Publication Information

{'id': 'https://openalex.org/W2116709740', 'doi': 'https://doi.org/10.1074/jbc.274.42.30101', 'title': 'Identification of Flow-dependent Endothelial Nitric-oxide Synthase Phosphorylation Sites by Mass Spectrometry and Regulation of Phosphorylation and Nitric Oxide Production by the Phosphatidylinositol 3-Kinase Inhibitor LY294002', 'display_name': 'Identification of Flow-dependent Endothelial Nitric-oxide Synthase Phosphorylation Sites by Mass Spectrometry and Regulation of Phosphorylation and Nitric Oxide Production by the Phosphatidylinositol 3-Kinase Inhibitor LY294002', 'publication_year': 1999, 'publication_date': '1999-10-01', 'ids': {'openalex': 'https://openalex.org/W2116709740', 'doi': 'https://doi.org/10.1074/jbc.274.42.30101', 'mag': '2116709740', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/10514497'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.42.30101', 'pdf_url': 'http://www.jbc.org/article/S0021925819518701/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819518701/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5011055783', 'display_name': 'Byron Gallis', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I201448701', 'display_name': 'University of Washington', 'ror': 'https://ror.org/00cvxb145', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I201448701']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Byron Gallis', 'raw_affiliation_strings': ['From the Departments of Medicine and Molecular Biotechnology, University of Washington, Seattle, Washington 98195'], 'affiliations': [{'raw_affiliation_string': 'From the Departments of Medicine and Molecular Biotechnology, University of Washington, Seattle, Washington 98195', 'institution_ids': ['https://openalex.org/I201448701']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5040594335', 'display_name': 'Garry L. Corthals', 'orcid': 'https://orcid.org/0000-0001-9423-5596'}, 'institutions': [{'id': 'https://openalex.org/I201448701', 'display_name': 'University of Washington', 'ror': 'https://ror.org/00cvxb145', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I201448701']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Garry L. Corthals', 'raw_affiliation_strings': ['Molecular Biotechnology, University of Washington, Seattle, Washington 98195'], 'affiliations': [{'raw_affiliation_string': 'Molecular Biotechnology, University of Washington, Seattle, Washington 98195', 'institution_ids': ['https://openalex.org/I201448701']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5023542709', 'display_name': 'David R. Goodlett', 'orcid': 'https://orcid.org/0000-0002-8045-8200'}, 'institutions': [{'id': 'https://openalex.org/I201448701', 'display_name': 'University of Washington', 'ror': 'https://ror.org/00cvxb145', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I201448701']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'David R. Goodlett', 'raw_affiliation_strings': ['Molecular Biotechnology, University of Washington, Seattle, Washington 98195'], 'affiliations': [{'raw_affiliation_string': 'Molecular Biotechnology, University of Washington, Seattle, Washington 98195', 'institution_ids': ['https://openalex.org/I201448701']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5112639091', 'display_name': 'Hiroto Ueba', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I201448701', 'display_name': 'University of Washington', 'ror': 'https://ror.org/00cvxb145', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I201448701']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Hiroto Ueba', 'raw_affiliation_strings': ['From the Departments of Medicine and Molecular Biotechnology, University of Washington, Seattle, Washington 98195'], 'affiliations': [{'raw_affiliation_string': 'From the Departments of Medicine and Molecular Biotechnology, University of Washington, Seattle, Washington 98195', 'institution_ids': ['https://openalex.org/I201448701']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5067724612', 'display_name': 'Francis Kim', 'orcid': 'https://orcid.org/0000-0003-3941-8984'}, 'institutions': [{'id': 'https://openalex.org/I201448701', 'display_name': 'University of Washington', 'ror': 'https://ror.org/00cvxb145', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I201448701']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Francis Kim', 'raw_affiliation_strings': ['From the Departments of Medicine and Molecular Biotechnology, University of Washington, Seattle, Washington 98195'], 'affiliations': [{'raw_affiliation_string': 'From the Departments of Medicine and Molecular Biotechnology, University of Washington, Seattle, Washington 98195', 'institution_ids': ['https://openalex.org/I201448701']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5088326447', 'display_name': 'Steven R. Presnell', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I130701444', 'display_name': 'Georgia Institute of Technology', 'ror': 'https://ror.org/01zkghx44', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I130701444']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Steven R. Presnell', 'raw_affiliation_strings': ['School of Chemistry and Biochemistry, Georgia Institute of Technology, Atlanta, Georgia 30332;'], 'affiliations': [{'raw_affiliation_string': 'School of Chemistry and Biochemistry, Georgia Institute of Technology, Atlanta, Georgia 30332;', 'institution_ids': ['https://openalex.org/I130701444']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5079780359', 'display_name': 'Daniel Figeys', 'orcid': 'https://orcid.org/0000-0002-5373-7546'}, 'institutions': [{'id': 'https://openalex.org/I201448701', 'display_name': 'University of Washington', 'ror': 'https://ror.org/00cvxb145', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I201448701']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Daniel Figeys', 'raw_affiliation_strings': ['Molecular Biotechnology, University of Washington, Seattle, Washington 98195'], 'affiliations': [{'raw_affiliation_string': 'Molecular Biotechnology, University of Washington, Seattle, Washington 98195', 'institution_ids': ['https://openalex.org/I201448701']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5011627807', 'display_name': 'David G. Harrison', 'orcid': 'https://orcid.org/0000-0001-9363-6451'}, 'institutions': [{'id': 'https://openalex.org/I150468666', 'display_name': 'Emory University', 'ror': 'https://ror.org/03czfpz43', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I150468666']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'David G. Harrison', 'raw_affiliation_strings': ['Department of Medicine, Emory University School of Medicine, Atlanta, Georgia 30322.'], 'affiliations': [{'raw_affiliation_string': 'Department of Medicine, Emory University School of Medicine, Atlanta, Georgia 30322.', 'institution_ids': ['https://openalex.org/I150468666']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5003632963', 'display_name': 'Bradford C. Berk', 'orcid': 'https://orcid.org/0000-0002-2767-4115'}, 'institutions': [{'id': 'https://openalex.org/I201448701', 'display_name': 'University of Washington', 'ror': 'https://ror.org/00cvxb145', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I201448701']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Bradford C. Berk', 'raw_affiliation_strings': ['From the Departments of Medicine and Molecular Biotechnology, University of Washington, Seattle, Washington 98195'], 'affiliations': [{'raw_affiliation_string': 'From the Departments of Medicine and Molecular Biotechnology, University of Washington, Seattle, Washington 98195', 'institution_ids': ['https://openalex.org/I201448701']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5053361384', 'display_name': 'Ruedi Aebersold', 'orcid': 'https://orcid.org/0000-0002-9576-3267'}, 'institutions': [{'id': 'https://openalex.org/I201448701', 'display_name': 'University of Washington', 'ror': 'https://ror.org/00cvxb145', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I201448701']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Ruedi Aebersold', 'raw_affiliation_strings': ['Molecular Biotechnology, University of Washington, Seattle, Washington 98195'], 'affiliations': [{'raw_affiliation_string': 'Molecular Biotechnology, University of Washington, Seattle, Washington 98195', 'institution_ids': ['https://openalex.org/I201448701']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5027120648', 'display_name': 'Marshall A. Corson', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I201448701', 'display_name': 'University of Washington', 'ror': 'https://ror.org/00cvxb145', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I201448701']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Marshall A. Corson', 'raw_affiliation_strings': ['From the Departments of Medicine and Molecular Biotechnology, University of Washington, Seattle, Washington 98195'], 'affiliations': [{'raw_affiliation_string': 'From the Departments of Medicine and Molecular Biotechnology, University of Washington, Seattle, Washington 98195', 'institution_ids': ['https://openalex.org/I201448701']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 3, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 15.246, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 331, 'citation_normalized_percentile': {'value': 0.982464, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 98, 'max': 99}, 'biblio': {'volume': '274', 'issue': '42', 'first_page': '30101', 'last_page': '30108'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10683', 'display_name': 'Mass Spectrometry Techniques and Applications', 'score': 0.9988, 'subfield': {'id': 'https://openalex.org/subfields/1607', 'display_name': 'Spectroscopy'}, 'field': {'id': 'https://openalex.org/fields/16', 'display_name': 'Chemistry'}, 'domain': {'id': 'https://openalex.org/domains/3', 'display_name': 'Physical Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10683', 'display_name': 'Mass Spectrometry Techniques and Applications', 'score': 0.9988, 'subfield': {'id': 'https://openalex.org/subfields/1607', 'display_name': 'Spectroscopy'}, 'field': {'id': 'https://openalex.org/fields/16', 'display_name': 'Chemistry'}, 'domain': {'id': 'https://openalex.org/domains/3', 'display_name': 'Physical Sciences'}}, {'id': 'https://openalex.org/T12793', 'display_name': 'Caveolin-1 and cellular processes', 'score': 0.9987, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10155', 'display_name': 'Nitric Oxide and Endothelin Effects', 'score': 0.9977, 'subfield': {'id': 'https://openalex.org/subfields/2737', 'display_name': 'Physiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/phosphoserine', 'display_name': 'Phosphoserine', 'score': 0.5636679}, {'id': 'https://openalex.org/keywords/phosphopeptide', 'display_name': 'Phosphopeptide', 'score': 0.44048008}], 'concepts': [{'id': 'https://openalex.org/C2778326061', 'wikidata': 'https://www.wikidata.org/wiki/Q1761022', 'display_name': 'Enos', 'level': 4, 'score': 0.803596}, {'id': 'https://openalex.org/C519581460', 'wikidata': 'https://www.wikidata.org/wiki/Q207843', 'display_name': 'Nitric oxide', 'level': 2, 'score': 0.67057437}, {'id': 'https://openalex.org/C11960822', 'wikidata': 'https://www.wikidata.org/wiki/Q242736', 'display_name': 'Phosphorylation', 'level': 2, 'score': 0.6165646}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.59741956}, {'id': 'https://openalex.org/C2908688039', 'wikidata': 'https://www.wikidata.org/wiki/Q408853', 'display_name': 'Nitric Oxide Synthase Type III', 'level': 5, 'score': 0.58478165}, {'id': 'https://openalex.org/C2780307904', 'wikidata': 'https://www.wikidata.org/wiki/Q2701649', 'display_name': 'Phosphoserine', 'level': 4, 'score': 0.5636679}, {'id': 'https://openalex.org/C75217442', 'wikidata': 'https://www.wikidata.org/wiki/Q423650', 'display_name': 'Protein kinase B', 'level': 3, 'score': 0.52175266}, {'id': 'https://openalex.org/C2780610907', 'wikidata': 'https://www.wikidata.org/wiki/Q2273248', 'display_name': 'Phosphatidylinositol', 'level': 3, 'score': 0.5186569}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.48820144}, {'id': 'https://openalex.org/C2777622882', 'wikidata': 'https://www.wikidata.org/wiki/Q417619', 'display_name': 'Nitric oxide synthase', 'level': 3, 'score': 0.4620722}, {'id': 'https://openalex.org/C2779933727', 'wikidata': 'https://www.wikidata.org/wiki/Q7187535', 'display_name': 'Phosphopeptide', 'level': 3, 'score': 0.44048008}, {'id': 'https://openalex.org/C123012128', 'wikidata': 'https://www.wikidata.org/wiki/Q5376430', 'display_name': 'Endothelial stem cell', 'level': 3, 'score': 0.42762733}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.3223795}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.2522038}, {'id': 'https://openalex.org/C202751555', 'wikidata': 'https://www.wikidata.org/wiki/Q221681', 'display_name': 'In vitro', 'level': 2, 'score': 0.09949884}, {'id': 'https://openalex.org/C178790620', 'wikidata': 'https://www.wikidata.org/wiki/Q11351', 'display_name': 'Organic chemistry', 'level': 1, 'score': 0.0}, {'id': 'https://openalex.org/C2776414213', 'wikidata': 'https://www.wikidata.org/wiki/Q183290', 'display_name': 'Serine', 'level': 3, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D002867', 'descriptor_name': 'Chromones', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': True}, {'descriptor_ui': 'D004791', 'descriptor_name': 'Enzyme Inhibitors', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': True}, {'descriptor_ui': 'D005090', 'descriptor_name': 'Exodeoxyribonucleases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D009025', 'descriptor_name': 'Morpholines', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': True}, {'descriptor_ui': 'D009569', 'descriptor_name': 'Nitric Oxide', 'qualifier_ui': 'Q000096', 'qualifier_name': 'biosynthesis', 'is_major_topic': True}, {'descriptor_ui': 'D019001', 'descriptor_name': 'Nitric Oxide Synthase', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D000081082', 'descriptor_name': 'Phosphoinositide-3 Kinase Inhibitors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D000595', 'descriptor_name': 'Amino Acid Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001483', 'descriptor_name': 'Base Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002417', 'descriptor_name': 'Cattle', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002478', 'descriptor_name': 'Cells, Cultured', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002867', 'descriptor_name': 'Chromones', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017931', 'descriptor_name': 'DNA Primers', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004791', 'descriptor_name': 'Enzyme Inhibitors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005090', 'descriptor_name': 'Exodeoxyribonucleases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005090', 'descriptor_name': 'Exodeoxyribonucleases', 'qualifier_ui': 'Q000302', 'qualifier_name': 'isolation & purification', 'is_major_topic': False}, {'descriptor_ui': 'D005090', 'descriptor_name': 'Exodeoxyribonucleases', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D007700', 'descriptor_name': 'Kinetics', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013058', 'descriptor_name': 'Mass Spectrometry', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008969', 'descriptor_name': 'Molecular Sequence Data', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009025', 'descriptor_name': 'Morpholines', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009569', 'descriptor_name': 'Nitric Oxide', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019001', 'descriptor_name': 'Nitric Oxide Synthase', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019001', 'descriptor_name': 'Nitric Oxide Synthase', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D052250', 'descriptor_name': 'Nitric Oxide Synthase Type III', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010449', 'descriptor_name': 'Peptide Mapping', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010748', 'descriptor_name': 'Phosphopeptides', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010748', 'descriptor_name': 'Phosphopeptides', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D010766', 'descriptor_name': 'Phosphorylation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.42.30101', 'pdf_url': 'http://www.jbc.org/article/S0021925819518701/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/10514497', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.42.30101', 'pdf_url': 'http://www.jbc.org/article/S0021925819518701/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'score': 0.65, 'display_name': 'Clean water and sanitation', 'id': 'https://metadata.un.org/sdg/6'}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 58, 'referenced_works': ['https://openalex.org/W1479676079', 'https://openalex.org/W1480586135', 'https://openalex.org/W1495926848', 'https://openalex.org/W1513613509', 'https://openalex.org/W1527219367', 'https://openalex.org/W1529396499', 'https://openalex.org/W1530835851', 'https://openalex.org/W1591210132', 'https://openalex.org/W1604362023', 'https://openalex.org/W1607892649', 'https://openalex.org/W1678800844', 'https://openalex.org/W1850214287', 'https://openalex.org/W1967743115', 'https://openalex.org/W1970548320', 'https://openalex.org/W1971915141', 'https://openalex.org/W1981978551', 'https://openalex.org/W1982420679', 'https://openalex.org/W1987013989', 'https://openalex.org/W1987149804', 'https://openalex.org/W1988960711', 'https://openalex.org/W1989260194', 'https://openalex.org/W1997634470', 'https://openalex.org/W2007737411', 'https://openalex.org/W2010100459', 'https://openalex.org/W2022568707', 'https://openalex.org/W2023145731', 'https://openalex.org/W2023170094', 'https://openalex.org/W2025965334', 'https://openalex.org/W2028880044', 'https://openalex.org/W2035508242', 'https://openalex.org/W2037770675', 'https://openalex.org/W2038307719', 'https://openalex.org/W2041075406', 'https://openalex.org/W2044918962', 'https://openalex.org/W2046659581', 'https://openalex.org/W2054014973', 'https://openalex.org/W2059286336', 'https://openalex.org/W2059572899', 'https://openalex.org/W2064554520', 'https://openalex.org/W2066231048', 'https://openalex.org/W2068820862', 'https://openalex.org/W2070999822', 'https://openalex.org/W2075796682', 'https://openalex.org/W2078594804', 'https://openalex.org/W2079044752', 'https://openalex.org/W2084379296', 'https://openalex.org/W2086262311', 'https://openalex.org/W2090440116', 'https://openalex.org/W2092437783', 'https://openalex.org/W2094694252', 'https://openalex.org/W2094920550', 'https://openalex.org/W2112736947', 'https://openalex.org/W2132440861', 'https://openalex.org/W2134785329', 'https://openalex.org/W2146736971', 'https://openalex.org/W2168259122', 'https://openalex.org/W2461168023', 'https://openalex.org/W4244059644'], 'related_works': ['https://openalex.org/W2986570277', 'https://openalex.org/W2335390738', 'https://openalex.org/W2149013144', 'https://openalex.org/W2104658162', 'https://openalex.org/W2102225645', 'https://openalex.org/W2068367688', 'https://openalex.org/W2057928274', 'https://openalex.org/W2048404939', 'https://openalex.org/W2024590470', 'https://openalex.org/W1995271291'], 'abstract_inverted_index': {'Endothelial': [0, 190, 443, 464, 483], 'cells': [1, 37, 191, 227, 403, 465, 587, 998, 4047, 4086, 4143], 'release': [2, 192, 583], 'nitric': [3, 193, 383, 461], 'oxide': [4, 194, 384, 462, 2971, 4154], '(NO)': [5, 195], 'acutely': [6, 196], 'in': [7, 47, 100, 173, 180, 197, 237, 290, 363, 370, 473, 811, 900, 946, 955, 964, 967, 1011, 1019, 1036, 1067, 1084, 1103, 1128, 1248, 1312, 1354, 1576, 1578, 1619, 1641, 1671, 1689, 1716, 1729, 1763, 1913, 1934, 1945, 1956, 2006, 2072, 2199, 2208, 2212, 2219, 2225, 2293, 2320, 2473, 2491, 2499, 2538, 2554, 2602, 2609, 2639, 2889, 2980, 3324, 3453, 3566, 3647, 3649, 3707, 3763, 3777, 3907, 3966, 3968, 3979, 4010, 4020, 4068, 4085, 4088, 4129, 4149, 4220, 4267, 4275, 4299, 4306, 4320, 4369], 'response': [8, 198, 474, 968, 1104, 1313, 3980], 'to': [9, 199, 427, 475, 486, 543, 578, 942, 969, 1000, 1072, 1097, 1105, 1109, 1120, 1226, 1244, 1281, 1300, 1314, 1324, 1369, 1638, 1703, 1711, 1721, 1976, 1999, 2057, 2138, 2270, 2482, 2517, 2676, 2691, 2721, 2932, 2942, 2958, 3084, 3285, 3398, 3659, 3665, 3679, 3981, 4025, 4073, 4098, 4235, 4272, 4281, 4346], 'increased': [10, 184, 200, 374, 478, 1073, 1106, 1285, 1292, 4339], 'laminar': [11, 201, 1639, 4026, 4099], 'fluid': [12, 202, 385, 479], 'shear': [13, 56, 203, 246, 386, 480, 1632, 4380], 'stress,': [14, 204], 'and': [15, 52, 95, 114, 164, 183, 205, 242, 285, 304, 354, 373, 460, 469, 477, 540, 571, 581, 818, 1014, 1086, 1108, 1145, 1233, 1291, 1318, 1327, 1336, 1357, 1391, 1399, 1416, 1490, 1527, 1546, 1551, 1561, 1574, 1624, 1631, 1644, 1659, 1680, 1732, 1745, 1761, 1790, 1846, 1889, 1920, 1971, 1997, 2018, 2049, 2080, 2130, 2185, 2210, 2235, 2278, 2302, 2312, 2324, 2328, 2356, 2413, 2471, 2511, 2559, 2594, 2611, 2629, 2648, 2684, 2701, 2776, 2899, 2906, 2935, 3069, 3073, 3079, 3099, 3116, 3119, 3155, 3164, 3181, 3186, 3213, 3219, 3280, 3330, 3401, 3412, 3428, 3447, 3451, 3496, 3544, 3550, 3644, 3711, 3717, 3728, 3790, 3826, 3892, 3900, 3915, 3971, 4038, 4057, 4075, 4096, 4136, 4201, 4209, 4228, 4255, 4284, 4305, 4337, 4361, 4409], 'the': [16, 119, 129, 151, 176, 181, 206, 309, 319, 341, 366, 371, 699, 796, 805, 961, 1023, 1093, 1099, 1116, 1185, 1189, 1208, 1277, 1350, 1355, 1359, 1660, 1704, 1726, 1746, 1921, 1924, 1972, 2023, 2038, 2062, 2183, 2186, 2220, 2275, 2279, 2294, 2298, 2303, 2325, 2391, 2397, 2437, 2484, 2487, 2493, 2512, 2548, 2560, 2651, 2695, 2712, 2764, 2767, 2778, 2794, 2923, 2936, 2946, 2954, 3005, 3008, 3026, 3066, 3100, 3214, 3271, 3290, 3325, 3551, 3567, 3666, 3697, 3703, 3786, 3902, 3973, 4039, 4058, 4069, 4150, 4221, 4285, 4300, 4307, 4314, 4359, 4386, 4400, 4404], 'increase': [17, 207, 470, 575, 899, 945, 1018, 1035, 1066, 4106], 'is': [18, 208, 451, 568, 809, 3964, 3977], 'correlated': [19, 209], 'with': [20, 39, 86, 125, 210, 229, 276, 315, 698, 1230, 1585, 1677, 1682, 1757, 1878, 1903, 2027, 2042, 2284, 2308, 2314, 2361, 2436, 2540, 2582, 2615, 2666, 2851, 3109, 3184, 3289, 3385, 3685, 3757, 3789, 4008, 4053, 4147, 4218, 4340], 'enhanced': [21, 211, 3978], 'phosphorylation': [22, 161, 212, 351, 1038, 1085, 1228, 1246, 1326, 1360, 3974, 4131, 4406, 4415], 'of': [23, 31, 74, 150, 154, 213, 221, 264, 340, 344, 453, 584, 807, 994, 1078, 1088, 1092, 1115, 1118, 1136, 1170, 1188, 1197, 1203, 1207, 1288, 1295, 1306, 1332, 1766, 1808, 1856, 1881, 1886, 1892, 1906, 1959, 2055, 2135, 2364, 2390, 2443, 2447, 2461, 2486, 2502, 2520, 2531, 2547, 2625, 2766, 2772, 2788, 3010, 3030, 3409, 3468, 3472, 3671, 3675, 3683, 3693, 3702, 3737, 3743, 3760, 3783, 3975, 4152, 4213, 4223, 4313, 4334, 4356, 4358, 4379, 4388, 4416], 'endothelial': [24, 36, 214, 226, 380, 402, 997, 4142], 'nitric-oxide': [25, 215, 381, 433, 436, 444], 'synthase': [26, 216, 382, 434, 437, 445], '(eNOS).': [27, 217], 'Phosphoamino': [28, 218], 'acid': [29, 219, 1125, 1444, 1463, 2082, 2645, 2683, 2687, 4264], 'analysis': [30, 220, 1279, 2083, 4368], 'eNOS': [32, 48, 64, 160, 172, 185, 222, 238, 254, 350, 362, 375, 567, 576, 695, 808, 947, 1020, 1037, 1100, 1175, 1309, 1325, 1362, 1370, 1933, 2121, 2157, 2216, 2358, 3012, 3032, 3122, 3229, 3293, 3327, 3565, 3635, 3661, 3684, 3712, 3724, 3738, 3751, 3762, 3784, 3797, 3963, 3976, 4050, 4081, 4130, 4205, 4248, 4270, 4326, 4391], 'from': [33, 223, 586, 905, 1182, 1212, 1215, 1373, 1385, 1405, 1421, 1435, 1446, 1458, 1468, 1496, 1502, 1513, 1520, 1532, 1544, 1555, 1565, 1614, 1923, 2124, 2182, 2396, 2674, 2694, 2711, 2928, 2940, 3332, 3785, 3863], 'bovine': [34, 224, 400, 995, 1696, 2020, 3031, 3292], 'aortic': [35, 225, 401, 996], 'labeled': [38, 228, 1681, 3864, 4007, 4141, 4217], '[32P]orthophosphate': [40, 230, 1685, 4009, 4148, 4219], 'demonstrated': [41, 145, 231, 335], 'that': [42, 146, 232, 336, 456, 667, 798, 804, 953, 1064, 1344, 1358, 2893, 2915, 3273, 3962, 3972, 4204, 4247], 'only': [43, 233, 4250], 'phosphoserine': [44, 234, 4208, 4251], 'was': [45, 235, 1316, 1320, 1371, 1383, 1445, 1466, 1500, 1511, 1518, 1542, 1701, 1938, 1954, 2040, 2051, 2064, 2122, 2158, 2189, 2217, 2268, 2300, 2331, 2411, 2469, 2497, 2515, 2535, 2552, 2569, 2607, 2655, 2689, 2751, 2791, 2883, 2966, 3015, 3063, 3077, 3114, 3152, 3179, 3210, 3268, 3274, 3283, 3328, 3389, 3396, 3436, 3553, 3569, 3602, 3636, 3645, 3677, 3713, 3730, 3755, 3861, 4051, 4060, 4082, 4265, 4279, 4397, 4411], 'present': [46, 236, 1094, 1342], 'under': [49, 239, 2239, 2523, 4144, 4230, 4252], 'both': [50, 240, 569, 1284, 2774, 4253], 'static': [51, 241, 1717, 3969, 4021, 4089, 4145, 4231, 4254, 4324], 'flow': [53, 243, 1315, 3982, 4256], 'conditions.': [54, 244, 2961], 'Fluid': [55, 245], 'stress': [57, 247, 387, 481, 1633, 4381], 'induced': [58, 248], 'phosphate': [59, 249, 4374, 4389], 'incorporation': [60, 250, 2187, 3729, 4375, 4387, 4402], 'into': [61, 251, 2274, 3161, 3391, 3403, 3795, 4390, 4403], 'two': [62, 120, 252, 310, 1307, 2488, 2549, 3018, 3215, 4333, 4370], 'specific': [63, 253, 1308, 3691, 4401], 'tryptic': [65, 78, 255, 268, 1137, 1168, 1250, 2392, 4282, 4286], 'peptides': [66, 256, 1138, 1178, 1232, 1262, 1559, 2693, 4287, 4296], 'as': [67, 69, 92, 118, 257, 259, 282, 308, 1174, 1222, 1238, 1589, 1647, 1810, 1824, 2086, 2368, 2400, 2415, 2563, 2725, 2916, 2968, 2978, 3081, 3221, 3261, 3335, 3574, 3609, 3752, 3832, 4376], 'early': [68, 258], '30': [70, 260, 1005, 3492, 3770, 3857], 's': [71, 261, 1006], 'after': [72, 262, 2636, 3642, 3909], 'initiation': [73, 263], 'flow.': [75, 265], 'The': [76, 266, 1090, 1123, 1261, 1304, 1365, 1557, 1820, 1896, 1952, 2144, 2156, 2194, 2351, 2528, 2566, 2599, 2749, 3266, 3434, 3600, 3723, 4046, 4066, 4269, 4295, 4353], 'flow-induced': [77, 159, 267, 349], 'phosphopeptides': [79, 122, 269, 312, 1211, 1251, 2393, 4329, 4363], 'were': [80, 116, 270, 306, 1096, 1252, 1263, 1403, 1419, 1434, 1456, 1494, 1530, 1553, 1563, 1572, 1617, 1636, 1674, 1714, 1754, 1795, 1815, 1822, 1899, 1927, 1974, 1990, 2025, 2084, 2147, 2197, 2282, 2306, 2318, 2359, 2394, 2634, 2699, 2718, 2836, 2909, 3159, 3166, 3432, 3449, 3548, 3662, 3705, 3726, 3775, 3793, 3828, 3896, 4006, 4018, 4048, 4071, 4216, 4288, 4297, 4364], 'enriched,': [81, 271], 'separated': [82, 272, 1265, 2148, 3714, 3862], 'by': [83, 97, 109, 123, 162, 167, 188, 273, 287, 299, 313, 352, 357, 378, 490, 1134, 1139, 1199, 1255, 1266, 1812, 2160, 2191, 2206, 2223, 2402, 2475, 2509, 2573, 2613, 2707, 2964, 3263, 3276, 3605, 3639, 3715, 3720, 3732, 3739, 3866, 3898, 3911, 4077, 4303, 4310, 4366], 'capillary': [84, 274, 1272, 2465, 2534, 2901], 'electrophoresis': [85, 275, 420, 425, 440, 1273, 1950], 'intermittent': [87, 277, 2285], 'voltage': [88, 278, 424, 2908, 2938], 'drops,': [89, 279], 'also': [90, 280], 'known': [91, 281], '"peak': [93, 283], 'parking,"': [94, 284], 'analyzed': [96, 286], 'collision-induced': [98, 288, 408, 1200], 'dissociation': [99, 289, 409, 1201], 'a': [101, 133, 291, 323, 704, 812, 943, 1008, 1015, 1079, 1204, 1216, 1642, 1730, 1852, 1876, 1882, 1941, 1946, 1993, 2033, 2150, 2213, 2321, 2444, 2459, 2476, 2500, 2506, 2518, 2541, 2555, 2659, 2667, 2754, 2785, 2839, 2852, 2886, 2920, 2951, 2975, 3082, 3086, 3459, 3690, 3753, 3764, 4054, 4102, 4210, 4291, 4377, 4393], 'tandem': [102, 110, 292, 300, 410], 'mass': [103, 111, 293, 301, 411, 426, 1146, 1192, 2848, 2924, 2955], 'spectrometer.': [104, 294, 1193], 'Two': [105, 295], 'phosphopeptide': [106, 296], 'sequences': [107, 297], 'determined': [108, 298, 1133, 1811, 2190, 2401, 3731, 3897], 'spectrometry,': [112, 302], 'TQpSFSLQER': [113, 303], 'KLQTRPpSPGPPPAEQLLSQAR,': [115, 305], 'confirmed': [117, 307], 'flow-dependent': [121, 311, 4405], 'co-migration': [124, 314], 'synthetic': [126, 316, 1558], 'phosphopeptides.': [127, 317], 'Because': [128, 318], 'sequence': [130, 320, 3282, 3294], '(RIR)TQpSFSLQER': [131, 321], 'contains': [132, 322, 4206, 4249], 'consensus': [134, 324], 'substrate': [135, 325], 'site': [136, 178, 326, 368, 1352], 'for': [137, 327, 1004, 1283, 1540, 1629, 1686, 1707, 1725, 1797, 1817, 1848, 1968, 1981, 2003, 2069, 2141, 2242, 2287, 2571, 2623, 2716, 2780, 3007, 3168, 3441, 3501, 3559, 4240], 'protein': [138, 328, 392, 396, 701, 1080, 1112, 1337, 1809, 1887, 3601, 3766], 'kinase': [139, 329, 393, 1081, 1113, 1338, 3767, 3787], 'B': [140, 330, 394, 1339, 4245], '(PKB': [141, 331], 'or': [142, 332, 447, 1719, 2029, 4023, 4173, 4233], 'Akt),': [143, 333], 'we': [144, 334, 3914], 'LY294002,': [147, 337], 'an': [148, 338, 898, 1065, 2564, 2917, 3110, 3417, 4063], 'inhibitor': [149, 339], 'upstream': [152, 342], 'activator': [153, 343], 'PKB,': [155, 345, 3740], 'phosphatidylinositol': [156, 346, 441, 1333], '3-kinase,': [157, 347], 'inhibited': [158, 348], '97%': [163, 353], 'NO': [165, 355, 467, 471, 484, 585, 965, 1012, 1030, 1074, 1121, 1328, 2962], 'production': [166, 356, 472, 966, 1013, 1031, 1075, 1329], '68%.': [168, 358], 'Finally,': [169, 359], 'PKB': [170, 360, 1345, 1402, 3658, 3676, 3744, 3774, 3792], 'phosphorylated': [171, 179, 361, 369, 1102, 1127, 1311, 1353, 3965, 4084], 'vitro': [174, 364, 1348], 'at': [175, 365, 1349, 1626, 1668, 1800, 1803, 1851, 1929, 1978, 2032, 2066, 2245, 2290, 2577, 2763, 3231, 3438, 3444, 3504, 3555, 3562, 3652, 3689, 3769, 3856, 4237], 'same': [177, 367, 1351], 'cell': [182, 372, 509, 1217, 1356], 'enzymatic': [186, 376, 1363], 'activity': [187, 377, 806, 3692, 3746], '15–20-fold.': [189, 379], 'high': [388, 423, 1140], 'pressure': [389, 1141, 2557], 'liquid': [390, 1142], 'chromatography': [391, 416, 1143, 1259, 1428, 3573, 3608, 3869], 'mitogen-activated': [395], 'free': [397, 901], 'intracellular': [398, 902, 906], 'calcium': [399, 903, 1024], "Dulbecco's": [404], 'modified': [405, 1414], "Eagle's": [406], 'medium': [407, 1579, 1706], 'spectrometry': [412, 1147], 'immobilized': [413, 1256], 'metal': [414, 1257, 2407], 'affinity': [415, 1258, 2408], 'solid': [417, 1269], 'phase': [418, 1270, 3400], 'extraction-capillary': [419], 'polyvinylidene': [421], 'difluoride': [422, 1507], 'charge': [428], 'ratio': [429], 'nitrogen': [430, 2970], 'oxides': [431], 'inducible': [432], 'neuronal': [435], 'polyacrylamide': [438], 'gel': [439, 1944, 1953, 1996, 2063, 2195, 2221, 2280, 2304, 2352, 2398, 3904, 4070], '3-kinase': [442, 1334], '(eNOS1': [446], 'type': [448], 'III': [449], 'NOS)': [450], 'one': [452, 2546], 'three': [454], 'isoenzymes': [455], 'converts': [457], 'l-arginine': [458], 'tol-citrulline': [459], '(NO).': [463], 'synthesize': [466], 'tonically': [468], 'agonists': [476], '(FSS).': [482], 'contributes': [485], 'blood': [487], 'vessel': [488, 492, 2507, 2558], 'homeostasis': [489], 'regulating': [491], 'tone': [493], '(1Palmer': [494], 'R.M.': [495, 913, 931, 978, 1046, 1598, 2989, 3047, 3136, 3308, 3924, 3990, 4114], 'Ferrige': [496], 'A.G.': [497], 'Moncada': [498, 553], 'S.': [499, 554, 618, 717, 771, 3251, 3533, 3950], 'Nature.': [500], '1987;': [501, 1867], '327:': [502], '524-526Crossref': [503], 'PubMed': [504, 521, 535, 560, 598, 623, 655, 690, 733, 761, 789, 840, 866, 890, 919, 938, 988, 1056, 1162, 1608, 1843, 1870, 2101, 2116, 2176, 2262, 2346, 2383, 2431, 2744, 2811, 2830, 2876, 2999, 3058, 3147, 3205, 3256, 3319, 3356, 3380, 3538, 3595, 3630, 3851, 3887, 3934, 3955, 4000, 4124, 4168, 4196], 'Scopus': [505, 522, 536, 561, 599, 624, 656, 691, 734, 762, 790, 841, 867, 891, 920, 989, 1057, 1163, 1609, 1871, 2102, 2117, 2177, 2263, 2347, 2384, 2432, 2745, 2812, 2831, 2877, 3000, 3059, 3148, 3206, 3257, 3320, 3357, 3381, 3539, 3596, 3631, 3852, 3888, 3935, 3956, 4001, 4125, 4169, 4197], '(9366)': [506], 'Google': [507, 524, 538, 563, 601, 626, 658, 693, 736, 764, 792, 843, 869, 893, 922, 939, 991, 1059, 1165, 1611, 1844, 1873, 2104, 2119, 2179, 2265, 2349, 2386, 2434, 2747, 2814, 2833, 2879, 3002, 3061, 3150, 3208, 3259, 3322, 3359, 3383, 3541, 3598, 3633, 3854, 3890, 3937, 3958, 4003, 4127, 4171, 4199], 'Scholar),': [508, 525, 539, 694, 793, 2180, 2266], 'growth': [510], '(2Garg': [511], 'U.C.': [512], 'Hassid': [513], 'A.': [514, 619, 674, 2164, 2334, 2371, 2734, 2800, 2822, 2866, 3252, 3534, 3951], 'J.': [515, 589, 608, 644, 679, 715, 722, 750, 769, 778, 829, 855, 879, 915, 933, 1533, 1834, 3052, 3141, 3313, 3345, 3369, 3523, 3584, 3619, 4182, 4185], 'Clin.': [516, 3053, 3142, 3314], 'Invest.': [517, 3054, 3143, 3315], '1989;': [518, 532, 3202], '83:': [519], '1774-1777Crossref': [520], '(1997)': [523], 'platelet': [526], 'aggregation': [527], '(3Ignarro': [528], 'L.J.': [529, 633, 3235], 'Circ.': [530, 983, 1051, 1603, 2994, 3929, 3995, 4119], 'Res.': [531, 556, 984, 1052, 1604, 2995, 3930, 3996, 4120, 4163], '65:': [533], '1-21Crossref': [534], '(904)': [537], 'leukocyte': [541], 'binding': [542, 766], 'endothelium': [544], '(4Radomski': [545], 'M.W.': [546], 'Vallance': [547], 'P.': [548, 606, 709, 852, 1656, 1742, 2109, 3239, 3521, 4035], 'Whitley': [549], 'G.': [550, 591, 604, 707, 2730, 2862, 3519, 4176], 'Foxwell': [551], 'N.': [552, 1155], 'Cardiovasc.': [555], '1993;': [557, 3952], '27:': [558], '1380-1382Crossref': [559], '(209)': [562], 'Scholar).': [564, 659, 894, 992, 1060, 1166, 1612, 1666, 1752, 2120, 2350, 2387, 2748, 2834, 2880, 3003, 3599, 3634, 4004, 4045], 'In': [565, 660, 1242], 'vivo': [566], 'myristoylated': [570], 'palmitoylated.': [572], 'These': [573], 'modifications': [574], 'compartmentalization': [577], 'plasmalemmal': [579, 665], 'caveolae': [580], 'facilitate': [582], '(5Liu': [588], 'Garcia-Cardena': [590], 'Sessa': [592, 611, 720, 3526, 4183], 'W.C.': [593, 612, 721, 3527, 4184], 'Biochemistry.': [594], '1996;': [595, 620, 647, 753, 985, 1053, 1605, 2173, 2259, 2343, 2380, 2808, 2827, 2996, 3372, 3535, 3622, 3931, 3997, 4121, 4165, 4188], '35:': [596], '13277-13281Crossref': [597], '(203)': [600], 'Scholar,': [602, 627, 737, 844, 870, 923, 2105, 2815, 3360, 3938], '6Garcia-Cardena': [603], 'Oh': [605, 3520], 'Liu': [607, 3242, 3522, 4181], 'Schnitzer': [609, 3524], 'J.E.': [610, 3525, 3845, 3881], 'Proc.': [613, 3246, 3528, 3945], 'Natl.': [614, 3247, 3529, 3946], 'Acad.': [615, 3248, 3530, 3947], 'Sci.': [616, 3249, 3531, 3948], 'U.': [617, 3250, 3532, 3949], '93:': [621, 3536], '6448-6453Crossref': [622, 3537], '(578)': [625, 3540], '7Shaul': [628], 'P.W.': [629], 'Smart': [630], 'E.J.': [631], 'Robinson': [632], 'German': [634], 'Z.': [635], 'Yuhanna': [636], 'I.S.': [637], 'Ying': [638], 'Y.': [639], 'Anderson': [640, 3196], 'R.G.': [641], 'Michel': [642, 748, 853, 877], 'T.': [643, 672, 749, 773, 775, 854, 878, 1534, 2111, 3940], 'Biol.': [645, 680, 723, 751, 779, 830, 856, 880, 1835, 3346, 3370, 3585, 3620, 4186], 'Chem.': [646, 681, 724, 752, 780, 831, 857, 881, 1836, 2172, 2342, 2379, 2740, 2826, 2872, 3347, 3371, 3586, 3621, 4187], '271:': [648, 754, 3373, 3623, 4189], '6518-6522Abstract': [649], 'Full': [650, 652, 685, 687, 728, 730, 756, 758, 784, 786, 835, 837, 861, 863, 885, 887, 1840, 3351, 3353, 3375, 3377, 3590, 3592, 3625, 3627, 4191, 4193], 'Text': [651, 653, 686, 688, 729, 731, 757, 759, 785, 787, 836, 838, 862, 864, 886, 888, 1841, 3352, 3354, 3376, 3378, 3591, 3593, 3626, 3628, 4192, 4194], 'PDF': [654, 689, 732, 760, 788, 839, 865, 889, 1842, 3355, 3379, 3594, 3629, 4195], '(626)': [657], 'caveolae,': [661], 'which': [662, 1275, 2679, 2782], 'are': [663, 4318, 4344], 'small': [664, 1129, 2786, 4211], 'invaginations': [666], 'sequester': [668], 'signaling': [669], 'proteins': [670, 1130, 1172, 1213, 1973, 1987, 2056, 4067], '(8Okamoto': [671], 'Schlegel': [673], 'Scherer': [675], 'P.E.': [676], 'Lisanti': [677, 718, 776], 'M.P.': [678, 719, 777], '1998;': [682], '273:': [683], '5419-5422Abstract': [684], '(1347)': [692], 'specifically': [696], 'interacts': [697], 'scaffolding': [700], 'caveolin-1': [702, 816], 'through': [703, 815, 3270], 'caveolin': [705], '(9Garcia-Cardena': [706], 'Martasek': [708, 3238], 'Masters': [710, 3244], 'B.S.': [711, 3245], 'Skidd': [712], 'P.M.': [713], 'Couet': [714], 'Li': [716, 770, 3941], '1997;': [725, 781, 832, 858, 882], '272:': [726, 782, 833, 859, 883], '25437-25440Abstract': [727], '(696)': [735], '10Feron': [738], 'O.': [739, 848, 874, 1650, 1736, 2168, 2338, 2375, 4029], 'Belhassen': [740], 'L.': [741, 743, 3944], 'Kobzik': [742], 'Smith': [744], 'T.W.': [745], 'Kelly': [746], 'R.A.': [747], '22810-22814Abstract': [755], '(598)': [763], 'Scholar)': [765, 940, 1845, 1874, 2435, 3062, 3151, 3209, 3260, 3323, 3384, 3542, 3855, 3891, 3959, 4128, 4172, 4200], 'motif': [767], '(11Couet': [768], 'Okamoto': [772], 'Ikezu': [774], '6525-6533Abstract': [783], '(811)': [791], 'located': [794, 2159], 'near': [795], 'domain': [797], 'binds': [799], 'Ca2+/calmodulin.': [800], 'Recent': [801], 'studies': [802], 'suggest': [803], 'regulated': [810], 'reciprocal': [813], 'manner': [814], 'inhibition': [817], 'Ca2+/calmodulin': [819], 'stimulation': [820], '(12Ju': [821], 'H.': [822], 'Zou': [823], 'R.': [824, 1157, 2095, 2425, 2738, 2805, 2824, 2870, 3843, 3879, 4178], 'Venema': [825, 827, 4159], 'V.J.': [826, 4156], 'R.C.': [828, 3338, 3577, 4160], '18522-18525Abstract': [834], '(526)': [842], '13Michel': [845], 'J.B.': [846, 872], 'Feron': [847, 873], 'Sase': [849], 'K.': [850, 3035, 3124, 3296], 'Prabhakar': [851], '25907-25912Abstract': [860], '(271)': [868], '14Michel': [871], 'Sacks': [875], 'D.': [876, 2728, 2798, 2817, 2860], '15583-15586Abstract': [884], '(512)': [892], 'Increased': [895], 'FSS': [896, 970, 1003, 1068, 1107, 1119, 1323, 1640, 1724, 4027, 4100, 4236, 4349], 'stimulates': [897], '[Ca2+]i': [904, 956], 'stores': [907], '(15James': [908], 'N.L.': [909, 974, 1042, 1594, 2985, 3920, 3986, 4110], 'Harrison': [910, 981, 1049, 1601, 2992, 3036, 3125, 3297, 3343, 3582, 3927, 3993, 4117], 'D.G.': [911, 982, 1050, 1602, 2993, 3037, 3126, 3298, 3344, 3583, 3928, 3994, 4118], 'Nerem': [912, 930, 977, 1045, 1597, 2988, 3046, 3135, 3307, 3923, 3989, 4113], 'FASEB': [914], '1995;': [916, 3253, 3348, 3587], '9:': [917], '968-973Crossref': [918], '(48)': [921], '16Geiger': [924], 'R.V.': [925], 'Berk': [926, 979, 1047, 1599, 1653, 1739, 2990, 3925, 3991, 4032, 4115], 'B.C.': [927, 980, 1048, 1600, 2991, 3926, 3992, 4116], 'Alexander': [928, 3048, 3137, 3309], 'R.W.': [929, 3049, 3138, 3310], 'Am.': [932], 'Physiol.': [934], '1992;': [935, 3055, 3144, 3316], '262:': [936], 'C1411-C1417Crossref': [937], 'leading': [941], 'Ca2+/calmodulin-dependent': [944], 'activity.': [948, 1364], 'However,': [949, 1167], 'recent': [950], 'investigations': [951], 'show': [952], 'increases': [954, 1361], 'do': [957], 'not': [958, 1235], 'fully': [959], 'explain': [960], 'rapid': [962, 1029, 1180], 'rise': [963, 1010], '(17Corson': [971, 1039, 1591, 2982, 3917, 3983, 4107], 'M.A.': [972, 1040, 1592, 2983, 3918, 3984, 4108], 'James': [973, 1041, 1593, 2984, 3919, 3985, 4109], 'Latta': [975, 1043, 1595, 2986, 3921, 3987, 4111], 'S.E.': [976, 1044, 1596, 2987, 3922, 3988, 4112], '79:': [986, 1054, 1606, 2997, 3932, 3998, 4122], '984-991Crossref': [987, 1055, 1607, 2998, 3933, 3999, 4123], '(411)': [990, 1058, 1610, 3001, 3936, 4002, 4126], 'Exposure': [993], '(BAEC)': [999], '25': [1001, 2291], 'dynes/cm2': [1002, 1723, 4239, 4348], 'caused': [1007, 1028, 4101], '7-fold': [1009], 'corresponding': [1016], '2-fold': [1017, 4105], 'phosphorylation,': [1021, 3780], 'whereas': [1022], 'ionophore': [1025], 'A23187': [1026], 'neither': [1027], 'nor': [1032], 'any': [1033], 'net': [1034], 'We': [1061, 1341], 'therefore': [1062], 'hypothesized': [1063], 'could': [1069], 'be': [1070, 1132, 1236, 3286], 'transduced': [1071], 'via': [1076, 1330, 3171], 'activation': [1077, 1087, 1331, 3736], 'cascade': [1082], 'resulting': [1083], 'eNOS.': [1089, 4268], 'objectives': [1091], 'work': [1095], 'elucidate': [1098], 'sites': [1101, 1247, 4407], 'identify': [1110, 1245], 'potential': [1111], 'mediators': [1114], 'mechanotransduction': [1117], 'production.': [1122], 'amino': [1124], 'residues': [1126, 1310], 'may': [1131], 'fractionation': [1135], '(HPLC)': [1144], '(18Gygi': [1148], 'S.P.': [1149, 3043, 3132, 3304], 'Han': [1150], 'D.K.': [1151], 'Gingras': [1152], 'A.C.': [1153], 'Sonenberg': [1154], 'Aebersold': [1156, 2094, 2424, 2737, 2804, 2823, 2869], 'Electrophoresis.': [1158, 2112, 2258], '1999;': [1159, 2741, 2873, 3848, 3884], '20:': [1160], '310-319Crossref': [1161], '(89)': [1164], 'fragmentation': [1169], 'large': [1171], 'such': [1173, 2914], 'creates': [1176], 'numerous': [1177], 'whose': [1179], 'elution': [1181, 2624], 'HPLC': [1183, 1541, 2652, 2654, 2713], 'exceeds': [1184], 'scan': [1186, 1286, 2930], 'rate': [1187], 'triple': [1190, 2846], 'quadrupole': [1191, 2847], 'This': [1194, 3075, 3104], 'prevents': [1195], 'acquisition': [1196, 2882], 'sequences,': [1198], '(CID),': [1202], 'substantial': [1205], 'fraction': [1206, 2705], 'peptides.': [1209], 'Additionally,': [1210], 'isolated': [1214], 'will': [1218, 1234], 'nearly': [1219, 4104], 'always': [1220], 'exist': [1221], 'minor': [1223, 3386], 'ions': [1224, 1290], 'due': [1225], 'sub-stoichiometric': [1227], 'compared': [1229], 'nonphosphorylated': [1231], 'scanned': [1237], 'major': [1239], 'parent': [1240, 1289], 'ions.': [1241], 'order': [1243], 'eNOS,': [1249], 'first': [1253, 4301], 'enriched': [1254], '(IMAC).': [1260], 'then': [1264, 2536, 3182, 3718], 'peak': [1267, 1278], 'parking': [1268], 'extraction': [1271], '(SPE-CE),': [1274], 'extends': [1276], 'time': [1280, 3699, 4341, 4395], 'provide': [1282], 'times': [1287, 1728, 1902], 'MS/MS': [1293, 2933], 'analyses': [1294], 'each': [1296, 2441, 3471, 4357], 'selected': [1297], 'peptide': [1298], 'according': [1299, 3664], 'optimized': [1301], 'CID': [1302], 'parameters.': [1303], 'identity': [1305], 'determined,': [1317], 'evidence': [1319, 1343], 'obtained': [1321, 1420, 1501, 1543], 'linking': [1322], '(PI3-kinase)': [1335], '(PKB).': [1340], 'phosphorylates': [1346], 'eNOSin': [1347], 'monoclonal': [1366, 1894, 4055], 'antibody': [1367, 1382, 1398], '(H32)': [1368], 'purchased': [1372, 1384, 1404, 1457, 1467, 1495, 1512, 1519, 1531, 1554, 1564], 'Biomol': [1374], '(Plymouth': [1375], 'Meeting,': [1376], 'NJ).': [1377], 'Anti-phosphoserine': [1378], '473-PKB': [1379], 'rabbit': [1380], 'polyclonal': [1381, 1397], 'New': [1386], 'England': [1387], 'Biolabs': [1388], '(Beverly,': [1389], 'MA),': [1390], 'anti-PKB': [1392, 2030], '(pleckstrin': [1393], 'homology': [1394], 'domain)': [1395], 'sheep': [1396], 'activated': [1400], 'recombinant': [1401, 3761], 'Upstate': [1406], 'Biotechnology': [1407], 'Inc.': [1408, 1505, 1536], '(Lake': [1409], 'Placid,': [1410], 'NY).': [1411], 'Sequencing': [1412], 'grade': [1413, 2366], 'trypsin': [1415, 1784, 2367], 'compound': [1417], 'U0126': [1418], 'Promega': [1422], '(Madison,': [1423], 'WI).': [1424], 'Cellulose': [1425], 'thin': [1426, 3867, 4292, 4315], 'layer': [1427, 3868, 4293, 4316], 'sheets': [1429], '(20': [1430], '×': [1431, 2454, 2759, 3557], '20': [1432, 3516, 3560, 3800], 'cm)': [1433], 'Eastman': [1436], 'Kodak': [1437], 'Co.': [1438], 'Constant': [1439], 'boiling': [1440], '6': [1441], 'n': [1442], 'hydrochloric': [1443], 'Pierce.': [1447], 'Hybond': [1448], 'ECL': [1449], 'nitrocellulose': [1450, 1977, 4074, 4273], 'membranes': [1451, 2024], 'andl-[U-14C]arginine': [1452], 'monohydrochloride': [1453], '(278': [1454], 'mCi/mmol)': [1455], 'Amersham': [1459], 'Pharmacia': [1460, 2047], 'Biotech.': [1461], '[32P]Orthophosphoric': [1462], '(185': [1464], 'MBq)': [1465], 'NEN': [1469], 'Life': [1470, 1503], 'Science': [1471], 'Products.': [1472], 'Phosphoserine,': [1473], 'phosphothreonine,': [1474], 'phosphotyrosine,': [1475], 'ninhydrin,': [1476], 'polyvinylpyrrolidone': [1477], '(PVP40,M': [1478], 'r': [1479], '=': [1480, 3420, 4259], '40,000),': [1481], 'silver': [1482, 2161, 3640, 3721], 'nitrate': [1483], 'ultra,': [1484, 1487], 'sodium': [1485, 1488, 1914], 'thiosulfate': [1486], 'carbonate,': [1489], '8-(chlorophenylthio)-guanosine': [1491], '3′:5′-cyclic': [1492], 'monophosphate': [1493], 'Sigma.': [1497], 'Protein': [1498], 'A-agarose': [1499, 1888], 'Technologies,': [1504, 1582], 'Polyvinylidene': [1506], '(PVDF)': [1508], 'Immobilon': [1509, 2059], 'P': [1510, 2060], 'Millipore': [1514], '(Bedford,': [1515], 'MA).': [1516], 'DETA-NONOate': [1517], 'Alexis': [1521], 'Biochemicals': [1522], '(San': [1523, 2841], 'Diego,': [1524], 'CA).': [1525, 1569], 'Formaldehyde': [1526], 'ammonium': [1528, 2201, 2227, 2310], 'bicarbonate': [1529, 2311], 'Baker': [1535], 'High': [1537], 'purity': [1538], 'acetonitrile': [1539], 'Burdick': [1545], 'Jackson': [1547], '(Muskegon,': [1548], 'MI).': [1549], 'LY294002': [1550], 'PD98059': [1552], 'Calbiochem.': [1556], 'RIRTQpSFSLQER': [1560], 'KLQTRPpSPGPPPAEQLLSQAR': [1562], 'SynPep': [1566], 'Corp.': [1567], '(Dublin,': [1568], 'BAEC': [1570, 1667, 2136, 2965, 3967, 4005, 4215, 4343], 'cultures': [1571], 'established': [1573], 'maintained': [1575, 1715, 4019, 4087, 4229], 'culture': [1577, 1622, 1705, 1718, 2128, 2133, 3435, 4090], '199': [1580], '(Life': [1581], 'Inc.)': [1583], 'supplemented': [1584], 'fetal': [1586, 1695], 'calf': [1587], 'serum': [1588, 2021], 'described': [1590, 1648, 1825, 2087, 2369, 2416, 2726, 2857, 2979, 3336, 3575, 3610, 3833], 'Cells': [1613, 1635, 1713, 1753, 4017], 'passage': [1615], '3–8': [1616], 'seeded': [1618], '100-mm': [1620, 1672, 2127], 'tissue': [1621], 'dishes': [1623, 1673, 2129, 2134], 'used': [1625, 1816, 2690, 3080, 3678], '60–80%': [1627, 1669], 'confluency': [1628], 'labeling': [1630], 'experiments.': [1634], 'exposed': [1637, 1720, 2137, 4234, 4345], 'cone': [1643, 1731], 'plate': [1645, 1733], 'viscometer': [1646, 1734], '(19Traub': [1649, 1735, 4028], 'Yan': [1651, 1737, 4030], 'C.': [1652, 1738, 4031], 'B.': [1654, 1740, 1833, 1862, 2732, 2864, 4033], 'Lelkes': [1655, 1741, 4034], 'Mechanical': [1657, 1743, 4036], 'Forces': [1658, 1744, 4037], 'Endothelium.': [1661, 1747, 4040], 'Hardood': [1662, 1748, 4041], 'Academic': [1663, 1749, 4042], 'Publishers,': [1664, 1750, 4043], 'UK1999Google': [1665, 1751, 4044], 'confluence': [1670], 'washed': [1675, 1756, 1900, 2198, 2307], 'twice': [1676], 'phosphate-free': [1678, 1690, 4011], 'DMEM': [1679, 1691, 4012], '1': [1683, 2004, 2142, 2243, 2288, 3469, 3483, 3486, 3489, 3815, 4092, 4134, 4241, 4244, 4277], 'mCi/ml': [1684], '3': [1687, 3429, 3804, 3823], 'h': [1688, 1850, 2005, 2071, 2244, 2289, 3443], 'containing': [1692, 1769, 2075, 2231, 2354, 3406, 3799, 3905, 4013], '10%': [1693, 3650], 'dialyzed': [1694], 'serum.': [1697], 'Na3VO4': [1698, 4224], '(200': [1699], 'μm)': [1700, 2761, 3688], 'added': [1702], '10': [1708, 1778, 1781, 1969, 2232, 3466, 3681], 'min': [1709, 1799, 3503, 3561], 'prior': [1710], 'harvest.': [1712], '12–15': [1722], 'indicated': [1727, 3698], 'rapidly': [1755], 'ice-cold': [1758], 'phosphate-buffered': [1759, 1767], 'saline': [1760, 1768], 'lysed': [1762, 3452], '0.7': [1764], 'ml': [1765, 1905, 1958, 3408, 3470], '1%': [1770, 2019, 2200, 2226, 2309], 'Triton': [1771], 'X-100,': [1772], '50': [1773, 3454, 3818], 'mm': [1774, 1787, 1792, 1858, 1963, 2008, 2011, 2233, 2237, 2758, 3455, 3463, 3481, 3484, 3487, 3546, 3816, 3819], 'β-glycerophosphate,': [1775], '200': [1776, 3445, 4014], 'μmNa3VO4,': [1777], 'μg/ml': [1779, 1782, 3414], 'leupeptin,': [1780, 3473], 'soybean': [1783], 'inhibitor,': [1785], '2': [1786, 1791, 2236, 4331], 'benzamidine': [1788], 'HCl,': [1789], 'EDTA.': [1793, 2632], 'Lysates': [1794], 'centrifuged': [1796, 3554], '5': [1798, 1890, 2070, 2521, 2578, 3480, 3508, 3513], '14,000': [1801], 'rpm': [1802], '4': [1804, 1849, 3563, 3807, 3809, 3812], '°C.': [1805, 1931, 2247, 3506, 3564, 3654, 3771, 3858], 'Equivalent': [1806], 'amounts': [1807], 'Bradford': [1813], 'assay': [1814], 'all': [1818], 'immunoprecipitations.': [1819], 'supernatants': [1821], 'precleared': [1823], '(20Acres': [1826], 'R.B.': [1827], 'Conlon': [1828], 'P.J.': [1829], 'Mochizuki': [1830], 'D.Y.': [1831], 'Gallis': [1832, 1861, 2731, 2863], '1986;': [1837], '261:': [1838], '16210-16214Abstract': [1839], 'incubated': [1847, 2283, 3756], 'final': [1853], 'NaCl': [1854], 'concentration': [1855], '400': [1857], '(21Peltz': [1859], 'G.A.': [1860], 'Peterlin': [1863], 'B.M.': [1864], 'Anal.': [1865, 2096, 2171, 2341, 2378, 2426, 2739, 2825, 2871, 3846, 3882], 'Biochem.': [1866, 2097, 2427, 3847, 3883, 4161], '167:': [1868], '239-244Crossref': [1869], '(6)': [1872], 'on': [1875, 1940, 1992, 2149, 2658, 2753, 2838, 2911, 4062], 'rocker': [1877], '60': [1879], 'μl': [1880], '20%': [1883, 2076], 'suspension': [1884], '(v/v)': [1885, 2272], 'μg': [1891, 3467, 3682, 3759], 'anti-eNOS': [1893], 'antibody.': [1895], 'immune': [1897, 1925], 'pellets': [1898, 1926], 'four': [1901], '0.8': [1904], 'lysis': [1907], 'buffer': [1908, 1937, 1961, 2074, 2299], 'without': [1909, 3773, 3791], 'protease': [1910, 3460], 'inhibitors,': [1911], 'boiled': [1912, 3706], 'dodecyl': [1915], 'sulfate': [1916], '(SDS)': [1917], 'sample': [1918, 1936, 2750, 2779, 3709], 'buffer,': [1919, 2277, 3710], 'eluates': [1922], 'stored': [1928, 3646], '−20': [1930, 2941], 'Immunoprecipitated': [1932], 'SDS': [1935, 3708], 'fractionated': [1939, 1991, 4061, 4298], '9%': [1942, 1994, 2153], 'SDS-polyacrylamide': [1943, 1995, 2154, 4064], 'Bio-Rad': [1947], 'Mini-PROTEAN': [1948], 'II': [1949], 'apparatus.': [1951], 'soaked': [1955], '100': [1957, 1979, 2007, 2010, 2362, 3413], 'transfer': [1960, 2073], '(24': [1962], 'Tris': [1964], 'base,': [1965], '181': [1966], 'mmglycine)': [1967], 'min,': [1970], 'transferred': [1975, 1998, 2065, 4072, 4271], 'V': [1980, 2068], '70': [1982], 'min.': [1983, 2143, 4242], 'For': [1984, 2053, 2248, 2544, 3669, 3735], 'Western': [1985], 'blotting,': [1986], '(30': [1988], 'μg/lane)': [1989], 'nitrocellulose.': [2000], 'After': [2001, 2036, 2296, 3779], 'blocking': [2002], 'NaCl,': [2009], 'Tris-HCl,': [2012], 'pH': [2013, 2203, 2229, 3457, 3821], '7.4,': [2014], '0.1%': [2015, 2621], 'Tween': [2016], '20,': [2017], 'albumin,': [2022], 'reacted': [2026, 2041], 'anti-phospho-PKB': [2028], 'antibodies': [2031, 2045], '1:1000': [2034], 'dilution.': [2035], 'washing,': [2037, 2326], 'blot': [2039], 'horseradish': [2043], 'peroxidase-conjugated': [2044], '(Amersham': [2046], 'Biotech),': [2048], 'chemiluminescence': [2050, 2976], 'performed.': [2052], 'blotting': [2054], 'PVDF': [2058], 'membrane,': [2061], '35': [2067], 'methanol.': [2077], 'Phosphopeptide': [2078], 'mapping': [2079], 'phosphoamino': [2081, 4263], 'performed': [2085, 3663], '(22Affolter': [2088, 2418], 'M.': [2089, 2166, 2170, 2336, 2340, 2373, 2377, 2419, 2736, 2868, 3045, 3134, 3306, 3841, 3877], 'Watts': [2090, 2420], 'J.D.': [2091, 2421], 'Krebs': [2092, 2422], 'D.L.': [2093, 2423], '1994;': [2098, 2113, 2428], '223:': [2099, 2429], '74-81Crossref': [2100, 2430], '(45)': [2103, 2433], '23van': [2106], 'der': [2107], 'Geer': [2108], 'Hunter': [2110], '15:': [2114], '544-554Crossref': [2115], '(125)': [2118], 'immunoprecipitated': [2123, 4052], 'six': [2125], '[32P]orthophosphate-labeled': [2126], '12': [2131], 'non-labeled': [2132], '15': [2139, 3502, 4238, 4347], 'dynes/cm2FSS': [2140], 'pooled': [2145], 'immunoprecipitates': [2146], '0.75-mm': [2151], 'thick,': [2152], 'gel.': [2155, 4065], 'staining': [2162], '(24Shevchenko': [2163, 2333, 2370], 'Wilm': [2165, 2335, 2372], 'Vorm': [2167, 2337, 2374], 'Mann': [2169, 2339, 2376], '68:': [2174, 2344, 2381, 2828], '850-858Crossref': [2175, 2345, 2382], '(7831)': [2178, 2348, 2385], 'excised': [2181], 'gel,': [2184], 'of32P': [2188], 'Cerenkov': [2192, 2403, 2708, 3733], 'counting.': [2193, 2404, 2709, 3734], 'slices': [2196, 2222, 2281, 2305, 2317, 2353], 'bicarbonate,': [2202, 2228], '8.3,': [2204, 2230], 'shrunk': [2205, 2313], 'dehydration': [2207], 'acetonitrile,': [2209, 2678, 2724], 'dried': [2211, 2319], 'vacuum': [2214, 2322], 'centrifuge.': [2215], 'reduced': [2218, 2355], 'incubation': [2224], 'dithiothreitol': [2234], 'EDTA': [2238], 'N2': [2240], 'gas': [2241], '56': [2246], 'alkylation': [2249], '(25Moritz': [2250], 'R.L.': [2251], 'Eddes': [2252], 'J.S.': [2253], 'Reid': [2254], 'G.E.': [2255], 'Simpson': [2256], 'R.J.': [2257], '17:': [2260], '907-917Crossref': [2261], '(92)': [2264], '4-vinylpyridine': [2267], 'diluted': [2269, 3794], '2%': [2271], 'directly': [2273], 'reduction': [2276], 'shaking': [2286], '°C': [2292, 3233, 3440], 'dark.': [2295], 'S-pyridylethylation,': [2297], 'removed,': [2301], 'acetonitrile.': [2315], 'Gel': [2316], 'centrifuge,': [2323], 'shrinking,': [2327], 'drying': [2329], 'procedure': [2330], 'repeated': [2332], 'alkylated': [2357], 'digested': [2360], 'ng': [2363, 3674, 3742], 'sequencing': [2365], 'Ninety-five': [2388], 'percent': [2389], 'recovered': [2395], 'slice,': [2399], 'An': [2405, 3022], 'ion': [2406, 2897, 2912, 2918, 2947], 'column': [2409, 2514, 2568], '(IMAC)': [2410], 'constructed': [2412, 3016], 'operated': [2414], 'previously': [2417, 2858], 'following': [2438, 3067], 'exceptions.': [2439], 'To': [2440], 'end': [2442, 2496], '10-cm-long': [2445], 'piece': [2446, 2460, 2530], 'Teflon': [2448, 2495], 'tubing': [2449], '(1/16': [2450], 'inches': [2451, 2456], 'outer': [2452], 'diameter': [2453], '0.0001': [2455], 'inner': [2457], 'diameter)': [2458], 'polyimide-coated': [2462], 'fused': [2463, 2532], 'silica': [2464, 2533, 3903], '(PlymicroTechnologies,': [2466], 'Tucson,': [2467], 'AZ)': [2468], 'inserted': [2470], 'held': [2472], 'place': [2474, 2492, 2539], 'union': [2477], '(Valco,': [2478], 'Houston,': [2479], 'TX).': [2480], 'Prior': [2481], 'fixing': [2483], 'second': [2485, 2529, 2542, 4308], 'polyimide': [2489, 2550], 'capillaries': [2490, 2551], 'open': [2494], 'placed': [2498, 2553, 2762], 'slurry': [2501], 'POROS-MC': [2503], '(PerSeptive)': [2504], 'inside': [2505], 'pressurized': [2508], 'helium,': [2510], 'IMAC': [2513, 2567], 'packed': [2516], 'length': [2519], 'cm': [2522], '500': [2524, 3407, 3422, 3424], 'pounds/square': [2525, 2579], 'inch': [2526], 'pressure.': [2527], 'fixed': [2537], 'union.': [2543], 'operation': [2545], 'helium': [2556], 'other': [2561, 4262], 'served': [2562], 'outlet.': [2565], 'prepared': [2570, 2777], 'use': [2572], 'washing': [2574, 2614], '(5': [2575], 'min/wash': [2576], 'inch)': [2580], 'sequentially': [2581], 'water,': [2583, 2587, 2620, 2628], '0.1': [2584, 2588, 2595, 2603, 2616, 2630], 'm': [2585, 2589, 2596, 2604, 2617, 2631], 'EDTA,': [2586, 3485], 'acetic': [2590, 2597, 2605, 2618, 2641, 2682], 'acid,': [2591, 2606, 2619, 2642, 3427], '0.1m': [2592], 'FeCl3,': [2593], 'acid.': [2598], 'sample,': [2600], 'reconstituted': [2601, 2638], 'loaded': [2608], 'entirety': [2610], 'followed': [2612], 'NH4H2PO4': [2622], 'bound': [2626], 'phosphopeptides,': [2627], 'Peptides': [2633, 2835], 'concentrated': [2635, 2719], 'IMAC,': [2637], '0.4%': [2640, 2681], '0.005%': [2643, 2685], 'heptafluorobutyric': [2644, 2686], '(solvent': [2646], 'A)': [2647, 3500, 4278], 'injected': [2649], 'onto': [2650, 2793, 4290], 'column.': [2653, 2670, 2696], 'carried': [2656, 3829], 'out': [2657, 3830], 'Michrome': [2660], 'Bioresources': [2661], 'instrument': [2662, 2890], '(Auburn,': [2663], 'CA)': [2664, 2843], 'equipped': [2665, 2850], '0.5-mm': [2668], 'C18': [2669, 2755], 'A': [2671, 2770, 3174, 3223, 3394, 3418, 4135], 'linear': [2672], 'gradient': [2673], '0': [2675], '60%': [2677], 'contained': [2680, 4327], 'wash,': [2688], 'elute': [2692], 'One-minute': [2697], 'fractions': [2698], 'collected': [2700], '32P': [2702], 'content': [2703], 'per': [2704], 'estimated': [2706], 'Fractions': [2710], 'separation': [2714], 'intended': [2715], 'SPE-CE': [2717], 'slightly': [2720], 'remove': [2722], 'excess': [2723], '(26Figeys': [2727, 2859], 'Corthals': [2729, 2861], 'Ducret': [2733, 2799, 2821, 2865], 'Corson': [2735, 2867], '71:': [2742, 2874], '2279-2287Crossref': [2743, 2875], '(54)': [2746, 2878], 'pressure-injected': [2752, 2792], 'cartridge': [2756, 2796], '(1': [2757, 3462], '250': [2760], 'head': [2765], 'CE': [2768, 2781, 2907, 2937], 'capillary.': [2769], 'series': [2771], 'washes': [2773], 'desalted': [2775], 'began': [2783], 'when': [2784, 4342], 'plug': [2787], 'organic': [2789], 'solvent': [2790], 'SPE': [2795], '(27Figeys': [2797], 'Yates': [2801], 'III,': [2802], 'J.R.': [2803], 'Nat.': [2806], 'Biotechnol.': [2807], '14:': [2809], '1579-1583Crossref': [2810], '(167)': [2813], '28Figeys': [2816], 'van': [2818], 'Oostveen': [2819], 'I.': [2820, 3362, 3612], '1822-1828Crossref': [2829], '(136)': [2832], 'sequenced': [2837, 3269], 'Finnigan': [2840], 'Jose,': [2842], 'TSQ': [2844], '7000': [2845], 'spectrometer': [2849, 2925, 2956], 'home-built': [2853], 'electrospray': [2854], 'ionization': [2855], 'device': [2856], 'Data': [2881], 'computer-controlled': [2884], 'using': [2885, 2974, 3017, 3065, 3089, 3094, 3571, 3657, 3750], 'program': [2887], 'written': [2888], 'control': [2891], 'language': [2892], 'automatically': [2894], 'provided': [2895], 'data-dependent': [2896], 'selection': [2898, 2905], 'varied': [2900], 'electrophoretic': [2902], 'voltage.': [2903], 'Ion': [2904], 'dependent': [2910], 'intensity': [2913, 2922], 'reached': [2919], 'given': [2921], 'simultaneously': [2926], 'switched': [2927], 'full': [2929], 'mode': [2931, 2934], 'decreased': [2939, 2949], '−5': [2943], 'kV.': [2944], 'When': [2945], 'signal': [2948], 'below': [2950], 'preset': [2952], 'threshold,': [2953], 'returned': [2957], 'initial': [2959, 3027], 'scanning/electrophoretic': [2960], 'released': [2963], 'measured': [2967], 'its': [2969], '(NOx)': [2972], 'metabolites,': [2973], 'detector': [2977], 'detail': [2981], 'pCeNOS,': [3004], 'plasmid': [3006], 'expression': [3009, 3230], 'His6': [3011], 'inEscherichia': [3013], 'coli,': [3014], 'sequential': [3019], 'two-piece': [3020], 'ligations.': [3021], 'NdeI-SfiI': [3023], 'fragment': [3024, 3076, 3088, 3105, 3108], 'including': [3025], '533': [3028], 'nucleotides': [3029], 'cDNA': [3033], '(29Nishida': [3034, 3123, 3295], 'Navas': [3038, 3127, 3299], 'J.P.': [3039, 3128, 3300], 'Fisher': [3040, 3129, 3301], 'A.A.': [3041, 3130, 3302], 'Dockery': [3042, 3131, 3303], 'Uematsu': [3044, 3133, 3305], 'Murphy': [3050, 3139, 3311], 'T.J.': [3051, 3140, 3312], '90:': [3056, 3145, 3317, 3953], '2092-2096Crossref': [3057, 3146, 3318], '(616)': [3060, 3149, 3321], 'created': [3064], 'sense': [3068, 3096], 'antisense': [3070, 3102], 'primers:': [3071], '5′-TGATTACCATATGGCC[CATCAC]3AACTTGAAGAGTGTGGGCCAGGAG': [3072], '5′-GCGCCAGGCCTGCTTGGCCCCGAAC.': [3074], 'purified': [3078, 3115, 3331, 3570, 3604], 'template': [3083], 'create': [3085], 'HindIII-SfiI1': [3087], 'additional': [3090], 'polymerase': [3091, 3277], 'chain': [3092, 3278], 'reaction,': [3093, 3279], 'this': [3095, 3281], 'primer': [3097], '5′-TATCCCAAGCTTGGGTGATTACCATATGGCCCA': [3098], 'former': [3101], 'primer.': [3103], '(a': [3106], 'HindIII-SfiI': [3107], 'internal': [3111], 'NdeI': [3112, 3185], 'site)': [3113], 'cut': [3117, 3154, 3183, 3211], 'withHindIII': [3118], 'SfiI.': [3120], 'pBluescript': [3121], 'similarly': [3153], 'dephosphorylated.': [3156], 'Ligation': [3157], 'products': [3158], 'transformed': [3160, 3390], 'DH5α': [3162], 'cells,': [3163], 'colonies': [3165], 'screened': [3167, 3220], 'positive': [3169, 3175, 3224], 'recombinants': [3170], 'restriction': [3172], 'digest.': [3173], 'clone': [3176, 3225, 3267], '(pBlueNOS': [3177], 'NDE)': [3178], 'maxiprepped': [3180], 'XbaI.': [3187], 'pCW': [3188], 'ori+': [3189], '(30Muchmore': [3190], 'D.C.': [3191], 'McIntosh': [3192], 'L.P.': [3193], 'Russell': [3194], 'C.B.': [3195], 'D.E.': [3197], 'Dahlquist': [3198], 'F.W.': [3199], 'Methods': [3200], 'Enzymol.': [3201], '177:': [3203], '44-73Crossref': [3204], '(474)': [3207], 'similarly,': [3212], 'pieces': [3216], 'ligated,': [3217], 'transformed,': [3218], 'before.': [3222], '(pCeNOS)': [3226], 'allowed': [3227], 'isopropyl-1-thio-β-d-galactopyranoside-induced': [3228], '23': [3232, 3439], '(31Roman': [3234], 'Sheta': [3236], 'E.A.': [3237], 'Gross': [3240], 'S.S.': [3241], 'Q.': [3243], '92:': [3254], '8428-8432Crossref': [3255], '(244)': [3258], 'judged': [3262], 'immunoblot': [3264], 'analysis.': [3265], 'region': [3272], 'amplified': [3275], 'found': [3284], 'perfectly': [3287], 'consistent': [3288], 'published': [3291], 'region.': [3326], 'expressed': [3329], 'E.': [3333], 'coli': [3334], '(32Venema': [3337, 3576], 'Sayegh': [3339, 3578], 'H.S.': [3340, 3579], 'Arnal': [3341, 3580], 'J.F.': [3342, 3581], '270:': [3349, 3588], '14705-14711Abstract': [3350, 3589], '(98)': [3358, 3597, 4170], '33Rodriguez-Crespo': [3361], 'Gerber': [3363, 3613], 'N.C.': [3364, 3614], 'Ortiz': [3365, 3615], 'de': [3366, 3616], 'Montellano': [3367, 3617], 'P.R.': [3368, 3618], '11462-11467Abstract': [3374, 3624], '(185)': [3382, 3632], 'modifications.': [3387], 'pCeNOS': [3388], 'BL21(DE3)pLysS': [3392], 'cells.': [3393], 'colony': [3395], 'grown': [3397], 'log': [3399], 'innoculated': [3402], '2-liter': [3404], 'flasks': [3405], 'Terrific': [3410], 'broth': [3411], 'ampicillin.': [3415], 'At': [3416, 3696], '600': [3419], '0.8,': [3421], 'μmisopropyl-1-thio-β-d-galactopyranoside,': [3423], 'μm': [3425, 3430, 3509, 3517, 3805, 3810, 3813, 3824, 4015], 'aminolevulinic': [3426], 'riboflavin': [3431], 'added.': [3433], 'shaken': [3437], '24': [3442], 'rpm,': [3446], 'bacteria': [3448], 'pelleted': [3450], 'Tris,': [3456, 3820], '8.0,': [3458], 'mixture': [3461], 'phenylmethylsulfonyl': [3464], 'fluoride,': [3465], 'pepstatin': [3474], 'A,': [3475, 4093], 'chymostatin,': [3476], 'benzamidine,': [3477], 'antipain,': [3478], '2.': [3479, 4322], 'β-mercaptoethanol,': [3482], 'EGTA),': [3488], 'mg/ml': [3490, 3498], 'lysozyme,': [3491], 'units/ml': [3493], 'DNase': [3494], 'I,': [3495], '0.15': [3497], 'RNase': [3499], '37': [3505], 'Then': [3507], 'flavin': [3510], 'adenine': [3511], 'dinucleotide,': [3512], 'μmflavin': [3514], 'mononucleotide,': [3515], '(6Garcia-Cardena': [3518], '(R-5,6,7,8-tetrahydro-l-biopterin,': [3543], '40': [3545], 'β-mercaptoethanol': [3547], 'added,': [3549], 'lysate': [3552], '50,000': [3556], 'g': [3558], 'supernatant': [3568], '2′,5′-ADP-Sepharose': [3572], 'further': [3603], 'Ni2+': [3606], 'chelate': [3607], '(33Rodriguez-Crespo': [3611], '95%': [3637], 'pure': [3638], 'stain': [3641], 'SDS-PAGE': [3643, 3716], 'aliquots': [3648, 3701, 3782], 'glycerol': [3651], '−80': [3653], 'Kinase': [3655], 'reactions': [3656, 3788, 3827], 'phosphorylate': [3660, 3680], "manufacturer's": [3667], 'instructions.': [3668], 'determination': [3670], 'stoichiometry': [3672], '150': [3673], '[γ-32P]ATP': [3686], '(90': [3687], '2800': [3694], 'cpm/pmol.': [3695], 'points,': [3700], 'reaction': [3704, 3768], 'localized': [3719], 'staining.': [3722], 'bands': [3725], 'excised,': [3727], '300': [3741], '(specific': [3745], '560': [3747], 'nmol/min': [3748], 'mg': [3749], 'substrate)': [3754], '2.5': [3758], '20-min': [3765], 'Reactions': [3772], 'run': [3776], 'parallel.': [3778], '1-μg': [3781], '100-μl': [3796], 'assays': [3798], 'μml-[U-14C]arginine': [3801], '(1375': [3802], 'cpm/pmol),': [3803], 'CaCl2,': [3806], 'μmFAD,': [3808], 'FMN,': [3811], 'BH4,': [3814], 'NADPH,': [3817], '7.5,': [3822], 'calmodulin,': [3825], 'exactly': [3831], '(34Kumar': [3834, 3870], 'V.B.': [3835, 3871], 'Bernardo': [3836, 3872], 'A.E.': [3837, 3873], 'Alshaher': [3838, 3874], 'M.M.': [3839, 3875], 'Buddhiraju': [3840, 3876], 'Purushothaman': [3842, 3878], 'Morley': [3844, 3880], '269:': [3849, 3885], '17-20Crossref': [3850, 3886], '(20)': [3853, 3889], 'Labeled': [3859], 'arginine': [3860], 'citrulline': [3865], '[14C]citrulline': [3893, 3906], 'counts/min': [3894], 'formed': [3895], 'scraping': [3899], 'counting': [3901], 'scintillant': [3908], 'localization': [3910], 'autoradiography.': [3912], 'Previously': [3913], 'others': [3916], '35Michel': [3939], 'G.K.': [3942], 'Busconi': [3943], '6252-6256Crossref': [3954], '(305)': [3957], 'have': [3960, 4140, 4202], 'shown': [3961, 4203, 4319], 'conditions': [3970, 4146, 4257, 4325], 'Na3VO4.': [4016], 'condition': [4022, 4232], 'subjected': [4024, 4280], 'lysed;': [4049], 'antibody,': [4056], 'immunoprecipitate': [4059], 'detected': [4076, 4266], 'autoradiography': [4078], '(Fig.1': [4079], 'A).': [4080], 'basally': [4083], '(Fig.': [4091, 4330, 4350], 'lane': [4094], '1),': [4095], 'exposure': [4097], 'rapid,': [4103], '(see': [4132, 4225], 'Fig.': [4133, 4243, 4276, 4321], 'legend).': [4137], 'Previous': [4138], 'investigators': [4139], 'presence': [4151, 4222], 'phenylarsine': [4153], '(36Venema': [4155], 'Marrero': [4157], 'M.B.': [4158], 'Biophys.': [4162], 'Commun.': [4164], '226:': [4166], '703-710Crossref': [4167], 'pervanadate': [4174], '(37Garcia-Cardena': [4175], 'Fan': [4177], 'Stern': [4179], 'D.F.': [4180], '27237-27240Abstract': [4190], '(428)': [4198], 'predominantly': [4207], 'amount': [4212], 'phosphotyrosine.': [4214], '"Experimental': [4226], 'Procedures")': [4227], 'shows': [4246], '(n': [4258], '3).': [4260], 'No': [4261], '(shown': [4274], 'cleavage': [4283], 'spotted': [4289], 'plate.': [4294], 'dimension': [4302, 4309], 'HVE': [4304], 'TLC.': [4311], 'Autoradiograms': [4312], 'plates': [4317], 'Under': [4323], '8–10': [4328], 'A),': [4332], 'which,': [4335], 'F1': [4336, 4408], 'F2,': [4338], '2,': [4351], 'B—D).': [4352], 'relative': [4354], 'volumes': [4355], 'basal': [4360], 'flow-stimulated': [4362], 'quantified': [4365], 'PhosphorImager': [4367], 'independent': [4371], 'experiments': [4372], 'examining': [4373], 'function': [4378], 'duration': [4382], '(Table': [4383], 'I).': [4384], 'Whereas': [4385], 'during': [4392], '10-min': [4394], 'course': [4396], 'approximately': [4398], '2-fold,': [4399], 'F2': [4410], 'more': [4412], 'pronounced.': [4413], 'Flow-dependent': [4414], 'pep': [4417]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2116709740', 'counts_by_year': [{'year': 2024, 'cited_by_count': 1}, {'year': 2023, 'cited_by_count': 2}, {'year': 2022, 'cited_by_count': 2}, {'year': 2021, 'cited_by_count': 3}, {'year': 2020, 'cited_by_count': 4}, {'year': 2019, 'cited_by_count': 5}, {'year': 2018, 'cited_by_count': 7}, {'year': 2017, 'cited_by_count': 7}, {'year': 2016, 'cited_by_count': 11}, {'year': 2015, 'cited_by_count': 5}, {'year': 2014, 'cited_by_count': 9}, {'year': 2013, 'cited_by_count': 11}, {'year': 2012, 'cited_by_count': 12}], 'updated_date': '2024-12-17T17:21:34.860381', 'created_date': '2016-06-24'}