Science, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, the'], 'affiliations': [{'raw_affiliation_string': 'Laboratory of Biological Chemistry, Department of Applied Biological Chemistry, Graduate School of Agriculture and Life Science, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, the', 'institution_ids': ['https://openalex.org/I74801974']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5025804896', 'display_name': 'Satoshi Nagata', 'orcid': 'https://orcid.org/0000-0001-9156-5215'}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Satoshi Nagata', 'raw_affiliation_strings': ['Laboratory of Biological Chemistry, Department of Applied Biological Chemistry, Graduate School of Agriculture and Life Science, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, the'], 'affiliations': [{'raw_affiliation_string': 'Laboratory of Biological Chemistry, Department of Applied Biological Chemistry, Graduate School of Agriculture and Life Science, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, the', 'institution_ids': ['https://openalex.org/I74801974']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5103493246', 'display_name': 'Yasuhisa Fukui', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Yasuhisa Fukui', 'raw_affiliation_strings': ['Laboratory of Biological Chemistry, Department of Applied Biological Chemistry, Graduate School of Agriculture and Life Science, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, the'], 'affiliations': [{'raw_affiliation_string': 'Laboratory of Biological Chemistry, Department of Applied Biological Chemistry, Graduate School of Agriculture and Life Science, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, the', 'institution_ids': ['https://openalex.org/I74801974']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 2, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 5.102, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 130, 'citation_normalized_percentile': {'value': 0.946989, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 96, 'max': 97}, 'biblio': {'volume': '274', 'issue': '7', 'first_page': '3919', 'last_page': '3922'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10617', 'display_name': 'Cellular transport and secretion', 'score': 0.9997, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10617', 'display_name': 'Cellular transport and secretion', 'score': 0.9997, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10169', 'display_name': 'Protein Kinase Regulation and GTPase Signaling', 'score': 0.9996, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10929', 'display_name': 'Wnt/β-catenin signaling in development and cancer', 'score': 0.9983, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/pleckstrin-homology-domain', 'display_name': 'Pleckstrin homology domain', 'score': 0.80331004}, {'id': 'https://openalex.org/keywords/phosphatidylinositol-4,5-bisphosphate', 'display_name': 'Phosphatidylinositol 4,5-bisphosphate', 'score': 0.54409415}], 'concepts': [{'id': 'https://openalex.org/C49658373', 'wikidata': 'https://www.wikidata.org/wiki/Q24776397', 'display_name': 'Pleckstrin homology domain', 'level': 3, 'score': 0.80331004}, {'id': 'https://openalex.org/C2780610907', 'wikidata': 'https://www.wikidata.org/wiki/Q2273248', 'display_name': 'Phosphatidylinositol', 'level': 3, 'score': 0.7388965}, {'id': 'https://openalex.org/C2780723820', 'wikidata': 'https://www.wikidata.org/wiki/Q1934178', 'display_name': 'Nucleus', 'level': 2, 'score': 0.61580515}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.5552188}, {'id': 'https://openalex.org/C2777853560', 'wikidata': 'https://www.wikidata.org/wiki/Q3083814', 'display_name': 'Phosphatidylinositol 4,5-bisphosphate', 'level': 4, 'score': 0.54409415}, {'id': 'https://openalex.org/C190062978', 'wikidata': 'https://www.wikidata.org/wiki/Q79899', 'display_name': 'Cytoplasm', 'level': 2, 'score': 0.5109638}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.5073206}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.4704035}, {'id': 'https://openalex.org/C142613039', 'wikidata': 'https://www.wikidata.org/wiki/Q272983', 'display_name': 'Green fluorescent protein', 'level': 3, 'score': 0.43600893}, {'id': 'https://openalex.org/C97029542', 'wikidata': 'https://www.wikidata.org/wiki/Q281417', 'display_name': 'Protein kinase A', 'level': 3, 'score': 0.43471393}, {'id': 'https://openalex.org/C62478195', 'wikidata': 'https://www.wikidata.org/wiki/Q828130', 'display_name': 'Signal transduction', 'level': 2, 'score': 0.42695823}, {'id': 'https://openalex.org/C184235292', 'wikidata': 'https://www.wikidata.org/wiki/Q421851', 'display_name': 'Kinase', 'level': 2, 'score': 0.4059155}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.350837}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.34868932}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D002467', 'descriptor_name': 'Cell Nucleus', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D019869', 'descriptor_name': 'Phosphatidylinositol 3-Kinases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D018129', 'descriptor_name': 'Phosphatidylinositol Phosphates', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D010750', 'descriptor_name': 'Phosphoproteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D016475', 'descriptor_name': '3T3 Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D048868', 'descriptor_name': 'Adaptor Proteins, Signal Transducing', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001692', 'descriptor_name': 'Biological Transport', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001798', 'descriptor_name': 'Blood Proteins', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D001798', 'descriptor_name': 'Blood Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001923', 'descriptor_name': 'Brain Chemistry', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019556', 'descriptor_name': 'COS Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002467', 'descriptor_name': 'Cell Nucleus', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004789', 'descriptor_name': 'Enzyme Activation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005260', 'descriptor_name': 'Female', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017403', 'descriptor_name': 'In Situ Hybridization', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051379', 'descriptor_name': 'Mice', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009474', 'descriptor_name': 'Neurons', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D009474', 'descriptor_name': 'Neurons', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016716', 'descriptor_name': 'PC12 Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019869', 'descriptor_name': 'Phosphatidylinositol 3-Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018129', 'descriptor_name': 'Phosphatidylinositol Phosphates', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011247', 'descriptor_name': 'Pregnancy', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051381', 'descriptor_name': 'Rats', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017386', 'descriptor_name': 'Sequence Homology, Amino Acid', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016335', 'descriptor_name': 'Zinc Fingers', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.7.3919', 'pdf_url': 'http://www.jbc.org/article/S0021925819878596/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/9933577', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.7.3919', 'pdf_url': 'http://www.jbc.org/article/S0021925819878596/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 30, 'referenced_works': ['https://openalex.org/W1487365829', 'https://openalex.org/W1525343967', 'https://openalex.org/W1526250277', 'https://openalex.org/W1545503281', 'https://openalex.org/W1550981215', 'https://openalex.org/W1880055085', 'https://openalex.org/W1970587959', 'https://openalex.org/W1973837499', 'https://openalex.org/W1975642651', 'https://openalex.org/W1982720718', 'https://openalex.org/W1988904707', 'https://openalex.org/W2001234795', 'https://openalex.org/W2014295084', 'https://openalex.org/W2017499074', 'https://openalex.org/W2026973601', 'https://openalex.org/W2036931150', 'https://openalex.org/W2037258269', 'https://openalex.org/W2039185825', 'https://openalex.org/W2050498522', 'https://openalex.org/W2051878975', 'https://openalex.org/W2063975035', 'https://openalex.org/W2076790164', 'https://openalex.org/W2077673188', 'https://openalex.org/W2089073865', 'https://openalex.org/W2101168569', 'https://openalex.org/W2124913425', 'https://openalex.org/W2146157811', 'https://openalex.org/W2152344629', 'https://openalex.org/W2181316944', 'https://openalex.org/W2415639145'], 'related_works': ['https://openalex.org/W360280127', 'https://openalex.org/W3216857189', 'https://openalex.org/W2415255352', 'https://openalex.org/W2121079700', 'https://openalex.org/W2093057561', 'https://openalex.org/W2072253274', 'https://openalex.org/W2061282090', 'https://openalex.org/W2052082800', 'https://openalex.org/W2046808609', 'https://openalex.org/W2040399427'], 'abstract_inverted_index': {'PIP3BP': [0, 34, 44, 144, 159, 186, 220, 230, 330, 345, 857, 921, 974, 1023, 1051, 1064, 1092, 1095, 1113, 1340, 1388, 1442, 1699, 1735, 2161, 2262, 2331, 2345, 2356, 2366, 2385, 2414, 2611, 2635, 2652, 3052, 3067, 3194, 3225, 3274, 3306, 3473, 3484, 3499, 3506, 3529], 'is': [1, 187, 449, 453, 905, 970, 1033, 1642, 1881, 2367, 2689, 3295, 3323, 3329, 3340, 3346, 3394, 3447, 3485, 3530], 'a': [2, 11, 54, 163, 188, 197, 240, 349, 859, 863, 937, 1082, 1105, 1265, 1546, 1594, 1643, 1652, 1744, 1806, 1856, 1935, 1948, 1988, 2027, 2227, 2410, 2655, 2694, 2813, 2958, 3082, 3390, 3420, 3430, 3440, 3477], 'phosphatidylinositol': [3, 89, 189, 275, 382, 385, 390, 395, 488, 492, 931], '3,4,5-trisphosphate-binding': [4, 190], 'protein': [5, 40, 150, 165, 191, 226, 336, 351, 947, 1032, 1059, 1355, 1592, 1626, 1641, 1650, 1733, 1756, 1846, 2316, 2420, 2427, 2437, 2534, 2582, 3138, 3392], '(PIP3BP)': [6, 192], 'abundant': [7, 193, 906], 'in': [8, 59, 64, 69, 102, 121, 127, 146, 166, 183, 194, 245, 250, 255, 288, 307, 313, 332, 352, 369, 706, 772, 907, 915, 961, 1013, 1069, 1093, 1134, 1247, 1271, 1291, 1312, 1322, 1378, 1383, 1387, 1655, 1739, 1934, 1947, 2026, 2162, 2212, 2266, 2273, 2308, 2320, 2341, 2349, 2359, 2369, 2375, 2389, 2428, 2442, 2518, 2550, 2592, 2642, 2657, 2669, 2699, 2720, 2726, 2731, 2737, 2786, 2875, 2904, 2919, 2922, 2963, 3072, 3087, 3089, 3102, 3133, 3142, 3159, 3191, 3224, 3331, 3335, 3348, 3407, 3467, 3500], 'brain,': [9, 195, 908], 'containing': [10, 196, 1249, 1294, 1937], 'zinc': [12, 198, 938, 1884], 'finger': [13, 199, 939, 1885], 'motif': [14, 200, 940], 'and': [15, 29, 79, 96, 201, 215, 265, 282, 483, 491, 591, 714, 727, 766, 775, 949, 1022, 1118, 1129, 1241, 1268, 1306, 1320, 1328, 1362, 1439, 1545, 1705, 1799, 1932, 2005, 2012, 2034, 2063, 2151, 2186, 2190, 2192, 2228, 2244, 2276, 2284, 2311, 2422, 2459, 2631, 2678, 2680, 2749, 2754, 2772, 2885, 2934, 2952, 3053, 3059, 3064, 3081, 3293, 3312, 3413], 'two': [16, 202, 950, 1775, 1781, 1966, 2177], 'pleckstrin': [17, 203, 429], 'homology': [18, 204], '(PH)': [19, 205], 'domains.': [20, 206, 952], 'Staining': [21, 207], 'of': [22, 31, 33, 62, 88, 99, 111, 133, 137, 148, 180, 208, 217, 219, 248, 274, 285, 297, 319, 323, 334, 366, 420, 463, 712, 731, 764, 851, 918, 944, 1019, 1030, 1056, 1075, 1085, 1099, 1104, 1124, 1200, 1206, 1218, 1222, 1233, 1325, 1369, 1441, 1482, 1485, 1496, 1550, 1599, 1631, 1647, 1708, 1734, 1780, 1794, 1835, 1854, 1963, 1968, 2041, 2104, 2160, 2179, 2249, 2330, 2355, 2371, 2391, 2403, 2425, 2523, 2545, 2580, 2595, 2610, 2619, 2697, 2724, 2747, 2765, 2777, 2788, 2797, 2809, 2826, 2835, 2866, 2873, 2900, 2910, 2912, 3022, 3024, 3027, 3034, 3040, 3051, 3066, 3092, 3127, 3130, 3136, 3146, 3164, 3173, 3185, 3193, 3210, 3221, 3279, 3289, 3300, 3319, 3376, 3404, 3429, 3433, 3443, 3462, 3498, 3505, 3508, 3518, 3533, 3540, 3551], 'rat': [23, 209, 2163, 2173, 2294, 2376], 'brain': [24, 210, 2164, 2174], 'cells': [25, 211, 465, 1128, 1131, 1261, 1288, 1793, 1804, 1927, 2181, 2195, 2205, 2374, 2394, 2406, 2431, 2458, 2463, 2571, 2597, 2621, 2673, 2701, 2733, 2769, 2791, 2868, 2924, 2938, 3043, 3061, 3117, 3149, 3187, 3203, 3415], 'with': [26, 143, 212, 329, 1142, 1274, 1316, 1471, 1651, 1715, 1743, 1753, 1758, 1767, 1771, 1777, 1801, 2019, 2031, 2036, 2165, 2231, 2409, 2623, 2703, 2774, 3046, 3188], 'anti-PIP3BP': [27, 213, 2168], 'antibody': [28, 214, 1049], 'determination': [30, 216], 'localization': [32, 57, 218, 243, 1043, 1055, 2402, 2424, 2512, 3026, 3039, 3428], 'fused': [35, 221, 1800, 2415, 2539, 2954, 3078], 'to': [36, 47, 93, 154, 222, 233, 279, 340, 703, 722, 923, 927, 942, 958, 963, 973, 1008, 1024, 1050, 1067, 1091, 1357, 1597, 1635, 1843, 1871, 1974, 2100, 2156, 2253, 2416, 2535, 2540, 2583, 2615, 2692, 2955, 2960, 3013, 3079, 3123, 3195, 3228, 3232, 3362, 3396, 3456, 3487, 3513, 3536], 'the': [37, 48, 65, 94, 103, 122, 128, 134, 138, 149, 152, 155, 167, 184, 223, 234, 251, 280, 289, 308, 314, 320, 324, 335, 338, 341, 353, 370, 464, 723, 755, 916, 1017, 1028, 1031, 1041, 1070, 1073, 1100, 1122, 1150, 1201, 1216, 1223, 1226, 1230, 1234, 1236, 1242, 1258, 1287, 1338, 1375, 1379, 1384, 1444, 1479, 1483, 1486, 1494, 1636, 1648, 1656, 1697, 1706, 1754, 1768, 1784, 1795, 1802, 1836, 1841, 1873, 1883, 1964, 1969, 1980, 2006, 2042, 2044, 2102, 2158, 2172, 2180, 2203, 2209, 2216, 2236, 2247, 2257, 2267, 2274, 2277, 2312, 2321, 2372, 2400, 2417, 2423, 2426, 2429, 2443, 2446, 2519, 2533, 2536, 2551, 2570, 2577, 2581, 2584, 2596, 2606, 2613, 2616, 2643, 2658, 2670, 2681, 2727, 2738, 2762, 2766, 2789, 2799, 2810, 2820, 2827, 2833, 2867, 2871, 2876, 2898, 2905, 2913, 2920, 3015, 3032, 3038, 3047, 3060, 3090, 3093, 3103, 3109, 3121, 3125, 3137, 3140, 3147, 3160, 3186, 3196, 3208, 3211, 3230, 3280, 3290, 3298, 3310, 3313, 3317, 3332, 3336, 3349, 3353, 3359, 3397, 3405, 3408, 3450, 3457, 3463, 3481, 3488, 3501, 3509, 3534, 3538, 3541, 3552], 'green': [38, 224, 402, 1057, 2418], 'fluorescent': [39, 225, 403, 1058, 2419], '(GFP-PIP3BP)': [41, 227], 'revealed': [42, 228, 2200, 2633, 2869], 'that': [43, 115, 158, 173, 229, 301, 344, 359, 452, 484, 754, 910, 943, 1112, 1198, 1598, 2201, 2261, 2365, 2383, 2576, 2605, 2634, 2651, 2787, 2870, 2897, 3202, 3287, 3305, 3326, 3342, 3367, 3393, 3439, 3472, 3483, 3491], 'was': [45, 51, 67, 231, 237, 253, 752, 1026, 1065, 1077, 1096, 1147, 1203, 1344, 1365, 1476, 1491, 1662, 1700, 1729, 1737, 1789, 1862, 1869, 1888, 1985, 1993, 2098, 2153, 2298, 2305, 2318, 2332, 2346, 2386, 2432, 2438, 2516, 2565, 2586, 2590, 2639, 2667, 2729, 2742, 2770, 2779, 2783, 2801, 2829, 2879, 2892, 2916, 3068, 3114, 3155, 3275, 3383, 3511], 'targeted': [46, 232, 3372, 3395, 3455, 3486], 'nucleus.': [49, 185, 235, 371, 1094, 1981, 2268, 2537, 2617, 2659, 2671, 3502], 'Targeting': [50, 236], 'dependent': [52, 238], 'on': [53, 239, 1121, 1215, 2889, 3037, 3316], 'putative': [55, 241], 'nuclear': [56, 242, 1989, 2401, 2755, 2763, 2877, 2890, 3016, 3025, 3337, 3354, 3409, 3427, 3519], 'signal': [58, 244, 1086, 2696, 3521], 'PIP3BP.': [60, 246, 1487, 2524, 3301], 'Generation': [61, 247], 'PIP3': [63, 249, 864, 924, 1025, 1076, 2666, 2698, 2725, 2778, 2915, 2965, 3294], 'nucleus': [66, 95, 104, 123, 153, 252, 281, 290, 309, 339, 1101, 1117, 2370, 2390, 2552, 2585, 2644, 2728, 2906, 2921, 3088, 3141, 3161, 3197, 3281, 3311, 3398, 3458, 3489, 3510, 3535], 'detected': [68, 254, 1012, 1078, 2347, 2388, 2441, 2591, 2730, 2893, 2918, 3156], 'H2O2-treated': [70, 256, 2767, 2821, 3412], '293T': [71, 112, 257, 298, 1130, 2700, 2768, 2822, 2923, 3377], 'cells,': [72, 78, 113, 258, 264, 299, 2043, 2189, 2823, 2933], 'nerve': [73, 259, 442, 919], 'growth': [74, 81, 260, 267, 443, 447, 457], 'factor': [75, 82, 261, 268, 458, 461], '(NGF)-treated': [76, 262], 'PC12': [77, 263, 2457, 2932], 'platelet-derived': [80, 266, 446], '(PDGF)-treated': [83, 269], 'NIH': [84, 270, 2936], '3T3': [85, 271, 2937], 'cells.': [86, 135, 169, 272, 321, 355, 2351, 2361, 3378, 3464], 'Translocation': [87, 273], '3-kinase': [90, 101, 117, 142, 182, 276, 287, 303, 328, 368, 373, 725, 733, 1090, 1543, 1552, 2688, 2902, 3036, 3057, 3113, 3175, 3215, 3344, 3369, 3387], '(PI': [91, 277, 374, 494, 933], '3-kinase)': [92, 278, 375], 'enhanced': [97, 283], 'activity': [98, 284, 1007, 1123, 2903, 3318], 'PI': [100, 116, 141, 181, 286, 302, 327, 367, 380, 387, 392, 414, 421, 724, 732, 852, 928, 1089, 1108, 1125, 1542, 1551, 2687, 2901, 2929, 3035, 3056, 3095, 3112, 3174, 3214, 3320, 3327, 3343, 3368, 3386, 3434, 3444], 'fraction': [105, 291, 2323, 2764, 2878], 'were': [106, 292, 1132, 1210, 1239, 1245, 1262, 1269, 1289, 1310, 1390, 1554, 1717, 1750, 1764, 1797, 1838, 1928, 1952, 1972, 2008, 2017, 2046, 2206, 2271, 2287, 2357, 2407, 2454, 2674, 2683, 3044, 3062, 3085, 3100, 3118, 3204, 3226, 3416], 'observed': [107, 293, 2358, 3119], 'after': [108, 130, 294, 316, 456, 1079, 1831, 2882, 3373, 3459], 'H2O2': [109, 295, 2883, 3374], 'treatment': [110, 296, 2884, 3375], 'suggesting': [114, 157, 300, 343, 1081, 2260, 2575, 2832, 2896, 3201], 'can': [118, 160, 304, 346, 582, 758, 1114, 3307, 3351, 3370, 3453, 3474], 'be': [119, 176, 305, 362, 704, 913, 959, 1872, 2254, 2264, 2908, 3020, 3371, 3389, 3424, 3454, 3494], 'activated': [120, 306, 454, 2691, 3094], 'as': [124, 126, 162, 310, 312, 348, 588, 710, 845, 847, 858, 1052, 1054, 1154, 1392, 1665, 1719, 1891, 1987, 2010, 2048, 2067, 2734, 2736, 2950, 2957, 3476], 'well': [125, 311, 846, 1053, 2735, 3324], 'membrane': [129, 315, 2013, 2753, 3104, 3355], 'appropriate': [131, 317, 3460], 'stimulation': [132, 318, 462, 3461], 'Co-expression': [136, 322, 3129], 'constitutively': [139, 325, 412, 1106, 1540, 2927, 3054, 3110, 3212], 'active': [140, 326, 413, 1107, 1541, 2928, 3055, 3111, 3213], 'resulted': [145, 331, 3132, 3190], 'exportation': [147, 333, 3134, 3504, 3520], 'from': [151, 337, 1225, 1299, 1979, 2290, 2637, 3139, 3358, 3411], 'cytoplasm,': [156, 342], 'function': [161, 179, 347, 365, 917, 3475, 3497], 'PIP3-binding': [164, 350, 432, 860, 966, 2947, 3478], 'intact': [168, 354, 2430], 'These': [170, 356, 579, 2362, 2602, 3284, 3302], 'results': [171, 357, 2270, 2363, 2453, 2603, 2649, 3285, 3303, 3466], 'imply': [172, 358], 'there': [174, 360, 3492], 'may': [175, 361, 912, 2653, 2907, 3019, 3388, 3423, 3493], 'an': [177, 363, 450, 1323, 1349, 1468, 1472, 1500, 1628, 1778, 2624, 3495, 3516], 'unknown': [178, 364, 3496], 'Phosphatidylinositol': [372], '1The': [376], 'abbreviations': [377], 'used': [378, 1718, 1986, 2009, 2715, 2946, 3381], 'are:': [379], '3-kinase,': [381, 2930, 3435, 3445], '3-kinase;': [383, 415, 422], 'PIP3,': [384, 3233], '3,4,5-trisphosphate;': [386], '3,': [388], '4-P2,': [389], '3,4-bisphosphate;': [391], '4,': [393], '5-P2,': [394], '4,5-bisphosphate;': [396], 'GAP,': [397], 'GTPase': [398], 'activating': [399, 946], 'protein;': [400, 404, 427, 433], 'GFP,': [401, 2956], 'DMEM,': [405], "Dulbecco's": [406, 1135], 'modified': [407, 1136], 'minimal': [408, 1137], 'essential': [409, 1138], 'medium;': [410], 'BD110,': [411], 'BDKN,': [416], 'kinase': [417, 1547, 1644, 1657, 3170], 'negative': [418, 729, 1548, 1645, 3171], 'mutant': [419, 1342, 1549, 2559, 3273], 'GFAP,': [423], 'glial': [424, 1280, 2194, 2285, 2313, 2322, 2360], 'fiber': [425, 2314], 'acidic': [426, 2315], 'PH,': [428], 'homology;': [430], 'PIP3BP,': [431, 1467, 2404, 2546, 3041], 'GST,': [434], 'glutathione': [435], 'S-transferase;': [436], 'TLC,': [437], 'thin': [438], 'layer': [439, 1232], 'chromatography;': [440], 'NGF,': [441], 'factor;': [444], 'PDGF,': [445], 'factor.': [448], 'enzyme': [451], 'immediately': [455], 'or': [459, 930, 1341, 1710, 1721, 2528, 2664, 3105], 'differentiation': [460], '(1Stephens': [466], 'L.R.': [467, 675], 'Jackson': [468, 977], 'T.R.': [469], 'Hawkins': [470, 688], 'P.T.': [471, 689], 'Biochim.': [472, 1186], 'Biophys.': [473, 1187], 'Acta.': [474, 1188], '1993;': [475, 602, 1527], '1179:': [476], '27-75Crossref': [477], 'PubMed': [478, 511, 531, 557, 574, 608, 640, 669, 694, 745, 803, 837, 899, 1000, 1192, 1427, 1459, 1533, 1587, 1620, 1688, 1824, 1921, 2084, 2143, 2478, 2503, 2860, 2985, 3005, 3267], 'Scopus': [479, 532, 575, 641, 695, 746, 804, 838, 900, 1001, 1193, 1428, 1460, 1621, 1689, 1825, 1922, 2085, 2144, 2479, 2504, 2861, 2986, 3006, 3268], '(426)': [480], 'Google': [481, 512, 534, 558, 577, 609, 643, 670, 697, 748, 806, 840, 902, 1003, 1195, 1430, 1462, 1534, 1588, 1623, 1691, 1827, 1924, 2061, 2087, 2146, 2481, 2506, 2863, 2988, 3008, 3270], 'Scholar)': [482, 1196, 1431, 1925, 2062, 2507], 'generates': [485], 'second': [486], 'messengers,': [487], '3,4,5-trisphosphate': [489], '(PIP3)': [490], '3,4-bisphosphate': [493], '3,4-P2)': [495], '(2Shibasaki': [496], 'F.': [497, 687, 1511, 1517, 1903, 1905, 2490, 2993], 'Homma': [498, 2074], 'Y.': [499, 624, 735, 788, 876, 882, 886, 892, 1165, 1171, 1185, 1404, 1410, 1414, 1420, 1507, 1515, 1558, 1580, 1679, 1815, 1895, 1915, 2052, 2071, 2075, 2077, 2111, 2131, 2846, 3244, 3250, 3254, 3260], 'Takenawa': [500, 1518], 'T.': [501, 567, 677, 872, 884, 1161, 1167, 1400, 1412, 1519, 1817, 1897, 1899, 1909, 1911, 3240, 3252], 'J.': [502, 548, 599, 620, 636, 740, 780, 826, 894, 989, 1422, 1524, 1581, 1819, 2079, 2132, 2492, 3001, 3262], 'Biol.': [503, 549, 600, 660, 827, 990, 1525, 2133, 2976], 'Chem.': [504, 550, 601, 828, 991, 1526, 2134], '1991;': [505, 1821, 2058], '266:': [506], '8108-8114Abstract': [507], 'Full': [508, 528, 554, 605, 664, 666, 832, 834, 995, 997, 1530, 2138, 2140, 2980, 2982], 'Text': [509, 529, 555, 606, 665, 667, 833, 835, 996, 998, 1531, 2139, 2141, 2981, 2983], 'PDF': [510, 530, 556, 607, 668, 836, 999, 1532, 2142, 2984], 'Scholar,': [513, 535, 559, 610, 644, 671, 807, 2482, 2989], '3Auger': [514], 'K.R.': [515, 541], 'Serunian': [516], 'L.A.': [517, 2465], 'Soltoff': [518], 'S.P.': [519], 'Libby': [520], 'P.': [521, 658], 'Cantley': [522, 546, 568, 812], 'L.C.': [523, 547, 813], 'Cell.': [524], '1989;': [525], '57:': [526], '167-175Abstract': [527], '(682)': [533], '4Carpenter': [536], 'C.L.': [537], 'Duckworth': [538], 'B.C.': [539], 'Auger': [540], 'Cohen': [542, 657], 'B.': [543, 784], 'Schaffhausen': [544], 'B.S.': [545], '1990;': [551], '265:': [552], '19704-19711Abstract': [553], '5Whitman': [560], 'M.': [561, 565, 1562, 1570, 1677, 1907, 1913, 2107, 2121, 2844], 'Downes': [562, 649], 'C.P.': [563, 650], 'Keeler': [564], 'Keller': [566], 'L.': [569], 'Nature.': [570], '1988;': [571], '332:': [572], '644-646Crossref': [573], '(739)': [576], 'Scholar).': [578, 698, 749, 841, 903, 1004, 1463, 1535, 1589, 1624, 1692, 1828, 2088, 2147, 2864, 3009, 3271], '3′-phosphorylated': [580, 756], 'phosphoinositides': [581, 757], 'activate': [583, 759], 'serine,': [584], 'threonine': [585], 'kinases': [586, 848], 'such': [587, 709, 2949], 'PKB/Akt,': [589], 'PKCs,': [590], 'PDKs': [592], '(6Nakanishi': [593], 'H.': [594, 1183, 1505, 1521, 1572, 1574, 2056, 2123, 2125, 2840, 2842], 'Brewer': [595], 'K.A.': [596], 'Exton': [597], 'J.H.': [598], '268:': [603, 1528, 1618], '13-16Abstract': [604], '7Akimoto': [611], 'K.': [612, 622, 628, 782, 868, 880, 888, 1163, 1177, 1396, 1408, 1416, 1513, 1560, 1566, 1813, 2117, 2486, 2968, 2991, 3236, 3248, 3256], 'Takahashi': [613], 'R.': [614, 874, 1169, 1402, 2488, 3242], 'Moriya': [615], 'S.': [616, 626, 630, 634, 737, 739, 823, 870, 878, 890, 1173, 1179, 1181, 1398, 1406, 1418, 1454, 1509, 1564, 1568, 1578, 1669, 1681, 1811, 1901, 2109, 2115, 2119, 2473, 2498, 2850, 3238, 3246, 3258], 'Nishioka': [617, 1506], 'N.': [618, 1523, 2073, 2113], 'Takayanagi': [619], 'Kimura': [621, 887, 1415, 1559, 3255], 'Fukui': [623, 891, 1184, 1419, 1514, 1579, 2076, 2130, 3259], 'Osada': [625], 'Mizuno': [627], 'Hirai': [629], 'Kazlauskas': [631], 'A.': [632, 980, 1175, 1455, 1609, 1671, 1675, 2474, 2499], 'Ohno': [633], 'EMBO': [635], '1996;': [637, 992, 2081, 2857], '15:': [638, 1686], '788-798Crossref': [639], '(257)': [642], '8Alessi': [645], 'D.R.': [646], 'James': [647], 'S.R.': [648], 'Holmes': [651, 684], 'A.B.': [652, 685, 988], 'Gaffney': [653, 678], 'P.R.J.': [654, 679], 'Reese': [655, 680], 'C.B.': [656, 681], 'Curr.': [659, 2975], '1997;': [661, 691, 896, 1424, 2135, 3264], '7:': [662], '261-269Abstract': [663], '9Stokoe': [672], 'D.': [673, 798], 'Stephens': [674], 'Copeland': [676], 'Painter': [682], 'G.F.': [683], 'McCormick': [686], 'Science.': [690, 799, 1616], '277:': [692], '567-570Crossref': [693], '(1048)': [696], 'They': [699, 1309], 'are': [700, 720, 849, 956, 2182, 2752, 3525], 'also': [701, 2387, 2640, 2917], 'suggested': [702, 2235, 3227], 'involved': [705, 771, 914, 960], 'other': [707], 'events': [708], 'rearrangement': [711, 774], 'cytoskeleton': [713], 'vesicle': [715, 776], 'transport': [716], 'because': [717, 2301, 2909, 3021, 3399], 'these': [718, 3028], 'phenomena': [719], 'sensitive': [721], 'inhibitors': [726], 'dominant': [728], 'mutants': [730, 1382], '(10Fukui': [734], 'Ihara': [736, 1563, 2114], 'Nagata': [738, 889, 1172, 1417, 1577, 1900, 2108, 3257], 'Biochem.': [741, 895, 1423, 2080, 3000, 3263], '1998;': [742, 800, 829, 1189, 1584, 1918, 2977, 3002], '124:': [743], '1-7Crossref': [744], '(42)': [747], 'Recently,': [750, 2942], 'it': [751, 911, 2782], 'reported': [753, 1601], 'guanine': [760], 'nucleotide': [761], 'exchanging': [762], 'factors': [763], 'Rac': [765], 'Arf,': [767], 'small': [768, 2191, 3441], 'G': [769, 843], 'proteins': [770, 844, 2614, 2828, 3406], 'actin': [773], 'transport,': [777], 'respectively': [778, 2757], '(11Han': [779], 'Luby-Phelps': [781], 'Das': [783], 'Shu': [785], 'X.': [786], 'Xia': [787], 'Mosteller': [789], 'R.D.': [790], 'Krishna': [791], 'U.M.': [792], 'Falck': [793], 'J.R.': [794], 'White': [795], 'M.A.': [796], 'Broek': [797], '279:': [801], '558-560Crossref': [802], '(710)': [805], '12Klarlund': [808], 'J.K.': [809], 'Remeh': [810], 'L.E.': [811], 'Buxton': [814], 'J.M.': [815, 2972, 2997], 'Holik': [816], 'J.J.': [817], 'Sakelis': [818], 'C.': [819, 825, 2848], 'Patki': [820], 'V.': [821], 'Corvera': [822], 'MP': [824], '273:': [830], '1859-1862Abstract': [831], '(146)': [839], 'Therefore,': [842, 3480], 'downstream': [850], '3-kinase.': [853, 1109, 1126, 3096, 3321], 'We': [854, 2525, 2660, 2713, 3365, 3524, 3543], 'have': [855, 2945], 'identified': [856], 'protein,': [861, 967], 'using': [862, 1047, 1374, 2094, 2336, 2379, 2456, 2812], 'analogue': [865], 'column': [866, 2096, 2815], '(13Tanaka': [867, 1395, 3235], 'Imajoh-Ohmi': [869, 1397, 3237], 'Swada': [871, 1399, 3239], 'Shirai': [873, 883, 1157, 1168, 1401, 1411, 3241, 3251], 'Hashimoto': [875, 1170, 1403, 3243], 'Iwasaki': [877, 1405, 3245], 'Kaibuchi': [879, 1407, 1565, 2116, 3247], 'Kanaho': [881, 1409, 3249], 'Terada': [885, 1164, 1413, 3253], 'Eur.': [893, 1421, 2078, 3261], '245:': [897, 1425, 3265], '512-519Crossref': [898, 1426, 3266], '(82)': [901, 1429, 3269], 'It': [904, 935, 3322, 3339], 'implying': [909], 'systems.': [920], 'binds': [922, 1634], 'but': [925], 'not': [926, 2220, 2280, 2509, 2529, 2665, 2784, 2817, 3167, 3177, 3205, 3276], '3,4-P2': [929], '4,5-bisphosphate': [932], '4,5-P2).': [934], 'has': [936, 1010, 1593, 1627], 'homologous': [941, 972], 'Arf-GTPase': [945], '(GAP)': [948], 'PH': [951, 954, 1385, 3222, 3291], 'Both': [953], 'domains': [955, 1386, 3223, 3292], 'shown': [957, 2340, 2719, 3071], 'binding': [962, 1018, 3231], 'PIP3.': [964, 3017, 3364], 'Another': [965], 'centaurin': [968, 1020], 'α,': [969], 'highly': [971], '(14Hammonds-Odie': [975], 'L.P.': [976], 'T.R.A.': [978], 'Profit': [979], 'Blader': [981], 'I.J.': [982], 'Turck': [983], 'C.W.': [984], 'Prestwich': [985], 'G.D.': [986], 'Teibert': [987], '271:': [993], '18859-18868Abstract': [994], '(142)': [1002], 'No': [1005, 2352], 'GAP': [1006], 'Arf': [1009], 'been': [1011], 'either': [1014], 'protein.': [1015, 3479, 3542], 'Although': [1016, 3419], 'α': [1021], 'specific,': [1027], 'role': [1029, 2656, 3539], 'unclear.': [1034], 'To': [1035, 1464, 2398, 3030], 'address': [1036], 'this': [1037, 2530, 2716, 3179, 3436, 3468], 'question,': [1038], 'we': [1039], 'determined': [1040, 1870, 2662], 'intracellular': [1042], 'by': [1044, 1102, 1149, 1156, 1212, 1228, 1367, 1432, 1443, 1499, 1602, 1805, 1847, 1930, 2065, 2208, 2334, 2629, 2676, 2685, 2744, 2803, 3207, 3449], 'immunological': [1045], 'techniques,': [1046], 'monoclonal': [1048, 1725, 2169], '(GFP)': [1060], 'fusion': [1061, 1354, 1732, 2436], 'proteins.': [1062, 3029], 'Surprisingly,': [1063], 'found': [1066, 2307, 2319, 2517, 3366], 'localize': [1068], 'nucleus,': [1071, 2444, 3333], 'where': [1072], 'generation': [1074, 2723, 2776], 'stimulation,': [1080], 'new': [1083], 'pathway': [1084], 'transduction': [1087], 'through': [1088, 1264], 'exported': [1097, 3277, 3531], 'out': [1098, 1664, 1890, 2155, 3135, 3278, 3507, 3532], 'expression': [1103, 1350, 1501, 1537, 2159, 2238, 2625, 3050, 3163, 3209], 'This': [1110, 3018, 3272], 'suggests': [1111, 3490], 'shuttle': [1115, 3308], 'between': [1116, 1875, 3309], 'cytoplasm': [1119, 3314], 'depending': [1120, 3315], 'COS-7': [1127, 2405, 2620, 3042], 'cultured': [1133, 1321], 'medium': [1139, 1293], '(DMEM)': [1140], 'supplemented': [1141, 1273, 2030], '10%': [1143, 1250, 1275], 'calf': [1144], 'serum.': [1145], 'Transfection': [1146], 'done': [1148, 1973, 2099, 2300], 'calcium': [1151], 'phosphate': [1152], 'method': [1153, 1446, 1809], 'described': [1155, 1393, 1555, 1666, 1892, 2049, 2068], 'et': [1158, 1604, 2708], 'al.': [1159, 1605], '(15Shirai': [1160], 'Tanaka': [1162, 2843], 'Sawada': [1166], 'Iwamatsu': [1174], 'Okawa': [1176], 'Li': [1178], 'Hattori': [1180], 'Mano': [1182], '1402:': [1190], '292-302Crossref': [1191], '(47)': [1194], 'except': [1197], 'pH': [1199], 'buffer': [1202, 1936], '7.00': [1204], 'instead': [1205], '7.15.': [1207], 'Pregnant': [1208], 'mice': [1209, 1749], 'sacrificed': [1211], 'cervical': [1213], 'dislocation': [1214], '18th-day': [1217], 'gestation.': [1219], 'After': [1220, 1783, 1851, 1945, 1961, 2039], 'isolation': [1221], 'embryos': [1224], 'uterus,': [1227], 'cutting': [1229], 'outer': [1231], 'pelvis,': [1235], 'fetal': [1237, 1251, 1276], 'meninges': [1238], 'removed': [1240], 'cerebral': [1243, 2213], 'cortices': [1244], 'placed': [1246], 'DMEM': [1248, 1272], 'bovine': [1252, 1277], 'serum': [1253, 1278], '(Life': [1254], 'Technologies,': [1255, 1301], 'Inc.).': [1256], 'Following': [1257], 'mechanical': [1259], 'dissociation,': [1260], 'passed': [1263], '#100': [1266], 'mesh,': [1267], 'suspended': [1270, 1290], 'for': [1279, 1352, 1435, 1539, 1840, 1866, 1958, 2000, 2023, 2413, 2627, 2711, 3049, 3297, 3426, 3548], 'cell': [1281, 1285], 'culture.': [1282], 'For': [1283], 'neuronal': [1284, 2188, 2204, 2283, 2309, 2350, 2373], 'culture,': [1286], 'neurobasal': [1292], '2%': [1295], 'B27': [1296], 'supplement': [1297], '(both': [1298], 'Life': [1300], 'Inc.),': [1302], '74': [1303], 'μg/ml': [1304], 'l-glutamine': [1305], '25': [1307, 2032], 'μml-glutamate.': [1308], 'plated': [1311], 'culture': [1313, 1833], 'dishes': [1314], 'coated': [1315], 'poly-l-lysine': [1317], '(100': [1318], 'μg/ml)': [1319], 'atmosphere': [1324], '95%': [1326], 'air': [1327], '5%': [1329], 'CO2': [1330], 'at': [1331, 1478, 1954, 1996, 3356], '36': [1332], '°C.': [1333], 'A': [1334, 1693, 1724, 2557], 'cDNA': [1335, 1484, 1694], 'fragment': [1336, 1695], 'encoding': [1337, 1696], 'full-length': [1339, 1698], 'PIP3BPs': [1343, 3077], 'subcloned': [1345, 1701], 'into': [1346, 1702], 'pEGFP': [1347], 'c-1,': [1348], 'vector': [1351, 1502, 2626], 'GFP': [1353, 2538, 2588, 2638, 3080], '(CLONTECH),': [1356], 'produce': [1358, 3363], 'pEGFP-PIP3BP,': [1359], 'pEGFP-PIP3BP(−NLS),': [1360], 'pEGFP(+NLS),': [1361], 'pEGFP-PIP3BP(−PH).': [1363], 'PIP3BP-NLS': [1364], 'constructed': [1366], 'deletion': [1368, 2558], 'amino': [1370, 1638, 1876, 2520, 2543, 2561, 2607], 'acid': [1371, 1877, 2562, 2608], '1–9': [1372, 2563], 'residues': [1373], 'restriction': [1376], 'site,XhoI,': [1377], 'cDNA.': [1380], 'Point': [1381, 3219], '(PIP3BP-PH)': [1389], 'introduced': [1391], 'previously': [1394, 1556, 1667, 1893, 2050, 2069, 3234], 'substituting': [1433], 'Cys': [1434], 'Arg': [1436], '(residues': [1437], '149': [1438], '272)': [1440], 'Kunkel': [1445], '(16Kunkel': [1447], 'T.A.': [1448], 'Proc.': [1449, 2468, 2493, 2853], 'Natl.': [1450, 2469, 2494, 2854], 'Acad.': [1451, 2470, 2495, 2855], 'Sci.': [1452, 1583, 2471, 2496, 2856], 'U.': [1453, 1576, 2127, 2472, 2497, 2852], '1985;': [1456], '82:': [1457], '488-492Crossref': [1458], '(4900)': [1461], 'obtain': [1465], 'Myc-tagged': [1466], 'Myc-tag': [1469], 'sequence': [1470, 2531], 'initiation': [1473], 'codon,': [1474], 'ATGGAACAGAAGCTGATCTCAGAAGAAGATCT,': [1475], 'attached': [1477], '5′': [1480], 'end': [1481], 'The': [1488, 1536, 1590, 1625, 1864, 1926, 1982, 1991, 2003, 2434, 2647, 2740, 2795, 3116, 3169, 3379, 3465, 3503], 'resulting': [1489, 1983], 'gene': [1490], 'expressed': [1492, 1738], 'under': [1493, 3120], 'control': [1495], 'SRα': [1497], 'promoter': [1498], 'pMIKNeo': [1503], '(17Hayashi': [1504], 'Kamohara': [1508], 'Kanai': [1510], 'Ishii': [1512], 'Shibasaki': [1516], 'Kido': [1520], 'Katsunuma': [1522], '7107-7117Abstract': [1529], 'vectors': [1538], '(BD110)': [1544], '(BDKN)': [1553], '(18Kita': [1557], 'Kobayashi': [1561], 'Kuroda': [1567, 2118, 2849], 'Ui': [1569, 2120], 'Iba': [1571, 2122], 'Konishi': [1573, 2124, 2707], 'Kikkawa': [1575, 2126, 2851], 'Cell': [1582, 2296], '111:': [1585], '907-915Crossref': [1586], 'BD110': [1591, 1649, 3131, 3165], 'structure': [1595], 'similar': [1596], 'p110*': [1600], 'Hu': [1603], '(19Hu': [1606], 'Q.J.': [1607], 'Klippel': [1608], 'Muslin': [1610], 'A.J.': [1611], 'Fantl': [1612], 'W.J.': [1613], 'Williams': [1614], 'L.T.': [1615], '1995;': [1617], '100-102Crossref': [1619], '(517)': [1622], 'inter-SH2': [1629], 'domain': [1630], 'p85,': [1632], 'which': [1633, 1788, 1880, 2751, 3345, 3446], 'p110': [1637], 'terminus.': [1639], 'BDKN': [1640], 'counterpart': [1646], 'point': [1653], 'mutation': [1654], 'domain.': [1658], 'In': [1659, 2148, 2171, 2198, 2819, 3097], 'situ': [1660, 2149], 'hybridization': [1661, 2150], 'carried': [1663, 1889, 2154], '(20Hirota': [1668], 'Ito': [1670], 'Morii': [1672], 'E.': [1673], 'Wanaka': [1674], 'Tohyama': [1676], 'Kitamura': [1678], 'Nomura': [1680], 'Mol.': [1682], 'Brain': [1683], 'Res.': [1684], '1992;': [1685], '47-54Crossref': [1687], '(216)': [1690], 'pBluescript': [1703], 'SK(+),': [1704], 'transcripts': [1707], 'T7': [1709], 'T3': [1711], 'RNA': [1712], 'polymerase': [1713], 'labeled': [1714, 2018], 'digoxigenin': [1716], 'antisense': [1720, 2210], 'sense': [1722, 2217], 'probes.': [1723], 'antibody,': [1726], 'mAb': [1727, 1860, 1867, 2166, 2250, 2337, 2380], '13–14,': [1728, 2167], 'produced.': [1730], 'GST': [1731], '(GST-PIP3BP)': [1736], 'Escherichia': [1740], 'coliand': [1741], 'purified': [1742, 1755, 1844], 'glutathione-Sepharose': [1745], 'column.': [1746], 'Eight-week-old': [1747], 'male': [1748], 'injected': [1751], 'subcutaneously': [1752, 1766], 'mixed': [1757, 1770], 'complete': [1759], "Freund's": [1760, 1773], 'adjuvant.': [1761], 'Booster': [1762], 'injections': [1763], 'given': [1765, 1790], 'antigen': [1769], 'incomplete': [1772], 'adjuvant': [1774], 'times': [1776], 'interval': [1779], 'weeks.': [1782], 'final': [1785], 'booster': [1786], 'injection,': [1787], 'intravenously,': [1791], 'spleen': [1792], 'mouse': [1796], 'taken': [1798], 'SP2/O': [1803], 'polyethylene': [1807], 'glycol': [1808], '(21Nagata': [1810], 'Yamamoto': [1812], 'Ueno': [1814, 1914], 'Kurata': [1816], 'Chiba': [1818], 'Hybridoma.': [1820], '10:': [1822], '317-322Crossref': [1823], '(8)': [1826], 'Ten': [1829], 'days': [1830], 'fusion,': [1832], 'supernatant': [1834, 1992, 2004], 'hybridomas': [1837], 'examined': [1839, 2333], 'reactivity': [1842], 'GST-PIP3BP': [1845], 'enzyme-linked': [1848], 'immunosorbent': [1849], 'assay.': [1850], 'several': [1852, 2943], 'cycles': [1853, 1967], 'cloning,': [1855], 'hybridoma': [1857], 'clone': [1858], 'producing': [1859], '13–14': [1861, 1868, 2251, 2381], 'established.': [1863], 'epitope': [1865], 'region': [1874], 'position': [1878], '42–109,': [1879], 'within': [1882, 2256, 3198], 'motif.': [1886], 'Immunostaining': [1887, 2378], '(22Yoshida': [1894], 'Tsutsumi': [1896], 'Makita': [1898], 'Tashiro': [1902], 'Yoshida': [1904], 'Sekijima': [1906], 'Shin-ichi': [1908], 'Harada': [1910], 'Keizo': [1912], 'Toxicol.': [1916], 'Pathol.': [1917], '26:': [1919], '411-418Crossref': [1920], '(66)': [1923], 'collected': [1929], 'centrifugation': [1931, 2632], 'resuspended': [1933], '20': [1938], 'mmTris-Cl': [1939], '(pH': [1940], '7.5),': [1941], '10': [1942, 2704], 'mm': [1943], 'CaCl2.': [1944], 'homogenization': [1946], 'Dounce': [1949], 'homogenizer,': [1950], 'they': [1951, 3011, 3099], 'centrifuged': [1953], '1,000': [1955], '×': [1956, 1998], 'g': [1957, 1999], '5': [1959], 'min.': [1960, 2002], 'removal': [1962], 'supernatant,': [1965], 'same': [1970, 2237], 'procedure': [1971], 'remove': [1975], 'any': [1976], 'non-nuclear': [1977], 'membranes': [1978], 'pellet': [1984, 2007], 'fraction.': [1990], 'further': [1994], 'ultracentrifugated': [1995], '100,000': [1997], '30': [2001, 3199], 'cytosolic': [2011, 3106, 3360], 'fractions,': [2014], 'respectively.': [2015], 'Cells': [2016], '[32P]orthophosphate': [2020], '(1': [2021], 'mCi/ml)': [2022], '4': [2024], 'h': [2025], 'phosphate-free': [2028], 'MEM': [2029], 'mmHepes-NaOH': [2033], 'treated': [2035, 2702], 'various': [2037], 'stimuli.': [2038], 'fractionation': [2040, 2297, 2741], 'lipids': [2045, 2682], 'extracted': [2047], '(23Fukui': [2051], 'Saltiel': [2053], 'A.R.': [2054], 'Hanafusa': [2055], 'Oncogene.': [2057], '6:': [2059], '407-411PubMed': [2060], 'analyzed': [2064, 2684], 'TLC': [2066, 2105], '(24Kabuyama': [2070], 'Nakatsu': [2072, 2112], '238:': [2082], '350-356Crossref': [2083], '(12)': [2086], 'High': [2089], 'performance': [2090, 2805], 'liquid': [2091, 2806], 'chromatography': [2092, 2807], 'analysis': [2093, 2234, 2808], 'SAX5': [2095, 2814], '(Whatman)': [2097], 'confirm': [2101, 2399], 'result': [2103], '(25Kobayashi': [2106], 'Kita': [2110], 'Saitoh': [2128], 'I.': [2129], '272:': [2136], '16089-16092Abstract': [2137], '(122)': [2145], 'immunostaining': [2152, 2233, 2447], 'determine': [2157], 'antibody.': [2170], 'section,': [2175], 'roughly': [2176], 'types': [2178], 'clearly': [2183, 2780, 3470], 'seen:': [2184], 'large': [2185], 'round-shaped': [2187], 'sharp-shaped': [2193], '(Fig.1': [2196], 'A).': [2197, 2941], 'situhybridization': [2199], 'only': [2202], 'stained': [2207], 'probe': [2211, 2218], 'cortex,': [2214], 'whereas': [2215, 3153], 'did': [2219, 3176], 'give': [2221, 2693], 'clear': [2222], 'signals': [2223], '(Fig.': [2224, 2240, 2324, 2395, 2449, 2553, 2572, 2598, 2758, 2792, 2939, 3150, 3181, 3216], '1': [2225, 2241, 2325, 2343, 2396, 2450, 2554, 2573, 2599], 'A,': [2226, 2242, 2722, 3075], 'b).': [2229], 'Consistent': [2230], 'this,': [2232], 'pattern': [2239], 'c': [2243], 'd).': [2245, 2601], 'Interestingly,': [2246], 'staining': [2248, 3402], 'appeared': [2252], 'restricted': [2255], 'hematoxylin-stained': [2258], 'areas,': [2259], 'might': [2263], 'located': [2265, 2641], 'Similar': [2269, 2452], 'obtained': [2272, 2455], 'hippocampus': [2275], 'cerebellum': [2278], '(data': [2279, 2508, 2816, 3166], 'shown).': [2281, 2510, 2818, 3168], 'Primary': [2282], 'cultures': [2286], 'prepared': [2288, 2771], 'separately': [2289], 'embryonic': [2291], 'day': [2292], '18': [2293], 'brains.': [2295], 'correctly': [2299], 'neuron-specific': [2302], 'enolase': [2303], '(NSE)': [2304], 'specifically': [2306], 'fraction,': [2310], '(GFAP)': [2317], 'B,': [2326, 2344, 3515], 'bottom': [2327], 'part).': [2328], 'Expression': [2329], 'immunoblotting': [2335], '13–14.': [2338], 'As': [2339, 2718, 3070], 'Fig.': [2342, 3073], 'exclusively': [2348, 2440, 2549, 3158], 'detectable': [2353], 'amounts': [2354], 'suggest': [2364, 2604, 2650, 3286, 3304], 'localized': [2368, 2548, 3101], 'brain.': [2377], 'showed': [2382], 'native': [2384], 'neuroblastoma,': [2392], 'Neuro2A': [2393], 'C).': [2397, 2760], 'transfected': [2408, 2622, 3045, 3148], 'construct': [2411], 'coding': [2412], '(GFP-PIP3BP),': [2421], 'analyzed.': [2433], 'GFP-PIP3BP': [2435], 'almost': [2439, 3157, 3417], 'supporting': [2445], 'data': [2448], 'D,a).': [2451], 'neuroblastoma': [2460], 'Neuro': [2461], '2A': [2462], '(26Greene': [2464], 'Tischler': [2466], 'A.S.': [2467], '1976;': [2475], '73:': [2476], '2424-2428Crossref': [2477], '(4861)': [2480], '27Olmsted': [2483], 'J.B.': [2484], 'Carlson': [2485], 'Klebe': [2487], 'Ruddle': [2489], 'Rosenbaum': [2491], '1970;': [2500], '65:': [2501], '129-136Crossref': [2502], '(261)': [2505], 'Nuclear': [2511], 'signal-like': [2513], 'motif,': [2514], 'KERRK,': [2515], 'terminus': [2521], 'part': [2522], 'tested': [2526], 'whether': [2527, 2663], 'directs': [2532], 'amino-terminal': [2541], '14': [2542], 'acids': [2544], 'MAKERRKAVLELLQ,': [2547], 'D,': [2555, 2600], 'c).': [2556], 'lacking': [2560], '(GFP-PIP3BP(−NLS))': [2564], 'diffusely': [2566], 'distributed': [2567], 'all': [2568, 2593], 'over': [2569], 'D,b),': [2574], 'targeting': [2578], 'mechanism': [2579], 'absent.': [2587], 'alone': [2589], 'parts': [2594], '1–14': [2609], 'targets': [2612], 'Fractionation': [2618, 2865], 'Myc-PIP3BP': [2628], 'homogenizing': [2630], 'free': [2636], '(see': [2645], 'below).': [2646], 'above': [2648], 'play': [2654], 'therefore': [2661], 'generated': [2668], 'Various': [2672], 'stimulated': [2675], 'agonists': [2677], 'fractionated,': [2679], 'TLC.': [2686], 'strongly': [2690], 'strong': [2695], 'mmH2O2.': [2705], '2H.': [2706], 'al.,': [2709], 'submitted': [2710], 'publication.': [2712], 'first': [2714], 'system.': [2717], 'Fig.2': [2721], 'those': [2732], 'membrane.': [2739, 3338], 'confirmed': [2743, 2802], 'Western': [2745], 'blotting': [2746], 'Src': [2748], 'Myc,': [2750], 'proteins,': [2756, 2948], '2': [2759, 2793, 2940], 'When': [2761], 'incubated': [2773], '[32P]ATP-MgCl2,': [2775], 'detected;': [2781], 'seen': [2785], 'untreated': [2790], 'B).': [2794, 3183, 3218, 3283], 'presence': [2796], 'PIP3in': [2798], 'samples': [2800], 'high': [2804], 'lipids,': [2811], 'tyrosine': [2824, 2887], 'phosphorylation': [2825, 2888], 'extremely': [2830], 'elevated,': [2831], 'activation': [2834, 2899], 'many': [2836], 'signaling': [2837], 'pathways': [2838], '(28Konishi': [2839], 'Matsuzaki': [2841], 'Ono': [2845], 'Tokunaga': [2847], '93:': [2858], '7639-7643Crossref': [2859], '(189)': [2862], 'level': [2872], 'p85': [2874, 2891], 'markedly': [2880], 'elevated': [2881], 'considerable': [2886, 3431], '(Fig.2': [2894], 'C),': [2895], 'relocalization': [2911, 3126], 'enzyme.': [2914], 'transiently': [2925], 'expressed,': [2926], 'NGF-treated': [2931], 'PDGF-treated': [2935], 'groups': [2944], 'ARNO': [2951], 'GRP1,': [2953], 'means': [2959], 'visualize': [2961], 'changes': [2962], 'cellular': [2964], 'levels': [2966], '(29Venkateswarlu': [2967], 'Oatey': [2969, 2994], 'P.B.': [2970, 2995], 'Tavare': [2971, 2996], 'Cullen': [2973, 2998], 'P.J.': [2974, 2999], '8:': [2978], '463-466Abstract': [2979], '(224)': [2987], '30Venkateswarlu': [2990], 'Gunn-Moore': [2992], '335:': [3003], '139-146Crossref': [3004], '(118)': [3007], 'However,': [3010], 'failed': [3012], 'detect': [3014, 3124], 'failure': [3023], 'test': [3031], 'effect': [3033, 3180], 'constructs': [3048], '(BD110),': [3058], 'fractionated': [3063, 3086], 'distribution': [3065], 'determined.': [3069], '3': [3074, 3151, 3182, 3217], 'both': [3076], 'Myc': [3083], 'tag': [3084], 'absence': [3091], 'contrast,': [3098], 'fractions': [3107, 3410], 'when': [3108], 'co-expressed.': [3115], 'microscope': [3122], 'GFP-PIP3BP.': [3128], 'more': [3143], 'than': [3144], '75%': [3145], 'B),': [3152], 'fluorescence': [3154], 'without': [3162], 'version': [3172], 'cause': [3178], 'Treatment': [3184], 'wortmannin': [3189], 'relocation': [3192, 3299], 'min,': [3200], 'damaged': [3206], 'mutations': [3220], 'abolish': [3229], '(Fig.3': [3282], 'interaction': [3288], 'responsible': [3296], 'known': [3325], '4,5-P2': [3328], 'present': [3330, 3347, 3451], 'probably': [3334], 'possible': [3341], 'cytosol': [3350], 'approach': [3352], 'least': [3357], 'side': [3361], 'condition': [3380, 3422], 'here': [3382], 'artificial;': [3384], 'however,': [3385], 'specific': [3391], 'Coomassie': [3400], 'Blue': [3401], 'patterns': [3403], '-untreated': [3414], 'identical.': [3418], 'drastic': [3421], 'required': [3425], 'amount': [3432, 3442], 'finding': [3437], 'implicates': [3438], 'undetectable': [3448], 'methods,': [3452], 'paper': [3469], 'indicate': [3471], 'fact': [3482], 'resistant': [3512], 'leptomycin': [3514], 'inhibitor': [3517], '(NES)-dependent': [3522], 'exportation.': [3523], 'currently': [3526], 'examining': [3527], 'how': [3528], 'understand': [3537], 'thank': [3544], 'Dr.': [3545], 'Kathy': [3546], 'Barker': [3547], 'critical': [3549], 'reading': [3550], 'paper.': [3553]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2122434534', 'counts_by_year': [{'year': 2023, 'cited_by_count': 4}, {'year': 2022, 'cited_by_count': 1}, {'year': 2021, 'cited_by_count': 1}, {'year': 2020, 'cited_by_count': 2}, {'year': 2019, 'cited_by_count': 3}, {'year': 2018, 'cited_by_count': 2}, {'year': 2017, 'cited_by_count': 2}, {'year': 2016, 'cited_by_count': 1}, {'year': 2015, 'cited_by_count': 3}, {'year': 2014, 'cited_by_count': 1}, {'year': 2013, 'cited_by_count': 2}, {'year': 2012, 'cited_by_count': 2}], 'updated_date': '2025-01-10T19:29:55.936105', 'created_date': '2016-06-24'}