Publication Information

{'id': 'https://openalex.org/W2118369585', 'doi': 'https://doi.org/10.1074/jbc.m303840200', 'title': 'Mutation of Leu-536 in Human Estrogen Receptor-α Alters the Coupling between Ligand Binding, Transcription Activation, and Receptor Conformation', 'display_name': 'Mutation of Leu-536 in Human Estrogen Receptor-α Alters the Coupling between Ligand Binding, Transcription Activation, and Receptor Conformation', 'publication_year': 2003, 'publication_date': '2003-07-01', 'ids': {'openalex': 'https://openalex.org/W2118369585', 'doi': 'https://doi.org/10.1074/jbc.m303840200', 'mag': '2118369585', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/12736255'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m303840200', 'pdf_url': 'http://www.jbc.org/article/S0021925820846961/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820846961/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5007577874', 'display_name': 'Changqing Zhao', 'orcid': 'https://orcid.org/0000-0002-3825-0940'}, 'institutions': [{'id': 'https://openalex.org/I185443292', 'display_name': 'Wayne State University', 'ror': 'https://ror.org/01070mq45', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I185443292']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Changqing Zhao', 'raw_affiliation_strings': ['Department of Physiology, Wayne State University School of Medicine, Detroit, Michigan 48201'], 'affiliations': [{'raw_affiliation_string': 'Department of Physiology, Wayne State University School of Medicine, Detroit, Michigan 48201', 'institution_ids': ['https://openalex.org/I185443292']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5071333092', 'display_name': 'Akiko Koide', 'orcid': 'https://orcid.org/0000-0003-1796-7077'}, 'institutions': [{'id': 'https://openalex.org/I40347166', 'display_name': 'University of Chicago', 'ror': 'https://ror.org/024mw5h28', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I40347166']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Akiko Koide', 'raw_affiliation_strings': ['Department of Biochemistry and Molecular Biology, University of Chicago, Chicago, Illinois 60637'], 'affiliations': [{'raw_affiliation_string': 'Department of Biochemistry and Molecular Biology, University of Chicago, Chicago, Illinois 60637', 'institution_ids': ['https://openalex.org/I40347166']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5016774003', 'display_name': 'Judith Abrams', 'orcid': 'https://orcid.org/0000-0001-9171-6458'}, 'institutions': [{'id': 'https://openalex.org/I4210090317', 'display_name': 'The Barbara Ann Karmanos Cancer Institute', 'ror': 'https://ror.org/00ee40h97', 'country_code': 'US', 'type': 'facility', 'lineage': ['https://openalex.org/I2800590384', 'https://openalex.org/I4210090317']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Judith Abrams', 'raw_affiliation_strings': ['Barbara Ann Karmanos Cancer Institute, Detroit, Michigan 48201'], 'affiliations': [{'raw_affiliation_string': 'Barbara Ann Karmanos Cancer Institute, Detroit, Michigan 48201', 'institution_ids': ['https://openalex.org/I4210090317']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5020893902', 'display_name': 'Sarah Deighton-Collins', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I185443292', 'display_name': 'Wayne State University', 'ror': 'https://ror.org/01070mq45', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I185443292']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Sarah Deighton-Collins', 'raw_affiliation_strings': ['Department of Physiology, Wayne State University School of Medicine, Detroit, Michigan 48201'], 'affiliations': [{'raw_affiliation_string': 'Department of Physiology, Wayne State University School of Medicine, Detroit, Michigan 48201', 'institution_ids': ['https://openalex.org/I185443292']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5074867405', 'display_name': 'Ángela Vivanco Martínez', 'orcid': 'https://orcid.org/0000-0002-2358-4198'}, 'institutions': [{'id': 'https://openalex.org/I185443292', 'display_name': 'Wayne State University', 'ror': 'https://ror.org/01070mq45', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I185443292']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Angela Martinez', 'raw_affiliation_strings': ['Department of Physiology, Wayne State University School of Medicine, Detroit, Michigan 48201'], 'affiliations': [{'raw_affiliation_string': 'Department of Physiology, Wayne State University School of Medicine, Detroit, Michigan 48201', 'institution_ids': ['https://openalex.org/I185443292']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5016308160', 'display_name': 'Janice A. Schwartz', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I4210090317', 'display_name': 'The Barbara Ann Karmanos Cancer Institute', 'ror': 'https://ror.org/00ee40h97', 'country_code': 'US', 'type': 'facility', 'lineage': ['https://openalex.org/I2800590384', 'https://openalex.org/I4210090317']}, {'id': 'https://openalex.org/I185443292', 'display_name': 'Wayne State University', 'ror': 'https://ror.org/01070mq45', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I185443292']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Janice A. Schwartz', 'raw_affiliation_strings': ['Barbara Ann Karmanos Cancer Institute, Detroit, Michigan 48201', 'Department of Physiology, Wayne State University School of Medicine, Detroit, Michigan 48201'], 'affiliations': [{'raw_affiliation_string': 'Barbara Ann Karmanos Cancer Institute, Detroit, Michigan 48201', 'institution_ids': ['https://openalex.org/I4210090317']}, {'raw_affiliation_string': 'Department of Physiology, Wayne State University School of Medicine, Detroit, Michigan 48201', 'institution_ids': ['https://openalex.org/I185443292']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5026366958', 'display_name': 'Shohei Koide', 'orcid': 'https://orcid.org/0000-0001-5473-4358'}, 'institutions': [{'id': 'https://openalex.org/I40347166', 'display_name': 'University of Chicago', 'ror': 'https://ror.org/024mw5h28', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I40347166']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Shohei Koide', 'raw_affiliation_strings': ['Department of Biochemistry and Molecular Biology, University of Chicago, Chicago, Illinois 60637'], 'affiliations': [{'raw_affiliation_string': 'Department of Biochemistry and Molecular Biology, University of Chicago, Chicago, Illinois 60637', 'institution_ids': ['https://openalex.org/I40347166']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5090581606', 'display_name': 'Debra F. Skafar', 'orcid': 'https://orcid.org/0000-0002-5937-4889'}, 'institutions': [{'id': 'https://openalex.org/I4210090317', 'display_name': 'The Barbara Ann Karmanos Cancer Institute', 'ror': 'https://ror.org/00ee40h97', 'country_code': 'US', 'type': 'facility', 'lineage': ['https://openalex.org/I2800590384', 'https://openalex.org/I4210090317']}, {'id': 'https://openalex.org/I185443292', 'display_name': 'Wayne State University', 'ror': 'https://ror.org/01070mq45', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I185443292']}], 'countries': ['US'], 'is_corresponding': True, 'raw_author_name': 'Debra F. Skafar', 'raw_affiliation_strings': ['Barbara Ann Karmanos Cancer Institute, Detroit, Michigan 48201', 'Department of Physiology, Wayne State University School of Medicine, Detroit, Michigan 48201'], 'affiliations': [{'raw_affiliation_string': 'Barbara Ann Karmanos Cancer Institute, Detroit, Michigan 48201', 'institution_ids': ['https://openalex.org/I4210090317']}, {'raw_affiliation_string': 'Department of Physiology, Wayne State University School of Medicine, Detroit, Michigan 48201', 'institution_ids': ['https://openalex.org/I185443292']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 3, 'corresponding_author_ids': ['https://openalex.org/A5090581606'], 'corresponding_institution_ids': ['https://openalex.org/I4210090317', 'https://openalex.org/I185443292'], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 1.532, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 28, 'citation_normalized_percentile': {'value': 0.797293, 'is_in_top_1_percent': False, 'is_in_top_10_percent': False}, 'cited_by_percentile_year': {'min': 88, 'max': 89}, 'biblio': {'volume': '278', 'issue': '29', 'first_page': '27278', 'last_page': '27286'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10756', 'display_name': 'Estrogen and related hormone effects', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1311', 'display_name': 'Genetics'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10756', 'display_name': 'Estrogen and related hormone effects', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1311', 'display_name': 'Genetics'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T12356', 'display_name': 'Bioactive Compounds and Antitumor Agents', 'score': 0.9866, 'subfield': {'id': 'https://openalex.org/subfields/3005', 'display_name': 'Toxicology'}, 'field': {'id': 'https://openalex.org/fields/30', 'display_name': 'Pharmacology, Toxicology and Pharmaceutics'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11503', 'display_name': 'Cytokine Signaling Pathways and Interactions', 'score': 0.9656, 'subfield': {'id': 'https://openalex.org/subfields/2730', 'display_name': 'Oncology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/estrogen-receptor-alpha', 'display_name': 'Estrogen receptor alpha', 'score': 0.51098764}, {'id': 'https://openalex.org/keywords/estrogen-receptor-beta', 'display_name': 'Estrogen receptor beta', 'score': 0.43897778}, {'id': 'https://openalex.org/keywords/hormone-response-element', 'display_name': 'Hormone response element', 'score': 0.41252184}], 'concepts': [{'id': 'https://openalex.org/C84606932', 'wikidata': 'https://www.wikidata.org/wiki/Q416496', 'display_name': 'Estrogen receptor', 'level': 4, 'score': 0.71217275}, {'id': 'https://openalex.org/C2778938600', 'wikidata': 'https://www.wikidata.org/wiki/Q389934', 'display_name': 'Agonist', 'level': 3, 'score': 0.59142643}, {'id': 'https://openalex.org/C170493617', 'wikidata': 'https://www.wikidata.org/wiki/Q208467', 'display_name': 'Receptor', 'level': 2, 'score': 0.5536099}, {'id': 'https://openalex.org/C86339819', 'wikidata': 'https://www.wikidata.org/wiki/Q407384', 'display_name': 'Transcription factor', 'level': 3, 'score': 0.5531029}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.55147654}, {'id': 'https://openalex.org/C116569031', 'wikidata': 'https://www.wikidata.org/wiki/Q899107', 'display_name': 'Ligand (biochemistry)', 'level': 3, 'score': 0.5209497}, {'id': 'https://openalex.org/C172313692', 'wikidata': 'https://www.wikidata.org/wiki/Q14902310', 'display_name': 'Estrogen receptor alpha', 'level': 5, 'score': 0.51098764}, {'id': 'https://openalex.org/C143065580', 'wikidata': 'https://www.wikidata.org/wiki/Q3285695', 'display_name': 'Mutant', 'level': 3, 'score': 0.4520833}, {'id': 'https://openalex.org/C96307122', 'wikidata': 'https://www.wikidata.org/wiki/Q15329133', 'display_name': 'Estrogen receptor beta', 'level': 5, 'score': 0.43897778}, {'id': 'https://openalex.org/C51445715', 'wikidata': 'https://www.wikidata.org/wiki/Q410477', 'display_name': 'Hormone response element', 'level': 5, 'score': 0.41252184}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.3557852}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.34815133}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.28348222}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.11422554}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.09189808}, {'id': 'https://openalex.org/C121608353', 'wikidata': 'https://www.wikidata.org/wiki/Q12078', 'display_name': 'Cancer', 'level': 2, 'score': 0.0}, {'id': 'https://openalex.org/C530470458', 'wikidata': 'https://www.wikidata.org/wiki/Q128581', 'display_name': 'Breast cancer', 'level': 3, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D004958', 'descriptor_name': 'Estradiol', 'qualifier_ui': 'Q000031', 'qualifier_name': 'analogs & derivatives', 'is_major_topic': True}, {'descriptor_ui': 'D011960', 'descriptor_name': 'Receptors, Estrogen', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': True}, {'descriptor_ui': 'D011960', 'descriptor_name': 'Receptors, Estrogen', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D013629', 'descriptor_name': 'Tamoxifen', 'qualifier_ui': 'Q000031', 'qualifier_name': 'analogs & derivatives', 'is_major_topic': True}, {'descriptor_ui': 'D019943', 'descriptor_name': 'Amino Acid Substitution', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001483', 'descriptor_name': 'Base Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001665', 'descriptor_name': 'Binding Sites', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D001665', 'descriptor_name': 'Binding Sites', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004247', 'descriptor_name': 'DNA', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D004247', 'descriptor_name': 'DNA', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004958', 'descriptor_name': 'Estradiol', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D004958', 'descriptor_name': 'Estradiol', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D047628', 'descriptor_name': 'Estrogen Receptor alpha', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000077267', 'descriptor_name': 'Fulvestrant', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006367', 'descriptor_name': 'HeLa Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D066298', 'descriptor_name': 'In Vitro Techniques', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007930', 'descriptor_name': 'Leucine', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D007930', 'descriptor_name': 'Leucine', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008024', 'descriptor_name': 'Ligands', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008958', 'descriptor_name': 'Models, Molecular', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016297', 'descriptor_name': 'Mutagenesis, Site-Directed', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011401', 'descriptor_name': 'Promoter Regions, Genetic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011487', 'descriptor_name': 'Protein Conformation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D020849', 'descriptor_name': 'Raloxifene Hydrochloride', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D020849', 'descriptor_name': 'Raloxifene Hydrochloride', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011960', 'descriptor_name': 'Receptors, Estrogen', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D011960', 'descriptor_name': 'Receptors, Estrogen', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013629', 'descriptor_name': 'Tamoxifen', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D013629', 'descriptor_name': 'Tamoxifen', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018808', 'descriptor_name': 'Transcription Factor AP-1', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D018808', 'descriptor_name': 'Transcription Factor AP-1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015533', 'descriptor_name': 'Transcriptional Activation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D020798', 'descriptor_name': 'Two-Hybrid System Techniques', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m303840200', 'pdf_url': 'http://www.jbc.org/article/S0021925820846961/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/12736255', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m303840200', 'pdf_url': 'http://www.jbc.org/article/S0021925820846961/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'display_name': 'Good health and well-being', 'score': 0.85, 'id': 'https://metadata.un.org/sdg/3'}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 35, 'referenced_works': ['https://openalex.org/W1509151417', 'https://openalex.org/W1551123135', 'https://openalex.org/W1571431043', 'https://openalex.org/W1964957120', 'https://openalex.org/W1970713232', 'https://openalex.org/W1971960644', 'https://openalex.org/W1974357996', 'https://openalex.org/W1980040001', 'https://openalex.org/W1998804942', 'https://openalex.org/W2008822380', 'https://openalex.org/W2020725121', 'https://openalex.org/W2030762899', 'https://openalex.org/W2042924702', 'https://openalex.org/W2045389096', 'https://openalex.org/W2068113812', 'https://openalex.org/W2070092422', 'https://openalex.org/W2071171017', 'https://openalex.org/W2071993841', 'https://openalex.org/W2075345188', 'https://openalex.org/W2075775562', 'https://openalex.org/W2075788654', 'https://openalex.org/W2085124463', 'https://openalex.org/W2088002379', 'https://openalex.org/W2093676604', 'https://openalex.org/W2096690893', 'https://openalex.org/W2100907853', 'https://openalex.org/W2101738855', 'https://openalex.org/W2111650618', 'https://openalex.org/W2113249646', 'https://openalex.org/W2134647155', 'https://openalex.org/W2139879863', 'https://openalex.org/W2154911204', 'https://openalex.org/W2413288604', 'https://openalex.org/W3047703793', 'https://openalex.org/W4212936275'], 'related_works': ['https://openalex.org/W4312053305', 'https://openalex.org/W4247668793', 'https://openalex.org/W2402916029', 'https://openalex.org/W2363180692', 'https://openalex.org/W2342462201', 'https://openalex.org/W2186235043', 'https://openalex.org/W2161536954', 'https://openalex.org/W2154937055', 'https://openalex.org/W2076822465', 'https://openalex.org/W2068971907'], 'abstract_inverted_index': {'The': [0, 118, 235, 353, 470, 685, 900, 1198, 1224, 1363, 1572, 2231, 2293, 2313, 2372, 2396, 2429, 2447, 2463, 2472, 2509, 2534, 2653, 2850, 2919, 2980, 3001, 3045, 3057, 3066, 3271, 3299, 3501, 3659, 3700, 3711, 3748, 3791, 3833, 3878, 3889, 3929, 3953, 4155], 'estrogen': [1, 111, 236, 346, 472, 481, 494, 499, 694, 1285, 1358, 2261, 2409], 'receptor': [2, 237, 500, 523, 619, 910, 1359, 2262, 2575], '(ER),': [3, 238], 'of': [4, 37, 54, 66, 74, 80, 87, 93, 103, 123, 146, 152, 174, 179, 184, 192, 223, 228, 233, 239, 272, 289, 301, 309, 315, 322, 328, 338, 358, 381, 387, 409, 414, 419, 427, 458, 463, 468, 539, 553, 562, 616, 647, 691, 698, 732, 861, 866, 902, 915, 1042, 1162, 1166, 1307, 1366, 1411, 1432, 1455, 1467, 1484, 1574, 1582, 1585, 1718, 1736, 1746, 1754, 1766, 1794, 1801, 1839, 1858, 1868, 1880, 1901, 1981, 2023, 2044, 2113, 2129, 2137, 2224, 2255, 2272, 2334, 2348, 2352, 2375, 2449, 2528, 2559, 2573, 2582, 2586, 2688, 2707, 2720, 2765, 2774, 2780, 2852, 2861, 2885, 2903, 2910, 2915, 2925, 2937, 3003, 3011, 3086, 3118, 3142, 3150, 3159, 3161, 3171, 3250, 3280, 3287, 3301, 3349, 3387, 3440, 3484, 3531, 3604, 3638, 3644, 3661, 3694, 3718, 3736, 3750, 3784, 3798, 3818, 3835, 3872, 3896, 3914, 3931, 3950, 3960, 3989, 3996, 4002, 4044, 4083, 4115, 4135, 4143, 4148, 4172, 4190, 4199, 4210, 4217, 4238, 4240, 4258, 4267, 4294, 4317, 4320, 4333, 4336, 4348, 4350, 4361, 4397, 4409, 4417], 'which': [5, 240, 1443, 1473, 1593, 1729, 2216, 2355, 2480, 2520, 3033, 3554, 3568, 3597, 3981, 4379], 'there': [6, 241, 3581], 'are': [7, 242, 741, 1059, 1294, 1353, 1730, 2874, 3713, 3793, 3891, 3955], 'two': [8, 243, 733, 2408, 2477, 4074], 'forms,': [9, 244], 'ERα': [10, 39, 94, 153, 187, 205, 245, 274, 329, 388, 422, 440, 916, 1225, 1848, 1908, 2494, 2766, 3027, 4062, 4149, 4157], 'and': [11, 23, 31, 106, 114, 188, 231, 246, 258, 266, 341, 349, 423, 466, 547, 560, 636, 738, 747, 1291, 1298, 1342, 1413, 1450, 1458, 1480, 1602, 1614, 1724, 1748, 1759, 1865, 1882, 2032, 2121, 2135, 2161, 2173, 2192, 2206, 2276, 2344, 2365, 2381, 2388, 2421, 2434, 2441, 2453, 2486, 2501, 2564, 2597, 2648, 2659, 2724, 2738, 2757, 2798, 2823, 2833, 2871, 2890, 2912, 2951, 2960, 2972, 2985, 3028, 3040, 3051, 3073, 3091, 3127, 3138, 3154, 3190, 3233, 3291, 3330, 3357, 3390, 3401, 3407, 3411, 3424, 3443, 3449, 3452, 3512, 3536, 3615, 3647, 3652, 3667, 3682, 3707, 3739, 3764, 3777, 3786, 3821, 3826, 3841, 3856, 3869, 3885, 3920, 3948, 4029, 4032, 4068, 4095, 4118, 4129, 4158, 4164, 4204, 4243, 4290, 4375], 'ERβ,': [12, 247], 'is': [13, 60, 217, 248, 295, 452, 528, 534, 622, 642, 1368, 1435, 1597, 1860, 1903, 2025, 2034, 4212, 4412], 'a': [14, 25, 55, 134, 208, 249, 260, 290, 369, 443, 554, 623, 630, 637, 905, 1049, 1153, 1579, 1795, 1812, 2038, 2321, 2357, 2404, 2515, 2846, 2997, 3062, 3101, 3110, 3157, 3230, 3277, 3283, 3470, 3548, 3925, 3987, 4010, 4016, 4021, 4025, 4048, 4060, 4064, 4069, 4084, 4096, 4359, 4398], 'ligand-modulated': [15, 250], 'transcription': [16, 251, 1229, 4192, 4353], 'factor': [17, 252], 'important': [18, 253], 'in': [19, 48, 62, 71, 133, 140, 171, 207, 219, 254, 283, 297, 306, 368, 375, 406, 442, 454, 557, 908, 1046, 1061, 1201, 1311, 1372, 1599, 1610, 1617, 1721, 1725, 1770, 1804, 1811, 1845, 1871, 1891, 1905, 2026, 2040, 2118, 2220, 2242, 2266, 2425, 2730, 2754, 3115, 3207, 3276, 3303, 3319, 3453, 3486, 3520, 3553, 3567, 3585, 3596, 3663, 3725, 3807, 3837, 3903, 3924, 3945, 3967, 3980, 3999, 4047, 4052, 4169, 4207, 4235, 4287, 4298, 4307, 4373], 'both': [20, 255], 'normal': [21, 256], 'biology': [22, 257], 'as': [24, 68, 70, 259, 303, 305, 1288, 1347, 1349, 1356, 1419, 1740, 1742, 2788, 2876, 2940, 3042, 3097, 3343, 3523, 3572, 3677, 3759, 3851, 3935], 'target': [26, 261], 'for': [27, 262, 871, 1417, 1429, 2394, 2475, 2551, 2655, 2975, 3099, 3181, 3244, 3265, 3346, 3507, 3509, 3513, 3542, 3593, 3609, 4225, 4322, 4338, 4383, 4414], 'agents': [28, 263, 1423], 'to': [29, 76, 154, 168, 225, 264, 311, 389, 403, 460, 693, 1055, 1206, 1296, 1355, 1374, 1426, 1437, 1486, 1714, 1762, 1791, 2036, 2109, 2239, 2298, 2325, 2339, 2413, 2445, 2523, 2561, 2571, 2858, 3008, 3088, 3147, 3156, 3204, 3469, 3479, 3498, 3526, 3625, 3650, 3665, 3685, 3742, 3767, 3800, 3824, 3839, 3859, 3992, 4121, 4150, 4260, 4264, 4273, 4328, 4358, 4386, 4419], 'prevent': [30, 265, 1299], 'treat': [32, 267, 1297], 'breast': [33, 268, 563, 1300, 1420], 'cancer.': [34, 269], 'Crystallographic': [35, 270, 1453], 'studies': [36, 271, 1454], 'the': [38, 52, 63, 72, 78, 90, 100, 121, 124, 129, 141, 149, 158, 172, 182, 185, 190, 193, 203, 221, 226, 229, 273, 287, 298, 307, 313, 325, 335, 356, 359, 364, 376, 384, 393, 407, 417, 420, 425, 428, 438, 456, 461, 464, 537, 544, 550, 558, 617, 644, 648, 689, 729, 744, 748, 859, 909, 913, 1043, 1159, 1163, 1207, 1440, 1456, 1463, 1476, 1482, 1583, 1586, 1590, 1600, 1611, 1618, 1716, 1733, 1737, 1744, 1752, 1755, 1764, 1799, 1805, 1816, 1823, 1840, 1846, 1855, 1863, 1866, 1869, 1877, 1889, 1892, 1895, 1906, 1942, 1979, 1982, 1985, 2020, 2030, 2042, 2045, 2111, 2119, 2122, 2127, 2133, 2185, 2221, 2225, 2260, 2269, 2288, 2326, 2331, 2342, 2349, 2362, 2366, 2376, 2414, 2419, 2426, 2454, 2483, 2524, 2529, 2539, 2545, 2557, 2562, 2567, 2574, 2579, 2697, 2711, 2793, 2829, 2834, 2840, 2859, 2866, 2872, 2886, 2891, 2946, 2991, 3009, 3012, 3023, 3029, 3082, 3089, 3132, 3143, 3151, 3172, 3191, 3223, 3251, 3304, 3310, 3337, 3347, 3358, 3393, 3398, 3404, 3418, 3430, 3438, 3441, 3447, 3454, 3464, 3481, 3493, 3521, 3529, 3532, 3539, 3555, 3586, 3602, 3616, 3645, 3683, 3689, 3695, 3714, 3737, 3765, 3771, 3778, 3794, 3819, 3857, 3863, 3873, 3892, 3921, 3946, 3956, 3994, 4000, 4033, 4042, 4045, 4090, 4103, 4112, 4116, 4122, 4126, 4130, 4136, 4146, 4159, 4170, 4187, 4197, 4200, 4208, 4215, 4218, 4236, 4241, 4256, 4281, 4292, 4323, 4339, 4346, 4395, 4410, 4415], 'ligand-binding': [40, 126, 275, 361, 491, 638], 'domain': [41, 127, 132, 276, 362, 367, 634, 639, 687, 746], 'suggest': [42, 277], 'that': [43, 59, 84, 156, 201, 215, 278, 294, 319, 391, 436, 450, 641, 740, 911, 1058, 1156, 1283, 1424, 1462, 3225, 3691, 3773, 3865, 4100, 4394], 'Leu-536': [44, 88, 147, 180, 216, 279, 323, 382, 415, 451, 1616, 1786, 1859, 1902, 1976, 2024, 2117, 2131, 2281, 2691, 3394, 4004, 4137, 4144, 4272, 4369], 'may': [45, 280], 'be': [46, 281, 864, 1427, 1792, 3499], 'involved': [47, 282], 'hydrophobic': [49, 284, 1749, 1760, 1813, 1817, 2114, 4400], 'interactions': [50, 285, 1235, 1761, 2115, 2887, 3348, 3386], 'at': [51, 286, 1230, 1370, 1592, 1608, 1615, 1751, 1798, 2280, 3164, 3178, 3184, 3240, 3268, 4139, 4271, 4309, 4368, 4406], 'start': [53, 288, 1717, 1753, 1765, 1800], 'helix,': [56, 291, 1051, 1756], '"helix': [57, 292, 1052], '12,"': [58, 293, 1053], 'crucial': [61, 296], 'agonist-stimulated': [64, 299], 'activity': [65, 79, 92, 102, 232, 300, 314, 327, 337, 467, 533, 873, 1365, 1584, 2134, 2181, 2836, 2851, 2860, 2987, 3002, 3010, 3439, 3660, 3749, 3834, 3930, 4001, 4043, 4168, 4193, 4198, 4216, 4372], 'ERα,': [67, 198, 302, 433, 2566, 2895], 'well': [69, 304, 1348, 1741], 'ability': [73, 308, 4385, 4416], 'antagonists': [75, 310], 'block': [77, 312], 'ERα.': [81, 234, 316, 469, 2138, 4003], 'We': [82, 317, 2106, 3977, 4039, 4253, 4276], 'found': [83, 318, 1713], 'certain': [85, 320], 'mutations': [86, 119, 321, 354, 2294, 2692, 4270, 4367], 'increased': [89, 148, 189, 324, 383, 424], 'ligand-independent': [91, 326], 'although': [95, 330], 'greatly': [96, 331], 'reducing': [97, 332], 'or': [98, 195, 333, 430, 1361, 2310, 2770, 2782, 2812, 2815, 2820, 2893, 2906, 2927, 2967, 3025, 3256, 3322, 3574, 4063, 4077, 4283, 4404], 'eliminating': [99, 334], 'agonist': [101, 336, 1364, 1412, 1449, 4124], '17β-estradiol': [104, 339], '(E2)': [105, 340], '4-hydroxytamoxifen': [107, 342, 548, 2162, 2816], '(4OHT),': [108, 343, 549], 'on': [109, 344, 1305, 2132, 2845, 2996, 3417, 3446, 3492, 3655, 3744, 3829, 4352], 'an': [110, 115, 345, 350, 529, 627, 2218, 2976, 3561, 3656, 3745, 3774, 3830, 3866, 4078, 4140, 4265], 'response': [112, 347, 495, 695, 2410, 3664, 3838, 4114, 4147, 4259], 'element-driven': [113, 348], 'AP-1-driven': [116, 351, 3450, 3746, 3775, 3831, 3867], 'reporter.': [117, 352], 'impaired': [120, 355], 'interaction': [122, 183, 357, 418, 914, 1814, 3543, 3556, 3584], 'ER': [125, 360, 692, 2452, 3445, 3662, 3751, 3836, 3932, 4221, 4285, 4325], 'with': [128, 199, 363, 434, 917, 1408, 1815, 1876, 1987, 2029, 2690, 2735, 2776, 2800, 2839, 2900, 2957, 2990, 3020, 3070, 3074, 3108, 3121, 3167, 3222, 3261, 3392, 3688, 3770, 3862, 3917, 3986, 4007, 4059, 4089], 'SRC1': [130, 365, 2502, 2889], 'receptor-interacting': [131, 366], 'mammalian': [135, 370, 2476, 3455, 3926, 4376], 'two-hybrid': [136, 143, 210, 371, 378, 445, 3456, 3927, 4377], 'system.': [137, 211, 372, 446, 3084, 3928], 'When': [138, 373], 'tested': [139, 374, 4041, 4254], 'yeast': [142, 209, 377, 444, 2516, 4374], 'system,': [144, 379, 4109], 'mutation': [145, 178, 380, 413, 4341], 'basal': [150, 385, 4176], 'reactivity': [151, 167, 191, 386, 402, 426], 'probes': [155, 170, 200, 390, 405, 435], 'recognize': [157, 202, 392, 437], 'agonist-bound': [159, 394, 1612, 1806], 'conformation': [160, 206, 230, 395, 441, 465, 906, 2136], 'but': [161, 396, 1884], 'did': [162, 397], 'not': [163, 398, 3546, 4356], 'significantly': [164, 399], 'alter': [165, 400], 'its': [166, 401, 872], 'these': [169, 404, 1444, 1468], 'presence': [173, 408, 3573, 3949, 4171, 4209, 4396], 'E2.': [175, 410, 3952], 'Most': [176, 411], 'interestingly,': [177, 412], 'reduced': [181, 416, 3549], '4OHT-bound': [186, 204, 421, 439], 'raloxifene-': [194, 429], 'ICI': [196, 431, 1292, 2167, 3653, 3668, 3708, 3827, 3842, 3886, 4132], '182,780-bound': [197, 432], 'These': [212, 447, 1727, 4391], 'results': [213, 448, 727, 2873, 3432, 4392], 'show': [214, 449, 1344, 1461, 4393], 'critical': [218, 453, 1050, 1580, 4413], 'coupling': [220, 455], 'binding': [222, 457, 538, 690, 901, 1478, 1483, 2526, 2558, 3273, 3353, 4293], 'ligand': [224, 459, 1864, 2031, 2047, 3510, 3569, 3611, 3701, 3779, 3879], 'modulation': [227, 462], 'human': [471, 480, 2335], 'receptor-α': [473], '(hERα)': [474], '1The': [475], 'abbreviations': [476], 'used': [477, 556, 1295, 2238, 3041, 3096, 3478, 3624, 3703, 3881], 'are:': [478], 'hERα,': [479], 'receptor-α;': [482], 'E2,': [483, 3883, 4125], '17β-estradiol;': [484], '4OHT,': [485], '4-hydroxytamoxifen;': [486], 'DBD,': [487], 'DNA-binding': [488, 633, 686, 2518], 'domain;': [489, 492, 525], 'LBD,': [490, 749, 1044], 'ERE,': [493], 'element;': [496], 'SERMs,': [497], 'selective': [498, 1357], 'modulators;': [501], 'EGFP,': [502], 'enhanced': [503, 3034], 'green': [504, 2201, 3035], 'fluorescent': [505, 2202, 3036], 'protein;': [506], 'CMV,': [507], 'cytomegalovirus;': [508], 'RLU,': [509], 'relative': [510, 2877], 'luciferase': [511, 2368, 2550, 2835, 2854, 2863, 2878, 2986, 3005, 4092, 4105], 'unit(s);': [512], 'wt,': [513], 'wild': [514], 'type;': [515], 'GST,': [516], 'glutathione': [517], 'S-transferase;': [518], 'aa,': [519], 'amino': [520, 2496, 2503, 3990], 'acid(s);': [521], 'RID,': [522], 'interacting': [524, 1875], 'DES,': [526], 'diethylstilbestrol.': [527], 'allosteric': [530], 'protein': [531, 625, 649, 2203, 2513, 2537, 3037, 3302, 3312, 4321, 4337], 'whose': [532], 'modulated': [535], 'by': [536, 1048, 1732, 1743, 2125, 2284, 2319, 2386, 2402, 2439, 2460, 2492, 2695, 2704, 2717, 2762, 3176, 3195, 3238, 3296, 4248], 'ligands,': [540], 'including': [541], 'estradiol': [542, 2560, 2808, 2969, 4306], '(E2),': [543], 'cognate': [545], 'ligand,': [546], 'active': [551], 'metabolite': [552], 'drug': [555], 'treatment': [559], 'prevention': [561, 1422], 'cancer': [564, 1301, 1421], '(1Evans': [565, 650], 'R.M.': [566, 651, 1271], 'Science.': [567, 652, 1001, 1380], '1988;': [568, 653], '240:': [569, 654], '889-895Crossref': [570, 655], 'PubMed': [571, 586, 608, 656, 680, 720, 762, 788, 807, 833, 853, 895, 930, 952, 988, 1005, 1035, 1118, 1146, 1193, 1219, 1263, 1279, 1335, 1384, 1400, 1539, 1567, 1672, 1700, 1781, 1833, 1971, 2101, 2623, 2643, 2682, 3217, 3379], 'Scopus': [572, 587, 609, 657, 681, 721, 763, 789, 808, 834, 854, 896, 931, 953, 989, 1006, 1036, 1091, 1119, 1147, 1194, 1220, 1336, 1385, 1401, 1512, 1540, 1568, 1645, 1673, 1701, 1782, 1834, 1937, 1972, 2016, 2074, 2102, 2624, 2644, 2683, 3218, 3380], '(6341)': [573, 658], 'Google': [574, 589, 611, 659, 683, 723, 765, 791, 810, 836, 856, 898, 933, 955, 991, 1008, 1038, 1093, 1121, 1149, 1196, 1222, 1264, 1280, 1324, 1338, 1387, 1403, 1514, 1542, 1570, 1647, 1675, 1703, 1784, 1836, 1939, 1974, 2018, 2076, 2104, 2626, 2646, 2685, 3220, 3382], 'Scholar,': [575, 590, 660, 766, 792, 811, 837, 934, 956, 992, 1009, 1094, 1122, 1265, 1325, 1388, 1515, 1543, 1648, 1676, 2077, 2627, 3221], '2Nilsson': [576], 'S.': [577, 664, 704, 921, 974, 1128, 1130, 1210, 1255, 1549, 1551, 1682, 1684, 2618, 2667, 2671, 2677, 3364, 3368, 3374], 'Gustafsson': [578, 922, 1083, 1211, 1252, 1504, 1637, 1929, 2008, 2066], 'J.-A.': [579, 923, 1084, 1212, 1505, 1638, 1930, 2009, 2067], 'Breast': [580, 924, 1213, 1314], 'Cancer': [581, 925, 1214], 'Res.': [582, 803, 926, 1215], '2000;': [583, 927, 1216, 1830], '2:': [584, 928, 1217], '360-366Crossref': [585, 929, 1218], '(120)': [588, 932, 1221], '3Hall': [591, 935], 'J.M.': [592, 936, 1132, 1553, 1686], 'Couse': [593, 937], 'J.F.': [594, 938], 'Korach': [595, 939], 'K.S.': [596, 940], 'J.': [597, 758, 770, 842, 877, 941, 962, 1024, 1135, 1182, 1556, 1689, 2629], 'Biol.': [598, 843, 942, 1025, 1136, 1183, 1557, 1690], 'Chem.': [599, 844, 943, 1026, 1137, 1184, 1558, 1691], '2001;': [600, 944, 1138, 1559, 1692], '276:': [601, 945, 1139, 1560, 1693], '36869-36872Abstract': [602, 946], 'Full': [603, 605, 677, 717, 785, 848, 850, 892, 947, 949, 1030, 1032, 1113, 1115, 1141, 1143, 1188, 1190, 1534, 1536, 1562, 1564, 1667, 1669, 1695, 1697, 1966, 1968, 2096, 2098, 2640], 'Text': [604, 606, 678, 718, 786, 849, 851, 893, 948, 950, 1031, 1033, 1114, 1116, 1142, 1144, 1189, 1191, 1535, 1537, 1563, 1565, 1668, 1670, 1696, 1698, 1967, 1969, 2097, 2099, 2641], 'PDF': [607, 679, 719, 787, 852, 894, 951, 1034, 1117, 1145, 1192, 1538, 1566, 1671, 1699, 1970, 2100, 2642], '(1005)': [610, 954], 'Scholar).': [612, 684, 724, 857, 899, 1039, 1150, 1197, 1223, 1281, 1339, 1404, 1571, 1704, 1785, 1837, 2105, 2686, 3383], 'Like': [613], 'other': [614, 1896, 4183], 'members': [615], 'nuclear': [618], 'superfamily,': [620], 'hERα': [621, 3359, 3649, 3741, 3823, 3915, 4411], 'multidomain': [624], 'having': [626, 4009, 4269, 4280, 4366], 'N-terminal': [628, 745], 'domain,': [629, 2519], 'centrally': [631], 'located': [632, 742], '(DBD),': [635], '(LBD)': [640], 'near': [643], 'C': [645, 1160], 'terminus': [646, 1161], '4Kumar': [661], 'V.': [662, 702, 796, 1013, 1171], 'Green': [663, 703], 'Stack': [665, 705], 'G.': [666, 706], 'Berry': [667, 707], 'M.': [668, 708, 752, 1086, 1124, 1126, 1379, 1507, 1545, 1547, 1640, 1678, 1680, 1932, 2011, 2069], 'Jin': [669, 709], 'J.R.': [670, 710], 'Chambon': [671, 711, 755, 779, 797, 886, 2275], 'P.': [672, 712, 756, 780, 798, 819, 887, 958, 960, 1237, 1239, 1267], 'Cell.': [673, 713, 781, 888, 1109, 1530, 1663, 1962, 2092, 2636], '1987;': [674, 714], '51:': [675, 715], '941-951Abstract': [676, 716], '(1069)': [682, 722], 'mediates': [688], 'elements': [696, 2411], '(EREs)': [697], 'estrogen-regulated': [699], 'genes': [700], '(4Kumar': [701], 'Transcriptional': [725], 'enhancement': [726], 'from': [728, 2149, 2158, 2165, 2171, 2177, 2198, 2212, 2229, 2250, 2330, 2470, 2651, 2865, 3032, 3328, 3489, 4312], 'synergistic': [730], 'action': [731, 860], 'separate': [734, 3589, 3607], 'activation': [735, 2541, 4354], 'functions,': [736], 'AF-1': [737, 1151, 1375], 'AF-2,': [739], 'within': [743, 1064, 1158, 1822], 'respectively': [750, 4178], '(5Berry': [751], 'Metzger': [753], 'D.': [754, 774, 817, 881, 970, 1098, 1134, 1519, 1555, 1652, 1688, 1951, 2081], 'EMBO': [757], '1990;': [759], '9:': [760, 1277], '2811-2818Crossref': [761], '(664)': [764], '6Tora': [767], 'L.': [768, 875, 1080, 1102, 1501, 1523, 1634, 1656, 1926, 1955, 2005, 2063, 2085, 2669, 3210, 3366], 'White': [769, 876], 'Brou': [771, 878], 'C.': [772, 879, 964, 1241], 'Tassett': [773, 880], 'Webster': [775, 882], 'N.': [776, 883], 'Scheer': [777, 884], 'E.': [778, 885, 976, 1247, 1251, 2631, 4288], '1989;': [782, 804, 889], '59:': [783, 890], '477-487Abstract': [784, 891], '(890)': [790, 897], '7Bocquel': [793], 'M.T.': [794, 813], 'Kumar': [795], 'Gronemeyer': [799], 'H.': [800, 2633], 'Nucleic': [801], 'Acids': [802], '17:': [805], '2581-2595Crossref': [806], '(230)': [809], '8Tzukerman': [812], 'Esty': [814], 'A.': [815, 2619, 2665, 2678, 3362, 3375], 'Santiso-Mere': [816], 'Danielian': [818], 'Parker': [820], 'M.G.': [821], 'Stein': [822], 'R.B.': [823], 'Pike': [824, 1069, 1490, 1623, 1915, 1994, 2052], 'J.W.': [825], 'McDonnell': [826], 'D.P.': [827, 1021, 1179], 'Mol.': [828, 983, 1258, 1274, 1395], 'Endocrinol.': [829, 984, 1259, 1275, 1396], '1994;': [830, 2620], '8:': [831], '21-30Crossref': [832], '(612)': [835], '9McInerney': [838], 'E.M.': [839], 'Katzenellenbogen': [840, 977, 1248], 'B.S.': [841, 978, 1249], '1996;': [845], '271:': [846], '24172-24178Abstract': [847], '(181)': [855], 'Whereas': [858], 'AF1': [862], 'can': [863, 1226], 'independent': [865, 3720, 3802, 3898, 3962], 'hormone,': [867], 'AF2': [868, 1487], 'requires': [869], 'hormone': [870], '(6Tora': [874], 'agonists': [903], 'produces': [904], 'change': [907], 'facilitates': [912], 'coactivator': [918, 1065, 1199, 1477], 'proteins': [919, 1066, 3058, 4245, 4304], '(2Nilsson': [920, 1209], '10Webb': [957], 'Nguyen': [959, 967, 1238], 'Shinsako': [961], 'Anderson': [963], 'Feng': [965], 'W.': [966], 'M.P.': [968], 'Chen': [969], 'Huang': [971], 'S.-M.': [972], 'Subramanian': [973], 'McInerney': [975, 1246], 'Stallcup': [979], 'M.R.': [980], 'Kushner': [981, 1103, 1256, 1272, 1524, 1657, 1956, 2086], 'P.J.': [982, 1104, 1257, 1273, 1525, 1658, 1957, 2087], '1998;': [985, 1027, 1110, 1185, 1318, 1531, 1664, 1778, 1963, 2093], '12:': [986], '1605-1618Crossref': [987], '(0)': [990], '11Onate': [993], 'S.A.': [994, 1011, 1169], 'Tsai': [995, 997, 1016, 1018, 1174, 1176], 'S.Y.': [996, 1017, 1175], 'M.J.': [998, 1019, 1177], "O'Malley": [999, 1022, 1180, 1393], 'B.W.': [1000, 1023, 1181, 1394], '1995;': [1002, 1276], '270:': [1003], '1354-1357Crossref': [1004], '(2063)': [1007], '12Onate': [1010], 'Boonyaratanakornkit': [1012, 1170], 'Spencer': [1014, 1172], 'T.E.': [1015, 1173], 'Edwards': [1020, 1178], '273:': [1028, 1186], '12101-12108Abstract': [1029, 1187], '(347)': [1037, 1195], 'A': [1040, 3133, 3162], 'surface': [1041, 1155], 'formed': [1045], 'part': [1047, 1373, 1793], 'binds': [1054, 1152], 'LXXLL': [1056], 'sequences': [1057], 'present': [1060], 'multiple': [1062, 3632], 'copies': [1063], '(13Brzozowski': [1067, 1488, 1621, 1913, 1992, 2050], 'A.M.': [1068, 1489, 1622, 1914, 1993, 2051], 'A.C.W.': [1070, 1491, 1624, 1916, 1995, 2053], 'Dauter': [1071, 1492, 1625, 1917, 1996, 2054], 'Z.': [1072, 1392, 1493, 1626, 1918, 1997, 2055], 'Hubbard': [1073, 1494, 1627, 1919, 1998, 2056], 'R.E.': [1074, 1495, 1628, 1920, 1999, 2057], 'Bonn': [1075, 1496, 1629, 1921, 2000, 2058], 'T.': [1076, 1497, 1630, 1922, 2001, 2059], 'Engstrom': [1077, 1498, 1631, 1923, 2002, 2060], 'O.': [1078, 1499, 1632, 1924, 2003, 2061], 'Ohman': [1079, 1500, 1633, 1925, 2004, 2062], 'Greene': [1081, 1107, 1502, 1528, 1635, 1661, 1927, 1960, 2006, 2064, 2090], 'G.L.': [1082, 1108, 1503, 1529, 1636, 1662, 1928, 1961, 2007, 2065, 2091], 'Carlquist': [1085, 1506, 1639, 1931, 2010, 2068], 'Nature.': [1087, 1508, 1641, 1933, 2012, 2070], '1997;': [1088, 1397, 1509, 1642, 1934, 2013, 2071], '390:': [1089, 1510, 1643, 1935, 2014, 2072], '753-758Crossref': [1090, 1511, 1644, 1936, 2015, 2073], '(2963)': [1092, 1513, 1646, 1938, 2017, 2075], '14Shiau': [1095, 1516, 1649, 2078], 'A.K.': [1096, 1517, 1650, 1949, 2079], 'Barstad': [1097, 1518, 1651, 1950, 2080], 'Loria': [1099, 1520, 1653, 1952, 2082], 'P.M.': [1100, 1521, 1654, 1953, 2083], 'Cheng': [1101, 1522, 1655, 1954, 2084], 'Agard': [1105, 1526, 1659, 1958, 2088], 'D.A.': [1106, 1527, 1660, 1959, 2089], '95:': [1111, 1532, 1665, 1964, 2094], '927-937Abstract': [1112, 1533, 1666, 1965, 2095], '(2269)': [1120, 1541, 1674, 1973, 2103], '15Gangloff': [1123, 1544, 1677], 'Ruff': [1125, 1546, 1679], 'Eiler': [1127, 1548, 1681], 'Duclaud': [1129, 1550, 1683], 'Wurtz': [1131, 1552, 1685], 'Moras': [1133, 1554, 1687], '15059-15065Abstract': [1140, 1561, 1694], '(126)': [1148, 1569, 1702], 'distinct': [1154], 'lies': [1157], 'p160': [1164], 'group': [1165], 'coactivators': [1167, 1485, 3919], '(12Onate': [1168], 'proteins,': [1200, 2489], 'turn,': [1202], 'recruit': [1203], 'histone': [1204], 'acetyltransferases': [1205], 'complex': [1208, 1944, 1986], 'also': [1227, 2932, 3613], 'modulate': [1228], 'AP-1': [1231, 2327], 'sites': [1232, 2347, 2424, 2527], 'through': [1233, 1442], 'protein-protein': [1234], '(16Webb': [1236], 'Valentine': [1240], 'Lopez': [1242, 1268], 'G.N.': [1243, 1269], 'Kwok': [1244], 'G.R.': [1245], 'Enmark': [1250], 'J.A.': [1253], 'Nilsson': [1254], '1999;': [1260], '13:': [1261], '1672-1685Crossref': [1262], '17Webb': [1266], 'Uht': [1270], '443-456Crossref': [1278], 'Drugs': [1282], 'antagonize': [1284], 'action,': [1286], 'such': [1287], 'tamoxifen,': [1289], 'raloxifene,': [1290], '182,780,': [1293, 3709, 3887], '(18The': [1302], 'Consensus': [1303], 'Conference': [1304], 'Treatment': [1306], 'Estrogen': [1308], 'Deficiency': [1309], 'Symptoms': [1310], 'Women': [1312], 'Surviving': [1313], 'CancerObstet.': [1315], 'Gynecol.': [1316], 'Surv.': [1317], '53': [1319], '(Consensus': [1320], 'statement,': [1321], 'S2-S10):': [1322], 'S1-S83PubMed': [1323], '19Gradishar': [1326], 'W.J.': [1327], 'Curr.': [1328], 'Treat.': [1329], 'Options': [1330], 'Oncol.': [1331], '2003;': [1332], '4:': [1333], '141-150Crossref': [1334], '(5)': [1337], 'Because': [1340], 'tamoxifen': [1341], 'raloxifene': [1343, 1988, 2174], 'tissue-specific': [1345, 1448], 'agonist,': [1346], 'antagonist,': [1350], 'effects,': [1351], 'they': [1352], 'referred': [1354], 'modulators,': [1360], 'SERMs.': [1362], 'SERMs': [1367], 'due': [1369, 4263, 4357], 'least': [1371], '(20Shang': [1376], 'Y.': [1377], 'Brown': [1378], '2002;': [1381, 2679, 3214, 3376], '295:': [1382], '2465-2468Crossref': [1383], '(1000)': [1386], '21Smith': [1389], 'C.L.': [1390], 'Nawaz': [1391], '11:': [1398], '657-666Crossref': [1399], '(556)': [1402], 'To': [1405, 3384], 'develop': [1406], 'compounds': [1407, 1445], 'desirable': [1409], 'profiles': [1410], 'antagonist': [1414, 1451, 4131], 'activity,': [1415, 4177], 'particularly': [1416], 'use': [1418, 1757], 'need': [1425], 'taken': [1428], 'extended': [1430, 1464], 'periods': [1431], 'time,': [1433], 'it': [1434, 1808, 1885], 'necessary': [1436], 'fully': [1438], 'understand': [1439], 'mechanisms': [1441], 'exert': [1446], 'their': [1447, 3514, 4175, 4191, 4384], 'activity.': [1452, 4363], '4OHT-': [1457], 'raloxifene-bound': [1459], 'LBD': [1460, 1849, 1870, 1909, 2485, 2495, 2511], 'side': [1465, 1856, 1878, 1899, 2021, 4037], 'chains': [1466, 1879], 'ligands': [1469, 3598, 3697, 3875], 'displace': [1470], 'helix': [1471, 1575, 1594, 1605, 1802, 1824], '12,': [1472], 'then': [1474, 2973, 2983, 3412, 4040], 'occupies': [1475], 'groove': [1479], 'blocks': [1481], 'orientation': [1573], '12': [1576, 1595, 1606, 1803], 'is,': [1577], 'therefore,': [1578], 'determinant': [1581], 'ligand-bound': [1587], 'hERα.': [1588], 'Interestingly,': [1589], 'position': [1591, 4407], 'initiates': [1596], 'different': [1598, 3578], 'agonist-': [1601], 'antagonist-bound': [1603, 1619], 'structures;': [1604], 'starts': [1607], 'Asp-538': [1609], 'structure': [1613], 'structures': [1620, 1842], 'Particular': [1705], 'motifs': [1706], 'termed': [1707], '"capping': [1708], 'motifs"': [1709], 'have': [1710, 2605, 2661, 4185], 'frequently': [1711], 'been': [1712, 1789, 2606, 2662], 'stabilize': [1715, 1763], 'α': [1719, 1767, 2263], 'helices': [1720, 1768], 'model': [1722, 3503, 3522, 3550, 3564], 'peptides': [1723], 'proteins.': [1726], 'motifs,': [1728], 'characterized': [1731], 'dihedral': [1734], 'angles': [1735], 'peptide': [1738], 'backbone': [1739], 'pattern': [1745], 'hydrophilic': [1747], 'residues': [1750, 1818, 4008], 'hydrogen-bonding': [1758], '(reviewed': [1769], 'Ref.': [1771, 3208], '22Aurora': [1772], 'R.': [1773, 2612, 2635], 'Rose': [1774], 'G.D.': [1775], 'Prot.': [1776], 'Sci.': [1777, 2616, 2675, 3372], '7:': [1779], '21-38Crossref': [1780], '(657)': [1783], 'has': [1787, 2356], 'previously': [1788, 3345], 'suggested': [1790], 'capping': [1796], 'motif': [1797], 'ERα;': [1807], 'could': [1809], 'participate': [1810], 'Leu-540': [1819, 1881], 'and/or': [1820], 'Leu-541': [1821], '(23Skafar': [1825], 'D.F.': [1826, 3212], 'Cell': [1827, 2722, 3197], 'Biochem.': [1828], 'Biophys.': [1829], '33:': [1831], '53-62Crossref': [1832], '(13)': [1835], 'Examination': [1838], 'crystallographic': [1841], 'shows': [1843], 'that,': [1844], 'diethylstilbestrol-bound': [1847], '(Protein': [1850], 'Data': [1851, 3435], 'Bank': [1852], 'code': [1853, 1911, 1946, 1990], '3ERD,': [1854], 'chain': [1857, 1900, 2022], 'oriented': [1861], 'toward': [1862, 1978], 'core': [1867, 1980], 'one': [1872], 'molecule,': [1873], 'possibly': [1874], 'Leu-541,': [1883], 'projects': [1886], 'away': [1887], 'into': [1888, 2341, 2391, 2418, 2499, 2506, 2578, 2710, 2934], 'solvent': [1890], 'other.': [1893], 'On': [1894], 'hand,': [1897], 'no': [1898], 'visible': [1904], 'estradiol-bound': [1907], '(PDB': [1910, 1945, 1989], '1ERE': [1912], 'Scholar)).': [1940], 'In': [1941, 1984, 2543, 3601], '4-OHT-bound': [1943], '3ERT': [1947], '(14Shiau': [1948], 'Scholar)),': [1975, 2019], 'points': [1977], 'LBD.': [1983], '1ERR': [1991], 'direct': [2027], 'contact': [2028], 'so': [2033], 'predicted': [2035], 'play': [2037], 'role': [2039, 2112, 3995], 'sensing': [2041], 'nature': [2043, 2448], 'bound': [2046, 3292, 4305], '(Fig.': [2048, 4179, 4194, 4251], '1)': [2049], 'therefore': [2107], 'wanted': [2108], 'determine': [2110, 3993], 'involving': [2116], 'E2-bound': [2120], 'tamoxifen-bound': [2123], 'states': [2124], 'examining': [2126], 'effects': [2128], 'mutating': [2130], "Materials—Dulbecco's": [2139], 'modified': [2140, 2732], "Eagle's/Ham's": [2141], 'F-12': [2142], 'medium': [2143, 2795, 2802, 2948, 2962, 3153], 'without': [2144, 2745], 'phenol': [2145, 2746], 'red': [2146], 'was': [2147, 2156, 2169, 2175, 2182, 2227, 2237, 2248, 2268, 2317, 2400, 2458, 2468, 2576, 2702, 2796, 2837, 2856, 2949, 2988, 3006, 3038, 3054, 3068, 3095, 3113, 3135, 3145, 3174, 3236, 3274, 3307, 3317, 3545, 3551, 3565, 3570, 3582, 3623, 3640, 3670, 3752, 3844, 3933, 3984, 4005, 4262, 4355], 'obtained': [2148, 2176], 'Invitrogen;': [2150], 'dextran-coated': [2151, 2740], 'charcoal-treated': [2152, 2741], 'fetal': [2153, 2742], 'calf': [2154, 2743], 'serum': [2155, 2744], 'purchased': [2157, 2164, 2170, 2197, 2211, 2228, 2249, 2469, 2650], 'HyClone.': [2159], 'Estradiol': [2160, 3087], 'were': [2163, 2196, 2210, 2282, 2384, 2389, 2437, 2442, 2490, 2649, 2693, 2728, 2752, 2831, 2898, 2931, 2953, 2982, 3018, 3049, 3059, 3079, 3193, 3199, 3227, 3259, 3294, 3334, 3409, 3415, 3466, 3477, 3496, 3518, 3558, 3591, 3599, 3612, 3618, 3698, 3704, 3781, 3789, 3876, 3882, 4056, 4246], 'Sigma.': [2166], '182,780': [2168, 3654, 3669, 3828, 3843], 'Tocris,': [2172], 'Eli': [2178], 'Lilly.': [2179], 'Luciferase': [2180, 2187, 2725, 2842, 2993], 'measured': [2183, 2838, 2989, 3308, 3671, 3753, 3845, 3934, 4291], 'using': [2184, 2287, 2786, 2917, 3081, 3229, 3309, 3336, 3422, 3672, 3754, 3846, 3940], 'Dual': [2186, 2841, 2992], 'Assay': [2188, 2843, 2994], 'kit': [2189, 2291, 2844, 2995], '(Promega).': [2190, 2292, 2508, 2533], 'SuperFect': [2191, 2787], 'plasmid': [2193, 2785, 3400, 3406, 4071], 'preparation': [2194], 'kits': [2195], 'Qiagen.': [2199], 'Enhanced': [2200], '(EGFP)': [2204], 'vector': [2205, 2258, 2316, 2399, 2427, 2466, 2532, 2547, 2768, 2869, 4099], 'EGFP-specific': [2207, 3075], 'Color': [2208, 3076], 'Antibody': [2209], 'Clontech.': [2213], 'ERα-specific': [2214, 3071], 'Ab-1,': [2215, 3072], 'recognizes': [2217], 'epitope': [2219], 'AB': [2222], 'domains': [2223], 'receptor,': [2226], 'NeoMarkers.': [2230], 'ECL™': [2232, 3083], '(Amersham': [2233], 'Biosciences)': [2234], 'detection': [2235], 'system': [2236], 'visualize': [2240], 'bands': [2241], 'Western': [2243, 3015, 4249], 'immunoblotting.': [2244], '[3H]Estradiol,': [2245], '40–60': [2246], 'Ci/mmol,': [2247], 'PerkinElmer': [2251], 'Life': [2252], 'Sciences.': [2253], 'Construction': [2254, 2585], 'Vectors—The': [2256], 'expression': [2257, 2473, 2767, 4066, 4239], 'containing': [2259, 2407, 2803, 2963, 3254, 3282, 3340, 4072], 'cDNA,': [2264], 'HEGO': [2265], 'pSG5,': [2267], 'generous': [2270], 'gift': [2271], 'Drs.': [2273], 'Pierre': [2274], 'Hinrich': [2277], 'Gronemeyer.': [2278], 'Mutants': [2279, 4138], 'constructed': [2283, 2318, 2401, 2455, 2694, 3978], 'site-directed': [2285], 'mutagenesis': [2286], 'Gene': [2289], 'Editor': [2290], 'converted': [2295], 'leucine': [2296, 3982, 4403], '536': [2297, 3983, 4408], 'alanine': [2299], '(L536A),': [2300], 'glutamic': [2301], 'acid': [2302], '(L536E),': [2303], 'glycine': [2304], '(L536G),': [2305], 'isoleucine': [2306], '(L536I),': [2307], 'lysine': [2308], '(L536K),': [2309], 'asparagine': [2311], '(L536N).': [2312], 'pAP1-luc': [2314, 2783], 'reporter': [2315, 2398, 2456, 2531, 2784, 2855, 3776, 3868, 4070], 'cloning': [2320, 2403, 2493], 'DNA': [2322, 2405, 2461], 'fragment': [2323, 2406, 2699], 'corresponding': [2324, 2412], 'consensus': [2328, 2415, 4075, 4080], 'sequence': [2329, 4081, 4286], 'promoter': [2332], 'region': [2333, 2351, 2370], 'collagenase': [2336], '1': [2337, 2824, 2901, 3266], '(-73': [2338], '-52)': [2340], 'HindIII': [2343, 2420], 'XhoI': [2345, 2422], 'restriction': [2346, 2423], 'multicloning': [2350, 2363, 2580], 'pLuc-MCS': [2353], 'vector,': [2354, 3031, 4067], 'simple': [2358, 4085], 'TATA': [2359, 4086], 'box': [2360, 4087], 'between': [2361, 2888, 3136, 3534], 'site': [2364, 2378, 2581], 'firefly': [2367, 2853, 3004, 4091], 'coding': [2369, 4093], '(Stratagene).': [2371], 'single': [2373, 2430, 3111, 3692, 3870], 'strands': [2374, 2393, 2431], 'AP1': [2377, 4079], '(sense:': [2379, 2432], 'AGCTTATGAGTCAGACACCTCTGGCTTC': [2380], 'antisense:': [2382, 2435], 'tcgagaagccagaggtgtctgactcata)': [2383], 'synthesized': [2385, 2438], 'Operon': [2387, 2440], 'annealed': [2390, 2443], 'double': [2392], 'cloning.': [2395, 2446], 'p2ERE-luc': [2397, 2781], 'vitellogenin': [2416], 'ERE': [2417], 'pLuc-MCS.': [2428], 'AGCTTCTAGAGGATCCAGGTCACAGTGACCTGGGCCCGGATCCGGGCCCAGGTCACAGTGACCTGGCCC': [2433], 'tcgagggccaggtcactgtgacctgggcccggatccgggcccaggtcactgtgacctggatcctctaga)': [2436], 'prior': [2444], 'each': [2450, 3594, 3610, 3722, 3804, 3900, 3964], 'mutant': [2451, 3257, 3595, 3648, 3740, 3822, 4065, 4161, 4244], 'vectors': [2457, 2474, 3021], 'confirmed': [2459], 'sequencing.': [2462], 'internal': [2464, 2867, 3043], 'control': [2465, 2868, 3626, 4098], 'pRL-SV40': [2467, 2775], 'Promega.': [2471], 'hybrid': [2478], 'assay,': [2479], 'will': [2481, 2521], 'produce': [2482], 'Gal4-ERα': [2484], 'VP16-SRC1': [2487, 2535], 'fusion': [2488, 2512, 2536, 3104, 4303], 'generated': [2491], 'acids': [2497, 2504, 3991], '264–595': [2498], 'pBind-CMV': [2500, 2546, 2926], '190–400': [2505], 'pAct-CMV': [2507], 'Gal4-ER': [2510], 'contains': [2514], 'Gal4': [2517, 2525], 'bind': [2522, 4274, 4387], 'pG5luc': [2530, 2916], 'possesses': [2538], 'VP16': [2540], 'domain.': [2542], 'addition,': [2544], 'expresses': [2548, 4102], 'Renilla': [2549, 2862, 3013, 4104], 'normalizing': [2552], 'transfection': [2553, 2794, 2947, 4097], 'efficiency.': [2554], 'For': [2555], 'detecting': [2556], 'wt': [2563, 2892, 3024, 3090, 3442, 3646, 3738, 3820, 4061, 4117, 4156, 4220, 4242, 4282], 'mutated': [2565, 2894, 3026, 3444, 4119, 4284], 'cDNA': [2568], 'encoding': [2569], 'Ser-282': [2570], 'Val-595': [2572], 'inserted': [2577], 'pET-42b(+)': [2583], '(Novagen).': [2584], 'Yeast': [2587, 3314], 'Two-hybrid': [2588, 2882, 3315], 'Vectors—Yeast': [2589], 'strains': [2590], 'EGY48,': [2591], 'MATα': [2592], 'his3': [2593], 'trp1': [2594], 'ura3': [2595], 'leu2::6LexAop-LEU2,': [2596], 'RFY206,': [2598], 'MATa': [2599], 'his3Δ200': [2600], 'leu2–3': [2601], 'lys2Δ201': [2602], 'trp1Δ::hisG': [2603], 'ura3–52,': [2604], 'described': [2607, 2663, 3206, 3344, 3678, 3760, 3852, 3936], '(24Finley': [2608], 'Jr.,': [2609], 'R.L.': [2610], 'Brent': [2611, 2634], 'Proc.': [2613, 2672, 3369], 'Natl.': [2614, 2673, 3370], 'Acad.': [2615, 2674, 3371], 'U.': [2617, 2676, 3373], '91:': [2621], '12980-12984Crossref': [2622], '(241)': [2625], '25Gyuris': [2628], 'Golemis': [2630], 'Chertkov': [2632], '1993;': [2637], '75:': [2638], '791-803Abstract': [2639], '(1324)': [2645], 'Scholar)': [2647], 'Origene.': [2652], 'plasmids': [2654, 3342], 'B42-monobody,': [2656], 'B42-SRC-1': [2657], 'fusions,': [2658], 'pEGERα297–595': [2660, 2689], '(26Koide': [2664, 3361], 'Abbatiello': [2666, 3363], 'Rothgery': [2668, 3365], 'Koide': [2670, 3367], '99:': [2680, 3377], '1253-1258Crossref': [2681, 3378], '(112)': [2684, 3381], 'Variants': [2687], 'subcloning': [2696], 'NcoI-BamHI': [2698], '(BamHI': [2700], 'digestion': [2701, 2715], 'followed': [2703, 2716], 'Klenow': [2705, 2718], 'treatment)': [2706, 2719], 'pSG-hER-Leu-536': [2708], 'mutants': [2709, 3360, 3617, 3916, 3979, 4046, 4184, 4206], 'NcoI-XhoI': [2712], 'segment': [2713], '(XhoI': [2714], 'pEGERα297–595.': [2721], 'Transfection': [2723], 'Assays—HeLa': [2726], 'cells': [2727, 2830, 2897, 2939, 2952, 2981, 3017, 3192, 3226, 3676, 3758, 3850, 3944], 'maintained': [2729, 2974], "Dulbecco's": [2731], "Eagle's": [2733], 'medium/F-12': [2734], '1%': [2736], 'penicillin/streptomycin': [2737], '10%': [2739], 'red.': [2747], 'Cells': [2748, 4055], '(3': [2749], '×': [2750, 3242], '105/well)': [2751], 'seeded': [2753], 'six-well': [2755], 'dishes': [2756], '20': [2758, 3169, 4331], 'h': [2759, 3183, 3267], 'later': [2760], 'cotransfected': [2761, 4058], '0.8': [2763], 'μg': [2764, 2779, 2902, 2909, 2914, 2924, 2929], '(wild-type': [2769], 'mutant),': [2771, 2907], '50': [2772, 3262], 'ng': [2773], 'either': [2777, 2922, 4073, 4402], '2': [2778], 'carrier.': [2789], 'After': [2790, 2826, 2943, 3106], '4': [2791, 3116, 3182], 'h,': [2792, 2828, 2945], 'removed': [2797], 'replaced': [2799, 3985, 4006], 'culture': [2801, 2961, 3144, 3173], 'ethanol': [2804, 2964], '(vehicle': [2805, 2965], 'control),': [2806], '17-β': [2807], '(0.1,': [2809, 2817], '1,': [2810, 2818], '10,': [2811, 2819], '100': [2813, 2821], 'nm),': [2814], 'nm': [2822, 3263], 'μm).': [2825], '48': [2827], 'harvested': [2832], 'Turner': [2847, 2998], '20/20': [2848, 2999], 'luminometer.': [2849, 3000], 'normalized': [2857, 3007], 'expressed': [2864, 2875, 4277], 'pRL-SV40,': [2870], 'units': [2879], '(RLUs).': [2880], 'Mammalian': [2881], 'Assay—For': [2883], 'determination': [2884], 'HeLa': [2896, 2938, 3675, 3757, 3849, 3943, 4053], 'transfected': [2899, 2933, 3019, 3674, 3756, 3848, 3942], 'pBind-ERα': [2904], '(wt': [2905], '1.2': [2908, 2928], 'pAct-SRC1,': [2911], '1.5': [2913], 'SuperFect.': [2918], 'empty': [2920], 'vectors,': [2921], '1.0': [2923], 'pAct-CMV,': [2930], 'parallel': [2935, 3278], 'cultures': [2936], 'negative': [2941], 'controls.': [2942], '3': [2944], 'removed,': [2950], 'washed': [2954], 'three': [2955, 3719, 3799, 3897, 3961], 'times': [2956], 'phosphate-buffered': [2958], 'saline': [2959], 'control)': [2966], '17β': [2968], '(100': [2970], 'nm)': [2971, 4297], 'additional': [2977, 4381], '24': [2978], 'h.': [2979], 'harvested,': [2984], 'luciferase.': [3014], 'Blotting—HeLa': [3016], 'expressing': [3022, 3100], 'EGFP': [3030], 'translated': [3039], 'control.': [3044], 'whole': [3046], 'cell': [3047, 3234, 3252, 3305, 4299], 'extracts': [3048, 3198, 3253, 3306], 'prepared,': [3050], 'SDS-gel': [3052], 'electrophoresis': [3053], 'carried': [3055, 3723, 3805, 3901, 3965], 'out.': [3056], 'transferred': [3060, 3146], 'onto': [3061], 'polyvinylidene': [3063], 'difluoride': [3064], 'membrane.': [3065], 'membrane': [3067], 'immunoblotted': [3069], 'Antibody.': [3077], 'Bands': [3078], 'visualized': [3080], 'Binding': [3085], 'Mutant': [3092], 'ERα—BL21(DE3)pLysS': [3093], '(Novagen)': [3094], 'host': [3098], 'GST-tagged': [3102, 4278], 'ERα(S282-V595)': [3103, 4279], 'protein.': [3105], 'transformation': [3107], 'pET-42b(+)-hERα,': [3109], 'colony': [3112], 'cultured': [3114, 3155], 'ml': [3117, 3149, 3170], 'LB': [3119], 'broth': [3120], 'glucose': [3122], '(1%),': [3123], 'chloramphenicol': [3124], '(35': [3125, 3129], 'μg/ml),': [3126], 'kanamycin': [3128], 'μg/ml)': [3130], 'until': [3131], '600': [3134, 3163], '0.6': [3137, 3160], '1.': [3139], 'Two': [3140], 'milliliters': [3141], '25': [3148, 3188], 'same': [3152, 3431, 3494], 'density': [3158], '37': [3165], '°C': [3166], 'shaking.': [3168], 'induced': [3175], 'isopropyl-1-thio-β-d-galactopyranoside': [3177], '0.4': [3179], 'mm': [3180], 'room': [3185], 'temperature': [3186], '(about': [3187], '°C),': [3189], 'collected': [3194], 'centrifugation.': [3196], 'prepared': [3200], 'following': [3201, 3326], 'procedures': [3202], 'similar': [3203], 'those': [3205], '27Zhong': [3209], 'Skafar': [3211], 'Biochemistry.': [3213], '41:': [3215], '4209-4217Crossref': [3216], '(30)': [3219], 'exceptions': [3224], 'lysed': [3228], 'French': [3231], 'press,': [3232], 'debris': [3235], 'pelleted': [3237], 'centrifugation': [3239], '27,000': [3241], 'g': [3243], '30': [3245], 'min.': [3246], 'Aliquots': [3247], '(200': [3248], 'μl)': [3249], 'wild-type': [3255], 'ERαs': [3258], 'incubated': [3260], '[3H]estradiol': [3264, 4295], '0': [3269], '°C.': [3270], 'nonspecific': [3272], 'determined': [3275], 'set': [3279], 'incubations': [3281], '200-fold': [3284], 'molar': [3285], 'excess': [3286], 'unlabeled': [3288], 'estradiol.': [3289], 'Free': [3290], 'steroids': [3293], 'separated': [3295], 'dextran/charcoal': [3297], 'assay.': [3298, 3313], 'concentration': [3300, 3535], 'Bradford': [3311], 'Assay—Yeast': [3316], 'grown': [3318], 'YPD': [3320], 'media': [3321, 3325], 'YC': [3323], 'dropout': [3324], 'instructions': [3327], 'Origene': [3329], 'Invitrogen.': [3331], 'Quantitative': [3332], 'assays': [3333, 3414], 'performed': [3335, 3416], 'RFY206': [3338, 3402], 'strain': [3339], 'all': [3341, 4182, 4227], 'SRC-1,': [3350], 'monobodies': [3351, 3388], '(small': [3352], 'proteins)': [3354], 'E3#6,': [3355], 'E2#23,': [3356], 'measure': [3385], 'OHT#1': [3389], 'OHT#33': [3391], 'mutants,': [3395, 3508], 'EGY48': [3396], 'harboring': [3397, 3403], 'monobody': [3399], 'hERα-EF': [3405], 'pSH18–34': [3408], 'mated,': [3410], 'β-galactosidase': [3413], 'diploid': [3419, 3425], 'cells.': [3420, 4054], 'Assays': [3421], 'haploid': [3423], 'cells,': [3426], 'respectively,': [3427], 'yielded': [3428], 'essentially': [3429], '(not': [3433], 'shown).': [3434], 'Analysis—To': [3436], 'analyze': [3437], 'ERE-driven': [3448, 3657, 4141], 'reporters': [3451], 'assay': [3457, 4051], '(Figs.': [3458], '2,': [3459, 3687, 3769, 3861], '3,': [3460], '4,': [3461], '5,': [3462], '6),': [3463], 'data': [3465], 'first': [3467, 3502], 'subjected': [3468], 'log': [3471], 'transformation.': [3472], 'Random': [3473], 'effects-generalized': [3474], 'linear': [3475], 'models': [3476, 3590, 3608], 'assess': [3480], 'statistical': [3482], 'significance': [3483], 'differences': [3485, 4234], 'response;': [3487], 'observations': [3488], 'experiments': [3490], 'run': [3491], 'day': [3495], 'assumed': [3497], 'correlated.': [3500], 'fitted': [3504, 3552, 3566, 3592], 'included': [3505, 3519], 'indicators': [3506], 'concentrations,': [3511], 'interaction.': [3515], 'Ligand': [3516], 'concentrations': [3517, 3693, 3702, 3871, 3880], 'indicator': [3524], 'variables': [3525], 'avoid': [3527], 'constraining': [3528], 'shape': [3530], 'relationship': [3533], 'response.': [3537], 'If': [3538, 3580], 'simultaneous': [3540], 'test': [3541], 'terms': [3544, 3557], 'significant,': [3547], 'omitted.': [3559], 'Finally,': [3560], 'even': [3562], 'simpler': [3563], 'parameterized': [3571], 'absence,': [3575], 'collapsed': [3576], 'over': [3577], 'concentrations.': [3579], 'significant': [3583, 3605], 'full': [3587], 'model,': [3588], 'compared.': [3600, 3619], 'case': [3603], 'interaction,': [3606], 'fitted,': [3614], "Holm's": [3620], 'stepdown': [3621], 'procedure': [3622], 'type': [3627], 'I': [3628], 'errors': [3629], 'when': [3630], 'making': [3631], 'tests': [3633], 'among': [3634], 'coefficients.': [3635], 'Model': [3636], 'goodness': [3637], 'fit': [3639], 'assessed': [3641], 'graphically.Fig.': [3642], '3Response': [3643], '4OHT': [3651, 3743, 3780, 3788], 'promoter.': [3658, 3747, 3832], '4-OHT': [3666], 'transiently': [3673, 3755, 3847, 3941, 4057], 'under': [3679, 3761, 3853, 3937], '"Experimental': [3680, 3762, 3854, 3938], 'Procedures"': [3681, 3763, 3855, 3939], 'legend': [3684, 3766, 3858], 'Fig.': [3686, 3768, 3860], 'exception': [3690, 3772, 3864], 'indicated': [3696, 3874], 'used.': [3699, 3782, 3790, 3877], '4-OHT,': [3705], '10-7m,': [3706], '10-6m.': [3710, 3888], 'values': [3712, 3792, 3890, 3954], 'mean': [3715, 3795, 3893, 3957], '±': [3716, 3796, 3894, 3958, 4314, 4330], 'S.E.': [3717, 3797, 3895, 3959], 'experiments,': [3721, 3803, 3899, 3963], 'out': [3724, 3806, 3902, 3966], 'triplicate.View': [3726, 3808, 3904, 3968], 'Large': [3727, 3809, 3905, 3969], 'Image': [3728, 3810, 3906, 3970], 'Figure': [3729, 3811, 3907, 3971], 'ViewerDownload': [3730, 3812, 3908, 3972], 'Hi-res': [3731, 3813, 3909, 3973], 'image': [3732, 3814, 3910, 3974], 'Download': [3733, 3815, 3911, 3975], '(PPT)Fig.': [3734, 3816, 3912], '4Response': [3735], 'Concentrations': [3783], '10-10,10-9,10-8,10-7,': [3785], '10-6m': [3787], 'four': [3801], '5Response': [3817], 'E2': [3825, 3840, 4151, 4173, 4188, 4211, 4261, 4351, 4388, 4418], '10-8m,': [3884], '6Interactions': [3913], 'endogenous': [3918, 4123], 'SRC-1': [3922], 'RID': [3923], 'absence': [3947], '10-7m': [3951], '(PPT)': [3976], 'series': [3988], 'this': [3997, 4108], 'residue': [3998], 'negatively': [4011], 'charged': [4012, 4018], '(glutamic': [4013], 'acid,': [4014], 'L536E),': [4015], 'positively': [4017], '(lysine,': [4019], 'L536K),': [4020], 'polar': [4022], '(asparagine,': [4023], 'L536N),': [4024], 'small': [4026], '(alanine,': [4027], 'L536A,': [4028, 4201], 'glycine,': [4030], 'L536G),': [4031], 'isomeric': [4034], '(isoleucine,': [4035], 'L536I)': [4036], 'chain.': [4038], 'transient': [4049], 'cotransfection': [4050], 'EREs': [4076], 'upstream': [4082], 'linked': [4088], 'sequence,': [4094, 4326], 'constitutively': [4101], '(pRL-SV40).': [4106], 'Using': [4107], 'we': [4110], 'examined': [4111], 'transcriptional': [4113, 4167], 'ERs': [4120, 4365], 'SERM': [4127], '4-hydroxytamoxifen,': [4128], '182,780.': [4133], 'Activity': [4134], 'Promoter—Mutation': [4142], 'alters': [4145], '(p': [4152, 4222], '=': [4153, 4223, 4343], '0.03).': [4154], 'L536I': [4160], 'exhibited': [4162], '18-': [4163], '6-fold': [4165], 'higher': [4166], 'than': [4174, 4214], '2).': [4180, 4195, 4252], 'Remarkably,': [4181], 'lost': [4186], 'dependence': [4189], 'Furthermore,': [4196], 'L536E,': [4202], 'L536I,': [4203], 'L536K': [4205], 'less': [4213], 'E2-stimulated': [4219], '0.05': [4224], 'L536E;': [4226], 'others': [4228], 'p': [4229], '<': [4230], '0.001).': [4231], 'No': [4232], 'consistent': [4233], 'level': [4237], 'detected': [4247], 'immunoblotting': [4250], 'whether': [4255], 'loss': [4257, 4360], 'inability': [4266], 'receptors': [4268], 'hormone.': [4275], 'coli': [4289], '(50': [4296], 'extracts.': [4300], 'All': [4301], 'GST-ER(S282-V595)': [4302], 'vitro,': [4308], 'levels': [4310], 'ranging': [4311], '10.6': [4313], '2.5': [4315], 'pmol': [4316, 4332], '[3H]E2': [4318, 4334], 'bound/mg': [4319, 4335], 'non-mutated': [4324], 'up': [4327], '76': [4329], 'L536G': [4340], '(n': [4342], '3).': [4344], 'Therefore,': [4345], 'lack': [4347], 'effect': [4349], 'hormonebinding': [4362], 'Moreover,': [4364], 'exhibit': [4370], 'estradiol-dependent': [4371], 'assays,': [4378], 'provides': [4380], 'support': [4382], '(see': [4389], 'below).': [4390], 'large': [4399], 'residue,': [4401], 'isoleucine,': [4405], 'sti': [4420]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2118369585', 'counts_by_year': [{'year': 2023, 'cited_by_count': 1}, {'year': 2022, 'cited_by_count': 4}, {'year': 2021, 'cited_by_count': 1}, {'year': 2020, 'cited_by_count': 1}, {'year': 2019, 'cited_by_count': 2}, {'year': 2018, 'cited_by_count': 1}, {'year': 2016, 'cited_by_count': 2}, {'year': 2015, 'cited_by_count': 1}, {'year': 2014, 'cited_by_count': 2}, {'year': 2013, 'cited_by_count': 2}], 'updated_date': '2024-12-17T04:27:43.988450', 'created_date': '2016-06-24'}