Title: Modulation of Gene Expression by Cancer Chemopreventive Dithiolethiones through the Keap1-Nrf2 Pathway
Abstract: Enzyme inducers such as 3H-1,2-dithiole-3-thione (D3T) enhance the detoxication of environmental carcinogens and protect against neoplasia. The putative molecular sensor for inducers is Keap1, a sulfhydryl-rich protein that sequesters the transcription factor Nrf2 in the cytoplasm. Expression of these detoxication enzymes is blunted in nrf2-deficient mice; moreover, these mice are more sensitive to carcinogenesis, and the protective actions of dithiolethiones are lost with nrf2 disruption. Hepatic gene expression profiles were examined by oligonucleotide microarray analysis in vehicle- or D3T-treated wild-type mice as well as in nrf2 single and keap1-nrf2double knockout mice to identify those genes regulated by the Keap1-Nrf2 pathway. Transcript levels of 292 genes were elevated in wild-type mice 24 h after treatment with D3T; 79% of these genes were induced in wild-type, but notnrf2-deficient mice. Thesenrf2-dependent, D3T-inducible genes included known detoxication and antioxidative enzymes. Unexpected clusters included genes for chaperones, protein trafficking, ubiquitin/26 S proteasome subunits, and signaling molecules. Gene expression patterns in keap1-nrf2 double knockout mice were similar to those in nrf2-single knockout mice. D3T also led to nrf2-dependent repression of 31 genes at 24 h; principally genes related to cholesterol/lipid biosynthesis. Collectively, D3T increases the expression of genes through the Keap1-Nrf2 signaling pathway that directly detoxify toxins and generate essential cofactors such as glutathione and reducing equivalents. Induction ofnrf2-dependent genes involved in the recognition and repair/removal of damaged proteins expands the role of this pathway beyond primary control of electrophilic and oxidative stresses into secondary protective actions that enhance cell survival. Enzyme inducers such as 3H-1,2-dithiole-3-thione (D3T) enhance the detoxication of environmental carcinogens and protect against neoplasia. The putative molecular sensor for inducers is Keap1, a sulfhydryl-rich protein that sequesters the transcription factor Nrf2 in the cytoplasm. Expression of these detoxication enzymes is blunted in nrf2-deficient mice; moreover, these mice are more sensitive to carcinogenesis, and the protective actions of dithiolethiones are lost with nrf2 disruption. Hepatic gene expression profiles were examined by oligonucleotide microarray analysis in vehicle- or D3T-treated wild-type mice as well as in nrf2 single and keap1-nrf2double knockout mice to identify those genes regulated by the Keap1-Nrf2 pathway. Transcript levels of 292 genes were elevated in wild-type mice 24 h after treatment with D3T; 79% of these genes were induced in wild-type, but notnrf2-deficient mice. Thesenrf2-dependent, D3T-inducible genes included known detoxication and antioxidative enzymes. Unexpected clusters included genes for chaperones, protein trafficking, ubiquitin/26 S proteasome subunits, and signaling molecules. Gene expression patterns in keap1-nrf2 double knockout mice were similar to those in nrf2-single knockout mice. D3T also led to nrf2-dependent repression of 31 genes at 24 h; principally genes related to cholesterol/lipid biosynthesis. Collectively, D3T increases the expression of genes through the Keap1-Nrf2 signaling pathway that directly detoxify toxins and generate essential cofactors such as glutathione and reducing equivalents. Induction ofnrf2-dependent genes involved in the recognition and repair/removal of damaged proteins expands the role of this pathway beyond primary control of electrophilic and oxidative stresses into secondary protective actions that enhance cell survival. antioxidant response element 3H-1,2-dithiole-3-thione glutathione S-transferase NAD(P)H:quinone oxidoreductase microsomal epoxide hydrolase nuclear factor κB heat shock protein coefficients of variation average fold change reverse transcriptase-polymerase chain reaction Inducers of phase 2 and antioxidative enzymes are known to enhance the detoxication of environmental carcinogens in animals, often leading to protection against neoplasia (1Kensler T.W. Environ. Health Perspect. 1997; 105: 965-970Google Scholar, 2Hayes J.D. McMahon M. Cancer Lett. 2000; 174: 103-113Google Scholar). Use of enzyme inducers as cancer chemopreventive agents in humans is currently under clinical investigation (3Wang J.S. Shen X. He X. Zhu Y.R. Zhang B.C. Wang J.B. Qian G.S. Kuang S.Y. Zarba A. Egner P.A. Jacobson L.P. Munoz A. Helzlsouer K.J. Groopman J.D. Kensler T.W. J. Natl. Cancer Inst. 1999; 91: 347-354Google Scholar, 4Lam S. MacAulay C. Le Riche J.C. Dyachkova Y. Coldman A. Guillaud M. Hawk E. Christen M.O. Gazdar A.F. J. Natl. Cancer Inst. 2002; 94: 1001-1009Google Scholar). Regulation of both basal and inducible expression of cytoprotective genes is mediated in part by the antioxidant response element (ARE),1 a cis-acting sequence found in the 5′-flanking region of genes encoding many phase 2 enzymes including mouse glutathione S-transferase (GST) A1, human NAD(P)H quinone oxidoreductase (NQO1), and human γ-glutamylcysteine ligase as well as murine Nrf2 itself (5Rushmore T.H. King R.G. Paulson K.E. Pickett C.B. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 3826-3830Google Scholar, 6Favreau L. Pickett C.B. J. Biol. Chem. 1995; 270: 24468-24474Google Scholar, 7Moinova H.R. Mulcahy R.T. J. Biol. Chem. 1998; 273: 14683-14689Google Scholar, 8Kwak M.-K. Itoh K. Yamamoto M. Kensler T.W. Mol. Cell. Biol. 2002; 22: 2883-2892Google Scholar). Recently, Maf and CNC-bZIP (“cap”n collar family of basic region leucine zipper proteins) transcription factors such as Nrf2 have been shown to be ARE-binding proteins (9Venugopal R. Jaiswal A.K. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 14960-14965Google Scholar, 10Itoh K. Chiba T. Takahashi S. Ishii T. Igarashi K. Katoh Y. Oyake T. Hayashi N. Satoh K. Iatayama I. Yamamoto M. Nabeshima Y. Biochem. Biophys. Res. Commun. 1997; 236: 313-322Google Scholar). Overexpression of Nrf2 in human hepatoma cells enhanced both basal and inducible activation of an ARE reporter gene (10Itoh K. Chiba T. Takahashi S. Ishii T. Igarashi K. Katoh Y. Oyake T. Hayashi N. Satoh K. Iatayama I. Yamamoto M. Nabeshima Y. Biochem. Biophys. Res. Commun. 1997; 236: 313-322Google Scholar). Increased nuclear accumulation of Nrf2 has been observed in the liver of mice treated with 3H-1,2-dithiole-3-thione (D3T), a potent chemopreventive agent (8Kwak M.-K. Itoh K. Yamamoto M. Kensler T.W. Mol. Cell. Biol. 2002; 22: 2883-2892Google Scholar, 11Kwak M.-K. Itoh K. Yamamoto M. Sutter T.R. Kensler T.W. Mol. Med. 2001; 7: 135-145Google Scholar). Initially, this accumulation results from translocation of Nrf2 from the cytoplasm. Itoh et al. (12Itoh K. Wakabayashi N. Katoh Y. Ishii T. Igarashi K. Engel J.D. Yamamoto M. Genes Dev. 1999; 13: 76-86Google Scholar) have identified and characterized Keap1, an actin-binding protein localized to the cytoplasm that sequesters Nrf2 by specific binding to its N-terminal regulatory domain (13Dhakshinamoorthy S. Jaiswal A.K. Oncogene. 2001; 20: 3906-3917Google Scholar). Administration of sulfhydryl reactive compounds, such as diethylmaleate or D3T, abolishes Keap1 repression of Nrf2 activity in cells and facilitates the nuclear accumulation of Nrf2 (14Zipper L.M. Mulcahy R.T. J. Biol. Chem. 2002; 277: 36544-36552Google Scholar, 15Sekhar K.R. Spitz D.R. Harris S. Nguyen T.T. Meredith M.J. Holt J.T. Guis D. Marnett L.J. Summar M.L. Freeman M.L. Free Radic. Biol. Med. 2002; 32: 650-662Google Scholar). Recently, Dinkova-Kostova et al. (16Dinkova-Kostova A.T. Holtzclaw W.D. Cole R.N. Itoh K. Wakabayashi N. Katoh Y. Yamamoto M. Talalay P. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 11908-11913Google Scholar) has shown in a cell-free system that selective cysteine amino acids in Keap1 can react directly with a sufhydryl reactive inducer, dexamethasone mesylate, and trigger the release of Nrf2 from Keap1. These results support the hypothesis that Keap1 is a key regulatory molecule of Nrf2 and that the Keap1-Nrf2 complex acts as a sensor to oxidative or electrophilic stresses to induce protective genes promoting cell survival. Studies with nrf2-disrupted mice indicated that Nrf2 was essential for the induction of GST and NQO1 activitiesin vivo by different classes of chemopreventive agents including dithiole-thiones, isothiocyanates, and phenolic antioxidants (9Venugopal R. Jaiswal A.K. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 14960-14965Google Scholar, 11Kwak M.-K. Itoh K. Yamamoto M. Sutter T.R. Kensler T.W. Mol. Med. 2001; 7: 135-145Google Scholar, 17MacMahon M. Itoh K. Yamamoto M. Chanas S.A. Henderson C.J. McLellan L.I. Wolf C.R. Cavin C. Hayes J.D. Cancer Res. 2001; 61: 3299-3307Google Scholar). A series of studies from several laboratories have been undertaken over the past decade to better understand the range of genes coordinately induced by these agents so as to elucidate the biochemical basis for protection. Genes now recognized as induced through the Nrf2-ARE signaling system include a panel of xenobiotic conjugating enzymes, enzymes that provide cofactors and reducing equivalents for these reactions, and antioxidative enzymes and proteins (11Kwak M.-K. Itoh K. Yamamoto M. Sutter T.R. Kensler T.W. Mol. Med. 2001; 7: 135-145Google Scholar, 17MacMahon M. Itoh K. Yamamoto M. Chanas S.A. Henderson C.J. McLellan L.I. Wolf C.R. Cavin C. Hayes J.D. Cancer Res. 2001; 61: 3299-3307Google Scholar, 18Primiano T. Gastel J.A. Kensler T.W. Sutter T.R. Carcinogenesis. 1996; 17: 2297-2303Google Scholar, 19Thimmulappa R.K. Mai K.H. Srisuma S. Kensler T.W. Yamamoto M. Biswal S. Cancer Res. 2002; 62: 5196-5203Google Scholar, 20Lee J.M. Hanson J.M. Chu W.A. Johnson J.A. J. Biol. Chem. 2001; 276: 20011-20016Google Scholar). Collectively, these gene products facilitate the detoxication and elimination of toxic electrophilic and free radical metabolites of xenobiotics. The likely importance of these protective enzymes is highlighted by recent observations thatnrf2-knockout mice were considerably more sensitive to the acute toxicities of acetaminophen, butylated hydroxytoluene, and hyperoxia (21Enomoto A. Itoh K. Nagayoshi E. Haruta J. Kimura T. O'Conner T. Harada T. Yamamoto M. Toxicol. Sci. 2001; 59: 169-177Google Scholar, 22Chan K. Kan Y.W. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12731-12736Google Scholar, 23Chan K. Han X.D. Kan Y.W. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4611-4616Google Scholar, 24Cho H.-Y. Jedlicka A.E. Sekhar M.S. Reddy P.M. Zhang L.Y. Kensler T.W. Yamamoto M. Kleeberger S.R. Am. J. Respir. Cell Mol. Biol. 2001; 26: 42-51Google Scholar). These mice also form higher levels of DNA adducts following exposure to carcinogens such as aflatoxin B1, diesel particulate matter, and benzo[a]pyrene (25Kwak M.-K. Egner P.A. Dolan P.M. Ramos-Gomez M. Groopman J.D. Itoh K. Yamamoto M. Kensler T.W. Mutat. Res. 2001; 480–481: 305-315Google Scholar, 26Aoki Y. Sato H. Nishimura N. Takahashi S. Itoh K. Yamamoto M. Toxicol. Appl. Pharmacol. 2001; 173: 154-160Google Scholar, 27Ramos-Gomez M. Dolan P.M. Itoh K. Yamamoto M. Talalay P. Kensler T.W. Carcinogenesis. 2003; (in press)Google Scholar). Moreover,nrf2-disrupted mice are substantially more sensitive to the tumorigenicity of benzo[a]pyrene (28Ramos-Gomez M. Kwak M.-K. Dolan P.M. Itoh K. Yamamoto M. Talalay P. Kensler T.W. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 3410-3415Google Scholar). Dithiolethiones such as D3T, anethole dithiolethione, and oltipraz inhibit the toxicity and carcinogenicity of many chemical carcinogens in multiple target organs (29Wattenberg L.W. Bueding E. Carcinogenesis. 1986; 7: 1379-1388Google Scholar, 30Rao C.V. Rivenson A. Katiwalla M. Kelloff G.J. Reddy B.S. Cancer Res. 1993; 53: 2502-2506Google Scholar, 31Kensler T.W. Egner P.A. Dolan P. Groopman J.D. Roebuck B.D. Cancer Res. 1987; 47: 4271-4277Google Scholar, 32Kensler T.W. Groopman J.D. Eaton D.L. Curphey T.J. Roebuck B.D. Carcinogenesis. 1992; 13: 95-100Google Scholar) and are undergoing preclinical and clinical evaluations for use as cancer chemopreventive agents. Interestingly, the chemoprotective efficacy of dithiolethiones and other enzyme inducers is lost in nrf2-knockout mice (28Ramos-Gomez M. Kwak M.-K. Dolan P.M. Itoh K. Yamamoto M. Talalay P. Kensler T.W. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 3410-3415Google Scholar). Gene-disrupted animals provide elegant models for assessing the molecular mechanisms underlying the pharmacodynamic actions of chemopreventive agents. In this study, we have usednrf2-knockout mice and keap1-nrf2double knockout mice to probe the role of the Keap1-Nrf2-ARE signaling pathway in protecting cells against stress conditions. Through the use of oligonucleotide array technology it is apparent that not only are primary defense systems involving detoxication enzymes induced through this pathway, but that secondary defense mechanisms involving surveillance and repair of damaged biomolecules are also activated. Wild-type andnrf2-disrupted mice were generated from inbrednrf2 heterozygous mice (9Venugopal R. Jaiswal A.K. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 14960-14965Google Scholar, 11Kwak M.-K. Itoh K. Yamamoto M. Sutter T.R. Kensler T.W. Mol. Med. 2001; 7: 135-145Google Scholar).Keap1-nrf2 double knockout mice were generated by mating nrf2 −/− mice withkeap1 +/− mice to obtain the double homozygous mice (33Yamamoto M. Wakabayashi N. Ishii T. Kobayashi M. Kato Y. Itoh K. Proceedings of the 14th International Symposium on Microsomes and Drug Oxidation. Sapporo, Japan2002: 48Google Scholar). Genotypes were determined by PCR using primers TGGACGGGACTATTGAAGGCTG, GCCGCCTTTTCAGTAGATGGAGG, and GCGGATTGACCGTAATGGGATAGG for nrf2, and CGGGATCCCCATGGAAAGGCTTATTGAGTTC, GAAGTGCATGTAGATATACTCCC, and TCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCA for keap1. For the microarray analyses three male mice were used per group. Mice were fed AIN-76A semipurified diet for at least 10 days before treatment. 10–12-week-old mice were treated with 0.5 mmol/kg of D3T by gavage in a suspension consisting of 1% Cremophor and 25% of glycerol. Mice were sacrificed 6 h or 24 h after treatment, and livers were removed and snap-frozen. Additional mice were fed basal AIN-76A diet or diet supplemented with 0.03% (w/w) D3T for 7 days and sacrificed at day 8. The selected doses of D3T are the respective maximum tolerated doses for gavage and chronic dietary administration and do not affect body weight or other clinical signs over longer periods. It is estimated that the dietary dose provided about half of the amount of D3T per day that was administered in the single oral dose.Keap1-nrf2 double knockout mice were treated with either vehicle or D3T (0.5 mmol/kg) by gavage and sacrificed 24 h after treatment for microarray analysis of hepatic gene expression. Total RNA was isolated from frozen liver using the Totally RNA kit (Ambion, Austin, TX). Isolated RNA was then purified using the RNeasy Mini kit (Qiagen, Valencia, CA). cDNA was synthesized from total RNA using the Superscript Choice kit (Invitrogen, Carlsbad, CA) with a T7-(dT)24 primer. Biotin-labeled cRNA was prepared from cDNA by in vitro transcription (Enzo Biochemical, Farmingdale, NY) and fragmented by incubation at 94 °C for 45 min in 40 mm Tris acetate buffer, pH 8.1, with 100 mmpotassium and 30 mm magnesium acetate. Fragmented cRNA (12.5 μg) was hybridized at 45 °C for 16 h to a Murine Genome U74Av2 GeneChip® (Affymetrix, Santa Clara, CA) containing probes for ∼12,400 genes and expressed sequence tags (ESTs). Genechips were washed and stained using a fluid station and scanned using an Affymetrix Genechip system confocal scanner. Affymetrix Microarray Suite 4.1 was used for expression analysis and fluorescence intensity was measured for each probe array and normalized to the average fluorescence intensity for the entire probe array. Pairwise comparison between data from individual mice (n = 3), generating 9 comparisons, was performed. The change in gene expression for each gene was calculated as a ratio of average difference(D3T-treated)/average difference(vehicle-treated) and average fold changes from nine comparisons were obtained. To evaluate the reproducibility of paired comparisons, coefficients of variation (CV, S.D./mean) for the average difference change was applied, and 1.0 was used as a cutoff value (34Li J. Johnson J.A. Physiol. Genomics. 2002; 9: 137-144Google Scholar). After evaluating reproducibility, genes having comparison numbers of ≥7 were selected to filter out the false positive responses. Genespring software (Silicon Genetics, San Carlos, CA) and the Affymetrix Analysis Center website were used for the annotation of genes. For analysis of the distributions of gene families, expression levels of each gene category were plotted as histograms as described by Bouton and Pevsner (35Bouton C.M. Pevsner J. Bioinformatics. 2002; 18: 323-324Google Scholar). RT-PCR was performed on genes induced or repressed by D3T to confirm the microarray results. For the synthesis of cDNAs, 50 ng of total RNA was incubated for 20 min with 10 mm Tris (pH 8.4), 5 mm KCl, 5 mmMgCl2, 4 mm dNTPs, 0.125 μg of oligo(dT)12–18 and 30 units of M-MRV (Moloney Murine Leukemia Virus) reverse transcriptase (Invitrogen). PCR amplification for each gene was performed with a Fail Safe PCR kit (Epicentere, Madison, WI) using a DNA thermal cycler (MJ Research, Watertown, MA). Amplification conditions were 26–29 cycles for 5 min at 95 °C, 30 s at 56 °C and 40 s at 72 °C. PCR primers specific to NQO1, mEH, and albumin were used as described previously (11Kwak M.-K. Itoh K. Yamamoto M. Sutter T.R. Kensler T.W. Mol. Med. 2001; 7: 135-145Google Scholar). Other primers were synthesized by Integrated DNA Technology (Coralville, IA) and were as follows: GST Mu3 (GenBankTM accession numberJ03953) CAAGTTATGGACACCCGCAT and AGGCACTTGGGCTCAAACAT; UDP-glucose dehydrogenase (X06358) GACATGAATGACTACCAGAG and GTACGGAATTCTCTTGGAAG; heat shock protein 40 homolog b11 (AW122551) TACGATGATATCACTTCCTC and GGCGAGATTTCTATAAGATC; p58 (U28423) GTACGATGAAGCCATTCAGG and CCTTGCCATGAGTTCCAACT; proteasome subunit beta type 3 (AW045339) TTCAGCGTCCTGGTGGTGAT and ACAGAGCCTGTCATTGCTGG; 26 S proteasome-associated pad 1 homolog (Y13071); TATCAACACTCAGCAGAGCT and AATCCTTCCATCCAACTCT; 26 S proteasome ATPase 3 (AA409481) CCCTCAGACCACGGA and TGTGTGAGCGGGTATGAT; mCAR2 (AF009328) TTGTGCAGTTCAAGCCTCCAG and GCGTCCTCCATCTTGTAGCAA; carbonic anhydrase 3 (AJ006474) AACAGGAGCAAGAAAGAG and AGGTCTTCCCATTGTTCA. PCR products were electrophoresed on 1.8% agarose gels and the gel image captured and quantified with a VersaDoc Imaging System (BioRad). Oligonucleotide microarray was used to analyze the gene expression profiles in mouse liver following D3T treatment with a primary goal of identifying those genes that are regulated through the Keap1/Nrf2 signaling pathway. Expression levels of 352 genes (2.84% of the total genes on the array) were changed in the liver of wild-type mice 24 h after treatment with the potent chemoprotective agent D3T. 129 and 292 genes were increased 6 and 24 h after D3T treatment, respectively, while only 34 were elevated after feeding D3T for 1 week. Most of the D3T-induced genes were dependent on Nrf2 as 82, 79, and 97% of D3T-inducible genes were increased in wild-type mice but not innrf2–disrupted mice in the 6 h, 24 h, and dietary treatment groups, respectively (Fig.1). A much smaller number of genes were down-regulated by D3T (60 genes at 24 h). Also shown in Fig. 1, D3T suppressed the expression of 31 genes 24 h after treatment and 30 genes following dietary administration in wild-type mice only. Expression of most of these Nrf2-dependent, D3T-modulated genes was not altered in the keap1-nrf2double knockout mice 24 h after treatment with D3T. Only 15 out of the 231 Nrf2-dependent, D3T-inducible genes and 2 of the Nrf2-dependent, D3T-repressed genes were affected by D3T in these double knockout mice. Thus, D3T treatment altered the expression of only a modest subset of genes in the liver of wild-type mice and most of these genes were regulated through the Keap1/Nrf2 pathway. Comparisons of expression patterns at different time points indicated that maximal changes occurred 24 h after a single administration of D3T. Genes up-regulated by D3T in wild-type, but notnrf2-disrupted mice, were regarded as Nrf2-dependent, D3T-inducible genes. The 231 Nrf2-dependent genes elevated 24 h after treatment with D3T can be classified in several functional categories including xenobiotic metabolizing enzymes, antioxidants, chaperone/stress response proteins, ubiquitin/proteasome systems, acute response/immunity proteins, cytoskeletal organization proteins, protein trafficking proteins, membrane transport proteins, signaling molecules, transcription factors and regulators, and RNA processing/translation-related factors (TableI). As expected from earlier studies, a substantial number (26Aoki Y. Sato H. Nishimura N. Takahashi S. Itoh K. Yamamoto M. Toxicol. Appl. Pharmacol. 2001; 173: 154-160Google Scholar) of genes related to xenobiotic metabolism were induced by D3T treatment in anrf2-dependent manner. This gene category includes seven genes belonging to cytochrome P450 subfamilies. Ten genes related to glutathione synthesis and conjugation were induced by D3T only in wild-type mice and those included seven subunits of GSTs, glutathione reductase, and the regulatory and catalytic subunits of γ-glutamylcysteine ligase. NQO1, mEH, and UDP-glucuronosyl transferase 2 were also induced. Flavin-containing monooxygenase-1, carbonyl reductase and aldo-keto reductase family 1 were previously unrecognized D3T-inducible genes in mouse liver regulated through Nrf2. These results confirmed our previous observations that xenobiotic detoxifying genes are a major category of genes affected by D3T and nrf2 genotype. Several antioxidative genes were also induced by D3T; thioredoxin, thioredoxin reductase, and peroxiredoxin transcripts were increased by 2.2-, 3.2-, and 1.7-fold, respectively, 24 h after treatment. General enzymes including nucleotide diphosphatase (3.9-fold), aldolase 1A (2.2-fold), and amino levulinate synthase 1 (3.9-fold) were increased only in wild-type mice. UDP-glucose dehydrogenase was increased by D3T only in wild-type mice 6 h after treatment and in both genotypes 24 h after treatment; however, the induction in wild-type (7.5-fold) was much higher than in nrf2-disrupted (1.7-fold) mice.Table IHepatic Keap1-Nrf2-dependent, D3T-inducible genesCategories of genesAccession no.Description of genesAFC (D3T/vehicle)WTaGenes induced by D3T in wild type mice only, but not in nrf2-disrupted mice following single administration (6 h and 24 h) or administration in diet for 7 days compared to vehicle-treated wild-type mice.nrf2-keap1bGenes induced by D3T in keap1-nrf2 double knockout mice 24 h after treatment compared to vehicle-treated double knockout mice. Listed genes exhibited CV < 1 and appeared in at least seven of nine comparisons as described in “Experimental Procedures.” No value indicates no effect on gene expression under these criteria. double KO6 h24 hDiet (7 days)24 hChaperoneU27830Stress-induced phosphoprotein 12.04system/stressM18186Heat shock protein, 84 kDa 12.22response genesZ97207Butyrate-induced transcript 12.43AW122551Hsp40 homolog, subfamily B, member 114.14AI835630Hsp40 homolog, subfamily B, member 91.97J04633Hsp, 86 kD 14.11U28423p585.21AI835981Similar to cisplatin-resistance related protein2.17AI835644Endoplasmic reticulum protein 291.96AJ005253ClpP protease1.97Z31399η subunit of the chaperonin containing TCP-11.92X58990Peptidylprolyl isomerase B2.00U16959FK506-binding protein 54.562.77AI848798Crystallin, α C2.04AI846938Homocysteine-inducible, endoplasmic reticulumStress-inducible, ubiquitin-like domain member 11.51Ubiquitin-proteasomeAI836804Psma1, proteasome α-subunit 12.17AJ851441Psma4, proteasome α-subunit 42.16AW048997Psma5, proteasome α-subunit 51.34AW121552Psma6, proteasome α-subunit 61.80AI836676Psma7, proteasome α-subunit 72.71U60824Psmb1, proteasome β-subunit 11.87AI853269Psmb2, proteasome β-subunit 22.17AW045339Psmb3, proteasome β-subunit 32.91U65636Psmb4, proteasome β-subunit 42.28AB003304Psmb5, proteasome β-subunit 52.85UI3393Psmb6, proteasome β-subunit 62.23U39302Psmc1, proteasome subunit, ATPase 12.39AA409481Psmc3, proteasome subunit, ATPase 32.01AW123318Psmd1, proteasome subunit, nonATPase 12.90AI835520Psmd5, proteasome subunit nonATPase 53.11M64641Psmd7, proteasome subunit nonATPase 72.03AW121693Psmd11, proteasome subunit nonATPase 111.512.35AI838669Psmd12, proteasome subunit nonATPase 123.25AW045451Psmd13, proteasome subunit nonATPase 132.11Y1307126 S proteasome-associated pad1 homolog3.51D49686Tat-binding protein-12.93AW120683Ubiquitin-conjugating enzyme E2–322.91AI836406Ubiquitin 21.852.93AW060186Ubiquitin-specific protease 142.17X51703Ubiquitin b1.41AB011081Huntingtin-interacting protein-22.53Z14044Murine valosin-containing protein1.302.50Xenobiotic-metabolizingX04283Cyp1a21.34enzymesM19319Cyp2a412.38L06463Cyp2a122.41X63023Cyp3a131.80AB018421Cyp4a102.51Y11638Cyp4a145.669.45AF047726Cyp2c394.473.89U12961NAD(P)H menadione oxidoreductase (NQO1)5.245.98J03952GlutathioneS-transferase, mu 11.453.07J04696GlutathioneS-transferase, mu 24.41J03953GlutathioneS-transferase, mu 31.744.63L06047GlutathioneS-transferase, alpha 41.393.25J03958GlutathioneS-transferase, alpha 22.175.86X98056GlutathioneS-transferase, theta 23.321.84AI843448Microsomal glutathione S-transferase 31.52U85414γ-glutamylcysteine synthetase, catalytic3.632.83U95053γ-glutamylcysteine synthetase, regulatory1.562.36U89491Microsomal epoxide hydrolase2.734.032.69X06358UDP-glucuronosyltransferase 2 family, member 51.401.88D16215Flavin-containing monooxygenase 11.632.62U31966Carbonyl reductase1.515.94A1839814Aldo-keto reductase family 1, member A11.84AB017482Aldehyde oxidase 12.89AntioxidantAI851983Glutathione reductase 11.574.50A1118194Peroxiredoxin 11.66AB023564Type 1 peroxiredoxin1.69X77585Thioredoxin1.282.161.22AB027565Thioredoxin reductase 12.673.18General enzymesAF061017UDP-glucose dehydrogenase3.78J02652Malate oxidoreductase1.96Y00516Aldolase 1, A isoform1.612.19AF033381Betaine homocysteine methyl transferase1.92M73329Phospholipase C-α3.32U51805Arginase2.22M28666Porphobilinogen deaminase2.01U18975β-1, 4N-acetylgalactosaminyltransferase1.77K01515Hypoxanthine phosphoribosyltransferase1.88AF118128Nuclear RNA helicase Bat11.96AI846600Monoglyceride lipase1.74L31777Triosephosphate isomerase1.79M63245Amino levulinate synthase 11.573.943.43AW1242011-acylglycerol-3-phosphateO-acyltransferase 31.85AB025408Esterase 101.89AF080580Coq72.62X68378Cathepsin d2.01AW125874Asparaginyl-rRNA synthetase2.58AW122030Similar to phosphoserine aminotransferase9.00AW210370Glucan (1,4-α-), branching enzyme 11.852.43AI574278Insulin-degrading enzyme2.11AW045202Similar to disullide isomerase-related protein2.71AI849453Cytoplasmic tRNA synthetases1.442.45AW120896Deoxyribonuclease H α2.453.94AI840339Ribonuclease, RNase A family 41.54AI196896Fibrinogen β1.28Z23077S-adenosylmethionine decarboxylase1.95L09737GTP cyclohydrolase 11.46AF071068Aromatic-L-amino-acid decarboxylase1.99AF020039NADP-dependent isocitrate dehydrogenase1.39AF071068Dopa decarboxylase1.99AI851321Uridindiphosphoglucosepyrophosphorylase 21.35AW125336Pyruvate dehydrogenase β1.23AI117848Similar to mannosyl (α-1,6-)-2.06Glycoprotein β-1,2-N-acetylglucosaminyltransferaseAI194855Tryptophan 2,3-dioxygenase1.25AI840013Δ2-enoyl-coenzyme A isomerase1.72Kinase/phosphataseAJ238636Nucleoside diphosphatase2.393.891.57AI845584Dual specificity phosphatase 62.43Cell growthAW049795Transforming growth factor β-regulated gene 12.57U35142Retinoblastoma-binding protein mRbAp461.92AF084524Cellular repressor of EIA-stimulated genes2.033.251.58M605231db31.61AI326963Angiopoietin-like 41.52ApoptosisAF061972Tat-interacting protein TIP303.03AF041054EIB 19K/Bcl-2-binding protein homolog1.791.55US1052Defender against Apoptotic Death (Dad1) gene1.83AI837599Neural stem cell derived survival protein precursor2.31AV373612Bag32.45AA260005Pawr1.56Signal transductionU06834Eph receptor B42.91Signal regulatingX56831Mannose-6-phosphate-receptor2.04moleculeAW123904GABA receptor-associated protein-like 11.31AF023482HSI-associating protein1.82AF069542NFκB essential modulator2.46AF020185Protein inhibitor of nitric-oxide synthase, light chain 12.13AW121185Protein inhibitor of nitric-oxide synthase, heavy chain 11.85AF100694Pontin523.89L32751Ran2.71D86563Rab 41.372.27U37413Gna11, guanine nucleotide-binding protein2.23D29802p205, G protein β subuit-like1.79AF115480cAMP-dependent Rap1Guanine-nucleotide exchange factor2.222.19AV349152Regulator ofG-protein signaling 162.28Y00884Cai, calcium-binding protein4.23D87898ARF12.01AJ222586Precursor NEFA protein6.15Cellular communicationM81445Connexin1.441.39Protease inhibitorX69832Serine proteinase inhibitor 2,42.977.57M64086Spl2 proteinase inhibitor3.29Transcription factorM94087mATF41.66Nuclear receptor andAW123880X-box binding protein 12.08regulatorsAB012276ATF73.61U70736COP9 subunit 52.23AF009328mCAR2 (Nuclear receptor subfamily 1)2.692.45J03297Tumor rejection antigen gp965.54Zinc finger proteinsAF062071Zinc finger protein ZNF2162.23mRNA processingAJ839477Poly(rC)-binding protein 11.97L15447Small nuclear RNA1.92AI183202Heterogeneous nuclear ribonucleoprotein A13.73U14648Splicing factor, arginine/serine-rich 101.55Protein synthesisU76112Translation repressor NAT12.03AB003502Guanine nucleotide regulatory protein-11.96X15267Acidic ribosomal phosphoprotein PO1.74M25149Tissue-specific transplantation antigen P91A2.43AW061243eIF2a1.83U70733eIF3-p441.89U67328Translation initiator factor3s81.99M1140816 S ribosomal protein1.69AI839717Ribosomal protein L181.79Protein traffickingAF096868Vesicle-docking protein, 115kD2.43AI843665Sec23a1.79AI848343Sec23b1.67AB032902Sec611.8AB025218Int