Cleavage of Syndecan-1 by Membrane Type Matrix Metalloproteinase-1 Stimulates Cell Migration

Name: Work Video:
Duration: 3 min 30 s
Kazuhira Endo; Takahisa Takino; Hisashi Miyamori; Hidenori Kinsen; Tomokazu Yoshizaki; Mitsuru Furukawa; Hiroshi Sato
{'id': 'https://openalex.org/W2096372265', 'doi': 'https://doi.org/10.1074/jbc.m306736200', 'title': 'Cleavage of Syndecan-1 by Membrane Type Matrix Metalloproteinase-1 Stimulates Cell Migration', 'display_name': 'Cleavage of Syndecan-1 by Membrane Type Matrix Metalloproteinase-1 Stimulates Cell Migration', 'publication_year': 2003, 'publication_date': '2003-10-01', 'ids': {'openalex': 'https://openalex.org/W2096372265', 'doi': 'https://doi.org/10.1074/jbc.m306736200', 'mag': '2096372265', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/12904296'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m306736200', 'pdf_url': 'http://www.jbc.org/article/S0021925820828671/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820828671/pdf', 'any_repository_has_fulltext': True}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5068060184', 'display_name': 'Kazuhira Endo', 'orcid': 'https://orcid.org/0000-0002-5401-8594'}, 'institutions': [{'id': 'https://openalex.org/I10091056', 'display_name': 'Kanazawa University', 'ror': 'https://ror.org/02hwp6a56', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I10091056']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Kazuhira Endo', 'raw_affiliation_strings': ['Department of Molecular Virology and Oncology, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan', 'Department of Otolaryngology, Graduate School of Medical Science, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Otolaryngology, Graduate School of Medical Science, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan', 'institution_ids': ['https://openalex.org/I10091056']}, {'raw_affiliation_string': 'Department of Molecular Virology and Oncology, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan', 'institution_ids': ['https://openalex.org/I10091056']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5111532327', 'display_name': 'Takahisa Takino', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I10091056', 'display_name': 'Kanazawa University', 'ror': 'https://ror.org/02hwp6a56', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I10091056']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Takahisa Takino', 'raw_affiliation_strings': ['Department of Molecular Virology and Oncology, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Virology and Oncology, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan', 'institution_ids': ['https://openalex.org/I10091056']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5082942100', 'display_name': 'Hisashi Miyamori', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I10091056', 'display_name': 'Kanazawa University', 'ror': 'https://ror.org/02hwp6a56', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I10091056']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Hisashi Miyamori', 'raw_affiliation_strings': ['Department of Molecular Virology and Oncology, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Virology and Oncology, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan', 'institution_ids': ['https://openalex.org/I10091056']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5060312229', 'display_name': 'Hidenori Kinsen', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I10091056', 'display_name': 'Kanazawa University', 'ror': 'https://ror.org/02hwp6a56', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I10091056']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Hidenori Kinsen', 'raw_affiliation_strings': ['Department of Molecular Virology and Oncology, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan', 'Department of Otolaryngology, Graduate School of Medical Science, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Virology and Oncology, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan', 'institution_ids': ['https://openalex.org/I10091056']}, {'raw_affiliation_string': 'Department of Otolaryngology, Graduate School of Medical Science, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan', 'institution_ids': ['https://openalex.org/I10091056']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5090897933', 'display_name': 'Tomokazu Yoshizaki', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I10091056', 'display_name': 'Kanazawa University', 'ror': 'https://ror.org/02hwp6a56', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I10091056']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Tomokazu Yoshizaki', 'raw_affiliation_strings': ['Department of Otolaryngology, Graduate School of Medical Science, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Otolaryngology, Graduate School of Medical Science, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan', 'institution_ids': ['https://openalex.org/I10091056']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5090455609', 'display_name': 'Mitsuru Furukawa', 'orcid': 'https://orcid.org/0000-0002-5991-9244'}, 'institutions': [{'id': 'https://openalex.org/I10091056', 'display_name': 'Kanazawa University', 'ror': 'https://ror.org/02hwp6a56', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I10091056']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Mitsuru Furukawa', 'raw_affiliation_strings': ['Department of Otolaryngology, Graduate School of Medical Science, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Otolaryngology, Graduate School of Medical Science, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan', 'institution_ids': ['https://openalex.org/I10091056']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5071354099', 'display_name': 'Hiroshi Sato', 'orcid': 'https://orcid.org/0000-0002-5230-4677'}, 'institutions': [{'id': 'https://openalex.org/I10091056', 'display_name': 'Kanazawa University', 'ror': 'https://ror.org/02hwp6a56', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I10091056']}], 'countries': ['JP'], 'is_corresponding': True, 'raw_author_name': 'Hiroshi Sato', 'raw_affiliation_strings': ['Center for the Development of Molecular Target Drugs, Cancer Research Institute, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan', 'Department of Molecular Virology and Oncology, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan'], 'affiliations': [{'raw_affiliation_string': 'Center for the Development of Molecular Target Drugs, Cancer Research Institute, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan', 'institution_ids': ['https://openalex.org/I10091056']}, {'raw_affiliation_string': 'Department of Molecular Virology and Oncology, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan', 'institution_ids': ['https://openalex.org/I10091056']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': ['https://openalex.org/A5071354099'], 'corresponding_institution_ids': ['https://openalex.org/I10091056'], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 8.157, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 382, 'citation_normalized_percentile': {'value': 0.943568, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 99, 'max': 100}, 'biblio': {'volume': '278', 'issue': '42', 'first_page': '40764', 'last_page': '40770'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10620', 'display_name': 'Protease and Inhibitor Mechanisms', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1306', 'display_name': 'Cancer Research'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10620', 'display_name': 'Protease and Inhibitor Mechanisms', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1306', 'display_name': 'Cancer Research'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11131', 'display_name': 'Proteoglycans and glycosaminoglycans research', 'score': 0.9998, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10831', 'display_name': 'Cell Adhesion Molecules Research', 'score': 0.9955, 'subfield': {'id': 'https://openalex.org/subfields/2723', 'display_name': 'Immunology and Allergy'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/ht1080', 'display_name': 'HT1080', 'score': 0.9672679}, {'id': 'https://openalex.org/keywords/syndecan-1', 'display_name': 'Syndecan 1', 'score': 0.9451145}], 'concepts': [{'id': 'https://openalex.org/C2777751087', 'wikidata': 'https://www.wikidata.org/wiki/Q5636047', 'display_name': 'HT1080', 'level': 3, 'score': 0.9672679}, {'id': 'https://openalex.org/C65001120', 'wikidata': 'https://www.wikidata.org/wiki/Q14912913', 'display_name': 'Syndecan 1', 'level': 3, 'score': 0.9451145}, {'id': 'https://openalex.org/C54009773', 'wikidata': 'https://www.wikidata.org/wiki/Q1429031', 'display_name': 'Transfection', 'level': 3, 'score': 0.6171242}, {'id': 'https://openalex.org/C109523444', 'wikidata': 'https://www.wikidata.org/wiki/Q424216', 'display_name': 'Matrix metalloproteinase', 'level': 2, 'score': 0.5950252}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.52449316}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.4606033}, {'id': 'https://openalex.org/C81885089', 'wikidata': 'https://www.wikidata.org/wiki/Q189082', 'display_name': 'Cell culture', 'level': 2, 'score': 0.45516714}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.44300804}, {'id': 'https://openalex.org/C24530287', 'wikidata': 'https://www.wikidata.org/wiki/Q424204', 'display_name': 'Transmembrane protein', 'level': 3, 'score': 0.42617887}, {'id': 'https://openalex.org/C1491633281', 'wikidata': 'https://www.wikidata.org/wiki/Q7868', 'display_name': 'Cell', 'level': 2, 'score': 0.42188835}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.414357}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.30122373}, {'id': 'https://openalex.org/C170493617', 'wikidata': 'https://www.wikidata.org/wiki/Q208467', 'display_name': 'Receptor', 'level': 2, 'score': 0.08963305}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D008562', 'descriptor_name': 'Membrane Glycoproteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D008666', 'descriptor_name': 'Metalloendopeptidases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D011509', 'descriptor_name': 'Proteoglycans', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D001665', 'descriptor_name': 'Binding Sites', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002273', 'descriptor_name': 'Carcinogens', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002460', 'descriptor_name': 'Cell Line', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D045744', 'descriptor_name': 'Cell Line, Tumor', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002465', 'descriptor_name': 'Cell Movement', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D003001', 'descriptor_name': 'Cloning, Molecular', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018076', 'descriptor_name': 'DNA, Complementary', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018076', 'descriptor_name': 'DNA, Complementary', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D000939', 'descriptor_name': 'Epitopes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015723', 'descriptor_name': 'Gene Library', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005998', 'descriptor_name': 'Glycine', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005998', 'descriptor_name': 'Glycine', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007930', 'descriptor_name': 'Leucine', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007930', 'descriptor_name': 'Leucine', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D053513', 'descriptor_name': 'Matrix Metalloproteinase 16', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D053504', 'descriptor_name': 'Matrix Metalloproteinases, Membrane-Associated', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008562', 'descriptor_name': 'Membrane Glycoproteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008666', 'descriptor_name': 'Metalloendopeptidases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010455', 'descriptor_name': 'Peptides', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010455', 'descriptor_name': 'Peptides', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D011485', 'descriptor_name': 'Protein Binding', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011509', 'descriptor_name': 'Proteoglycans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011994', 'descriptor_name': 'Recombinant Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011994', 'descriptor_name': 'Recombinant Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D011994', 'descriptor_name': 'Recombinant Proteins', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D053668', 'descriptor_name': 'Syndecan-1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D053667', 'descriptor_name': 'Syndecans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013755', 'descriptor_name': 'Tetradecanoylphorbol Acetate', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019715', 'descriptor_name': 'Tissue Inhibitor of Metalloproteinase-1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019715', 'descriptor_name': 'Tissue Inhibitor of Metalloproteinase-1', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D019716', 'descriptor_name': 'Tissue Inhibitor of Metalloproteinase-2', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019716', 'descriptor_name': 'Tissue Inhibitor of Metalloproteinase-2', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D014162', 'descriptor_name': 'Transfection', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014945', 'descriptor_name': 'Wound Healing', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 6, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m306736200', 'pdf_url': 'http://www.jbc.org/article/S0021925820828671/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': True, 'landing_page_url': 'https://kanazawa-u.repo.nii.ac.jp/?action=repository_uri&item_id=27686', 'pdf_url': 'https://kanazawa-u.repo.nii.ac.jp/record/27686/files/AA00598579-2003-2005-12.pdf', 'source': {'id': 'https://openalex.org/S4306400882', 'display_name': 'Kanazawa University Repository for Academic Resources (DSpace) (Kanazawa University)', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I10091056', 'host_organization_name': 'Kanazawa University', 'host_organization_lineage': ['https://openalex.org/I10091056'], 'host_organization_lineage_names': ['Kanazawa University'], 'type': 'repository'}, 'license': 'cc-by-nc-nd', 'license_id': 'https://openalex.org/licenses/cc-by-nc-nd', 'version': 'submittedVersion', 'is_accepted': False, 'is_published': False}, {'is_oa': True, 'landing_page_url': 'https://kanazawa-u.repo.nii.ac.jp/?action=repository_uri&item_id=38708', 'pdf_url': 'https://kanazawa-u.repo.nii.ac.jp/record/38708/files/endo-2004-25.pdf', 'source': {'id': 'https://openalex.org/S4306400882', 'display_name': 'Kanazawa University Repository for Academic Resources (DSpace) (Kanazawa University)', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I10091056', 'host_organization_name': 'Kanazawa University', 'host_organization_lineage': ['https://openalex.org/I10091056'], 'host_organization_lineage_names': ['Kanazawa University'], 'type': 'repository'}, 'license': 'cc-by-nc-nd', 'license_id': 'https://openalex.org/licenses/cc-by-nc-nd', 'version': 'submittedVersion', 'is_accepted': False, 'is_published': False}, {'is_oa': True, 'landing_page_url': 'https://kanazawa-u.repo.nii.ac.jp/?action=repository_action_common_download&item_id=27686&item_no=1&attribute_id=26&file_no=1', 'pdf_url': 'https://kanazawa-u.repo.nii.ac.jp/?action=repository_action_common_download&item_id=27686&item_no=1&attribute_id=26&file_no=1', 'source': {'id': 'https://openalex.org/S4306400882', 'display_name': 'Kanazawa University Repository for Academic Resources (DSpace) (Kanazawa University)', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I10091056', 'host_organization_name': 'Kanazawa University', 'host_organization_lineage': ['https://openalex.org/I10091056'], 'host_organization_lineage_names': ['Kanazawa University'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': 'submittedVersion', 'is_accepted': False, 'is_published': False}, {'is_oa': True, 'landing_page_url': 'https://kanazawa-u.repo.nii.ac.jp/?action=repository_action_common_download&item_id=38708&item_no=1&attribute_id=26&file_no=1', 'pdf_url': 'https://kanazawa-u.repo.nii.ac.jp/?action=repository_action_common_download&item_id=38708&item_no=1&attribute_id=26&file_no=1', 'source': {'id': 'https://openalex.org/S4306400882', 'display_name': 'Kanazawa University Repository for Academic Resources (DSpace) (Kanazawa University)', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I10091056', 'host_organization_name': 'Kanazawa University', 'host_organization_lineage': ['https://openalex.org/I10091056'], 'host_organization_lineage_names': ['Kanazawa University'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': 'submittedVersion', 'is_accepted': False, 'is_published': False}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/12904296', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m306736200', 'pdf_url': 'http://www.jbc.org/article/S0021925820828671/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 62, 'referenced_works': ['https://openalex.org/W1524048408', 'https://openalex.org/W1562667342', 'https://openalex.org/W1575139878', 'https://openalex.org/W1581404300', 'https://openalex.org/W1782613870', 'https://openalex.org/W1846470953', 'https://openalex.org/W1894541755', 'https://openalex.org/W1967005449', 'https://openalex.org/W1968817120', 'https://openalex.org/W1969111387', 'https://openalex.org/W1969959856', 'https://openalex.org/W1971244052', 'https://openalex.org/W1978007139', 'https://openalex.org/W1979390430', 'https://openalex.org/W1982461187', 'https://openalex.org/W1985083844', 'https://openalex.org/W1989636194', 'https://openalex.org/W1990306722', 'https://openalex.org/W1998572605', 'https://openalex.org/W2001668798', 'https://openalex.org/W2005616134', 'https://openalex.org/W2008588224', 'https://openalex.org/W2009021998', 'https://openalex.org/W2011111584', 'https://openalex.org/W2011980209', 'https://openalex.org/W2012104993', 'https://openalex.org/W2015600487', 'https://openalex.org/W2022065340', 'https://openalex.org/W2040674436', 'https://openalex.org/W2044127568', 'https://openalex.org/W2052626837', 'https://openalex.org/W2052798492', 'https://openalex.org/W2056631886', 'https://openalex.org/W2058825541', 'https://openalex.org/W2062784484', 'https://openalex.org/W2067142683', 'https://openalex.org/W2069200668', 'https://openalex.org/W2071355842', 'https://openalex.org/W2071790834', 'https://openalex.org/W2095465363', 'https://openalex.org/W2096924438', 'https://openalex.org/W2107983150', 'https://openalex.org/W2109647778', 'https://openalex.org/W2109658199', 'https://openalex.org/W2113266466', 'https://openalex.org/W2132079001', 'https://openalex.org/W2132290892', 'https://openalex.org/W2135299677', 'https://openalex.org/W2139117855', 'https://openalex.org/W2143573041', 'https://openalex.org/W2154304757', 'https://openalex.org/W2155093913', 'https://openalex.org/W2157675590', 'https://openalex.org/W2159959764', 'https://openalex.org/W2161625600', 'https://openalex.org/W2164131493', 'https://openalex.org/W2169829977', 'https://openalex.org/W2406159810', 'https://openalex.org/W4238444116', 'https://openalex.org/W4250338620', 'https://openalex.org/W4250908540', 'https://openalex.org/W746902434'], 'related_works': ['https://openalex.org/W3182249781', 'https://openalex.org/W2104853531', 'https://openalex.org/W2096724505', 'https://openalex.org/W2096372265', 'https://openalex.org/W2069272506', 'https://openalex.org/W2017759366', 'https://openalex.org/W1999315026', 'https://openalex.org/W1989903743', 'https://openalex.org/W1593371871', 'https://openalex.org/W1472721655'], 'abstract_inverted_index': {'The': [0, 220, 716, 840, 2221, 2287, 2330, 2625, 2724, 2841, 3064, 3416, 3685, 3760, 3813, 4080, 4250, 4654, 5067], 'transmembrane': [1, 221, 442, 3093], 'heparan': [2, 222, 443, 900, 3094], 'sulfate': [3, 223, 444, 901, 3095], 'proteoglycan': [4, 224, 902, 3096], 'syndecan-1': [5, 35, 40, 46, 68, 76, 95, 107, 133, 170, 186, 205, 225, 255, 260, 266, 288, 296, 315, 327, 353, 390, 406, 425, 780, 1816, 1827, 2084, 2207, 2307, 2390, 2399, 2408, 2426, 2466, 2595, 2611, 2797, 3097, 3118, 3134, 3153, 3189, 3207, 3227, 3249, 3264, 3309, 3333, 3362, 3386, 3398, 3423, 3430, 3456, 3473, 3491, 3519, 3542, 3555, 3594, 3604, 3639, 3651, 3662, 3717, 3745, 3836, 3863, 3904, 3953, 3969, 3986, 3990, 3998, 4036, 4055, 4171, 4237, 4253, 4411, 4464, 4503, 4630, 4640, 4651, 4657, 4694, 4703, 4734, 4749, 4765, 4805, 4865, 4880, 4956, 4995, 5015, 5052, 5081, 5091, 5136, 5255, 5362, 5403, 5612, 5719, 5733, 5742], 'was': [6, 47, 82, 96, 110, 150, 226, 267, 302, 316, 330, 370, 1655, 1837, 1863, 1984, 2036, 2087, 2124, 2139, 2208, 2223, 2248, 2289, 2310, 2391, 2467, 2524, 2531, 2550, 2601, 2605, 2629, 2679, 2729, 2738, 2762, 2802, 2849, 2963, 3071, 3082, 3119, 3142, 3162, 3176, 3208, 3342, 3404, 3425, 3437, 3496, 3673, 3679, 3705, 3751, 3764, 3789, 3794, 3865, 3913, 3935, 3958, 4002, 4023, 4041, 4065, 4101, 4115, 4136, 4206, 4224, 4241, 4261, 4277, 4300, 4510, 4652, 4659, 4710, 4723, 4814, 4997, 5085, 5645], 'identified': [7, 227, 1104, 1815, 4309, 4406], 'from': [8, 192, 228, 412, 849, 1666, 1838, 1865, 1954, 1971, 1987, 2005, 2141, 2764, 2957, 3040, 3183, 3197, 3394, 3526, 3948, 3999, 4020, 4217, 4229, 4768, 5123, 5657, 5712], 'a': [9, 20, 229, 240, 518, 1027, 1818, 1985, 2134, 2258, 2277, 2555, 2575, 2594, 2683, 2768, 2890, 2995, 3002, 3009, 3018, 3047, 3123, 3137, 3193, 3380, 3454, 3654, 3693, 3765, 3803, 3807, 3847, 3929, 3941, 4263, 4552, 4567, 4771, 4820, 5148, 5651], 'human': [10, 230, 1158, 1853, 2959, 4864], 'placenta': [11, 231, 1854, 2960], 'cDNA': [12, 134, 232, 354, 1106, 1855, 2409, 2544, 2591, 2612, 2684, 2954, 2961, 2970, 2990, 3021, 3035, 3042, 3069, 3080, 3090, 3424, 3864], 'library': [13, 233, 1856, 2962], 'by': [14, 71, 79, 84, 88, 99, 103, 115, 207, 234, 291, 299, 304, 308, 319, 323, 335, 427, 504, 732, 1105, 1171, 1474, 1725, 1828, 1848, 2148, 2291, 2341, 2403, 2552, 2607, 2681, 2740, 2767, 2979, 3046, 3105, 3112, 3114, 3164, 3251, 3312, 3335, 3344, 3365, 3371, 3400, 3407, 3493, 3498, 3505, 3660, 3707, 3822, 3837, 3915, 3937, 4005, 4009, 4013, 4026, 4033, 4118, 4190, 4200, 4258, 4304, 4320, 4430, 4463, 4508, 4634, 4713, 4718, 4725, 4737, 4743, 4752, 4756, 4806, 4833, 4856, 4886, 5059, 5065, 5408, 5717], 'the': [15, 67, 122, 132, 172, 202, 210, 235, 287, 342, 352, 392, 422, 430, 634, 646, 652, 665, 1222, 1229, 1379, 1382, 1414, 1568, 1594, 1667, 1715, 1859, 1881, 2026, 2111, 2142, 2342, 2638, 2689, 2693, 2735, 2765, 2784, 2791, 2852, 2958, 3028, 3058, 3075, 3079, 3092, 3115, 3150, 3188, 3206, 3220, 3234, 3241, 3246, 3345, 3356, 3422, 3441, 3447, 3479, 3499, 3506, 3517, 3559, 3570, 3619, 3627, 3643, 3670, 3708, 3711, 3725, 3732, 3736, 3741, 3768, 3774, 3818, 3829, 3952, 3973, 3993, 4057, 4104, 4119, 4157, 4165, 4233, 4268, 4321, 4402, 4410, 4417, 4422, 4427, 4448, 4461, 4500, 4646, 4682, 4688, 4698, 4800, 4815, 4842, 4849, 4900, 5131, 5427, 5618, 5630, 5634, 5658, 5708, 5760, 5768, 5791], 'expression': [16, 236, 635, 781, 804, 1226, 1709, 1861, 2081, 2304, 2737, 3116, 3341, 3367, 3500, 3507, 4192, 4202, 4322, 4408, 4504, 4517, 4835, 4858, 4954, 4996, 5137, 5256, 5417], 'cloning': [17, 237, 1710, 2022, 4323], 'method': [18, 238, 1711, 2343], 'as': [19, 239, 537, 894, 930, 1730, 1817, 1886, 2038, 2153, 2257, 2276, 2327, 2393, 2490, 2696, 3136, 3192, 3267, 3940, 4011, 4314, 4566, 5751], 'gene': [21, 241, 803, 4412], 'product': [22, 242, 3688, 3763], 'that': [23, 154, 201, 243, 374, 421, 659, 1032, 1824, 3088, 3218, 3370, 3377, 3391, 3516, 3574, 3599, 3610, 3716, 3946, 3947, 4211, 4228, 4244, 4281, 4316, 4407, 4514, 4674, 4748, 4841, 5071, 5402, 5728], 'interacts': [24, 244], 'with': [25, 34, 52, 66, 131, 163, 176, 187, 245, 254, 272, 286, 351, 383, 396, 407, 791, 1228, 1289, 1877, 2015, 2031, 2089, 2126, 2225, 2237, 2250, 2267, 2312, 2407, 2435, 2450, 2454, 2482, 2526, 2559, 2579, 2603, 2631, 2731, 2760, 2804, 2874, 2889, 2965, 2985, 3144, 3160, 3187, 3240, 3258, 3421, 3433, 3446, 3451, 3461, 3465, 3478, 3532, 3573, 3603, 3653, 3666, 3675, 3721, 3755, 3791, 3796, 3844, 3911, 3983, 4050, 4145, 4175, 4182, 4267, 4318, 4513, 4639, 4662, 4666, 4702, 4827, 5009, 5018, 5147, 5264, 5371, 5426, 5614, 5623, 5721], 'membrane': [26, 246, 1117, 2218, 2222, 2836], 'type': [27, 247, 1115, 1118, 2455, 3534], 'matrix': [28, 248, 1008, 1015, 1038, 1174, 1298, 4893], 'metalloproteinase-1': [29, 249], '(MT1-MMP).': [30, 250], 'Co-expression': [31, 251, 3223, 3467, 4636], 'of': [32, 44, 50, 59, 94, 144, 155, 160, 169, 179, 183, 185, 204, 213, 252, 264, 270, 279, 314, 364, 375, 380, 389, 399, 403, 405, 424, 433, 506, 520, 636, 648, 664, 670, 721, 779, 843, 896, 1020, 1029, 1224, 1233, 1296, 1303, 1314, 1381, 1660, 1717, 1732, 1820, 1826, 2028, 2540, 2610, 2643, 2692, 2790, 2794, 2814, 2846, 2951, 2999, 3005, 3012, 3017, 3020, 3025, 3037, 3051, 3066, 3078, 3103, 3108, 3117, 3139, 3152, 3205, 3224, 3238, 3248, 3255, 3263, 3317, 3332, 3347, 3358, 3385, 3397, 3409, 3418, 3443, 3468, 3475, 3484, 3490, 3501, 3508, 3541, 3558, 3569, 3575, 3614, 3621, 3626, 3638, 3658, 3689, 3696, 3703, 3771, 3776, 3780, 3810, 3817, 3824, 3831, 3835, 3840, 3877, 3932, 3964, 3975, 3981, 3997, 4054, 4061, 4082, 4092, 4095, 4111, 4121, 4128, 4133, 4138, 4142, 4156, 4167, 4180, 4196, 4212, 4235, 4245, 4252, 4270, 4274, 4282, 4293, 4298, 4409, 4416, 4450, 4460, 4502, 4515, 4637, 4643, 4648, 4656, 4671, 4684, 4687, 4691, 4700, 4763, 4799, 4804, 4825, 4848, 4863, 4905, 4955, 5002, 5007, 5020, 5029, 5041, 5259, 5268, 5302, 5328, 5332, 5419, 5429, 5611, 5620, 5629, 5636, 5650, 5669, 5710, 5762, 5770, 5784, 5790], 'MT1-MMP': [33, 72, 117, 208, 253, 292, 337, 428, 1726, 1733, 1821, 1829, 1871, 2091, 2314, 2430, 2806, 2969, 2989, 3113, 3127, 3145, 3225, 3252, 3340, 3366, 3403, 3448, 3480, 3528, 3545, 3583, 3600, 3615, 3647, 3677, 3757, 3879, 4191, 4201, 4431, 4509, 4560, 4570, 4638, 4672, 4692, 4701, 4720, 4807, 4834, 4857, 5073, 5409, 5420, 5696, 5729], 'in': [36, 256, 501, 739, 782, 794, 1040, 1156, 1679, 1858, 2009, 2101, 2228, 2241, 2280, 2324, 2411, 2416, 2446, 2598, 2750, 2811, 2894, 2902, 3146, 3210, 3219, 3233, 3388, 3548, 3786, 3955, 3989, 3992, 4068, 4074, 4103, 4238, 4255, 4426, 4432, 4439, 4774, 4869, 4957, 5026, 5074, 5080, 5121, 5138, 5151, 5257, 5270, 5334, 5374, 5413, 5639, 5671, 5700, 5746], 'HEK293T': [37, 257, 1998], 'cells': [38, 51, 128, 146, 162, 194, 258, 271, 348, 366, 382, 414, 450, 650, 675, 742, 784, 851, 2002, 2099, 2130, 2322, 2396, 2405, 2444, 2863, 2866, 2898, 2910, 2993, 3161, 3185, 3239, 3257, 3390, 3410, 3419, 3444, 3459, 3476, 3871, 3912, 3926, 3966, 3982, 4001, 4022, 4029, 4071, 4076, 4097, 4114, 4135, 4144, 4219, 4240, 4247, 4257, 4276, 4284, 4441, 4910, 4961, 5008, 5033, 5049, 5076], 'promoted': [39, 70, 206, 259, 290, 426, 3650, 4414, 4641, 4736, 4832, 4855], 'shedding,': [41, 261, 3566, 3987, 4695], 'and': [42, 195, 262, 415, 492, 529, 533, 645, 667, 673, 729, 743, 749, 797, 800, 936, 1042, 1108, 1116, 1160, 1169, 1279, 1292, 1318, 1445, 1479, 1539, 1593, 1601, 1672, 1822, 1872, 1948, 1966, 1973, 1999, 2007, 2073, 2129, 2213, 2234, 2261, 2333, 2389, 2429, 2477, 2574, 2633, 2635, 2640, 2734, 2747, 2823, 2831, 2900, 2916, 2968, 2974, 2988, 3008, 3074, 3128, 3149, 3167, 3229, 3314, 3322, 3329, 3402, 3609, 3648, 3678, 3692, 3753, 3903, 3917, 3951, 3971, 4048, 4126, 4154, 4172, 4232, 4312, 4456, 4645, 4728, 4739, 4897, 4902, 4908, 4966, 5005, 5046, 5054, 5153, 5226, 5253, 5325, 5330, 5421, 5557, 5562, 5617, 5663, 5704, 5715, 5731, 5757, 5772], 'concentration': [43, 263, 3954, 4251, 4459, 4647], 'cell-associated': [45, 265, 3976, 4236, 4271], 'reduced.': [48, 268, 4653], 'Treatment': [49, 159, 269, 379, 3237, 3254, 3450, 4141], 'MMP': [53, 60, 273, 280, 1225, 1304, 3242, 3318, 5010], 'inhibitor': [54, 58, 274, 278, 1019, 3243], 'BB-94': [55, 85, 164, 275, 305, 384, 3244, 3452, 3984, 4051, 4122, 4146, 4259, 4290, 4727, 5062], 'or': [56, 91, 118, 165, 276, 311, 338, 385, 1231, 1312, 1472, 2034, 2092, 2145, 2315, 2437, 2864, 3157, 3339, 3463, 3470, 3510, 3563, 3826, 3909, 4123, 4147, 4203, 4721, 4808, 4836, 4859, 5061], 'tissue': [57, 277, 502, 1018, 5139, 5261], '(TIMP)-2': [61, 281], 'but': [62, 86, 101, 282, 306, 321, 939, 1727, 3349, 3368, 3482, 3503, 3567, 3806, 4007, 4072, 4084, 4296, 4563, 4664, 5063], 'not': [63, 87, 102, 283, 307, 322, 1719, 3062, 3369, 3504, 3553, 3580, 3801, 3856, 4008, 4073, 4078, 4085, 4301, 4519, 4557, 4665, 5064, 5118, 5129], 'TIMP-1': [64, 90, 284, 310, 3350, 3485, 3509, 4010, 4086, 5127], 'interfered': [65, 285], 'shedding': [69, 77, 191, 203, 289, 297, 411, 423, 921, 941, 1659, 1825, 3151, 3228, 3247, 3262, 3310, 3363, 3387, 3520, 3540, 3620, 3637, 3652, 3970, 3996, 4019, 4188, 4216, 4642, 4658, 4683, 4709, 4716, 4735, 4750, 4762, 4831, 4854, 5092, 5122, 5610, 5649, 5718, 5743, 5763], 'expression.': [73, 293, 3253], 'In': [74, 294, 1810, 3354, 3978, 4401, 4992, 5723], 'contrast,': [75, 295, 3355, 3979], 'induced': [78, 98, 167, 298, 318, 387, 2739, 3053, 3311, 3334, 3364, 3399, 3967, 4052, 4199, 4751], '12-O-tetradecanoylphorbol-13-acetate': [80, 300], 'treatment': [81, 301, 3338, 3495, 3963, 3980, 4049, 4205, 4260, 5006], 'inhibited': [83, 303, 3343, 4024, 4117, 4724, 4742], 'either': [89, 309, 2090, 2313, 3336, 4719], 'TIMP-2.': [92, 312, 3511], 'Shedding': [93, 313, 3102, 3331, 3396, 3859, 4163, 4195], 'also': [97, 317, 1477, 1728, 3260, 3405, 3438, 3590, 4003, 4031, 4413, 4564, 4632, 4660, 4711, 5086, 5424, 5549, 5698], 'MT3-MMP': [100, 119, 320, 339, 1873, 3649, 3845, 4809], 'other': [104, 324, 3624, 3852, 4667, 4758], 'MT-MMPs.': [105, 325, 4668], 'Recombinant': [106, 326, 1870, 1946, 2541], 'core': [108, 328, 4775], 'protein': [109, 329, 2597, 2678, 2736, 2758, 2799, 3664, 3719, 3747, 3785, 3843, 4776], 'shown': [111, 331, 1656, 4012, 4998, 5646, 5727], 'to': [112, 332, 496, 509, 517, 639, 651, 746, 786, 923, 925, 1035, 1164, 1166, 1284, 1469, 1657, 1676, 1712, 2023, 2110, 2783, 2833, 2896, 3027, 3057, 3199, 3523, 3538, 3592, 3635, 3735, 3749, 4152, 4421, 4561, 4627, 4867, 4875, 4891, 4999, 5036, 5089, 5144, 5368, 5551, 5553, 5647, 5667, 5707, 5767], 'be': [113, 333, 640, 1111, 1285, 1470, 4876, 5057, 5119, 5145, 5369, 5400, 5406, 5627], 'cleaved': [114, 334, 3730, 4633, 4882], 'recombinant': [116, 336, 2805, 3359, 3676, 3744, 3756, 3797, 4812], 'preferentially': [120, 340, 3729], 'at': [121, 341, 1880, 2566, 2586, 2688, 2817, 2919, 3669, 3724, 3731, 4262, 4770, 4883, 5364], 'Gly245-Leu246': [123, 214, 343, 434, 3777, 4168, 4816, 4843, 4862], 'peptide': [124, 215, 344, 435, 3778, 3833, 4817, 4844], 'bond.': [125, 345], 'HT1080': [126, 157, 346, 377, 2001, 2395, 2862, 3869, 4113, 4218, 5003, 5032, 5075, 5124], 'fibrosarcoma': [127, 347, 2000, 3870], 'stably': [129, 349, 2397, 3866, 4220], 'transfected': [130, 350, 2406, 3186, 3420, 3867], '(HT1080/SDC),': [135, 355, 3872], 'which': [136, 356, 1670, 1718, 2029, 2599, 2620, 3052, 3213, 3772, 3787, 3799, 3873, 3934, 4624, 4696, 5024, 5661, 5735], 'express': [137, 357, 3874], 'endogenous': [138, 358, 3382, 3878, 4436, 5072], 'MT1-MMP,': [139, 359, 1276, 2035, 3315, 3798, 4457, 4738, 5044], 'spontaneously': [140, 360, 3177], 'shed': [141, 361, 848, 3178, 3905, 3928, 5051, 5407, 5621], 'syndecan-1.': [142, 362, 3129, 3622, 3781, 3977, 4093, 4214, 4685, 4871], 'Migration': [143, 363, 2860, 4132], 'HT1080/SDC': [145, 161, 193, 365, 381, 413, 3925, 3965, 4000, 4021, 4028, 4045, 4070, 4096, 4134, 4143, 4159, 4230, 4246, 4283, 4294, 5048], 'on': [147, 171, 367, 391, 447, 2210, 2828, 3440, 3458, 3681, 4044, 4056, 4098, 4505, 5739], 'collagen-coated': [148, 368, 4099], 'dishes': [149, 369, 2103, 2449, 2872, 4100], 'significantly': [151, 189, 371, 409, 4087, 4207, 4278, 4302, 4829], 'slower': [152, 372, 3216, 3945, 4279], 'than': [153, 373, 1098, 3201, 3217, 4210, 4227, 4243, 4280, 4759], 'control': [156, 376, 2093, 2316, 2438], 'cells.': [158, 378, 3994, 4140, 4434], 'TIMP-2': [166, 386, 1947, 3323, 3360, 3469, 4006, 4083, 4124, 4148, 4437, 4731, 5060], 'accumulation': [168, 388, 3991, 4053], 'cell': [173, 180, 196, 218, 393, 400, 416, 438, 751, 795, 898, 1315, 1831, 2146, 2334, 2975, 3211, 3235, 3611, 3956, 4046, 4058, 4089, 4649, 4676, 5013, 5030, 5135, 5198, 5272, 5304, 5737], 'surface,': [174, 394, 1669, 4047, 5660], 'concomitant': [175, 395, 5017], 'further': [177, 397, 2135, 2906, 3514, 3968, 4149, 5027], 'retardation': [178, 398, 5028], 'migration.': [181, 197, 219, 401, 417, 439, 1832, 5031], 'Substitution': [182, 402], 'Gly245': [184, 404, 2600, 3788, 4181, 4826], 'Leu': [188, 408, 2604, 3792, 4183, 4828], 'reduced': [190, 410, 3230, 3972, 4830], 'These': [198, 418, 3374, 3512, 3596, 4745], 'results': [199, 419, 3375, 3513, 3597, 4746, 4767], 'suggest': [200, 420, 3598], 'through': [209, 429, 3605, 4164, 4447, 4704], 'preferential': [211, 431], 'cleavage': [212, 432, 3742, 3775, 3830, 4769, 4802, 4851], 'bond': [216, 436, 3779, 3834, 4818, 4845], 'stimulates': [217, 437, 1830], 'Syndecans': [440, 5547], 'are': [441, 661, 1026, 1033, 1154, 4442, 5034, 5423, 5548], 'proteoglycans': [445], 'expressed': [446, 5412, 5699], 'all': [448, 3067], 'adherent': [449], '(1Bernfield': [451, 753], 'M.': [452, 454, 464, 545, 560, 593, 677, 681, 705, 754, 756, 766, 822, 859, 878, 905, 988, 1085, 1122, 1240, 1242, 1257, 1261, 1265, 1329, 1355, 1357, 1420, 1428, 1745, 1765, 1792, 1798, 1902, 1932, 2052, 2188, 2355, 2372, 2504, 2653, 2659, 2706, 2712, 2932, 2938, 3279, 3893, 4336, 4356, 4383, 4389, 4480, 4532, 4572, 4584, 4603, 4613, 4786, 4912, 4916, 4940, 4972, 4976, 5159, 5163, 5180, 5182, 5206, 5208, 5280, 5282, 5340, 5346, 5382, 5439, 5443, 5447, 5458, 5468, 5491, 5499, 5535, 5583], 'Gotte': [453, 755], 'Park': [455, 757, 983, 1684, 2350, 3274, 4781, 5095, 5676], 'P.W.': [456, 556, 758, 984, 1685, 2351, 3275, 4782, 5096, 5677], 'Reizes': [457, 557, 759], 'O.': [458, 558, 760, 1543], 'Fitzgerald': [459, 761, 2369], 'M.L.': [460, 762, 980, 2347, 2370, 3271, 4778], 'Lincecum': [461, 763], 'J.': [462, 561, 579, 622, 685, 764, 872, 908, 967, 989, 1075, 1137, 1359, 1429, 1457, 1498, 1526, 1552, 1617, 1748, 1775, 1903, 1936, 2055, 2171, 2196, 2356, 2373, 2507, 3280, 3298, 3887, 4339, 4366, 4483, 4535, 4585, 4615, 4787, 4920, 5167, 5237, 5239, 5243, 5315, 5350, 5470, 5569, 5598], 'Zako': [463, 765], 'Annu.': [465, 690, 767, 1209, 4925], 'Rev.': [466, 691, 768, 1060, 1191, 1210, 4926], 'Biochem.': [467, 769, 968, 1937, 3297], '1999;': [468, 770, 971, 1087, 1124, 1140, 1334, 1938, 2198, 5169, 5504], '68:': [469, 771], '729-777Crossref': [470, 772], 'PubMed': [471, 487, 550, 572, 585, 601, 615, 628, 697, 711, 773, 814, 835, 866, 889, 917, 959, 974, 995, 1067, 1079, 1090, 1127, 1148, 1198, 1216, 1342, 1374, 1409, 1440, 1464, 1509, 1535, 1563, 1588, 1628, 1649, 1699, 1759, 1805, 1914, 1941, 2066, 2201, 2362, 2384, 2518, 2666, 2719, 2945, 3286, 3302, 3898, 4350, 4396, 4494, 4546, 4591, 4619, 4793, 4932, 4946, 4987, 5110, 5172, 5192, 5221, 5248, 5295, 5320, 5355, 5475, 5521, 5542, 5575, 5591, 5604, 5691], 'Scopus': [472, 488, 551, 573, 586, 602, 616, 629, 698, 712, 774, 815, 836, 867, 890, 960, 975, 996, 1068, 1080, 1091, 1128, 1149, 1199, 1217, 1343, 1375, 1410, 1441, 1510, 1564, 1589, 1629, 1700, 1760, 1806, 1915, 1942, 2067, 2202, 2363, 2385, 2519, 2667, 2720, 2946, 3287, 3303, 3899, 4351, 4397, 4495, 4547, 4592, 4620, 4794, 4933, 4947, 4988, 5111, 5173, 5193, 5222, 5249, 5296, 5321, 5356, 5476, 5522, 5543, 5576, 5592, 5605, 5692], '(2361)': [473, 775], 'Google': [474, 490, 553, 575, 588, 604, 618, 631, 700, 714, 776, 817, 838, 869, 892, 918, 962, 977, 998, 1070, 1082, 1093, 1130, 1151, 1201, 1219, 1250, 1273, 1345, 1377, 1412, 1443, 1465, 1512, 1536, 1566, 1591, 1631, 1650, 1702, 1762, 1783, 1808, 1917, 1944, 2069, 2181, 2204, 2365, 2387, 2521, 2669, 2722, 2948, 3289, 3305, 3901, 4353, 4374, 4399, 4497, 4549, 4594, 4622, 4796, 4935, 4949, 4990, 5113, 5175, 5195, 5224, 5251, 5298, 5323, 5358, 5396, 5455, 5478, 5507, 5524, 5545, 5578, 5594, 5607, 5694], 'Scholar,': [475, 554, 576, 589, 605, 619, 701, 818, 870, 963, 978, 1071, 1083, 1131, 1202, 1251, 1632, 1763, 1784, 1918, 2182, 2366, 3290, 4354, 4375, 4595, 4936, 5176, 5456, 5479, 5508, 5525, 5579, 5595], '2Rapraeger': [476], 'A.C.': [477, 578, 607, 806, 5568], 'Ott': [478], 'V.L.': [479], 'Curr.': [480, 1332], 'Opin.': [481], 'Cell.': [482, 580, 862, 1690, 5101, 5570, 5682], 'Biol.': [483, 562, 581, 597, 611, 693, 810, 861, 909, 952, 991, 1062, 1138, 1193, 1212, 1333, 1430, 1499, 1527, 1553, 1618, 1749, 1904, 2056, 2358, 2374, 2508, 3282, 4340, 4484, 4536, 4587, 4789, 4928, 5571, 5587], '1998;': [484, 953, 1906, 5245], '10:': [485], '620-628Crossref': [486], '(102)': [489, 603, 5593], 'Scholar)': [491, 893, 1466], 'have': [493, 1102, 1161, 1281, 1706, 1814, 4308, 5726], 'been': [494, 657, 1103, 1162, 1282, 5142], 'proposed': [495, 658], 'play': [497], 'an': [498, 787, 1300, 1708, 2080, 2303, 2560, 2580, 4176, 4963], 'important': [499, 662, 1301, 5631], 'role': [500], 'morphogenesis': [503], 'virtue': [505], 'their': [507, 512, 3536, 3633, 5637], 'ability': [508], 'bind,': [510], 'via': [511, 5559], 'covalently': [513], 'attached': [514], 'glycosaminoglycan': [515, 5560], 'chains,': [516], 'variety': [519], 'extracellular': [521, 1037, 1173, 1297, 4892], 'adhesive': [522], 'molecules': [523, 532, 4315], 'including': [524, 3851, 4895, 5043, 5431], 'fibronectin,': [525], 'thrombospondin,': [526], 'various': [527, 1157, 5554, 5640], 'collagens,': [528], 'heparin-binding': [530, 1415], 'growth-associated': [531], 'growth': [534, 540, 1384, 1417, 1515, 4967, 5555, 5713], 'factors': [535, 5556, 5616, 5625, 5714], 'such': [536, 929, 5750], 'basic': [538], 'fibroblast': [539, 1383], 'factor': [541, 1385, 1418, 1540], '(3Perrimon': [542], 'N.': [543, 591, 2161, 4601, 5581], 'Bernfield': [544, 559, 592, 858, 877, 987, 2354, 2371, 3278, 4785, 5345, 5582], 'Nature.': [546, 1370, 3894], '2000;': [547, 564, 582, 832, 992, 1461, 1555, 1585, 2359, 3283, 4790, 5317, 5518, 5572], '404:': [548], '725-728Crossref': [549], '(667)': [552], '4Park': [555], 'Chem.': [563, 910, 951, 1139, 1431, 1500, 1528, 1554, 1619, 1750, 1905, 2057, 2375, 2509, 4341, 4485, 4537], '275:': [565, 1556], '29923-29926Abstract': [566], 'Full': [567, 569, 914, 956, 1143, 1145, 1337, 1339, 1435, 1437, 1504, 1506, 1532, 1558, 1560, 1623, 1625, 1694, 1696, 1754, 1756, 1909, 1911, 2061, 2063, 2379, 2381, 2513, 2515, 4345, 4347, 4489, 4491, 4541, 4543, 5105, 5107, 5216, 5218, 5290, 5292, 5686, 5688], 'Text': [568, 570, 915, 957, 1144, 1146, 1338, 1340, 1436, 1438, 1505, 1507, 1533, 1559, 1561, 1624, 1626, 1695, 1697, 1755, 1757, 1910, 1912, 2062, 2064, 2380, 2382, 2514, 2516, 4346, 4348, 4490, 4492, 4542, 4544, 5106, 5108, 5217, 5219, 5291, 5293, 5687, 5689], 'PDF': [571, 916, 958, 1147, 1341, 1439, 1508, 1534, 1562, 1627, 1698, 1758, 1913, 2065, 2383, 2517, 4349, 4493, 4545, 5109, 5220, 5294, 5690], '(316)': [574], '5Rapraeger': [577], '149:': [583, 5573], '995-998Crossref': [584, 5574], '(177)': [587, 5577], '6Perrimon': [590, 5580], 'Semin.': [594, 608, 807, 5584], 'Cell': [595, 609, 692, 808, 830, 990, 1211, 1994, 2357, 3281, 3861, 4586, 4788, 4927, 5585], 'Dev.': [596, 610, 809, 5586], '2001;': [598, 612, 625, 811, 1620, 1751, 1780, 2058, 2510, 4342, 4371, 4486, 4538, 4588, 5213, 5287, 5539, 5588, 5601], '12:': [599, 613, 812, 5589], '65-67Crossref': [600, 5590], '7Rapraeger': [606], '107-116Crossref': [614, 813], '(109)': [617, 816], '8Woods': [620, 5596], 'A.': [621, 824, 828, 885, 965, 1056, 1187, 1396, 1405, 1454, 1483, 1485, 1545, 1547, 1549, 1767, 1894, 2173, 2194, 3889, 4358, 4580, 4983, 5157, 5202, 5276, 5338, 5380, 5597], 'Clin.': [623, 5599], 'Invest.': [624, 5600], '107:': [626, 1088, 1125, 5602], '935-941Crossref': [627, 5603], '(115)': [630, 5606], 'Scholar).': [632, 715, 777, 839, 919, 999, 1094, 1152, 1220, 1274, 1651, 1703, 1809, 1945, 2070, 2205, 2522, 2670, 2723, 2949, 3306, 4400, 4498, 4550, 4797, 4950, 4991, 5359, 5397, 5546, 5608, 5695], 'Since': [633, 4435, 5741], 'syndecans': [637, 660], 'appears': [638, 922, 5117], 'controlled': [641], 'during': [642], 'both': [643, 671, 747, 4726, 4906], 'development': [644, 5769], 'progression': [647], 'tumor': [649, 1167, 1290, 1347, 4960, 5414, 5752], 'metastatic': [653], 'phenotype,': [654], 'it': [655, 3121], 'has': [656, 1308, 5141], 'regulators': [663], 'migratory': [666, 4901], 'invasive': [668, 4903], 'behaviors': [669], 'normal': [672, 740, 897, 1041, 4907], 'transformed': [674, 2730, 4909], '(9Bernfield': [676, 4911], 'Kokenyesi': [678, 4913], 'R.': [679, 1367, 1390, 4914, 5186, 5384, 5516], 'Kato': [680, 2162, 4915], 'Hinkes': [682, 4917], 'M.T.': [683, 4918], 'Spring': [684, 4919], 'Gallo': [686, 856, 4921, 5343], 'R.L.': [687, 857, 4922, 5344], 'Lose': [688, 4923], 'E.J.': [689, 950, 4924], '1992;': [694, 911, 4929, 4984], '8:': [695, 4930], '365-393Crossref': [696, 4931], '(988)': [699, 4934], '10Inki': [702, 4937], 'P.': [703, 1353, 1452, 4938, 5161, 5184, 5204, 5278], 'Jalkanen': [704, 4939, 4975, 5162, 5181, 5207, 5281], 'Ann.': [706, 4941], 'Med.': [707, 1063, 1194, 4942], '1996;': [708, 1406, 1501, 4943], '28:': [709, 4944], '63-67Crossref': [710, 4945], '(105)': [713, 4948, 5250], 'syndecan': [717, 845], 'family': [718, 1028, 3629], 'is': [719, 737, 846, 942, 1299, 3392, 3521, 3616, 3728, 4631, 4679, 4754, 4846, 4881, 5077, 5262, 5697, 5744], 'composed': [720], 'four': [722, 733], 'closely': [723, 1287], 'related': [724], 'proteins': [725, 1039, 1517, 2776, 4813, 4894], '(syndecan-1,': [726], '-2,': [727], '-3,': [728], '-4)': [730], 'encoded': [731], 'different': [734, 3393, 3525], 'genes.': [735], 'Syndecan-1': [736, 2138, 2247, 2542, 2757, 2773, 2795, 3104, 3141, 3175, 3435, 3659, 3858, 4040, 4162, 4707, 4715], 'abundant': [738], 'epithelial': [741, 788, 4958, 4964], 'tissues,': [744], 'localizing': [745], 'basal': [748, 5303], 'suprabasal': [750], 'layers': [752], 'Disruption': [778], 'cultured': [783, 850, 2008, 2100, 2323, 2445, 2901], 'leads': [785], 'mesenchymal': [789], 'transformation,': [790], 'associated': [792, 1288, 3910, 5146, 5263, 5370, 5425], 'changes': [793], 'polarity': [796], 'cell-cell': [798], 'adhesion': [799], 'altered': [801], 'epithelium-specific': [802], '(7Rapraeger': [805], '11Dobra': [819], 'K.': [820, 1259, 1523, 1898, 2159, 2165, 5233, 5441, 5489, 5501, 5510, 5514, 5537], 'Andang': [821], 'Syrokou': [823], 'Karamanos': [825], 'N.K.': [826], 'Hjerpe': [827], 'Exp.': [829], 'Res.': [831, 1246, 1269, 1779, 2177, 4370, 5392, 5451, 5503], '258:': [833], '12-22Crossref': [834], '(65)': [837], 'intact': [841], 'ectodomain': [842, 1380, 3663, 3718, 3746, 4708, 4766, 5404], 'each': [844, 2847, 2923], 'constitutively': [847, 5050], '(12Kim': [852], 'C.W.': [853], 'Goldberger': [854], 'O.A.': [855], 'Mol.': [860], '1994;': [863, 886, 1371, 1529, 3895], '5:': [864, 954, 1077], '797-805Crossref': [865], '(358)': [868], '13Spring': [871], 'Paine-Saunders': [873], 'S.E.': [874], 'Hynes': [875], 'R.O.': [876], 'Proc.': [879, 1399, 4977], 'Natl.': [880, 1400, 4978], 'Acad.': [881, 1401, 4979], 'Sci.': [882, 1402, 4980], 'U.': [883, 1403, 4981], 'S.': [884, 1206, 1404, 4970, 4982, 5229, 5390, 5462, 5487, 5529], '91:': [887, 5540], '3334-3338Crossref': [888], '(122)': [891, 5523], 'part': [895], 'surface': [899, 1316, 3417, 3442, 3612, 4090, 4650, 4677, 5014], 'turnover': [903], '(14Yanagishita': [904], 'Hascall': [906], 'V.C.': [907], '267:': [912], '9451-9454Abstract': [913], 'Ectodomain': [920], 'contribute': [924, 1165, 5706, 5766], 'diverse': [926, 5701, 5747], 'pathophysiological': [927, 5641, 5702], 'events': [928, 5749], 'host': [931], 'defense,': [932], 'wound': [933, 5754], 'healing,': [934, 5755], 'arthritis,': [935, 5756], "Alzheimer's": [937, 5758], 'disease,': [938, 5759], 'how': [940], 'regulated': [943], 'remains': [944, 4874], 'largely': [945], 'unknown': [946], '(15Kiessling': [947], 'L.L.': [948], 'Gordon': [949, 1368], 'R49-R62Abstract': [955], '(32)': [961], '16Merlos-Suarez': [964], 'Arribas': [966], 'Soc.': [969], 'Trans.': [970], '27:': [972], '243-246Crossref': [973], '(17)': [976], '17Fitzgerald': [979], 'Wang': [981, 2348, 3272, 4779], 'Z.': [982, 2349, 3273, 4780], 'Murphy': [985, 2352, 3276, 4783], 'G.': [986, 1422, 1459, 2353, 3277, 4784], '148:': [993, 2360, 3284, 4791], '811-824Crossref': [994, 2361, 3285, 4792], '(352)': [997, 2364, 3288, 4795], 'Matrix': [1000], 'metalloproteinases': [1001], '(MMPs)': [1002], '1The': [1003], 'abbreviations': [1004], 'used': [1005], 'are:': [1006], 'MMP,': [1007], 'metalloproteinase;': [1009, 1016, 1021], 'GST,': [1010], 'glutathione': [1011], 'S-transferase;': [1012], 'MT-MMP,': [1013], 'membrane-type': [1014], 'TIMP,': [1017], 'TPA,': [1022], '12-O-tetradecanoylphorbol-13-acetate;': [1023], 'BB-94,': [1024, 3320, 3348], '[4-(N-hydroxyamino)-2R-iso-butyl-3-S-(thienylthiomethyl)-succinyl]-l-phenylalanine-N-methylamide.': [1025], 'Zn2+-dependent': [1030], 'enzymes': [1031], 'known': [1034, 5035, 5550], 'cleave': [1036, 1478], 'pathological': [1043, 5748], 'conditions': [1044, 5703], '(18Birkedal': [1045, 1176], 'H.H.': [1046, 1177], 'Moore': [1047, 1178], 'W.G.': [1048, 1179], 'Bodden': [1049, 1180], 'M.K.': [1050, 1181], 'Windsor': [1051, 1182], 'L.J.': [1052, 1183], 'Birkedal': [1053, 1184], 'H.B.': [1054, 1185], 'DeCarlo': [1055, 1186], 'Engler': [1057, 1188], 'J.A.': [1058, 1189], 'Crit.': [1059, 1190], 'Oral': [1061, 1192], '1993;': [1064, 1195, 1213], '4:': [1065, 1196], '197-250Crossref': [1066, 1197], '(2677)': [1069, 1200], '19Woessner': [1072], 'J.F.J.': [1073], 'FASEB': [1074], '1991;': [1076], '2145-2154Crossref': [1078], '(3125)': [1081], '20Seiki': [1084], 'APMIS.': [1086, 1123], '137-143Crossref': [1089, 1126], '(276)': [1092, 1129], 'To': [1095, 3307, 3739], 'date,': [1096], 'more': [1097, 3200], '20': [1099], 'mammalian': [1100], 'MMPs': [1101, 1119, 1153, 1476, 4319], 'cloning,': [1107], 'they': [1109], 'can': [1110], 'subgrouped': [1112], 'into': [1113, 2097, 2320, 2442, 2637, 2971, 2991, 3154, 3180, 3868, 3906], 'soluble': [1114], '(MT-MMPs)': [1120], '(20Seiki': [1121], '21Nagase': [1132], 'H.': [1133, 1236, 1238, 1253, 1255, 1263, 1489, 1525, 1551, 1735, 1741, 1747, 1771, 1777, 1788, 1790, 1800, 1892, 1922, 1930, 2042, 2048, 2054, 2163, 2167, 2494, 2500, 2506, 2649, 2651, 2661, 2702, 2704, 2714, 2928, 2930, 2940, 3881, 4326, 4332, 4338, 4362, 4368, 4379, 4381, 4391, 4470, 4476, 4482, 4522, 4528, 4534, 4578, 4582, 4597, 4607, 4609, 5165, 5210, 5284, 5378, 5386, 5435, 5437, 5445, 5460, 5481, 5527], 'Woessner': [1134], 'Jr.,': [1135], 'J.F.': [1136], '274:': [1141], '21491-21494Abstract': [1142], '(3937)': [1150], 'overexpressed': [1155], 'malignancies': [1159], 'thought': [1163], 'invasion': [1168, 1291], 'metastasis': [1170], 'degrading': [1172], 'components': [1175], '22Stetler': [1203], 'S.W.': [1204], 'Aznavoorian': [1205], 'Liotta': [1207], 'L.A.': [1208], '9:': [1214, 1335], '541-573Crossref': [1215], '(1536)': [1218], 'Thus,': [1221, 3130, 5609], 'level': [1223, 3232, 3931, 3974, 4234, 4269], 'correlates': [1227], 'invasiveness': [1230], 'malignancy': [1232, 5428], 'tumors': [1234, 5430], '(23Nomura': [1235], 'Sato': [1237, 1262, 1746, 1776, 1799, 1891, 1929, 2053, 2505, 2660, 2713, 2939, 4337, 4367, 4390, 4481, 4533, 4606, 5444, 5459], 'Seiki': [1239, 1264, 1744, 1797, 1901, 1931, 2051, 2503, 2658, 2711, 2937, 3892, 4335, 4388, 4479, 4531, 4583, 4612, 5446, 5467], 'Mai': [1241], 'Okada': [1243, 1266, 1795, 1893, 1899, 1933, 2656, 2709, 2935, 3884, 4386, 4579, 5448, 5463], 'Y.': [1244, 1267, 1487, 1495, 1497, 1739, 1743, 1796, 1900, 1926, 1928, 1934, 2046, 2050, 2498, 2502, 2657, 2710, 2936, 3885, 4330, 4334, 4387, 4474, 4478, 4526, 4530, 4574, 4605, 5342, 5348, 5449, 5464, 5466, 5483, 5493, 5497], 'Cancer': [1245, 1268, 1778, 2176, 4369, 5391, 5450, 5502], '1995;': [1247, 2178, 5472], '55:': [1248, 2179], '3263-3266PubMed': [1249], '24Ueno': [1252], 'Nakamura': [1254, 1921, 5436, 5513], 'Inoue': [1256, 5438], 'Imai': [1258, 1897, 5440, 5500, 5536], 'Noguchi': [1260, 5442], '1997;': [1270, 1432, 2376, 3299, 5189, 5352, 5452], '57:': [1271, 5453], '2055-2060PubMed': [1272, 5454], 'Particularly,': [1275], 'MMP-2,': [1277, 2032, 2966, 2986, 5045], 'MMP-7,': [1278], 'MMP-9': [1280], 'reported': [1283, 1468, 3268, 5088, 5367], 'most': [1286], 'metastasis.': [1293], 'Whereas': [1294], 'degradation': [1295, 1313], 'aspect': [1302], 'biology,': [1305], 'growing': [1306], 'evidence': [1307], 'demonstrated': [1309, 1823, 3773], 'specific': [1310], 'processing/activation': [1311], 'receptors': [1317], 'ligands.': [1319], 'Fas': [1320], 'ligand': [1321], '(25Powell': [1322], 'W.C.': [1323, 1689, 5100, 5681], 'Fingleton': [1324], 'B.': [1325, 5235, 5309], 'Wilson': [1326, 1686, 5097, 5678], 'C.L.': [1327, 1687, 5098, 5679], 'Boothby': [1328], 'Matrisian': [1330], 'L.M.': [1331], '1441-1447Abstract': [1336], '(380)': [1344], 'Scholar),': [1346, 1378, 1413, 1444, 1513, 1537, 1567, 1592, 2388, 3902, 4623, 5196, 5225, 5252, 5299, 5324], 'necrosis': [1348], 'factor-α': [1349], '(26Gearing': [1350], 'A.J.': [1351, 3296], 'Beckett': [1352], 'Christodoulou': [1354], 'Churchill': [1356], 'Clements': [1358], 'Davidson': [1360], 'A.H.': [1361, 1363], 'Drummond': [1362], 'Galloway': [1364], 'W.A.': [1365], 'Gilbert': [1366], 'J.L.': [1369, 1519, 1640], '370:': [1372, 3896], '555-557Crossref': [1373], '(1118)': [1376], 'receptor-1': [1386], '(27Levi': [1387], 'E.': [1388, 1896, 1924, 3891, 5242, 5778], 'Fridman': [1389], 'Miao': [1391], 'H.Q.': [1392], 'Ma': [1393], 'Y.S.': [1394], 'Yayon': [1395], 'Vlodavsky': [1397], 'I.': [1398, 1581, 1614, 1642, 4611], '93:': [1407], '7069-7074Crossref': [1408], '(300)': [1411], 'epidermal': [1416], '(28Suzuki': [1419], 'Raab': [1421], 'Moses': [1423], 'M.A.': [1424], 'Fernandez': [1425], 'C.A.': [1426, 1579], 'Klagsbrun': [1427], '272:': [1433, 2377], '31730-31737Abstract': [1434], '(273)': [1442], 'interleukin-8': [1446], '(29Van': [1447], 'den': [1448], 'Steen': [1449], 'P.E.': [1450], 'Proost': [1451], 'Wuyts': [1453], 'Van': [1455, 5240], 'Damme': [1456], 'Opdenakker': [1458], 'Blood.': [1460, 1645], '96:': [1462], '2673-2681Crossref': [1463], 'were': [1467, 1846, 1884, 1953, 1969, 2003, 2131, 2336, 2401, 2433, 2745, 2777, 2826, 2867, 2887, 2911, 2977, 3044, 3324, 3530, 3630, 3699, 4030, 4185, 4741, 5366], 'released': [1471], 'activated': [1473], 'MMPs.': [1475], 'inactivate': [1480], 'interleukin-1β': [1481], '(30Ito': [1482], 'Mukaiyama': [1484], 'Itoh': [1486, 1742, 2049, 2501, 4333, 4477, 4529, 4573, 4604, 5484, 5530], 'Nagase': [1488, 1524], 'Thogersen': [1490], 'I.B.': [1491, 5307], 'Enghild': [1492, 1520], 'J.J.': [1493, 1521], 'Sasaguri': [1494], 'Mori': [1496, 4577], '271:': [1502], '14657-14660Abstract': [1503], '(339)': [1511], 'insulin-like': [1514], 'factor-binding': [1516], '(31Fowlkes': [1518], 'Suzuki': [1522], '269:': [1530], '25742-25746Abstract': [1531], 'fibrinogen': [1538], 'XII': [1541], '(32Hiller': [1542], 'Lichte': [1544], 'Oberpichler': [1546], 'Kocourek': [1548], 'Tschesche': [1550], '33008-33013Abstract': [1557], '(106)': [1565], 'CC': [1569], 'chemokine': [1570, 1663, 5654], 'MCP-3': [1571], '(33McQuibban': [1572], 'G.A.': [1573, 1604, 1634], 'Gong': [1574, 1607, 1635], 'J.H.': [1575, 1608, 1636], 'Tam': [1576], 'E.M.': [1577], 'McCulloch': [1578], 'Clark-Lewis': [1580, 1613, 1641], 'Overall': [1582, 1615, 1643], 'C.M.': [1583, 1616, 1644], 'Science.': [1584], '289:': [1586], '1202-1206Crossref': [1587], '(654)': [1590], 'CXC': [1595, 1662, 5653], 'chemokines': [1596], 'stromal': [1597], 'cell-derived': [1598], 'factor-1': [1599], 'α': [1600], 'β': [1602], '(34McQuibban': [1603], 'Butler': [1605], 'G.S.': [1606], 'Bendall': [1609], 'L.': [1610], 'Power': [1611], 'C.': [1612, 2169, 2186], '276:': [1621, 1752, 2059, 2511, 4343, 4487, 4539], '43503-43508Abstract': [1622], '(546)': [1630], '35McQuibban': [1633], 'Wong': [1637], 'J.P.': [1638], 'Wallace': [1639], '2002;': [1646, 1691, 4616, 5102, 5393, 5683], '100:': [1647], '1160-1167Crossref': [1648], 'Recently,': [1652, 5643], 'matrilysin': [1653, 5116, 5411, 5422, 5644], '(MMP-7)': [1654, 5084], 'mediate': [1658, 5090, 5648], 'syndecan-1/a': [1661, 5652], '(KC)': [1664, 5655], 'complex': [1665, 4452, 4462, 5656], 'mucosal': [1668, 5659], 'directs': [1671, 4559, 5662], 'confines': [1673, 5664], 'neutrophil': [1674, 5665], 'influx': [1675, 5666], 'active': [1677, 3030, 3059, 4424], 'sites': [1678, 2642, 4803, 4852, 5668], 'injured': [1680, 5672], 'lungs': [1681, 5673], '(36Li': [1682, 5093, 5674], 'Q.': [1683, 5094, 5675], 'Parks': [1688, 5099, 5680], '111:': [1692, 5103, 5684], '635-646Abstract': [1693, 5104, 5685], '(659)': [1701, 5112, 5693], 'Previously,': [1704, 4306], 'we': [1705, 1813, 3131, 4307, 4405, 5725], 'developed': [1707], 'screen': [1713], 'genes,': [1714, 2025], 'products': [1716, 2027, 5622], 'only': [1720, 3426, 3646, 4025, 4558], 'modulate': [1721], 'pro-MMP-2': [1722, 4445, 4506], 'activation': [1723, 3110, 4446, 4507], 'mediated': [1724, 3111, 4429, 4755], 'serve': [1729], 'substrates': [1731], '(37Miyamori': [1734, 2041, 2493, 4325, 4469, 4521], 'Takino': [1736, 1768, 2043, 2495, 3882, 4327, 4359, 4471, 4523], 'T.': [1737, 1769, 1773, 1786, 1794, 1890, 1920, 2044, 2496, 2647, 2655, 2700, 2708, 2926, 2934, 3883, 4328, 4360, 4364, 4377, 4385, 4472, 4524, 4576, 4599, 5495, 5512], 'Kobayashi': [1738, 2045, 2497, 4329, 4473, 4525], 'Tokai': [1740, 2047, 2499, 4331, 4475, 4527], '28204-28211Abstract': [1753, 2060, 2512, 4344, 4488, 4540], '(207)': [1761, 2068, 2520, 4352, 4496, 4548], '38Nakada': [1764, 4355], 'Yamada': [1766, 4357], 'Miyamori': [1770, 1789, 2650, 2703, 2929, 4361, 4380], 'Takahashi': [1772, 4363], 'Yamashita': [1774, 4365], '61:': [1781, 4372], '8896-8902PubMed': [1782, 4373], '39Takino': [1785, 4376], 'Koshikawa': [1787, 2648, 2701, 2927, 4378, 4600], 'Tanaka': [1791, 2652, 2705, 2931, 4382], 'Sasaki': [1793, 2654, 2707, 2933, 4384], 'Oncogene.': [1801, 2662, 2715, 2941, 4392], '2003;': [1802, 2663, 2716, 2942, 4393], '22:': [1803, 2664, 2717, 2943, 4394, 5318], '4617-4626Crossref': [1804, 2665, 2718, 2944, 4395], '(126)': [1807, 2668, 2721, 2947, 4398], 'this': [1811, 3041, 3089, 4467, 4705, 4884, 4993, 5055], 'study,': [1812, 4404, 4994], 'substrate': [1819, 3138, 4568], "Materials—Dulbecco's": [1833], 'modified': [1834, 2011], "Eagle's": [1835, 2012], 'medium': [1836, 2013, 2123, 2418, 2895, 2904, 3156, 3182, 3908], 'Nissui': [1839], 'Pharmaceutical': [1840, 1989], 'Co.,': [1841, 1990], 'Ltd.': [1842, 1959, 1991], '(Tokyo,': [1843], 'Japan).': [1844, 1851, 1961, 1993, 2463], 'Primers': [1845], 'synthesized': [1847, 3752], 'Genset': [1849], '(Kyoto,': [1850], 'A': [1852, 2590, 3328], 'constructed': [1857], 'pEAK8': [1860, 2412], 'vector': [1862, 2413], 'obtained': [1864, 2004], 'EdgeBio': [1866], 'Systems': [1867], '(Gaithersburg,': [1868], 'MD).': [1869], 'catalytic': [1874, 2807, 3549], 'domains': [1875], 'tagged': [1876, 2759, 3665, 3720], 'FLAG': [1878, 1965], 'epitope': [1879, 1968, 3668, 3723], 'COOH': [1882], 'terminus': [1883, 3672, 3727], 'prepared': [1885], 'described': [1887, 2039, 2154, 2328, 2344, 2491, 2697, 4288], 'previously': [1888, 2040, 2155, 2345, 2492, 2698, 3269], '(40Kinoshita': [1889], 'Ohuchi': [1895, 1923], '273:': [1907], '16098-16103Abstract': [1908], '(260)': [1916], '41Shimada': [1919], 'Fujii': [1925], 'Murakami': [1927, 5461], 'Eur.': [1935], '262:': [1939], '907-914Crossref': [1940], '(90)': [1943], 'anti-MT2-MMP': [1949], 'monoclonal': [1950], 'antibody': [1951, 2253, 2260, 2265, 2279, 2476, 3172, 3413, 3709, 3922], '162-4E3': [1952], 'Daiichi': [1955], 'Fine': [1956], 'Chemical': [1957], 'Co.': [1958], '(Takaoka,': [1960], 'Monoclonal': [1962], 'antibodies': [1963], 'against': [1964, 3710], 'His6': [1967, 2761, 3667, 3712, 3722], 'purchased': [1970], 'Sigma': [1972], 'Santa': [1974], 'Cruz': [1975], 'Biotechnology,': [1976], 'Inc.': [1977], '(Santa': [1978], 'Cruz,': [1979], 'CA),': [1980], 'respectively.': [1981, 4161], '[4-(N-hydroxyamino)-2R-isobutyl-3-S-(thienylthiomethyl)-succinyl]-l-phenylalanine-N-methylamide': [1982], '(BB-94)': [1983], 'gift': [1986], 'Kotobuki': [1988], '(Nagano,': [1992], 'Culture—Human': [1995], 'embryonic': [1996], 'kidney': [1997], 'ATCC': [2006], "Dulbecco's": [2010], 'supplemented': [2014], '5%': [2016], 'fetal': [2017], 'calf': [2018], 'serum.': [2019], 'Expression': [2020, 2671], 'Cloning—Expression': [2021], 'identify': [2024, 3740], 'interact': [2030, 3602, 4317], 'MMP-9,': [2033, 2967, 2987], 'performed': [2037, 2468], 'Western': [2071, 2077, 3165, 3916, 3938], 'blotting': [2072, 2075, 3166, 3169, 3919, 3939, 4015], 'slot': [2074, 2300, 3168, 3918, 4014], 'For': [2076, 2299, 4951], 'blot': [2078, 2301], 'analysis,': [2079, 2302], 'plasmid': [2082, 2094, 2305, 2317, 2439, 2645, 2672, 2695], 'for': [2083, 2133, 2231, 2244, 2306, 2425, 2465, 2673, 2820, 2905, 2922, 3429, 3535, 3618, 3632, 4035, 4187, 4444, 4555, 4569, 4681, 4853, 5633, 5787], '(1': [2085, 2440, 2876], 'μg),': [2086], 'co-transfected': [2088, 2311, 2434, 2964, 3445, 3464, 3477], '(4': [2095], 'μg)': [2096, 2428, 2432, 2441], '293T': [2098, 2321, 2443, 2972, 2992, 3147, 3184, 3389, 3949, 4433, 4440], '10-cm': [2102], 'using': [2104, 2473, 2533, 2554, 2613, 2779, 2851, 3170, 3411, 3920, 4811], 'TransIT': [2105], 'LT1': [2106], 'transfection': [2107, 2472, 3050], 'reagent': [2108], 'according': [2109, 2782], "manufacturer's": [2112, 2785], 'instructions': [2113, 2786], '(Mirus,': [2114], 'Madison,': [2115], 'WI).': [2116], 'At': [2117], '24': [2118, 2136, 3038], 'h': [2119, 2470, 2884], 'after': [2120, 2471, 2885, 2917], 'transfection,': [2121], 'culture': [2122, 2143, 2331, 2417, 2924, 3155, 3181, 3221, 3907], 'replaced': [2125], 'serum-free': [2127], 'medium,': [2128], 'incubated': [2132, 2803, 3674, 3754, 3795], 'h.': [2137, 2246, 2908], 'enriched': [2140], 'supernatants': [2144, 2332], 'lysates': [2147, 2335, 2976], 'DEAE-Sepharose': [2149], 'beads': [2150, 2781], '(Amersham': [2151, 2219, 2771, 2787], 'Biosciences)': [2152], '(42Numa': [2156], 'F.': [2157, 5485, 5531], 'Hirabayashi': [2158], 'Tsunaga': [2160], "O'Rourke": [2164], 'Shao': [2166], 'Stechmann-Lebakken': [2168], 'Varani': [2170], 'Rapraeger': [2172], 'Dixit': [2174], 'V.M.': [2175], '4676-4680PubMed': [2180], '43Gattei': [2183], 'V.': [2184, 5388], 'Godeas': [2185], 'Degan': [2187], 'Rossi': [2189], 'F.M.': [2190], 'Aldinucci': [2191], 'D.': [2192], 'Pinto': [2193], 'Br.': [2195, 5166], 'Haematol.': [2197], '104:': [2199], '152-162Crossref': [2200], '(25)': [2203], 'Enriched': [2206], 'separated': [2209, 2827], '7%': [2211], 'SDS-PAGE': [2212, 2830, 3682], 'blotted': [2214, 2337, 2832], 'onto': [2215, 2338, 2869], 'Hybond': [2216, 2339], 'N+': [2217, 2340], 'Biosciences).': [2220, 2772, 2788], 'fixed': [2224], '0.05%': [2226], 'glutaraldehyde': [2227], 'phosphate-buffered': [2229, 2242, 2281, 2751], 'saline': [2230, 2243, 2282, 2752], '30': [2232], 'min': [2233], 'then': [2235, 2748], 'pretreated': [2236], '10%': [2238], 'skim': [2239, 2285], 'milk': [2240], '2': [2245, 2883], 'detected': [2249, 2392, 3191, 3706, 3936], 'anti-syndecan-1': [2251, 2474, 3171, 3412, 3921], 'MI15': [2252, 2475], '(Dako,': [2254], 'Glostrup,': [2255], 'Denmark)': [2256], 'first': [2259], 'goat': [2262, 2478], 'anti-mouse': [2263], 'IgG': [2264, 2480], 'conjugated': [2266, 2481], 'Alexa': [2268], 'Fluor': [2269], '680': [2270], '(Molecular': [2271, 2528], 'Probes,': [2272], 'Inc.,': [2273], 'Eugene,': [2274], 'OR)': [2275], 'second': [2278, 3048], 'containing': [2283, 2419, 2753], '3%': [2284], 'milk.': [2286], 'signal': [2288, 5565], 'monitored': [2290, 2532, 3914], 'LI-COR': [2292], 'Odyssey™': [2293], 'infrared': [2294], 'imaging': [2295], 'system': [2296], '(Lincoln,': [2297], 'NE).': [2298], '(100': [2308], 'ng)': [2309, 2319, 2801, 2810], '(400': [2318], '24-well': [2325], 'microplates': [2326], 'above.': [2329, 2394], '(17Fitzgerald': [2346, 3270, 4777], '44Subramanian': [2367], 'S.V.': [2368], '14713-14720Abstract': [2378], '(323)': [2386], 'expressing': [2398, 4221], '(HT1080/SDC)': [2400], 'established': [2402], 'selecting': [2404], 'cloned': [2410], '(EdgeBio': [2414], 'Systems)': [2415], '0.5': [2420, 2741], 'μg/ml': [2421], 'puromycin.': [2422], 'Immunostaining—Expression': [2423], 'plasmids': [2424], '(0.2': [2427], '(0.8': [2431], 'TIMP': [2436], '35-mm': [2447, 2870], 'diameter': [2448, 2871], 'glass': [2451], 'bottoms': [2452], 'coated': [2453, 2873], 'I': [2456], 'collagen': [2457, 2875, 4896], '(Matsunami': [2458], 'Glass': [2459], 'Industry': [2460], 'Ltd.,': [2461], 'Tokyo,': [2462], 'Immunostaining': [2464], '48': [2469], 'antimouse': [2479], 'Cy3': [2483], '(Jackson': [2484], 'ImmunoResearch': [2485], 'Laboratories,': [2486], 'West': [2487], 'Grove,': [2488], 'PA)': [2489], 'F-actin': [2523], 'visualized': [2525], 'rhodamine-phalloidin': [2527], 'Probes).': [2529], 'Fluorescence': [2530], 'inverted': [2534], 'confocal': [2535], 'laser': [2536], 'microscopy': [2537, 2914], '(Zeiss).': [2538], 'Preparation': [2539], 'Protein—Syndecan-1': [2543], 'fragment': [2545, 2592, 2628, 2685, 2848, 3081, 3695, 3805, 3809, 3820], 'encoding': [2546, 2593, 2686], 'amino': [2547, 2843, 2856, 4177], 'acids': [2548], '23–251': [2549], 'generated': [2551, 2606, 2680, 2824, 2994, 3821, 3846], 'PCR': [2553, 2608], 'flanking': [2556, 2576], 'forward': [2557], 'primer': [2558, 2578], 'extra': [2561, 2581], 'XhoI': [2562, 2632, 2639], 'site': [2563, 2583, 2691, 3733, 4773, 4885], '(underlined)': [2564, 2584], 'starting': [2565, 2585], 'nucleotide': [2567, 2587, 3076], '272': [2568], '(GenBank™': [2569, 3098], 'accession': [2570, 3099], 'number': [2571, 3100], 'J05392)': [2572], '(GGCCCTCGAGCAAATTGTGGCTACTAATTT)': [2573], 'reverse': [2577], 'BglII': [2582, 2634, 2641, 2690], '958': [2588], '(CCAGATCTCTCTTTCCTGTCCAGGAGGCCC).': [2589], 'mutant': [2596, 3546, 3585, 3784, 4174, 4198], 'substituted': [2602, 3790], 'amplification': [2609], 'mutagenesis': [2614], 'primers': [2615], '(sense,': [2616], 'GGGCCTCACAGCTCCTCCTGGACAGGAAAG;': [2617], 'antisense,': [2618], 'CTTTCCTGTCCAGGAGGAGCTGTGAGGCCC),': [2619], 'contain': [2621], 'mutated': [2622], 'nucleotides': [2623], '(underlined).': [2624], 'amplified': [2626], 'DNA': [2627, 2956], 'digested': [2630], 'inserted': [2636], 'His6-CTC': [2644], '(39Takino': [2646, 2699, 2925], 'syndecan-1-glutathione': [2674], 'S-transferase': [2675], '(GST)': [2676], 'fusion': [2677, 2775, 2798, 3842], 'inserting': [2682], 'GST': [2687, 2774, 3750], 'above': [2694], 'BL20': [2725], 'Escherichia': [2726], 'coli': [2727], 'strain': [2728], 'these': [2732, 4256, 5615, 5624], 'plasmids,': [2733], 'mm': [2742], 'isopropyl-β-thiogalactopyranoside.': [2743], 'Cells': [2744], 'collected': [2746], 'sonicated': [2749], '0.5%': [2754], 'Triton': [2755], 'X-100.': [2756], 'purified': [2763, 2778], 'supernatant': [2766], 'Ni2+-chelating': [2769], 'Sepharose': [2770], 'glutathione-Sepharose': [2780], 'Determination': [2789], 'Cleavage': [2792, 3657, 4166], 'Site': [2793], 'Protein—Recombinant': [2796], '(200': [2800], 'domain': [2808, 3550, 3561, 3572, 3588, 3608, 4690], '(20': [2809], '50': [2812], 'μl': [2813], 'TNC': [2815], 'buffer': [2816], '37': [2818], '°C': [2819], '3': [2821], 'h,': [2822], 'fragments': [2825, 3070, 3854], '12%': [2829], 'polyvinylidene': [2834], 'difluoride': [2835], '(Milipore': [2837], 'Corp.,': [2838], 'Bedford,': [2839], 'MA).': [2840], 'NH2-terminal': [2842, 3769, 3814], 'acid': [2844, 2857, 4178], 'sequence': [2845, 3077, 3770, 3815], 'determined': [2850, 4810], 'Beckman': [2853], 'Coulter': [2854], 'LF300': [2855], 'sequencer.': [2858], 'Wound-induced': [2859], 'Assay—Mock-transfected': [2861], 'HT/SDC': [2865], 'plated': [2868], '×': [2877], '106': [2878], 'cells/plate).': [2879], 'Semiconfluent': [2880], 'monolayers': [2881], 'formed': [2882], 'plating': [2886], 'scraped': [2888], 'plastic': [2891], 'tip,': [2892], 'rinsed': [2893], 'avoid': [2897], 'resettling,': [2899], 'fresh': [2903], '12': [2907], 'Migrating': [2909], 'photographed': [2912], 'under': [2913], 'before': [2915], 'incubation': [2918], '10': [2920], 'points': [2921], 'Screening': [2950], 'Human': [2952], 'Placenta': [2953], 'Library—Plasmid': [2955], 'cells,': [2973, 3148, 3950, 4130, 4160, 4231, 4295, 5004, 5125, 5415], 'analyzed': [2978, 3680], 'gelatin': [2980], 'zymography': [2981], '(Fig.': [2982, 3173, 3265, 3326, 3414, 3543, 3640, 3683, 3758, 3923, 3960, 4016, 4038, 4108, 4193, 4248, 4285], '1).': [2983], 'Transfection': [2984, 3016], '92-kDa': [2996], 'gelatinolytic': [2997], 'band': [2998, 3004, 3011, 3195, 3943], 'latent': [3000, 3006], 'pro-MMP-9,': [3001], '68-kDa': [3003], 'pro-MMP-2,': [3007, 4454], '64-kDa': [3010], 'MMP-2': [3013, 3026, 3055, 3109], 'intermediate': [3014, 4419], 'form.': [3015], 'pool': [3019, 3043], 'partially': [3022], 'stimulated': [3023, 3250, 3261], 'processing': [3024, 3056], '62-kDa': [3029], 'form': [3031, 3060, 4420, 4425], '(lane': [3032], '2).': [3033, 3174], 'Five': [3034], 'clones': [3036, 3039], 'isolated': [3045], 'screening,': [3049], 'partial': [3054], '(data': [3061, 3855, 4077, 4518], 'shown).': [3063, 3857, 4079], 'size': [3065], 'five': [3068], '2.4': [3072], 'kb,': [3073], 'determined.': [3083], 'Homology': [3084], 'search': [3085], 'analysis': [3086, 3816, 4670], 'revealed': [3087], 'encodes': [3091], 'J05392).': [3101], 'MT1-MMP—Although': [3106], 'stimulation': [3107], 'weak,': [3120], 'suggested': [3122, 4673], 'possible': [3124], 'interaction': [3125, 4699, 5619], 'between': [3126, 4453], 'examined': [3132, 3163, 3325, 4032, 4102, 4877], 'whether': [3133, 4878], 'serves': [3135, 4565], 'MT1-MMP.': [3140, 3395, 3466, 3527, 3838, 4635, 4760, 4887], 'co-expressed': [3143], 'its': [3158, 3231, 3606, 4173, 4675], 'association': [3159], 'slightly': [3179, 4116], 'cDNA,': [3190], 'smear': [3194, 3942], 'ranging': [3196], '100': [3198], '200': [3202], 'kDa.': [3203, 3812], 'Most': [3204], 'observed': [3209, 4067, 4661], 'lysate,': [3212], 'migrated': [3214], 'rather': [3215], 'medium.': [3222], 'accelerated': [3226, 4189, 4712, 4717], 'layer.': [3236], 'blocked': [3245, 3361, 3985, 4004, 4733, 5058], 'syndecan-1-transfected': [3256], 'TPA': [3259, 3313, 3337, 3372, 3378, 3401, 3462, 3494, 3962, 4204, 4722, 4753, 4837, 4860], '3A)': [3266], '45Hooper': [3291], 'N.M.': [3292], 'Karran': [3293], 'E.H.': [3294], 'Turner': [3295], '321:': [3300], '265-279Crossref': [3301], '(562)': [3304], 'compare': [3308], 'effects': [3316], 'inhibitors': [3319, 5011], 'TIMP-1,': [3321], '3,': [3327], 'B).': [3330], 'addition': [3346, 3357, 4081, 4120], 'had': [3351, 3486], 'no': [3352, 3487], 'effect.': [3353, 3488], 'treatment.': [3373, 4838, 4861], 'indicate': [3376, 4747], 'induces': [3379], 'BB-94-sensitive': [3381], 'protease': [3383], 'capable': [3384], 'compared': [3406, 3531, 3631, 4186, 4512], 'immunostaining': [3408, 4034, 5258], '3C).': [3415], 'faintly': [3427], 'immunostained': [3428], 'when': [3431], 'treated': [3432, 3460], 'TPA.': [3434, 4714], 'staining': [3436, 3457, 3474, 3492, 4091], 'weak': [3439, 4511], 'gene.': [3449], 'recovered': [3453, 3472], 'strong': [3455], 'TIMP-3': [3471, 3502], 'gene,': [3481], 'co-expression': [3483], 'Reduction': [3489], 'reversed': [3497], 'confirmed': [3515], 'TPA-induced': [3518, 4018], 'due': [3522], 'protease(s)': [3524], 'mutants': [3529], 'wild': [3533], 'capacity': [3537, 3634], 'cause': [3539, 3636], '4).': [3544], 'defective': [3547], '(MT1-EA)': [3551], 'did': [3552, 3579, 3800, 5128], 'induce': [3554, 3593], 'shedding.': [3556, 3595, 5082, 5132], 'Deletion': [3557, 4686], 'transmembrane/cytoplasmic': [3560, 3571], '(Δ535': [3562], 'Δ335)': [3564], 'abolished': [3565, 4693], 'substitution': [3568, 4179, 4824], 'interleukin-2': [3576], 'receptor': [3577, 4554], '(MT1/IL2R)': [3578], 'affect': [3581], 'it.': [3582, 4305], 'deletion': [3584], 'lacking': [3586], 'hemopexin': [3587, 3607], '(ΔPex)': [3589], 'failed': [3591], 'may': [3601, 4465, 5626, 5705, 5765], 'localization': [3613, 4037, 4678], 'essential': [3617, 4680], 'Next,': [3623, 3782], 'members': [3625], 'MT-MMP': [3628], '5).': [3641], 'Among': [3642], 'six': [3644], 'members,': [3645], 'comparable': [3655, 4264], 'efficiency.': [3656], 'MT1-MMP—Recombinant': [3661], 'carboxyl': [3671, 3726, 3737], '6A).': [3684], 'major': [3686, 3761, 3808, 4553, 4850], 'digestion': [3687, 3762, 3823, 3849], '25': [3690], 'kDa': [3691, 3698], 'minor': [3694, 3853], '23': [3697], 'observed;': [3700], 'however,': [3701, 4730, 5115], 'none': [3702], 'them': [3704], 'epitope.': [3713], 'This': [3714, 4839], 'indicates': [3715, 4840], 'adjacent': [3734], 'terminus.': [3738], 'site,': [3743], 'fused': [3748], '6B).': [3759], '29-kDa': [3766, 3804], 'fragment,': [3767], 'syndecan-1-GST': [3783, 3825, 3841], '(G245L-GST)': [3793], 'generate': [3802], '58': [3811], '58-kDa': [3819], 'G245L-GST': [3827], 'showed': [3828], 'Gly82-Leu83': [3832], 'Incubation': [3839], 'similar': [3848], 'pattern': [3850], 'Enhances': [3860], 'Motility—The': [3862], 'high': [3875, 5039], 'levels': [3876, 5040, 5363, 5418], '(46Sato': [3880], 'Cao': [3886], 'Shinagawa': [3888], 'Yamamoto': [3890], '61-65Crossref': [3897], '(2395)': [3900], '7).': [3924], 'continuously': [3927], 'moderate': [3930], 'syndecan-1,': [3933, 4272, 4644], 'migrating': [3944], 'lysate': [3957], 'low': [3959, 5254, 5326], '7A).': [3961], 'resulting': [3988], 'Spontaneous': [3995, 4215], '7B).': [4017], 'BB-94.': [4027], '7C).': [4039], 'weakly': [4042], 'stained': [4043], 'surface.': [4059], 'Formation': [4060], 'actin': [4062, 5021], 'stress': [4063, 5022], 'fibers': [4064], 'frequently': [4066], 'BB-94-treated': [4069], 'mock-transfected': [4075, 4112, 4139], 'enhanced': [4088], 'Motility': [4094, 4110], 'wound-induced': [4105], 'migration': [4106, 4151, 4273, 4292, 4297, 5001], 'assay': [4107], '7D).': [4109], '(93': [4125], '94%': [4127], 'mocktreated': [4129], 'respectively).': [4131], '78%': [4137], 'suppressed': [4150, 4291], '70': [4153], '71%': [4155], 'untreated': [4158], 'Peptide': [4169], 'Bond—Wild-type': [4170], '(G245L)': [4184], '8A).': [4194], 'G245L': [4197, 4222], 'less': [4208, 4225], 'effective': [4209, 4226], 'wild-type': [4213], '(HT1080/G245L)': [4223], 'HT1080/G245L': [4239, 4275, 4299], 'higher': [4242], '8B).': [4249], 'accumulated': [4254], 'level.': [4265], 'Consistent': [4266], '8C).': [4286], 'As': [4287], 'above,': [4289], 'affected': [4303], 'claudin-5,': [4310], 'N-Tes/testican-3,': [4311], 'KiSS-1/metastin': [4313], 'strategy': [4324], 'present': [4403], 'conversion': [4415], 'MMP-2-activated': [4418], 'fully': [4423], 'process': [4428, 4468], 'concentrations': [4438, 5016], 'suboptimal': [4443], 'formation': [4449, 5019], 'ternary': [4451], 'TIMP-2,': [4455], 'focal': [4458], 'promote': [4466], 'However,': [4499], 'effect': [4501], 'claudin-5': [4516], 'shown)': [4520], 'CD44,': [4551], 'hyaluronan,': [4556], 'lamellipodia': [4562], '(47Kajita': [4571], 'Chiba': [4575], 'Kinoh': [4581], '153:': [4589], '893-904Crossref': [4590], '(633)': [4593], '48Mori': [4596], 'Tomari': [4598], 'Kajita': [4602], 'Tojo': [4608], 'Yana': [4610], 'EMBO': [4614], '21:': [4617], '3949-3959Crossref': [4618], '(284)': [4621], 'led': [4625], 'us': [4626], 'examine': [4628], 'weather': [4629], 'promotion': [4655], 'MT3-MMP,': [4663], 'Mutation': [4669], 'hemopexinlike': [4689], 'suggests': [4697, 5070], 'domain.': [4706], 'TIMP-3;': [4729], 'selectively': [4732], 'neither': [4740], 'TIMP-1.': [4744, 5066], 'metalloproteinase(s)': [4757], 'TPA-accelerated': [4761], 'mouse': [4764, 4870, 4879], 'juxtamembrane': [4772, 4821], 'One': [4798], 'potential': [4801], 'within': [4819], 'site.': [4822], 'Indeed,': [4823], 'one': [4847, 5628], 'corresponds': [4866], 'Ser246-Leu247': [4868], 'It': [4872, 5398], 'still': [4873], 'Syndecan-mediated': [4888], 'cellular': [4889], 'attachment': [4890], 'fibronectin': [4898], 'regulates': [4899], 'phenotype': [4904], 'example,': [4952], 'exogenous': [4953], 'mammary': [4959], 'restored': [4962], 'morphology': [4965], 'characteristics': [4968], '(49Leppa': [4969], 'Mali': [4971], 'Miettinen': [4973], 'H.M.': [4974], '89:': [4985], '932-936Crossref': [4986], '(143)': [4989], 'down-regulate': [5000], 'increased': [5012], 'fibers,': [5023], 'resulted': [5025], 'produce': [5037], 'relatively': [5038], 'MMPs,': [5042], 'MMP-9.': [5047], 'ectodomain,': [5053, 5734], 'could': [5056], 'selective': [5068], 'inhibition': [5069], 'mainly': [5078], 'involved': [5079, 5120, 5745], 'Matrilysin': [5083], 'recently': [5087], 'Scholar);': [5114], 'because': [5126, 5416], 'block': [5130], 'High': [5133, 5360], 'cancer': [5134, 5155, 5200, 5260, 5376, 5433], 'biopsies': [5140], 'found': [5143], 'favorable': [5149], 'outcome': [5150, 5373], 'head': [5152], 'neck': [5154], '(50Anttonen': [5156], 'Kajanti': [5158, 5205, 5279], 'Heikkila': [5160, 5203, 5277], 'Joensuu': [5164, 5209, 5283], 'Cancer.': [5168, 5212, 5286, 5351, 5471, 5517, 5538], '79:': [5170], '558-564Crossref': [5171], '(120)': [5174], '51Pulkkinen': [5177], 'J.O.': [5178], 'Penttinen': [5179], 'Klemi': [5183], 'Grenman': [5185], 'Acta': [5187], 'Otolaryngol.': [5188], '117:': [5190], '312-315Crossref': [5191], '(108)': [5194], 'squamous': [5197, 5271], 'lung': [5199, 5273, 5375, 5432], '(52Anttonen': [5201, 5275], 'Lung': [5211, 5285], '32:': [5214, 5288], '297-305Abstract': [5215, 5289], '(76)': [5223, 5297], 'mesothelioma': [5227], '(53Kumar-Singh': [5228], 'Jacobs': [5230], 'W.': [5231, 5779], 'Dhaene': [5232], 'Weyn': [5234], 'Bogers': [5236], 'Weyler': [5238], 'Marck': [5241], 'Pathol.': [5244], '186:': [5246], '300-305Crossref': [5247], 'poor': [5265, 5372], 'histological': [5266], 'grade': [5267, 5327], 'differentiation': [5269, 5329], 'carcinoma': [5274, 5305, 5336], 'increasing': [5300], 'aggressiveness': [5301], '(54Bayer-Garner': [5306], 'Dilday': [5308], 'Sanderson': [5310], 'R.D.': [5311], 'Smoller': [5312], 'B.R.': [5313], 'Am.': [5314], 'Dermatopathol.': [5316], '119-122Crossref': [5319], '(43)': [5322], 'presence': [5331], 'metastases': [5333], 'hepatocellular': [5335], '(55Matsumoto': [5337], 'Ono': [5339], 'Fujimoto': [5341], 'Kohgo': [5347], 'Int.': [5349, 5469], '74:': [5353], '482-491Crossref': [5354], '(124)': [5357], 'serum': [5361], 'diagnosis': [5365], '(56Joensuu': [5377], 'Anttonen': [5379], 'Eriksson': [5381], 'Makitaro': [5383], 'Alfthan': [5385], 'Kinnula': [5387], 'Leppa': [5389], '62:': [5394], '5210-5217PubMed': [5395], 'would': [5399], 'hypothesized': [5401], 'might': [5405], 'and/or': [5410], '(24Ueno': [5434], '57Tokuraku': [5457], 'Watanabe': [5465], '64:': [5473], '355-359Crossref': [5474], '(268)': [5477], '58Yamamoto': [5480], 'Adachi': [5482], 'Iku': [5486, 5528], 'Matsuno': [5488], 'Kusano': [5490], 'Arimura': [5492], 'Endo': [5494], 'Hinoda': [5496], 'Hosokawa': [5498, 5534], '59:': [5505], '3313-3316PubMed': [5506], '59Ohashi': [5509], 'Nemoto': [5511], 'Nemori': [5515], '88:': [5519], '2201-2209Crossref': [5520], '60Yamamoto': [5526], 'Tang': [5532], 'X.': [5533], '1324-1331Crossref': [5541], '(28)': [5544], 'bind': [5552], 'cytokines': [5558, 5716], 'chains': [5561], 'consequently': [5563], 'regulate': [5564], 'transductions': [5566], '(5Rapraeger': [5567], 'complexed': [5613, 5720], 'steps': [5632], 'regulation': [5635, 5709], 'activities': [5638], 'situations.': [5642], 'injury': [5670], 'signals': [5711], 'them.': [5722], 'conclusion,': [5724], 'cleaves': [5730], 'sheds': [5732], 'enhances': [5736], 'motility': [5738], 'collagen.': [5740], 'progression,': [5753], 'identification': [5761], 'proteases': [5764], 'diagnostic': [5771], 'therapeutic': [5773], 'strategies.': [5774], 'We': [5775], 'thank': [5776], 'Dr.': [5777], 'Thompson': [5780], '(St.': [5781], "Vincent's": [5782], 'Institute': [5783], 'Medical': [5785], 'Research)': [5786], 'critical': [5788], 'reading': [5789], 'manuscript.': [5792]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2096372265', 'counts_by_year': [{'year': 2024, 'cited_by_count': 13}, {'year': 2023, 'cited_by_count': 12}, {'year': 2022, 'cited_by_count': 14}, {'year': 2021, 'cited_by_count': 18}, {'year': 2020, 'cited_by_count': 15}, {'year': 2019, 'cited_by_count': 14}, {'year': 2018, 'cited_by_count': 13}, {'year': 2017, 'cited_by_count': 19}, {'year': 2016, 'cited_by_count': 15}, {'year': 2015, 'cited_by_count': 15}, {'year': 2014, 'cited_by_count': 16}, {'year': 2013, 'cited_by_count': 21}, {'year': 2012, 'cited_by_count': 22}], 'updated_date': '2024-12-24T14:26:03.299984', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
