Internal transcribed spacer primers and sequences for improved characterization of basidiomycetous orchid mycorrhizas

Name: Work Video:
Duration: 3 min 30 s
D. Lee Taylor; Melissa McCormick
{'id': 'https://openalex.org/W2113341737', 'doi': 'https://doi.org/10.1111/j.1469-8137.2007.02320.x', 'title': 'Internal transcribed spacer primers and sequences for improved characterization of basidiomycetous orchid mycorrhizas', 'display_name': 'Internal transcribed spacer primers and sequences for improved characterization of basidiomycetous orchid mycorrhizas', 'publication_year': 2007, 'publication_date': '2007-12-10', 'ids': {'openalex': 'https://openalex.org/W2113341737', 'doi': 'https://doi.org/10.1111/j.1469-8137.2007.02320.x', 'mag': '2113341737', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/18086221'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1111/j.1469-8137.2007.02320.x', 'pdf_url': 'https://onlinelibrary.wiley.com/doi/pdfdirect/10.1111/j.1469-8137.2007.02320.x', 'source': {'id': 'https://openalex.org/S58631098', 'display_name': 'New Phytologist', 'issn_l': '0028-646X', 'issn': ['0028-646X', '1469-8137'], 'is_oa': False, 'is_in_doaj': False, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320595', 'host_organization_name': 'Wiley', 'host_organization_lineage': ['https://openalex.org/P4310320595'], 'host_organization_lineage_names': ['Wiley'], 'type': 'journal'}, 'license': None, 'license_id': None, 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'bronze', 'oa_url': 'https://onlinelibrary.wiley.com/doi/pdfdirect/10.1111/j.1469-8137.2007.02320.x', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5090619209', 'display_name': 'D. Lee Taylor', 'orcid': 'https://orcid.org/0000-0002-5985-9210'}, 'institutions': [{'id': 'https://openalex.org/I141472210', 'display_name': 'University of Alaska Fairbanks', 'ror': 'https://ror.org/01j7nq853', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I141472210']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'D. Lee Taylor', 'raw_affiliation_strings': ['University of Alaska, Institute of Arctic Biology, 311 Irving I Building, Fairbanks, AK 99775, USA;'], 'affiliations': [{'raw_affiliation_string': 'University of Alaska, Institute of Arctic Biology, 311 Irving I Building, Fairbanks, AK 99775, USA;', 'institution_ids': ['https://openalex.org/I141472210']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5014875183', 'display_name': 'Melissa McCormick', 'orcid': 'https://orcid.org/0000-0001-6564-7575'}, 'institutions': [{'id': 'https://openalex.org/I52218309', 'display_name': 'Smithsonian Environmental Research Center', 'ror': 'https://ror.org/032a13752', 'country_code': 'US', 'type': 'facility', 'lineage': ['https://openalex.org/I103187081', 'https://openalex.org/I52218309']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Melissa K. McCormick', 'raw_affiliation_strings': ['Smithsonian Environmental Research Center, Edgewater, MD 21037, USA;'], 'affiliations': [{'raw_affiliation_string': 'Smithsonian Environmental Research Center, Edgewater, MD 21037, USA;', 'institution_ids': ['https://openalex.org/I52218309']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 2, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 5510, 'currency': 'USD', 'value_usd': 5510, 'provenance': 'doaj'}, 'apc_paid': None, 'fwci': 3.824, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 282, 'citation_normalized_percentile': {'value': 0.916404, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 98, 'max': 99}, 'biblio': {'volume': '177', 'issue': '4', 'first_page': '1020', 'last_page': '1033'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10825', 'display_name': 'Plant Pathogens and Fungal Diseases', 'score': 0.9973, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10825', 'display_name': 'Plant Pathogens and Fungal Diseases', 'score': 0.9973, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10451', 'display_name': 'Mycorrhizal Fungi and Plant Interactions', 'score': 0.9967, 'subfield': {'id': 'https://openalex.org/subfields/1110', 'display_name': 'Plant Science'}, 'field': {'id': 'https://openalex.org/fields/11', 'display_name': 'Agricultural and Biological Sciences'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10487', 'display_name': 'Plant and animal studies', 'score': 0.9928, 'subfield': {'id': 'https://openalex.org/subfields/1105', 'display_name': 'Ecology, Evolution, Behavior and Systematics'}, 'field': {'id': 'https://openalex.org/fields/11', 'display_name': 'Agricultural and Biological Sciences'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [], 'concepts': [{'id': 'https://openalex.org/C2778805511', 'wikidata': 'https://www.wikidata.org/wiki/Q1713', 'display_name': 'Citation', 'level': 2, 'score': 0.5311792}, {'id': 'https://openalex.org/C161191863', 'wikidata': 'https://www.wikidata.org/wiki/Q199655', 'display_name': 'Library science', 'level': 1, 'score': 0.4781338}, {'id': 'https://openalex.org/C155794727', 'wikidata': 'https://www.wikidata.org/wiki/Q2306414', 'display_name': 'Internal transcribed spacer', 'level': 4, 'score': 0.41839358}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.38943905}, {'id': 'https://openalex.org/C53553401', 'wikidata': 'https://www.wikidata.org/wiki/Q47307', 'display_name': 'Genealogy', 'level': 1, 'score': 0.3314166}, {'id': 'https://openalex.org/C95457728', 'wikidata': 'https://www.wikidata.org/wiki/Q309', 'display_name': 'History', 'level': 0, 'score': 0.28432137}, {'id': 'https://openalex.org/C67905577', 'wikidata': 'https://www.wikidata.org/wiki/Q215980', 'display_name': 'Ribosomal RNA', 'level': 3, 'score': 0.23367682}, {'id': 'https://openalex.org/C41008148', 'wikidata': 'https://www.wikidata.org/wiki/Q21198', 'display_name': 'Computer science', 'level': 0, 'score': 0.18608183}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.18294683}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.10138884}], 'mesh': [{'descriptor_ui': 'D001487', 'descriptor_name': 'Basidiomycota', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D017931', 'descriptor_name': 'DNA Primers', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D004271', 'descriptor_name': 'DNA, Fungal', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D021901', 'descriptor_name': 'DNA, Intergenic', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D038821', 'descriptor_name': 'Mycorrhizae', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D029595', 'descriptor_name': 'Orchidaceae', 'qualifier_ui': 'Q000382', 'qualifier_name': 'microbiology', 'is_major_topic': True}, {'descriptor_ui': 'D001483', 'descriptor_name': 'Base Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001487', 'descriptor_name': 'Basidiomycota', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017931', 'descriptor_name': 'DNA Primers', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004271', 'descriptor_name': 'DNA, Fungal', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D021901', 'descriptor_name': 'DNA, Intergenic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008969', 'descriptor_name': 'Molecular Sequence Data', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D038821', 'descriptor_name': 'Mycorrhizae', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D029595', 'descriptor_name': 'Orchidaceae', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010802', 'descriptor_name': 'Phylogeny', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1111/j.1469-8137.2007.02320.x', 'pdf_url': 'https://onlinelibrary.wiley.com/doi/pdfdirect/10.1111/j.1469-8137.2007.02320.x', 'source': {'id': 'https://openalex.org/S58631098', 'display_name': 'New Phytologist', 'issn_l': '0028-646X', 'issn': ['0028-646X', '1469-8137'], 'is_oa': False, 'is_in_doaj': False, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320595', 'host_organization_name': 'Wiley', 'host_organization_lineage': ['https://openalex.org/P4310320595'], 'host_organization_lineage_names': ['Wiley'], 'type': 'journal'}, 'license': None, 'license_id': None, 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/18086221', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1111/j.1469-8137.2007.02320.x', 'pdf_url': 'https://onlinelibrary.wiley.com/doi/pdfdirect/10.1111/j.1469-8137.2007.02320.x', 'source': {'id': 'https://openalex.org/S58631098', 'display_name': 'New Phytologist', 'issn_l': '0028-646X', 'issn': ['0028-646X', '1469-8137'], 'is_oa': False, 'is_in_doaj': False, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320595', 'host_organization_name': 'Wiley', 'host_organization_lineage': ['https://openalex.org/P4310320595'], 'host_organization_lineage_names': ['Wiley'], 'type': 'journal'}, 'license': None, 'license_id': None, 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'id': 'https://metadata.un.org/sdg/15', 'display_name': 'Life on land', 'score': 0.66}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 92, 'referenced_works': ['https://openalex.org/W1531312922', 'https://openalex.org/W1535793535', 'https://openalex.org/W1551459746', 'https://openalex.org/W1627725260', 'https://openalex.org/W186900372', 'https://openalex.org/W1903526441', 'https://openalex.org/W1963957860', 'https://openalex.org/W1969897365', 'https://openalex.org/W1970201335', 'https://openalex.org/W1976322208', 'https://openalex.org/W1982705563', 'https://openalex.org/W1983078695', 'https://openalex.org/W1984844512', 'https://openalex.org/W1993922028', 'https://openalex.org/W1997720205', 'https://openalex.org/W2003010213', 'https://openalex.org/W2011215772', 'https://openalex.org/W2013564539', 'https://openalex.org/W2014565975', 'https://openalex.org/W2018120025', 'https://openalex.org/W2021438117', 'https://openalex.org/W2025730603', 'https://openalex.org/W2025996020', 'https://openalex.org/W2026051879', 'https://openalex.org/W2032832327', 'https://openalex.org/W2034640618', 'https://openalex.org/W2050775804', 'https://openalex.org/W2051431345', 'https://openalex.org/W2055201758', 'https://openalex.org/W2058054430', 'https://openalex.org/W2065614644', 'https://openalex.org/W2070532354', 'https://openalex.org/W2071320637', 'https://openalex.org/W2076308228', 'https://openalex.org/W2078872583', 'https://openalex.org/W2082928585', 'https://openalex.org/W2085799155', 'https://openalex.org/W2088481129', 'https://openalex.org/W2099769181', 'https://openalex.org/W2103000070', 'https://openalex.org/W2103088017', 'https://openalex.org/W2103300831', 'https://openalex.org/W2103934714', 'https://openalex.org/W2104142783', 'https://openalex.org/W2106924437', 'https://openalex.org/W2109782899', 'https://openalex.org/W2112456157', 'https://openalex.org/W2119022588', 'https://openalex.org/W2120611635', 'https://openalex.org/W2120644786', 'https://openalex.org/W2122038684', 'https://openalex.org/W2122880809', 'https://openalex.org/W2122923188', 'https://openalex.org/W2123286248', 'https://openalex.org/W2126231531', 'https://openalex.org/W2127115991', 'https://openalex.org/W2130889389', 'https://openalex.org/W2132926880', 'https://openalex.org/W2134866070', 'https://openalex.org/W2136233546', 'https://openalex.org/W2139176936', 'https://openalex.org/W2140682278', 'https://openalex.org/W2144755161', 'https://openalex.org/W2148000872', 'https://openalex.org/W2151018827', 'https://openalex.org/W2156888857', 'https://openalex.org/W2158714788', 'https://openalex.org/W2159281307', 'https://openalex.org/W2161907160', 'https://openalex.org/W2165889977', 'https://openalex.org/W2167710548', 'https://openalex.org/W2168628882', 'https://openalex.org/W2168884420', 'https://openalex.org/W2169880829', 'https://openalex.org/W2251019903', 'https://openalex.org/W2325259663', 'https://openalex.org/W2328745922', 'https://openalex.org/W2344723781', 'https://openalex.org/W2797752543', 'https://openalex.org/W2989345970', 'https://openalex.org/W302238319', 'https://openalex.org/W3111303053', 'https://openalex.org/W4232140966', 'https://openalex.org/W4237142329', 'https://openalex.org/W4238316260', 'https://openalex.org/W4242587736', 'https://openalex.org/W4247428054', 'https://openalex.org/W4252754411', 'https://openalex.org/W4252875058', 'https://openalex.org/W4255838863', 'https://openalex.org/W590197378', 'https://openalex.org/W904373744'], 'related_works': ['https://openalex.org/W4391375266', 'https://openalex.org/W2788277189', 'https://openalex.org/W2394236990', 'https://openalex.org/W2130076355', 'https://openalex.org/W2119695867', 'https://openalex.org/W2082860237', 'https://openalex.org/W2046158694', 'https://openalex.org/W2013243191', 'https://openalex.org/W1993764875', 'https://openalex.org/W1990804418'], 'abstract_inverted_index': {'New': [0, 3440], 'PhytologistVolume': [1], '177,': [2], 'Issue': [3], '4': [4], 'p.': [5], '1020-1033': [6], 'Free': [7], 'Access': [8], 'Internal': [9], 'transcribed': [10, 287, 974, 3841, 4016], 'spacer': [11, 288, 975, 3842, 4017], 'primers': [12, 236, 258, 290, 316, 1158, 1261, 1375, 1434, 1724, 1783, 1864, 1924, 1935, 1942, 1956, 3042, 3556, 3600, 3835, 4010], 'and': [13, 157, 161, 173, 180, 199, 253, 302, 323, 333, 345, 364, 377, 572, 575, 593, 649, 817, 832, 875, 882, 983, 1054, 1096, 1148, 1210, 1258, 1336, 1429, 1442, 1472, 1484, 1501, 1514, 1566, 1582, 1630, 1634, 1668, 1676, 1684, 1737, 1755, 1761, 1763, 1773, 1775, 1802, 1813, 1857, 1879, 1943, 2014, 2024, 2033, 2075, 2663, 2683, 2739, 2747, 2780, 2839, 2863, 2891, 2911, 2925, 2945, 2960, 2972, 2996, 3043, 3073, 3110, 3180, 3268, 3382, 3428, 3438, 3461, 3500, 3536, 3562, 3610, 3627, 3646, 3685, 3699, 3783, 3833, 3867, 3965, 4008, 4054, 4114, 4149, 4194], 'sequences': [14, 246, 352, 400, 1316, 1381, 1493, 1706, 3085, 3103, 3121, 3146, 3198, 3671, 3725, 3853, 3900, 4023, 4247], 'for': [15, 43, 62, 89, 108, 122, 532, 671, 1023, 1622, 1757, 1796, 1832, 1934, 1946, 2640, 2647, 2679, 2761, 2894, 2906, 2937, 3022, 3144, 3199, 3258, 3299, 3308, 3449, 3820, 3836, 3994, 4011, 4135], 'improved': [16, 3638], 'characterization': [17, 979], 'of': [18, 29, 32, 75, 78, 159, 169, 182, 193, 218, 228, 267, 271, 327, 335, 358, 375, 412, 428, 434, 441, 452, 481, 492, 505, 535, 539, 577, 595, 618, 652, 748, 856, 890, 904, 907, 954, 969, 980, 1025, 1094, 1100, 1111, 1132, 1135, 1151, 1167, 1176, 1183, 1197, 1205, 1218, 1225, 1229, 1237, 1246, 1281, 1302, 1314, 1325, 1379, 1386, 1394, 1405, 1425, 1445, 1469, 1481, 1491, 1510, 1517, 1531, 1545, 1547, 1586, 1624, 1638, 1642, 1651, 1691, 1695, 1714, 1804, 1829, 1922, 1953, 1978, 1994, 2037, 2051, 2064, 2608, 2636, 2650, 2710, 2719, 2728, 2772, 2809, 2818, 2821, 2842, 2855, 2989, 3061, 3071, 3077, 3082, 3119, 3135, 3201, 3203, 3212, 3253, 3401, 3404, 3452, 3466, 3481, 3554, 3573, 3601, 3616, 3697, 3706, 3743, 3779, 3794, 3808, 3811, 3830, 3838, 3897, 3939, 3948, 3967, 3982, 3985, 4005, 4013, 4028, 4056, 4069, 4082, 4101, 4119, 4122, 4237, 4256, 4267, 4274, 4282, 4294], 'basidiomycetous': [19, 2670], 'orchid': [20, 221, 273, 475, 493, 546, 764, 851, 858, 1058, 1101, 1627, 2045, 3574, 3724, 3898], 'mycorrhizas': [21, 436, 454, 476, 985, 1404], 'D.': [22, 25, 68, 71, 124], 'Lee': [23, 26, 69, 72, 125], 'Taylor,': [24, 70], 'Taylor': [27, 73, 126, 486, 925, 929, 958, 1077, 2731], 'University': [28, 74], 'Alaska,': [30, 76], 'Institute': [31, 77], 'Arctic': [33, 79], 'Biology,': [34, 80], '311': [35, 81], 'Irving': [36, 82], 'I': [37, 83, 3331, 3356], 'Building,': [38, 84], 'Fairbanks,': [39, 85], 'AK': [40, 86], '99775,': [41, 87], 'USA;Search': [42, 88], 'more': [44, 63, 90, 109, 1413], 'papers': [45, 64, 91, 110], 'by': [46, 65, 92, 111, 342, 424, 630, 1678, 2881, 2902, 2941, 3094, 3175, 3348, 3471, 3924, 3958], 'this': [47, 66, 93, 112, 194, 506, 1168, 1395, 1927, 3761], 'authorMelissa': [48, 94], 'K.': [49, 52, 95, 98], 'McCormick,': [50, 96], 'Melissa': [51, 97], 'McCormick': [53, 99, 1069], 'Smithsonian': [54, 100], 'Environmental': [55, 101], 'Research': [56, 102], 'Center,': [57, 103], 'Edgewater,': [58, 104], 'MD': [59, 105], '21037,': [60, 106], 'USASearch': [61, 107], 'author': [67, 113], 'First': [114], 'published:': [115, 1964], '10': [116, 2827, 2907, 3319, 3376, 3648], 'December': [117], '2007': [118], 'https://doi.org/10.1111/j.1469-8137.2007.02320.xCitations:': [119], '212': [120], 'Author': [121], 'Correspondence:': [123], 'Tel:': [127], '+1': [128, 133], '907': [129, 134], '474': [130, 135], '6982': [131], 'Fax:': [132], '6967Email:': [136], '[email': [137], 'protected]': [138], 'AboutSectionsPDF': [139], 'ToolsRequest': [140], 'permissionExport': [141], 'citationAdd': [142], 'to': [143, 165, 188, 209, 237, 263, 320, 397, 448, 516, 550, 569, 589, 640, 771, 822, 886, 916, 948, 1014, 1031, 1045, 1114, 1123, 1156, 1276, 1296, 1353, 1399, 1417, 1438, 1477, 1497, 1719, 1727, 1747, 1766, 1798, 1938, 2071, 2626, 2667, 3052, 3154, 3161, 3224, 3293, 3321, 3344, 3366, 3386, 3550, 3640, 3736, 3756, 3790, 3855, 3876, 3936, 4125, 4161, 4166, 4213, 4239, 4285], 'favoritesTrack': [144], 'citation': [145], 'ShareShare': [146], 'Give': [147], 'accessShare': [148, 151], 'full': [149], 'text': [150], 'full-text': [152, 167, 191], 'accessPlease': [153], 'review': [154], 'our': [155, 3062, 3078, 3434], 'Terms': [156, 179], 'Conditions': [158, 181], 'Use': [160], 'check': [162], 'box': [163], 'below': [164, 187], 'share': [166, 189], 'version': [168, 192, 1828], 'article.I': [170], 'have': [171, 444, 542, 766, 977, 1120, 1371, 1411, 1454, 3049, 3951], 'read': [172], 'accept': [174], 'the': [175, 185, 216, 229, 265, 268, 272, 311, 328, 371, 408, 420, 438, 449, 462, 482, 503, 551, 570, 573, 578, 590, 596, 609, 619, 644, 650, 656, 668, 690, 709, 718, 753, 797, 815, 827, 902, 952, 955, 970, 1005, 1018, 1029, 1047, 1092, 1105, 1115, 1136, 1173, 1184, 1188, 1219, 1265, 1271, 1277, 1303, 1326, 1333, 1419, 1422, 1426, 1430, 1440, 1456, 1466, 1486, 1518, 1639, 1643, 1652, 1664, 1692, 1696, 1715, 1729, 1735, 1799, 1807, 1822, 1836, 1854, 1940, 1947, 1954, 1958, 1989, 1995, 2018, 2026, 2038, 2616, 2633, 2637, 2655, 2700, 2716, 2724, 2735, 2748, 2769, 3019, 3105, 3132, 3136, 3167, 3191, 3204, 3210, 3217, 3230, 3234, 3277, 3288, 3304, 3324, 3328, 3340, 3345, 3351, 3353, 3418, 3450, 3453, 3464, 3477, 3482, 3510, 3516, 3531, 3591, 3633, 3641, 3647, 3681, 3707, 3716, 3727, 3741, 3749, 3757, 3780, 3812, 3839, 3859, 3865, 3877, 3905, 3925, 3937, 3945, 3949, 3955, 3968, 3986, 4003, 4014, 4029, 4057, 4075, 4083, 4095, 4099, 4110, 4120, 4126, 4147, 4167, 4178, 4202, 4235, 4246, 4253, 4257, 4264, 4268, 4279, 4295], 'Wiley': [176], 'Online': [177], 'Library': [178], 'UseShareable': [183], 'LinkUse': [184], 'link': [186], 'a': [190, 324, 425, 445, 497, 533, 626, 791, 839, 905, 1203, 1235, 1312, 1354, 1507, 1528, 1584, 1969, 2641, 2705, 2708, 2859, 2865, 2882, 3116, 3140, 3402, 3407, 3552, 3617, 3678, 3702, 3719, 3733, 3744, 3772, 3809, 3883, 3983, 4102, 4129, 4162], 'article': [195], 'with': [196, 416, 479, 565, 873, 1050, 1200, 1207, 1305, 1649, 1932, 1936, 2615, 2815, 2874, 2948, 3004, 3025, 3187, 3375, 3395, 3582, 3667, 3721, 3740, 3775, 3851, 3882, 3911, 3954, 4094], 'your': [197], 'friends': [198], 'colleagues.': [200], 'Learn': [201], 'more.Copy': [202], 'URL': [203], 'Summary': [204], '•': [205, 283, 313, 348], 'Despite': [206], 'advances': [207], 'owing': [208, 1275], 'molecular': [210, 1098, 1272, 3254, 4271], 'approaches,': [211], 'several': [212, 356, 399, 1180, 1259, 1324, 1460, 1712, 2040, 3895], 'hurdles': [213, 280, 1088], 'still': [214, 1089, 3676], 'obstruct': [215], 'identification': [217, 491, 747, 1024, 1099], 'fungi': [219, 269, 464, 480, 495, 540, 564, 681, 935, 1027, 1119, 1206, 1231, 1268, 1282, 1448, 1461, 1483, 1505, 3818, 3992], 'forming': [220], 'mycorrhizas.': [222], 'The': [223, 331, 405, 431, 490, 537, 600, 841, 854, 1338, 1392, 1534, 1844, 1862, 2606, 2897, 3101, 3389, 3520, 3577, 3624, 3661, 3690, 3730, 3769, 3823, 3845, 3960, 3997, 4038, 4131, 4198, 4208], 'Tulasnellaceae': [224, 297, 594, 818, 2316, 2325, 2334, 2343, 2354, 2365, 2376, 2387, 2396, 3106, 3326, 3391, 3483, 3517, 3532, 3754], 'exhibit': [225], 'accelerated': [226, 1133], 'evolution': [227, 1134, 3255, 3759], 'nuclear': [230, 971, 1137, 1644, 1697, 3478, 3973, 4062], 'ribosomal': [231, 972, 1138, 1647, 1700, 3479, 3813, 3987], 'operon,': [232], 'causing': [233], 'most': [234, 295, 409, 635, 680, 1019, 1106, 1327, 1991], 'standard': [235, 1126, 1226], 'fail': [238], 'in': [239, 261, 277, 370, 385, 388, 467, 501, 521, 625, 674, 679, 773, 850, 869, 892, 1057, 1091, 1153, 1172, 1179, 1187, 1251, 1270, 1283, 1323, 1403, 1449, 1465, 1475, 1485, 1523, 1549, 1589, 1674, 1680, 1788, 1811, 1869, 1926, 1957, 2056, 2697, 2858, 3097, 3149, 3190, 3216, 3233, 3314, 3370, 3417, 3515, 3590, 3701, 3752, 3760, 3796, 3804, 3848, 3870, 3894, 3978, 4066, 4079, 4098, 4117, 4151, 4177, 4201, 4245, 4270], 'polymerase': [240, 2066, 2846], 'chain': [241, 2067], 'reaction': [242, 2068], '(PCR)': [243, 2069], 'trials.': [244], 'Insufficient': [245], 'are': [247, 259, 298, 317, 339, 353, 477, 686, 714, 723, 830, 912, 1043, 1216, 1345, 1619, 1867, 1929, 2054, 2620, 3393, 3431, 3506, 3512, 3874, 3880, 3888, 3922, 4025, 4047], 'available': [248, 3342, 3432, 3643, 4248], 'from': [249, 355, 401, 1317, 1348, 1421, 1459, 1463, 1506, 1527, 1571, 1707, 1848, 2294, 2351, 2362, 2373, 2384, 2437, 2449, 2461, 2473, 2612, 2622, 2657, 2669, 2687, 2694, 2768, 2984, 2987, 3242, 3318, 3456, 3816, 3920, 3990], 'well': [250, 1318, 1542], 'characterized': [251, 423, 1319, 1576], 'isolates': [252, 765, 1320, 1570], 'fruitbodies.': [254], 'Lastly,': [255, 349, 1452], 'taxon-specific': [256], 'PCR': [257, 304, 967, 1127, 1257, 2609, 2805, 3000], 'needed': [260], 'order': [262, 1476, 4118], 'explore': [264], 'ecology': [266], 'outside': [270, 1301], 'root.': [274], 'Here,': [275], 'progress': [276], 'overcoming': [278], 'these': [279, 336, 389, 435, 605, 653, 1118, 1230, 1368, 1550, 1894, 2998, 3797], 'is': [281, 407, 422, 437, 496, 530, 608, 666, 700, 704, 790, 845, 1012, 1170, 1311, 1340, 1398, 1967, 2635, 3484, 3585, 3597, 3621, 3694, 3732, 3787, 3847, 4259], 'reported.': [282], 'Broad-spectrum': [284], 'basidiomycete': [285, 3441, 4283], 'internal': [286, 973, 3840, 4015], '(ITS)': [289, 976, 3843, 4018], 'that': [291, 366, 541, 1215, 1341, 1488, 2654, 3157, 3303, 3557, 3595, 3605, 3630, 3792, 3901, 3934, 4021, 4032, 4292], 'do': [292, 3902], 'not': [293, 835, 1249, 3513, 3524, 3622, 3788, 3903], 'exclude': [294], 'known': [296, 474, 1346], 'presented.': [299], 'blast': [300, 343, 1831, 4106, 4296], 'searches': [301, 344, 3070, 3076, 3374, 4081], 'empirical': [303, 346, 2065, 2680], 'tests': [305, 1977, 2682], 'support': [306], 'their': [307, 518, 1532, 1577], 'wide': [308, 1508], 'utility': [309], 'within': [310, 655, 726, 739, 800, 838, 888, 1332, 1806, 3104, 3530, 3931, 4128], 'Basidiomycota.': [312], 'Taxon-specific': [314], 'ITS': [315, 350, 1006, 1315, 1420, 1457, 1730, 3102, 3137, 3442, 3454, 3555], 'presented': [318, 354], 'targeted': [319], 'orchid-associated': [321, 585, 694, 749, 1329, 1423, 1447, 1482, 1670, 2028], 'Tulasnella,': [322, 1428], 'core': [325, 1424, 3528], 'component': [326], 'Thelephora–Tomentella': [329, 1431], 'complex.': [330, 1432], 'efficiency': [332], 'selectivity': [334, 2076], 'primer': [337, 1128, 1396, 1415, 1742, 1877, 1887, 1979, 2073, 2618, 2643, 2681, 3448, 3503, 3521, 3579, 3620, 3634, 3662, 3692, 3717, 3731, 3770, 3821, 3995, 4022, 4070], 'sets': [338, 1416, 1435], 'again': [340, 4048], 'supported': [341], 'tests.': [347], 'DNA': [351, 1986, 2052, 2672, 2762, 2845, 2909], 'strains': [357, 1591, 2760, 2767], 'Epulorhiza,': [359], 'Ceratorhiza,': [360], 'Ceratobasidium,': [361], 'Sistotrema,': [362], 'Thanatephorus': [363, 616, 2283, 3856], 'Tulasnella': [365, 1906, 2322, 2331, 2340, 2349, 2360, 2371, 2382, 2393, 3534, 3560, 3644], 'were': [367, 1232, 1242, 1248, 1262, 1515, 1717, 1732, 1744, 1793, 1851, 1981, 2665, 2685, 2702, 2713, 2812, 2935, 2967, 2982, 3002, 3037, 3065, 3086, 3107, 3173, 3221, 3249, 3256, 3274, 3291, 3364, 3413, 3767, 3909, 4072, 4091, 4144, 4174], 'originally': [368], 'described': [369, 1723, 3046], 'landmark': [372, 1467, 2770], 'mycorrhizal': [373, 429, 470, 494, 547, 852, 1059, 1102, 1177, 1198, 1252, 1267, 1504], 'studies': [374, 1468, 1618, 2771, 4273], 'Currah': [376, 779, 810, 1474, 1565, 1594, 1605, 1609, 2781], 'Warcup.': [378], 'Detailed': [379], 'phylogenetic': [380, 1479], 'analyses': [381, 1544, 3058, 3420, 4068, 4090], 'reveal': [382], 'some': [383, 857, 893, 3527, 3776, 4233], 'inconsistencies': [384], 'species': [386, 587, 603, 648, 672, 698, 733, 751, 837, 859, 1030, 1182, 1300, 2046, 3529, 3561, 3795], 'concepts': [387], 'taxonomically': [390], 'challenging': [391], 'resupinate': [392, 711], 'basidiomycetes,': [393, 1663, 4275], 'but': [394, 763, 2016, 3193, 3584, 3675, 4140], 'also': [395, 1703, 1764, 1968, 3222, 3541, 4289], 'help': [396, 1366, 1437], 'place': [398], 'environmental': [402, 1026, 1284, 1492], 'samples.': [403], 'Introduction': [404], 'Orchidaceae': [406, 421, 2580, 2590, 2600], 'species-rich': [410], 'family': [411], 'flowering': [413], 'plants.': [414], 'Along': [415], 'other': [417, 1669, 3565, 3654, 3688, 3871, 4153], 'unique': [418], 'features,': [419], 'novel': [426], 'form': [427, 451], 'interaction.': [430], 'diagnostic': [432, 1217], 'feature': [433], 'intracellular': [439], 'coils': [440], 'hyphae,': [442], 'which': [443, 465, 509, 794, 1157, 1247, 1306, 1376, 1937, 3151, 3462, 3505, 3873, 4050, 4276], 'superficial': [446], 'resemblance': [447], 'Paris': [450], 'arbuscular': [453, 469, 984], '(Smith': [455], '&': [456, 662, 757, 785, 803, 811, 926, 940, 991, 997, 1062, 1553, 1606, 1610, 2721, 2732, 2774, 2928, 3008, 3265, 3473], 'Read,': [457], '1997).': [458, 1843], 'However,': [459, 582, 678, 826, 866, 1085, 1221, 3476], 'rather': [460], 'than': [461, 3672, 4263], 'Glomeromycotan': [463], 'engage': [466], 'all': [468, 473, 510, 583, 1387, 3120, 3145, 3219, 3458, 3653, 3722, 3737, 3852, 4158], 'associations,': [471], 'nearly': [472, 1825, 3602], 'formed': [478], 'Basidiomycota': [483, 579, 1892, 1902, 3566, 3655, 3739, 4148], '(Rasmussen,': [484, 864], '1995;': [485], 'et': [487, 524, 776, 780, 807, 879, 898, 930, 944, 959, 987, 1001, 1038, 1066, 1070, 1074, 1078, 1082, 1141, 1145, 1161, 1191, 1595, 1602, 1614, 1841, 1973, 2000, 2782, 2920, 2963, 3177, 3182, 3424, 3489, 3493, 3497, 3544], 'al.,': [488, 525, 777, 781, 808, 880, 899, 931, 945, 960, 988, 1002, 1039, 1067, 1071, 1075, 1079, 1083, 1142, 1146, 1162, 1192, 1596, 1603, 1615, 1842, 1974, 2001, 2921, 2964, 3490, 3494, 3498, 3545], '2002).': [489, 961, 1003, 1163], 'critical': [498, 3682], 'first': [499, 528, 669], 'step': [500, 529, 844], 'exploring': [502], 'biology': [504, 953], 'symbiosis,': [507], 'on': [508, 965, 1734, 1835, 2974, 3433, 4087, 4249], 'orchids': [511, 871, 896, 1112, 1304, 1464, 1513, 1551], 'so': [512], 'far': [513], 'studied': [514], 'depend': [515], 'complete': [517, 3243, 4084], 'life': [519], 'cycles': [520, 2857], 'nature': [522], '(Arditti': [523], '1990).': [526, 742, 1975, 2965], 'This': [527, 561, 702], 'difficult': [531, 913, 1122, 1295], 'number': [534, 906, 4281], 'reasons.': [536], 'majority': [538], 'been': [543, 769, 884, 1294, 1962, 3050, 3952], 'recorded': [544, 584], 'as': [545, 689, 1017, 1287, 1541, 1543, 3045, 3415, 3563, 3567, 3858, 3915, 4216], 'symbionts': [548, 855, 903, 1110], 'belong': [549, 588, 1113], 'anamorphic': [552, 1578], 'form-genus': [553], 'Rhizoctonia': [554, 586, 602, 647, 695, 750, 801, 1666, 2029, 2265], '(Burgeff,': [555], '1959;': [556, 921], 'Hadley,': [557], '1982;': [558, 805], 'Rasmussen,': [559], '1995).': [560, 865], 'genus': [562, 1032, 1427], 'includes': [563], 'perfect': [566, 3734], 'states': [567, 1579], 'belonging': [568], 'Ascomycota': [571], 'Pucciniomycotina': [574], 'Agaricomycotina': [576, 597, 657, 1996], '(Roberts,': [580], '1999).': [581], 'Ceratobasidiaceae,': [591, 719, 2032, 3352], 'Sebacinaceae': [592, 816, 1335, 2298, 2307], '(Wells,': [598], '1994).': [599], 'best-known': [601], 'among': [604, 646, 3632], 'three': [606, 622, 691, 1086, 2044, 3163, 3325, 3390, 3687], 'families': [607, 623, 654, 692], 'damping-off': [610], 'root': [611], 'pathogen': [612], 'R.': [613], 'solani': [614], '(teleomorph': [615], 'cucumeris)': [617], 'Ceratobasidiaceae.': [620, 1337], 'All': [621, 1891, 1901], 'lie': [624], 'gray': [627], 'area': [628], 'occupied': [629], 'diverse': [631, 1662, 1708, 2035, 3817, 3991], 'basal': [632], 'hymenium-forming': [633], 'fungi,': [634, 3899], 'having': [636], 'septate': [637], 'basidia,': [638], 'leading': [639, 947], 'perpetual': [641], 'disagreements': [642], 'about': [643], 'relationships': [645], 'placements': [651], '(see': [658, 957, 2730, 3657, 3710], 'Wells,': [659], '1994;': [660], 'Weiss': [661], 'Oberwinkler,': [663], '2001).': [664], 'Morphology': [665], 'naturally': [667], 'choice': [670], 'discrimination': [673], 'eukaryotes,': [675], 'including': [676, 1390, 1711, 2003, 2043, 2715, 3130], 'fungi.': [677], 'where': [682], 'complex': [683], 'fruit': [684, 772], 'bodies': [685], 'absent,': [687], 'such': [688, 1286], 'containing': [693], 'species,': [696], 'morphological': [697, 1052], 'delimitation': [699], 'difficult.': [701], 'difficulty': [703], 'further': [705, 3208], 'multiplied': [706], 'when': [707, 1255, 2660, 3113], 'even': [708], 'cryptic,': [710], 'fruiting': [712], 'structures': [713, 1536], 'rarely': [715, 768], 'seen.': [716], 'In': [717, 1408, 1563, 1815, 1949, 2674, 2758], 'vegetative': [720], 'hyphal': [721], 'morphologies': [722], 'mostly': [724], 'homogeneous': [725], 'genera,': [727], 'while': [728, 1382, 3569, 3885, 3917], 'many': [729, 870, 1342, 3502, 3564, 4152, 4293], 'characters': [730], 'overlap': [731], 'between': [732, 1779], 'or': [734, 737, 914, 1290, 1321, 1909, 2691], 'vary': [735], 'environmentally': [736], 'developmentally': [738], 'individuals': [740], '(Andersen,': [741, 824], 'Basidial': [743], 'morphology': [744], 'provides': [745], 'reliable': [746], 'at': [752, 1028, 2870, 2878, 2886, 2904, 3680, 3686, 3726, 3748, 3863, 3944], 'morpho-species': [754], 'level': [755, 1033], '(Warcup': [756, 939, 1552], 'Talbot,': [758, 941, 1554], '1966,': [759, 1555], '1967,': [760, 1556, 2777], '1971,': [761, 1557, 1560, 2778], '1980),': [762], 'very': [767, 2627, 3446], 'induced': [770], 'culture': [774, 1055], '(Ramsay': [775, 878], '1986;': [778], '1987,': [782, 1597], '1990;': [783], 'Milligan': [784], 'Williams,': [786], '1988).': [787], 'Septal': [788], 'ultrastructure': [789, 833, 1588], 'concrete': [792], 'character': [793], 'clearly': [795], 'distinguishes': [796], 'major': [798, 847, 1087, 1653, 1665, 1992, 2027], 'clades': [799, 1344, 1490, 1993, 2030, 3156, 3896], '(Khan': [802], 'Kimbrough,': [804], 'Marchisio': [806], '1985;': [809, 924], 'Sherburne,': [812, 1607], '1992),': [813], 'although': [814, 3785], 'require': [819], 'detailed': [820, 1538], 'observation': [821], 'separate': [823, 836, 3164], '1996).': [825, 1616, 1687, 3100], 'methods': [828, 963, 2712], 'involved': [829], 'laborious': [831], 'does': [834, 3523, 3673], 'genus.': [840], 'fungal': [842, 1109, 1299, 1343, 1401, 1654, 2676], 'isolation': [843, 867], 'another': [846], 'stumbling': [848], 'block': [849], 'research.': [853], 'can': [860, 936, 1362, 1494], 'be': [861, 937, 1015, 1363, 1495, 3159, 3607, 3800, 4034, 4290], 'routinely': [862], 'isolated': [863, 938, 1462, 1503, 1626, 2293, 2436, 2448, 2460, 2472], 'success': [868], 'varies': [872], 'season': [874], 'prior': [876], 'disturbance': [877], '1986)': [881], 'has': [883, 1008, 1293, 1961, 3663, 3677, 3718, 3771], 'shown': [885, 3394, 3862, 4024], 'decline': [887], 'hours': [889], 'collection': [891], 'epiphytic': [894, 1181], 'Andean': [895], '(Suarez': [897, 1190], '2006).': [900, 1084, 1193, 3546], 'Furthermore,': [901], 'orchids,': [908, 1575], 'especially': [909], 'nonphotosynthetic': [910], 'ones,': [911], 'impossible': [915], 'isolate': [917], '(Downie,': [918], '1943;': [919], 'Burgeff,': [920], 'Warcup,': [922, 1559], '1981,': [923, 1561], 'Bruns,': [927, 992, 998, 1063, 2733, 2929], '1997;': [928, 1064, 1600], '2003).': [932], 'Finally,': [933], 'nonsymbiotic': [934], '1967;': [942], 'Suarez': [943, 1081, 3176, 3543], '2006),': [946, 3499], 'suspect': [949], 'conclusions': [950], 'concerning': [951], 'symbiosis': [956], 'Molecular': [962], 'based': [964, 3421], 'fungal-specific': [966], 'amplification': [968, 1378, 1385, 1805, 2806, 3451, 3465, 3572, 3793, 3837, 4012], 'revolutionized': [978], 'ecto-,': [981], 'ericoid': [982], '(Gardes': [986, 2927], '1991;': [989], 'Gardes': [990, 2720, 3472], '1993;': [993], 'Redecker,': [994], '2000;': [995], 'Horton': [996], '2001;': [999], 'Vralstad': [1000], 'While': [1004], 'region': [1007, 1458, 1641, 1731, 3455, 3705, 3810, 3908, 3984], 'certain': [1009], 'limitations,': [1010], 'it': [1011, 1292, 3338, 3786], 'unlikely': [1013], 'displaced': [1016], 'effective': [1020, 3447], 'single': [1021, 3618], 'locus': [1022], '(Bruns,': [1034], '2001': [1035], 'contra': [1036], 'Seifert': [1037], '2007).': [1040], 'PCR-based': [1041], 'approaches': [1042, 3172], 'helping': [1044], 'overcome': [1046], 'problems': [1048], 'associated': [1049], 'limited': [1051], 'variation': [1053], 'biases': [1056, 4244], 'research': [1060], '(Taylor': [1061, 1160, 3488], 'Bidartondo': [1065], '2004;': [1068, 1072, 1076, 1080], 'Selosse': [1073], 'stand': [1090], 'way': [1093], 'comprehensive': [1095], 'unbiased': [1097], 'symbionts.': [1103], 'First,': [1104], 'commonly': [1107, 1725], 'encountered': [1108], 'Tulasnellaceae,': [1116, 1334, 2031, 3192], 'yet': [1117], 'proven': [1121], 'characterize': [1124, 1400], 'using': [1125, 1222, 1821, 1853, 1984, 2661, 2958, 3018, 3040, 3089, 3229, 3261, 3276, 3284, 3372, 4074], 'sets,': [1129], 'apparently': [1130], 'because': [1131, 3400], 'operon': [1139, 3480], '(Binder': [1140], '2005;': [1143, 3495], 'Moncalvo': [1144, 3423, 3496], '2006)': [1147, 3283], 'consequent': [1149], 'mutation': [1150], 'bases': [1152, 3588, 3650, 3747, 3887, 3913, 3930], 'conserved': [1154, 3227, 3508, 3514, 3668, 3704, 3765], 'regions': [1155, 1743, 3766], 'hybridize': [1159], 'A': [1164, 1688, 3445], 'compelling': [1165], 'example': [1166], 'problem': [1169], 'seen': [1171, 1250, 4097], 'recent': [1174], 'study': [1175, 1585, 1928], 'associations': [1178], 'Pleurothallinae': [1185], 'growing': [1186], 'Andes': [1189], 'Electron': [1194], 'microscopic': [1195], 'examination': [1196], 'tissues': [1199], 'pelotons': [1201], 'revealed': [1202], 'predominance': [1204], 'dolipore': [1208], 'septa': [1209, 1245], 'imperforate,': [1211], 'slightly': [1212, 3695], 'curved': [1213], 'parenthesomes': [1214], 'Tulasnellaceae.': [1220], 'an': [1223, 2975, 3128, 3312, 3405, 3637], 'array': [1224], 'primers,': [1227], 'few': [1228, 1519, 3642, 3745, 3773, 4103], 'amplified.': [1233], 'Instead,': [1234], 'variety': [1236, 2709], 'low-level': [1238], 'contaminants,': [1239], 'particularly': [1240, 1331], 'ascomycetes,': [1241], 'amplified': [1243, 3039], '(the': [1244], 'structures).': [1253], 'Only': [1254], 'nested': [1256], 'Tulasnella-specific': [1260], 'used': [1263, 1621, 1726, 2936, 3153, 3160, 3174, 3292, 3819, 3993], 'did': [1264], 'true': [1266], 'appear': [1269], 'surveys.': [1273], 'Secondly,': [1274], 'extremely': [1278, 3108], 'high': [1279, 1786, 4142], 'diversity': [1280, 1402], 'samples': [1285], 'ectomycorrhizal': [1288], 'roots': [1289], 'soil,': [1291], 'track': [1297], 'particular': [1298, 1446, 3932, 3940, 4240], 'they': [1307], 'associate.': [1308], 'Third,': [1309], 'there': [1310, 4173], 'paucity': [1313], 'fruitbodies': [1322, 2690], 'important': [1328, 4214], 'clades,': [1330], 'result': [1339], 'only': [1347, 3131, 3226], 'sequence': [1349, 3604, 3879], 'data,': [1350], 'without': [1351, 3311], 'connection': [1352], 'whole': [1355, 1498], 'organism': [1356], 'whose': [1357], 'physiology,': [1358], 'morphology,': [1359], 'anatomy,': [1360], 'etc.': [1361], 'studied.': [1364], 'To': [1365, 3207, 3891, 4232], 'combat': [1367], 'issues,': [1369], 'we': [1370, 1410, 1453, 1865, 2764, 3114, 3548], 'developed': [1372, 1412, 1866, 3470], 'new': [1373, 1741, 1923, 1941, 3834, 4009], 'fungal-selective': [1374], 'minimize': [1377], 'plant': [1380, 3467, 3670], 'allowing': [1383], 'robust': [1384], 'tested': [1388, 1795], 'Basidiomycota,': [1389, 4185, 4220], 'Tulasnella.': [1391, 4207], 'purpose': [1393], 'pair': [1397, 1939, 1960, 3553], 'unstudied': [1406], 'orchids.': [1407], 'addition,': [1409], 'selective': [1414], 'amplify': [1418, 1728, 3526, 3559], 'These': [1433, 1617, 4089], 'should': [1436, 4033, 4288], 'elucidate': [1439], 'distribution': [1441], 'natural': [1443, 1450], 'histories': [1444], 'environments.': [1451], 'sequenced': [1455, 2997, 3063, 4260], 'Jack': [1470], 'Warcup': [1471, 1500, 2773], 'Randolf': [1473], 'improve': [1478], 'resolution': [1480], 'hope': [1487], 'additional': [1489, 2049], 'connected': [1496], 'organisms.': [1499], 'Talbot': [1502, 2775], 'spectrum': [1509], 'Australian': [1511], 'terrestrial': [1512, 1574], 'one': [1516, 1950, 1952, 3664], 'teams': [1520], 'who': [1521], 'succeeded': [1522], 'inducing': [1524], 'teleomorph': [1525], 'formation': [1526], 'large': [1529, 1698, 3708, 3988, 3998], 'percentage': [1530], 'isolates.': [1533], 'sexual': [1535], 'allowed': [1537], 'taxonomic': [1539, 4169], 'work': [1540], 'patterns': [1546, 4096], 'specificity': [1548, 1797, 3938, 4071], '1980;': [1558], '1985).': [1562], 'turn,': [1564], 'colleagues': [1567], 'obtained': [1568, 2703, 2983], 'numerous': [1569, 3195], 'North': [1572], 'American': [1573], '(rarely,': [1580], 'teleomorphs)': [1581], 'conducted': [1583], 'septal': [1587], 'representative': [1590, 2766], '(Currah,': [1592], '1987;': [1593], '1988,': [1598], '1990,': [1599], 'Mordue': [1601], '1989;': [1604], '1992;': [1608, 1612], 'Zelmer,': [1611], 'Zelmer': [1613], 'widely': [1620], 'comparison': [1623], 'newly': [1625], 'strains.': [1628], 'Materials': [1629], 'Methods': [1631], 'Primer': [1632, 1790, 1874, 1882, 2913], 'design': [1633, 3551], 'testing': [1635, 1817], 'An': [1636], 'alignment': [1637, 1690, 3118, 3129, 3260, 3827, 3846, 4001, 4039], '3′': [1640, 3649, 3696, 3946, 4254], 'small': [1645, 3592, 3814, 3824], 'subunit': [1646, 1699, 3709, 3815, 3825, 3989, 3999], 'gene': [1648, 1701], 'representatives': [1650], 'phyla': [1655], '(Chytridiomycota,': [1656], 'Blastocladiomycota,': [1657], 'Zygomycota,': [1658, 4189, 4224], 'Glomeromycota,': [1659, 4187, 4222], 'Ascomycota,': [1660, 3781, 4183], 'Basidiomycota),': [1661], 'groups': [1667, 4215], 'lineages': [1671, 4241], 'was': [1672, 1702, 1818, 2900, 3122, 3147, 3152, 3316, 3335, 3339, 3360, 3469, 4137, 4206], 'initiated': [1673], 'ClustalW': [1675], 'modified': [1677, 1765], 'eye': [1679], 'paup*b10': [1681], '(Swofford,': [1682], '1990)': [1683, 2785, 2922], 'Se-Al': [1685, 3098], '(Rambaut,': [1686, 3099], 'similar': [1689, 3197], '5′': [1693, 3589, 3750, 4265], 'end': [1694, 3751, 3947, 4255, 4266], 'constructed.': [1704], 'GenBank': [1705, 1834, 3053, 3072, 3971, 4060], 'vascular': [1709, 2041, 3669], 'plants,': [1710, 2042], 'members': [1713, 2036, 3778], 'Orchidaceae,': [1716, 4195, 4230], 'added': [1718], 'both': [1720, 1810, 3864, 4196], 'alignments.': [1721, 1739], 'Previously': [1722], 'located': [1733], 'SSU': [1736, 3950, 3974, 4258], 'LSU': [1738, 4063, 4269], 'Prospective': [1740, 1782], 'then': [1745, 1794, 3016, 3087, 3139, 3611], 'imported': [1746], 'NetPrimer': [1748], '(Premier': [1749], 'Biosoft,': [1750], 'Palo': [1751], 'Alto,': [1752], 'CA,': [1753, 2745, 2956, 3014, 3030], 'USA)': [1754, 2746, 2957, 3015, 3031], 'checked': [1756], 'unwanted': [1758], 'secondary': [1759], 'structure': [1760], 'cross-hybridization': [1762], 'achieve': [1767], 'desirable': [1768], 'annealing': [1769, 1880, 1944, 2885], 'temperatures': [1770, 1881, 1945, 2888], '(between': [1771], '50': [1772, 2824], '65˚C': [1774], '<': [1776], '3˚C': [1777], 'difference': [1778], 'paired': [1780], 'primers).': [1781], 'obtaining': [1784], 'relatively': [1785], 'scores': [1787], 'Net': [1789], '(above': [1791], '87)': [1792], 'target': [1800, 1808], 'clade': [1801, 1809, 1884], 'breadth': [1803, 2074], 'silico': [1812, 1816, 4067], 'empirically.': [1814], 'carried': [1819, 1982, 2813], 'out': [1820, 1983, 2814, 3295], "'find": [1823], 'short': [1824], 'exact': [1826], "matches'": [1827], 'nucleotide': [1830], 'searching': [1833], 'NCBI': [1837, 4112, 4168], 'website': [1838, 3079, 3435], '(http://www.ncbi.nlm.nih.gov/BLAST/;': [1839], 'Altshul': [1840], 'top': [1845, 3866, 4132], '1000–5000': [1846], 'matches': [1847, 4124, 4143, 4160], 'each': [1849, 2613, 2822, 3259, 3300], 'search': [1850, 3286, 3305], 'assessed': [1852], 'Taxonomy': [1855, 4155], 'Reports': [1856, 1859], 'Lineage': [1858], 'output': [1860], 'options.': [1861], 'optimal': [1863], 'listed': [1868], 'Table': [1870, 1872, 2059, 2061, 3539], '1.': [1871, 1873, 4043], 'sequences,': [1875, 3468, 3645], 'recommended': [1876, 1959], 'pairs': [1878, 2619, 2914], 'Target': [1883], 'Sequence': [1885], 'Paired': [1886], 'Temperature': [1888], '(ºC)': [1889], 'ITS1-OF': [1890, 1904, 2662, 2915, 3580, 3596, 4136, 4172], '(mix': [1893], 'two': [1895, 1955, 2990, 3587, 3599, 3628], 'primers)': [1896], 'AACTCGGCCATTTAGAGGAAGTAACTTGGTCATTTAGAGGAAGT': [1897], 'ITS4-OF': [1898, 1900, 2664, 3693, 4203], '60': [1899], 'GTTACTAGGGGAATCCTTGTT': [1903], 'ITS4-Tul': [1905], 'CCGCCAGATTCACACATTGA': [1907], 'ITS1': [1908, 2918, 2959], 'ITS5': [1910, 1966], '54': [1911], 'SSU1318-Tom': [1912, 1920], 'Thelephoraceae': [1913, 2441, 2453, 2465, 2477, 2486, 2495, 2504], 'CGATAACGAACGAGACCTTAT': [1914], 'LSU-Tom4': [1915, 1917], '62': [1916], 'Tomentella/Thelephora': [1918], 'GCCCTGTTCCAAGAGACTTA': [1919], 'Sequences': [1921, 3048], 'designed': [1925], 'given,': [1930], 'along': [1931], 'recommendations': [1933], 'PCR.': [1948], 'case,': [1951], 'previously': [1963, 3831, 4006], 'ITS1;': [1965], 'good': [1970], 'option': [1971, 4078], '(White': [1972, 2919, 2962], 'Empirical': [1976], 'performance': [1980], '56': [1985], 'extracts,': [1987], 'representing': [1988], 'following:': [1990], '(=': [1997], "'hymenomycetes')": [1998], '(Hibbett': [1999], '2007),': [2002], 'Tremellomycetes,': [2004], 'Dacrymycetes,': [2005], 'Auriculariales,': [2006], 'Gomphales,': [2007], 'Cantharellales,': [2008], 'Hymenochaetales,': [2009], 'Polyporales,': [2010], 'Russulales,': [2011], 'Sebacinales,': [2012], 'Thelephorales,': [2013, 2428, 2440, 2452, 2464, 2476, 2485, 2494, 2503], 'Agaricales,': [2015], 'missing': [2017, 3912], 'Geastrales,': [2019], 'Hysterangiales,': [2020], 'Phallales,': [2021], 'Gloeophorales,': [2022], 'Wallemiomycetes': [2023], 'Entorhizomycetes;': [2025], 'Sebacinaceae;': [2034], 'Thelephoraceae;': [2039], '(Table': [2047, 2889, 4036], '2;': [2048, 3540], 'details': [2050], 'sources': [2053], 'given': [2055, 2642], 'Supplementary': [2057], 'Material,': [2058], 'S1).': [2060], '2.': [2062], 'Results': [2063, 3437], 'trials': [2070], 'test': [2072], 'Family/lineage': [2077], 'ITS1/ITS4': [2078], 'ITS1F/ITS4': [2079], 'ITS1OF/ITS4OF': [2080], 'ITS1/ITS4-Tul': [2081], 'SSU1318': [2082], 'Tom/LSU-Tom4': [2083], 'Cortinarius': [2084], 'traganus': [2085], 'Agaricales': [2086, 2094], '+++': [2087, 2088, 2089, 2095, 2096, 2097, 2103, 2104, 2105, 2111, 2112, 2113, 2119, 2120, 2121, 2127, 2128, 2129, 2135, 2143, 2144, 2145, 2153, 2154, 2155, 2169, 2170, 2171, 2177, 2178, 2179, 2185, 2186, 2187, 2194, 2201, 2202, 2203, 2210, 2217, 2218, 2225, 2226, 2227, 2234, 2242, 2243, 2244, 2252, 2260, 2261, 2262, 2269, 2270, 2271, 2278, 2279, 2280, 2287, 2288, 2289, 2299, 2301, 2308, 2309, 2310, 2317, 2319, 2320, 2326, 2335, 2337, 2338, 2344, 2346, 2347, 2355, 2357, 2358, 2366, 2368, 2369, 2379, 2380, 2388, 2390, 2391, 2397, 2399, 2400, 2405, 2413, 2415, 2421, 2422, 2423, 2432, 2442, 2443, 2444, 2446, 2454, 2455, 2456, 2458, 2466, 2467, 2468, 2470, 2478, 2479, 2480, 2482, 2487, 2488, 2489, 2496, 2497, 2498, 2500, 2505, 2506, 2507, 2509, 2513, 2514, 2515, 2521, 2522, 2523, 2531, 2541, 2551, 2561, 2571, 2581, 2591, 2601], '–': [2090, 2099, 2106, 2107, 2130, 2131, 2138, 2139, 2146, 2147, 2156, 2164, 2165, 2173, 2180, 2181, 2188, 2189, 2196, 2197, 2204, 2205, 2212, 2213, 2220, 2221, 2228, 2236, 2237, 2245, 2246, 2254, 2255, 2263, 2264, 2272, 2273, 2281, 2282, 2290, 2291, 2302, 2303, 2311, 2312, 2321, 2330, 2339, 2348, 2359, 2381, 2392, 2401, 2408, 2409, 2416, 2417, 2424, 2433, 2434, 2445, 2457, 2508, 2516, 2517, 2524, 2525, 2533, 2534, 2535, 2543, 2544, 2545, 2553, 2554, 2563, 2564, 2572, 2573, 2574, 2575, 2584, 2585, 2594, 2595, 2602, 2603, 2604, 2605, 2790], '(+)': [2091, 2098, 2114, 2115, 2122, 2172, 2229, 2318, 2327, 2329, 2356, 2398, 2532, 2542, 2555, 2562, 2565], 'Galerina': [2092], 'patagonica': [2093], 'Fomitopsis': [2100], 'pinicola': [2101], 'Aphyllophorales': [2102], 'Auricularia': [2108], 'cornea': [2109], 'Auriculariales': [2110, 2118, 2126, 2134, 2142, 2151, 2160], 'Exidia': [2116, 2124], 'crenata': [2117], '+': [2123, 2136, 2137, 2162, 2195, 2211, 2345, 2378, 2389, 2425, 2469, 2481, 2490, 2499, 2583, 2593, 3330, 3332, 3355, 3357], 'sp.': [2125, 2141, 2167, 2239, 2275, 2350, 2361, 2372, 2383, 2484, 2493, 2502], 'Exidiopsis': [2132], 'punicea': [2133], 'Heterochaete': [2140], 'Tipularia': [2148, 2157, 2363, 2374, 2385], 'protocorm': [2149, 2158], 'mycorrhiza': [2150, 2159], 'MB': [2152, 2161, 2552, 2592, 2645], '++': [2163, 2193, 2209, 2219, 2233, 2235, 2251, 2253, 2300, 2328, 2336, 2367, 2370, 2377, 2406, 2407, 2414, 2430, 2431, 2491, 2582], 'Alpova': [2166], 'Boletales': [2168, 2176], 'Boletus': [2174], 'edulis': [2175], 'Dacrymyces': [2182, 2190], 'capitatus': [2183], 'Dacrymycetales': [2184, 2192], 'cerasi': [2191], 'Geastrum': [2198], 'mammosum': [2199], 'Geastrales': [2200], 'Gomphus': [2206], 'floccosus': [2207], 'Gomphoid-Phalloid': [2208], 'Polyporus': [2214], 'brumalis': [2215], 'Polyporoid': [2216, 2224, 2232], 'Trametes': [2222], 'versicolor': [2223, 2266], 'Trichaptum': [2230], 'abietinum': [2231], 'Ceratobasidium': [2238, 2247], 'Rhizoctonia,': [2240, 2249, 2258, 2267, 2276, 2285, 2297, 2306, 2315, 2324, 2333, 2342, 2353, 2364, 2375, 2386, 2395], 'Ceratobasidiaceae': [2241, 2250, 2259, 2268, 2277, 2286, 3419], 'sphaerosporum': [2248], 'Moniliopsis': [2256], 'anomala': [2257], 'Sistotrema': [2274], 'ochraceus': [2284], 'Fungus': [2292, 2435, 2447, 2459, 2471], 'Hexalectris': [2295], 'spicata': [2296], 'Sebacina': [2304], 'vermifera': [2305], 'Epulorhiza': [2313, 3537], 'anaticula': [2314], 'cystidiophora': [2323], 'calospora': [2332], 'irregularis': [2341, 3535], 'Goodyera': [2352], 'violea': [2394], 'Lactarius': [2402, 2410], 'resimus': [2403], 'Russulaceae': [2404, 2412, 2420], 'torminosus': [2411], 'Russula': [2418], 'brevipes': [2419], 'Hydnellum': [2426], 'peckii': [2427], 'Bankeraceae': [2429], 'Cephalanthera': [2438, 2450], 'austinae': [2439, 2451], 'Corallorhiza': [2462, 2474, 2576, 2586, 2658, 2991], 'odontorhiza': [2463, 2475], 'Tomentella': [2483, 2492, 2501], 'Sirobasidium': [2510], 'magnum': [2511], 'Tremellales': [2512, 2520], 'Tremella': [2518], 'mesenterica': [2519], 'Cuphea': [2526], 'miniata': [2527], 'stem': [2528, 2538, 2548, 2558, 2568, 2578, 2588, 2598], 'Eudicots;': [2529, 2539, 2549, 2559, 2569], 'Myrtales': [2530], 'Phacelia': [2536], 'viscida': [2537], 'Solanales': [2540], 'Verbena': [2546], 'speciosa': [2547], 'Lamiales': [2550], 'Silene': [2556], 'vulgaris': [2557], 'Caryophyllales': [2560], 'Dalechampia': [2566], 'volubilis': [2567], 'Malpighiales': [2570], 'maculata': [2577], 'Monocots;': [2579, 2589, 2599], 'mertensiana': [2587], 'Cypripedium': [2596], 'guttatum': [2597], 'intensity': [2607], 'products': [2610, 3001], 'produced': [2611, 3241], 'taxon': [2614, 4133, 4200], 'various': [2617, 2887, 3753], 'indicated': [2621, 3881, 3957], 'barely': [2623], 'visible,': [2624], '(+),': [2625], 'bright,': [2628], '+++.': [2629], 'Unless': [2630], 'otherwise': [2631], 'indicated,': [2632], 'band': [2634], 'expected': [2638], 'size': [2639], 'pair.': [2644], 'stands': [2646], 'multiple': [2648], 'bands': [2649], 'incorrect': [2651], 'sizes.': [2652], 'Note': [2653, 3594, 4020], 'amplicons': [2656], 'stems': [2659, 2988], 'found': [2666], 'derive': [2668], 'yeasts.': [2671], 'extraction': [2673, 2711], 'general,': [2675], 'genomic': [2677, 3575], 'DNAs': [2678, 2701], 'sequencing': [2684, 2910, 2947, 3023], 'extracted': [2686], 'either': [2688], 'dried': [2689], 'mycelium': [2692], 'grown': [2693], 'pure': [2695], 'cultures': [2696], 'broth.': [2698], 'Because': [2699], 'over': [2704, 2969], '15-yr': [2706], 'period,': [2707], 'utilized,': [2714], 'CTAB': [2717], 'method': [2718, 2727], 'Bruns': [2722, 3474], '(1996a),': [2723], 'SDS/Gene': [2725], 'Clean': [2726, 3007], "O'Donnell": [2729], '1997),': [2734], 'Qiagen': [2736, 2942], 'Plant': [2737], 'DNeasy': [2738], 'Genomic': [2740], 'Tip': [2741], 'kits': [2742], '(Qiagen,': [2743], 'Valencia,': [2744], 'Omega': [2749], 'Fungal': [2750], 'EZNA': [2751], 'kit': [2752, 3024], '(Omega': [2753], 'Biotek,': [2754], 'Doraville,': [2755], 'GA,': [2756], 'USA).': [2757, 2851], 'selecting': [2759, 3570], 'sequencing,': [2763], 'acquired': [2765], '(1966,': [2776], '1980)': [2779], 'al.': [2783, 3178, 3183, 3425], '(1987,': [2784], '(JHW': [2786], '062;': [2787], 'JHW': [2788, 2793], '0632': [2789], 'type': [2791], 'strain;': [2792], '0750;': [2794], 'UAMH': [2795, 2797, 2799, 2801], '5404;': [2796], '5428;': [2798], '5430;': [2800], '5443;': [2802], 'UAHM': [2803], '6440).': [2804], 'Amplification': [2807], 'reactions': [2808], '25': [2810, 2832], 'µl': [2811], 'final': [2816], 'concentrations': [2817], '200': [2819], 'µm': [2820], 'dNTP,': [2823], 'mm': [2825, 2828, 2833], 'KCl,': [2826], 'Tris-HCl': [2829], '(pH': [2830], '8.3),': [2831], 'MgCl,': [2834], '0.1': [2835], 'mg': [2836], 'ml−1': [2837], 'gelatin,': [2838], '0.5': [2840], 'units': [2841], 'Sigma': [2843], 'RedTaq': [2844], '(Sigma-Aldrich,': [2847], 'Saint': [2848], 'Louis,': [2849], 'MO,': [2850], 'Routine': [2852], 'amplifications': [2853, 2986], 'consisted': [2854], '35': [2856], 'MJ': [2860], 'PTC-200': [2861], 'thermocycler': [2862], 'employed': [2864], '2': [2866], 'min': [2867], 'initial': [2868, 2938], 'denaturation': [2869, 2877], '96˚C': [2871], 'before': [2872, 3613], 'thermocycling,': [2873], '30': [2875], 's': [2876, 2884], '94˚C': [2879], 'followed': [2880, 2901, 2940, 3093], '40': [2883], '1)': [2890], '72˚C': [2892, 2905], 'elongation': [2893], '1': [2895], 'min.': [2896, 2908], 'last': [2898], 'cycle': [2899, 2946], 'extension': [2903], 'cloning': [2912], 'plus': [2916, 2923, 2931, 3411], 'ITS4-OF;': [2917], 'ITS4-Tul;': [2924], 'ITS1-F': [2926, 3583], '1993)': [2930], 'TW13,': [2932], '(GGTCCGTGTTTCAAGACG': [2933], 'http://plantbio.berkeley.edu/~bruns/)': [2934], 'amplification,': [2939], 'Qiaquick': [2943], 'cleanup': [2944], 'BigDye': [2949], 'Terminator': [2950], '3.1': [2951], '(Applied': [2952], 'Biosystems,': [2953], 'Foster': [2954], 'City,': [2955], 'ITS4': [2961, 3698], 'Products': [2966], 'cleaned': [2968], 'Sephadex': [2970], 'G50': [2971], 'separated': [2973], 'ABI': [2976], '3130XL': [2977], 'capillary': [2978], 'system.': [2979], 'Mixed': [2980], 'fragments': [2981], 'ITS1-OF/ITS4-OF': [2985, 3444], 'species.': [2992], 'We': [2993, 3125, 3185], 'therefore': [2994, 3126], 'cloned': [2995, 3017], 'amplicons.': [2999], 'purified': [3003], 'Zymo': [3005], '5': [3006], 'Concentrator': [3009], 'columns': [3010], '(Zymo': [3011], 'Research,': [3012], 'Orange,': [3013], 'TOPO': [3020], 'TA': [3021], 'vector': [3026], 'PCR4.0': [3027], '(Invitrogen,': [3028], 'Carlsbad,': [3029], 'following': [3032, 4179], "manufacturers'": [3033], 'instructions.': [3034], 'Discrete': [3035], 'colonies': [3036], 'directly': [3038], 'M13': [3041], 'sequenced,': [3044], 'earlier.': [3047], 'submitted': [3051], 'under': [3054], 'accessions': [3055], 'EU218878-EU218895.': [3056], 'Phylogenetic': [3057], 'Close': [3059], 'relatives': [3060], 'specimens': [3064], 'identified': [3066], 'through': [3067], 'Discontinuous': [3068], 'MegaBLAST': [3069], 'masked,': [3074], 'FASTA': [3075], '(http://biotech.inbre.alaska.edu/fungal-metagenomics/).': [3080], 'Sets': [3081], 'closely': [3083], 'related': [3084], 'aligned': [3088, 3907], 'Muscle': [3090], '(Edgar,': [3091], '2004)': [3092], 'manual': [3095], 'optimization': [3096], 'diverse,': [3109], 'positional': [3111, 3214], 'homology': [3112, 3215], 'attempted': [3115], 'global': [3117], 'highly': [3123, 3196, 3703], 'suspect.': [3124], 'created': [3127], '5.8S': [3133], 'portion': [3134], 'region,': [3138], 'maximum': [3141, 3383], 'parsimony': [3142, 3367], 'tree': [3143], 'estimated': [3148, 3369], 'paup*4.0b10,': [3150], 'identify': [3155], 'could': [3158], 'create': [3162], 'alignments': [3165, 3220, 3244, 3248, 4100], 'spanning': [3166], 'entire': [3168, 3906], 'ITS1–5.8S-ITS2': [3169], 'region.': [3170, 3844, 4019], 'Similar': [3171], '(2006)': [3179], 'Shefferson': [3181], '(2007).': [3184], 'started': [3186], '154': [3188], 'taxa': [3189, 3798, 3872, 3933, 4116], 'pruned': [3194, 3223, 3246], 'ease': [3200], 'visualization': [3202], 'resulting': [3205, 3919], 'trees.': [3206], 'evaluate': [3209], 'effects': [3211], 'uncertain': [3213], 'alignments,': [3218, 3327], 'leave': [3225], 'positions': [3228, 3629, 3963, 4052], 'lenient': [3231], 'settings': [3232, 3290], 'Gblocks': [3235], 'web': [3236], 'server': [3237], '(Castresana,': [3238], '2000).': [3239], 'Trees': [3240], 'versus': [3245], "'Gblock'": [3247], 'compared.': [3250], 'Best-fitting': [3251], 'models': [3252], 'determined': [3257], 'ModelTest': [3262], '2.0': [3263], '(Posada': [3264], 'Crandall,': [3266], '1998)': [3267], 'Aikake': [3269], 'Information': [3270], 'Criteria.': [3271], 'Maximum-likelihood': [3272], 'trees': [3273, 3363, 3368, 3384, 3392], 'inferred': [3275], 'genetic': [3278], 'algorithm-driven': [3279], 'program': [3280], 'garli': [3281], '(Zwickl,': [3282], 'default': [3285], 'settings;': [3287], 'same': [3289], 'carry': [3294], '100': [3296, 3387], 'bootstrap': [3297], 'replicates': [3298], 'dataset,': [3301], 'except': [3302], 'termination': [3306], 'criterion': [3307], 'consecutive': [3309], 'generations': [3310], 'improvement': [3313], 'likelihood': [3315], 'dropped': [3317], '000': [3320], '5000.': [3322], 'For': [3323, 3350, 4171, 4251], 'GTR': [3329], 'G': [3333, 3358], 'model': [3334, 3343, 3359], 'used,': [3336], 'since': [3337], 'closest': [3341], 'ones': [3346], 'specified': [3347], 'ModelTest.': [3349], 'HKY': [3354], 'used.': [3361], 'Likelihood': [3362], 'compared': [3365, 3854], 'paup*4.0b10': [3371], 'heuristic': [3373], 'random': [3377], 'addition': [3378], 'replicates,': [3379], 'equal': [3380], 'weights': [3381], 'set': [3385], '000.': [3388], 'midpoint': [3396], 'rooting': [3397], '(Farris,': [3398], '1972),': [3399], 'lack': [3403], 'alignable,': [3406], 'priori,': [3408], 'outgroup.': [3409], 'Botryobasidium': [3410], 'Hyplotrichum': [3412], 'designated': [3414], 'outgroups': [3416], 'upon': [3422], '(2006).': [3426], 'Alignments': [3427], 'additonal': [3429], 'information': [3430], '(http://mercury.bio.uaf.edu/~lee_taylor/orchid_primers.html).': [3436], 'discussion': [3439], 'primers:': [3443], 'essentially': [3457], 'Eumycota,': [3459], 'ITS1-F,': [3460, 3674], 'minimizes': [3463], '(1993).': [3475], 'evolving': [3485], 'exceedingly': [3486], 'rapidly': [3487], '2002;': [3491], 'Binder': [3492], 'hence': [3501], 'sites': [3504], 'generally': [3507], 'across': [3509], 'Eumycota': [3511], '(1,': [3518], '2).': [3519, 3713], 'ITS-1F': [3522], 'effectively': [3525], '(e.g.': [3533], 'anaticula,': [3538], 'see': [3542], 'Hence,': [3547], 'sought': [3549], 'would': [3558], 'possible,': [3568], 'against': [3571], 'regions.': [3576], 'forward': [3578], 'overlaps': [3581], 'positioned': [3586], 'subunit.': [3593], 'really': [3598], 'identical': [3603, 3875], 'must': [3606], 'ordered': [3608], 'separately': [3609], 'combined': [3612], 'use;': [3614], 'synthesis': [3615], 'degenerate': [3619], 'recommended.': [3623], 'altered': [3625], 'placement': [3626], 'differ': [3631], 'forms': [3635], 'provide': [3636], 'fit': [3639], 'perfectly': [3651], 'match': [3652, 3735, 4077], 'inspected': [3656, 3723, 3738, 3777], 'alignment,': [3658, 3711], 'Fig.': [3659, 3712, 4042], '1).': [3660, 4037], 'fewer': [3665], 'mismatch': [3666, 3679, 3720], '3′-most': [3683, 3728], 'base': [3684], 'positions.': [3689], 'reverse': [3691, 4026], 'binds': [3700], 'Again,': [3714], 'however,': [3715], 'base.': [3729], 'exception': [3742], 'noncritical': [3746], '(owing': [3755], 'rapid': [3758], 'lineage,': [3762], 'no': [3763], 'entirely': [3764], 'found).': [3768], 'mismatches': [3774], 'Zygomycota': [3782], 'Chytridiomycota,': [3784, 4191, 4226], 'safe': [3789], 'assume': [3791], 'will': [3799], 'prevented.': [3801], 'Figure': [3802, 3976], '1Open': [3803], 'figure': [3805, 3979], 'viewerPowerPoint': [3806, 3980], 'Alignment': [3807, 3981], 'design.': [3822, 3996], '(SSU)': [3826], 'shows': [3828, 4002], 'locations': [3829, 4004], 'published': [3832, 4007], 'pretty': [3849], 'format': [3850, 4040], 'cucumeris': [3857], 'reference': [3860, 3878], 'sequence,': [3861], 'bottom.': [3868], 'Bases': [3869], "'.'": [3884], 'alternative': [3886], 'spelled': [3889], 'out.': [3890], 'maximize': [3892], 'representation': [3893], 'span': [3904, 3962, 4051], 'included,': [3910], 'coded': [3914], "'?',": [3916], 'gaps': [3918], 'indels': [3921], 'represented': [3923], "'–'": [3926], 'symbol.': [3927], 'Boxes': [3928], 'highlight': [3929], 'contribute': [3935], 'primers.': [3941], 'Two': [3942, 4044], 'portions': [3943, 3961, 4046], 'concatenated,': [3953], 'join': [3956], "'+++'.": [3959], '1307–1341': [3964], '1713–1821': [3966], 'Saccharomyces': [3969, 4058], 'cerevisiae': [3970, 4059], 'V01335': [3972], 'gene.': [3975, 4064], '2Open': [3977], '(LSU)': [4000], 'complements': [4027], 'actual': [4030], 'oligonucleotides': [4031], 'synthesized': [4035], 'follows': [4041], 'concatenated': [4045], 'shown,': [4049], '37–138': [4053], '179–209': [4055], 'J01355': [4061], 'Broader': [4065], 'performed': [4073], 'short-exact': [4076], 'blastn': [4080], 'nr': [4085], 'database': [4086], 'GenBank.': [4088, 4250], 'largely': [4092], 'congruent': [4093], 'selected': [4104], 'taxa.': [4105], 'lineage': [4107, 4204], 'reports': [4108, 4156], 'utilize': [4109], 'hierarchical': [4111], 'taxonomy': [4113, 4209], 'sort': [4115], 'proportion': [4121], 'best': [4123], 'query': [4127], 'taxon.': [4130], 'reported': [4134], 'Entoloma': [4138], '(Basidiomycota),': [4139], 'equally': [4141], 'distributed': [4145], 'throughout': [4146], 'occurred': [4150], 'Eumycota.': [4154], 'show': [4157], 'significant': [4159], 'query,': [4163], 'organized': [4164], 'according': [4165], 'hierarchy.': [4170], '5007': [4175], 'hits': [4176, 4212, 4238, 4284], 'groups:': [4180], 'Fungi,': [4181, 4218], '4694;': [4182], '2611;': [4184], '1214;': [4186], '615;': [4188], '75;': [4190], '74;': [4192], 'Embryophyta': [4193], '0.': [4197, 4231], 'top-ranked': [4199], 'report': [4205, 4210], 'showed': [4211], 'follows:': [4217], '4661;': [4219], '4253;': [4221], '191;': [4223], '53;': [4225], '3;': [4227], 'Embryophyta,': [4228], '16;': [4229], 'degree,': [4234], 'numbers': [4236], 'likely': [4242], 'reflect': [4243], 'example,': [4252], 'less': [4261], 'often': [4262], 'systematic': [4272], 'may': [4277], 'explain': [4278], 'lower': [4280], 'ITS1-OF.': [4286], 'It': [4287], 'noted': [4291]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2113341737', 'counts_by_year': [{'year': 2024, 'cited_by_count': 15}, {'year': 2023, 'cited_by_count': 13}, {'year': 2022, 'cited_by_count': 22}, {'year': 2021, 'cited_by_count': 24}, {'year': 2020, 'cited_by_count': 25}, {'year': 2019, 'cited_by_count': 16}, {'year': 2018, 'cited_by_count': 15}, {'year': 2017, 'cited_by_count': 12}, {'year': 2016, 'cited_by_count': 16}, {'year': 2015, 'cited_by_count': 14}, {'year': 2014, 'cited_by_count': 13}, {'year': 2013, 'cited_by_count': 26}, {'year': 2012, 'cited_by_count': 27}], 'updated_date': '2024-12-11T12:18:45.650961', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
