Title: Cell Wall Anchor Structure of BcpA Pili in Bacillus anthracis
Abstract: Assembly of pili in Gram-positive bacteria and their attachment to the cell wall envelope are mediated by sortases. In Bacillus cereus and its close relative Bacillus anthracis, the major pilin protein BcpA is cleaved between the threonine and the glycine of its C-terminal LPXTG motif sorting signal by the pilin-specific sortase D. The resulting acyl enzyme intermediate is relieved by the nucleophilic attack of the side-chain amino group of lysine within the YPKN motif of another BcpA subunit. Cell wall anchoring of assembled BcpA pili requires sortase A, which also cleaves the LPXTG sorting signal of BcpA between its threonine and glycine residues. We show here that sortases A and D require only the C-terminal sorting signal of BcpA for substrate cleavage. Unlike sortase D, which accepts the YPKN motif as a nucleophile, sortase A forms an amide bond between the BcpA C-terminal carboxyl group of threonine and the side-chain amino group of diaminopimelic acid within the cell wall peptidoglycan of bacilli. These results represent the first demonstration of a cell wall anchor structure for pili, which are deposited by sortase A into the envelope of many different microbes. Assembly of pili in Gram-positive bacteria and their attachment to the cell wall envelope are mediated by sortases. In Bacillus cereus and its close relative Bacillus anthracis, the major pilin protein BcpA is cleaved between the threonine and the glycine of its C-terminal LPXTG motif sorting signal by the pilin-specific sortase D. The resulting acyl enzyme intermediate is relieved by the nucleophilic attack of the side-chain amino group of lysine within the YPKN motif of another BcpA subunit. Cell wall anchoring of assembled BcpA pili requires sortase A, which also cleaves the LPXTG sorting signal of BcpA between its threonine and glycine residues. We show here that sortases A and D require only the C-terminal sorting signal of BcpA for substrate cleavage. Unlike sortase D, which accepts the YPKN motif as a nucleophile, sortase A forms an amide bond between the BcpA C-terminal carboxyl group of threonine and the side-chain amino group of diaminopimelic acid within the cell wall peptidoglycan of bacilli. These results represent the first demonstration of a cell wall anchor structure for pili, which are deposited by sortase A into the envelope of many different microbes. Many Gram-positive bacteria use pili, protein fibers that project from microbial surfaces, to adhere to and invade host tissues or form biofilms (1Telford J.L. Barocchi M. Margarit I. Rappuoli R. Grandi G. Nat. Rev. Microbiol. 2006; 4: 509-519Crossref PubMed Scopus (359) Google Scholar). Gram-positive pili are assembled from pilin subunits that are synthesized as precursors with N-terminal signal peptides and C-terminal sorting signals in the bacterial cytoplasm (P1) (2Ton-That H. Schneewind O. Mol. Microbiol. 2003; 50: 1429-1438Crossref PubMed Scopus (285) Google Scholar). The signal peptide is cleaved and precursors translocated through the bacterial membrane by the Sec machinery, thereby generating the P2 precursor (3Ton-That H. Schneewind O. Trends Microbiol. 2004; 12: 251-261Abstract Full Text Full Text PDF PubMed Scopus (194) Google Scholar, 4Budzik J.M. Marraffini L.A. Souda P. Whitelegge J.P. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 2008; 105: 10215-10220Crossref PubMed Scopus (74) Google Scholar). Assembly of pili involves the polymerization of the major pilin protein, a reaction that is catalyzed by pilin-specific sortase (2Ton-That H. Schneewind O. Mol. Microbiol. 2003; 50: 1429-1438Crossref PubMed Scopus (285) Google Scholar, 5Ton-That H. Marraffini L. Schneewind O. Mol. Microbiol. 2004; 53: 1147-1156Crossref PubMed Scopus (156) Google Scholar), designated sortase D in pathogenic Bacillus sp. (6Budzik J.M. Marraffini L.A. Schneewind O. Mol. Microbiol. 2007; 66: 495-510Crossref PubMed Scopus (77) Google Scholar). Pilin-specific sortases perform a transpeptidation reaction, whereby the C-terminal LPXTG motif sorting signal of the major pilin protein, BcpA in bacilli, is cleaved between the threonine and the glycine residue (4Budzik J.M. Marraffini L.A. Souda P. Whitelegge J.P. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 2008; 105: 10215-10220Crossref PubMed Scopus (74) Google Scholar). Intermediary product of this reaction is a thioester-linked acyl-enzyme between the active site cysteine residue of sortase and the carboxyl group of threonine (7Ton-That H. Liu G. Mazmanian S.K. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12424-12429Crossref PubMed Scopus (479) Google Scholar, 8Maresso A.W. Wu R. Kern J.W. Zhang R. Janik D. Missiakas D.M. Duban M.E. Joachimiak A. Schneewind O. J. Biol. Chem. 2007; 282: 23129-23139Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar). Nucleophilic attack of the ϵ-amino group of lysine within the YPKN pilin motif of another BcpA subunit resolves the sortase D intermediate and generates the amide bond between the C-terminal carboxyl group of threonine and the side-chain amino group of lysine of adjacent BcpA subunits (4Budzik J.M. Marraffini L.A. Souda P. Whitelegge J.P. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 2008; 105: 10215-10220Crossref PubMed Scopus (74) Google Scholar). Conservation of pilin-specific sortase, the YPKN motif, and C-terminal sorting signal in the major subunit of pilin proteins suggests that pilus assembly occurs by a universal mechanism in Gram-positive bacteria (2Ton-That H. Schneewind O. Mol. Microbiol. 2003; 50: 1429-1438Crossref PubMed Scopus (285) Google Scholar). Pili are anchored to the cell wall envelope of Gram-positive bacteria by a mechanism that requires sortase A (6Budzik J.M. Marraffini L.A. Schneewind O. Mol. Microbiol. 2007; 66: 495-510Crossref PubMed Scopus (77) Google Scholar, 9Dramsi S. Caliot E. Bonne I. Guadagnini S. Prevost M.C. Kojadinovic M. Lalioui L. Poyart C. Trieu-Cuot P. Mol. Microbiol. 2006; 60: 1401-1413Crossref PubMed Scopus (197) Google Scholar, 10Swaminathan A. Mandlik A. Swierczynski A. Gaspar A. Das A. Ton-That H. Mol. Microbiol. 2007; 66: 961-974Crossref PubMed Scopus (101) Google Scholar, 11Nobbs A.H. Rosini R. Rinaudo C.D. Maione D. Grandi G. Telford J.L. Infect. Immun. 2008; 76: 3550-3560Crossref PubMed Scopus (75) Google Scholar). Sortase A is otherwise known to cut the C-terminal LPXTG sorting signal of surface proteins and immobilize anchored products in the cell wall envelope of Gram-positive bacteria (12Navarre W.W. Schneewind O. Mol. Microbiol. 1994; 14: 115-121Crossref PubMed Scopus (312) Google Scholar, 13Schneewind O. Fowler A. Faull K.F. Science. 1995; 268: 103-106Crossref PubMed Scopus (377) Google Scholar). In Staphylococcus aureus, sortase A acyl enzyme intermediates are resolved by the nucleophilic attack of lipid II (14Ton-That H. Mazmanian H. Faull K.F. Schneewind O. J. Biol. Chem. 2000; 275: 9876-9881Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar, 15Perry A.M. Ton-That H. Mazmanian S.K. Schneewind O. J. Biol. Chem. 2002; 277: 16241-16248Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar), the biosynthetic precursor of peptidoglycan biosynthesis or, more specifically, the amino group of its cross-bridge, pentaglycine in S. aureus (16Higashi Y. Strominger J.L. Sweeley C.C. Proc. Natl. Acad. Sci. U. S. A. 1967; 57: 1878-1884Crossref PubMed Scopus (155) Google Scholar, 17Ghuysen J.-M. Tipper D.J. Birge C.H. Strominger J.L. Biochemistry. 1965; 4: 2245-2254Crossref Scopus (68) Google Scholar). In contrast to surface proteins, which are directly incorporated by sortase A into peptidoglycan (18Mazmanian S.K. Liu G. Ton-That H. Schneewind O. Science. 1999; 285: 760-763Crossref PubMed Scopus (794) Google Scholar, 19Mazmanian S.K. Liu G. Jensen E.R. Lenoy E. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 5510-5515Crossref PubMed Scopus (383) Google Scholar, 20Gaspar A.H. Marraffini L.A. Glass E.M. DeBord K.L. Ton-That H. Schneewind O. J. Bacteriol. 2005; 187: 4646-4655Crossref PubMed Scopus (70) Google Scholar), the mechanisms that provide for the deposition of pili in the cell wall envelope are still unknown. Unlike surface proteins, pili must first be assembled by pilin-specific sortase and then be deposited in the envelope (21Oh S.-Y. Budzik J.M. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 2008; 105: 13703-13704Crossref PubMed Scopus (18) Google Scholar). The latter requires the aforementioned signal peptide, YPKN pilin motif, and sorting signal, however, the requirements for substrate recognition of the major pilin by sortase A are still unknown. Further, the anchored product of the sortase A-mediated reaction, presumably pilin protein linked to cell wall, has not been characterized. Both of these questions are addressed in this report. Bacterial Plasmids and Strains—PCR with primer pairs P2 (encompassing an XbaI site) and P101 (NheI) amplified bcpA between residues 26 and 515 (Table 1). Primers P102 (NheI) and P103 (KpnI) amplified a fragment of bcpA beginning at residue 516 with the MH6 tag and srtD. Primer pairs P2/P101 and P102/103 generated PCR products that were digested with XbaI/NheI and NheI/KpnI and ligated into pLM5 digested with XbaI/KpnI to create pJB40. pJB39 (6Budzik J.M. Marraffini L.A. Schneewind O. Mol. Microbiol. 2007; 66: 495-510Crossref PubMed Scopus (77) Google Scholar) encodes wild-type bcpA-srtD under control of the IPTG 3The abbreviations used are: IPTGisopropyl 1-thio-β-d-galactopyranosideNi-NTAnickel-nitrilotriacetic acidRP-HPLCreverse-phase high-performance liquid chromatographyMALDI-MSmatrix-assisted laser desorption ionization-mass spectrometryGSTglutathione S-transferaseSSsorting signalHRPhorseradish peroxidasem-Dapmeso-diaminopimelic acidCADcollision-activated dissociation -inducible Pspac promoter. To generate pJB173 and pJB169, plasmids lacking srtD, pJB39 and pJB40 were amplified with Pfu DNA polymerase and P88/P89. Amplified plasmids were first incubated for 3 h with DpnI to digest methylated parental plasmid DNA and were then digested with KpnI for 2 h. Digested plasmid DNA was ligated and transformed into Escherichia coli DH5α (22Hanahan D. J. Mol. Biol. 1983; 166: 557-572Crossref PubMed Scopus (8213) Google Scholar).TABLE 1Primers used in this studyPrimerRestriction siteNucleic acid sequence (5′ -3′)2XbaIAAAtctagaGCACACTATTGCTTTTAAGAAGG17PstIGTTAAATTAACGATAGAActgcagAAAAGTGGATGGATTCTTC18PstIGAAGAATCCATCCACTTTTctgcagTTCTATCGTTAATTTAAC19PstIActcgagATCTTTTGAAGGGTGATGAATATATG20PstIAAActgcagTTTAATACTGTTCCCATCAAATAC88KpnIAAAggtaccAATACCTCCCAAAACAAGATTTC89KpnIAAAggtaccATCCTATTGTTATGTGTGTTTCTA101NheIAAAgctagcACTTTTATTATTTTCTATCGTTAATTTA102NheIAAAgctagcatgcatcaccatcaccatcacGGATGGATTCTTCCGGTAACG103KpnIAAAggtaccTTATCTTTGAATTTCCGGTCCC173NoneTTATACAACTTTAATTACGGCTACGCCTTATGGAATAAAC174NoneGTTTATTCCATAAGGCGTAGCCGTAATTAAAGTTGTATAA Open table in a new tab isopropyl 1-thio-β-d-galactopyranoside nickel-nitrilotriacetic acid reverse-phase high-performance liquid chromatography matrix-assisted laser desorption ionization-mass spectrometry glutathione S-transferase sorting signal horseradish peroxidase meso-diaminopimelic acid collision-activated dissociation pJB12 (6Budzik J.M. Marraffini L.A. Schneewind O. Mol. Microbiol. 2007; 66: 495-510Crossref PubMed Scopus (77) Google Scholar) encodes bcpA-srtD-bcpB under control of the IPTG-inducible Pspac promoter. pJB1 (23Marraffini L.A. Schneewind O. J. Bacteriol. 2007; 189: 6425-6436Crossref PubMed Scopus (33) Google Scholar) was used for expression of an untagged version of PlyL amidase (24Low L.Y. Yang C. Perego M. Osterman A. Liddington R.C. J. Biol. Chem. 2005; 280: 35433-35439Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar). pJB69 encodes bcpA-gst-srtD driven by the Pspac promoter (4Budzik J.M. Marraffini L.A. Souda P. Whitelegge J.P. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 2008; 105: 10215-10220Crossref PubMed Scopus (74) Google Scholar) and was used as a template to generate pSY8. pSY8 encodes for the cell wall sorting signal of bcpA fused to isdX1 at is N terminus and gst at its C terminus. To swap the bcpA coding region preceding its cell wall sorting signal with isdX1 in pJB69, a PstI site was generated 15 nucleotides upstream of the DNA sequence encoding for the LPVTG cell wall sorting signal with quick change mutagenesis and primers P17/18, as described previously (6Budzik J.M. Marraffini L.A. Schneewind O. Mol. Microbiol. 2007; 66: 495-510Crossref PubMed Scopus (77) Google Scholar). The resulting plasmid, pJB69-PstI, was digested with XbaI, blunt-ended, and digested with PstI. The purified plasmid fragment was ligated with PstI-digested isdX1 Pfu PCR product. Plasmid variants lacking srtD or containing srtD with active site cysteine 207 to alanine substitution were generated by quick change. Primers P173/174 generated pSY13 (isdX1SS-gst-srtDC207A). Primers P88/89 generated pSY14 (isdX1SS-GST). Fractionation of Bacillus Cultures—B. anthracis strain Sterne F32 or its isogenic variant AHG263 (srtA::ermC) (20Gaspar A.H. Marraffini L.A. Glass E.M. DeBord K.L. Ton-That H. Schneewind O. J. Bacteriol. 2005; 187: 4646-4655Crossref PubMed Scopus (70) Google Scholar) harboring pLM5 or plasmids encoding for B. cereus pilus genes were grown overnight at 30 °C on LB agar plates containing kanamycin and IPTG. Bacilli were suspended in 100 mm NaCl, vortexed briefly, and centrifuged for 2 min at 6000 × g. Cells were washed two more times in 0.1 m NaCl. The sediment was analyzed by immunoelectron microscopy with α-BcpA antisera and 10 nm gold anti-rabbit IgG conjugate as previously reported with additional wash steps between secondary antibody labeling and fixation with glutaraldehyde (6Budzik J.M. Marraffini L.A. Schneewind O. Mol. Microbiol. 2007; 66: 495-510Crossref PubMed Scopus (77) Google Scholar). For immunoblotting experiments, cells were extracted for 10 min by boiling with 500 μl of 6 m urea, 1% SDS, 50 mm Tris-HCl, pH 9.5, releasing the cytoplasm and membrane fractions (25Maresso A.W. Chapa T.J. Schneewind O. J. Bacteriol. 2006; 188: 8145-8152Crossref PubMed Scopus (107) Google Scholar). Bacterial samples were washed in water, extracted with 5% trichloroacetic acid, and peptidoglycan-digested with mutanolysin (6Budzik J.M. Marraffini L.A. Schneewind O. Mol. Microbiol. 2007; 66: 495-510Crossref PubMed Scopus (77) Google Scholar). Sortase A was detected by immunoblotting of extracts of bacilli that had been concentrated by precipitation with 8% trichloroacetic acid. Purification of Cell Wall-anchored Pilin—B. anthracis strain Sterne F32 harboring pJB169 was grown for 20 h at 30 °C in 6 liters of LB broth containing 10 μg/ml kanamycin and 1 mm IPTG. For mutanolysin treatment, cells were washed with 100 ml of double distilled water (ddH2O) and extracted by boiling with 100 ml of 6 m urea, 1% SDS, 50 mm Tris-HCl, pH 9.5. Murein sacculi were washed in ddH2O, extracted by boiling in 5% trichloroacetic acid, washed in 50 mm Tris-HCl (pH 6.3)-1.5 mm MgCl2, and peptidoglycan-digested with 20,000 units of mutanolysin (23Marraffini L.A. Schneewind O. J. Bacteriol. 2007; 189: 6425-6436Crossref PubMed Scopus (33) Google Scholar). For PlyL digestion, sedimented bacilli were washed once in 100 ml of 50 mm Tris-HCl (pH 7.5) and suspended in 50 ml of the same buffer supplemented with 5 mm phenylmethanesulfonyl fluoride (26Marraffini L.A. Schneewind O. J. Biol. Chem. 2005; 280: 16263-16271Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). Cell walls were broken in a bead beater instrument (Biospec Products Inc.) by 10 pulses of 1 min, followed by 5 min of incubation on ice. The crude lysate was decanted to remove the glass beads and centrifuged at 33,000 × g for 15 min to sediment cell wall sacculi and membranes. Sediment was treated with 1% Triton X-100, 100 mm phosphate (pH 7.5), and 1 mm phenylmethanesulfonyl fluoride, and peptidoglycan was then treated with PlyL as described previously (23Marraffini L.A. Schneewind O. J. Bacteriol. 2007; 189: 6425-6436Crossref PubMed Scopus (33) Google Scholar). Following cell wall digestion, insoluble material was removed by centrifugation at 33,000 × g. The pH of the samples was adjusted to 7.5 with 2 m sodium phosphate dibasic, and BcpAMH6 was purified by Ni-NTA affinity chromatography (26Marraffini L.A. Schneewind O. J. Biol. Chem. 2005; 280: 16263-16271Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). Purification of Pilin Anchor Peptides—Purified BcpAMH6 was methanol-chloroform-precipitated and cleaved with CNBr (26Marraffini L.A. Schneewind O. J. Biol. Chem. 2005; 280: 16263-16271Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). Anchor peptides were purified by a second round of Ni-NTA affinity chromatography under denaturing conditions and separated by reverse-phase high-performance liquid chromatography (RP-HPLC) with uv detection using a C18 column with a linear gradient from 1% to 99% acetonitrile (CH3CN) in 0.1% formic acid in 100 min, as previously reported for BcpA pilin peptides (4Budzik J.M. Marraffini L.A. Souda P. Whitelegge J.P. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 2008; 105: 10215-10220Crossref PubMed Scopus (74) Google Scholar). MALDI-MS—Aliquots of RP-HPLC fractions (0.5 μl) were co-spotted with matrix (0.5 μl of α-cyano-4-hydroxycinnamic acid) prepared at 10 mg/ml in CH3CN-water-trifluoroacetic acid (30:40:0.1), 4 mm (NH4)2HPO4. Matrix-assisted laser desorption ionization-mass spectrometry (MALDI-MS) spectra were obtained in a reflectron time-of-flight instrument (ABI Biosystems MALDI 4700) in reflectron mode. Spectra were acquired using external calibration with bovine insulin. Theoretical parent ion and fragmentation ion monoisotopic m/z values were produced with ProteinProspector version 4.27.2 MS-Product web-based program (University of California-San Francisco, prospector.ucsf.edu). Edman Degradation—RP-HPLC samples of anchor peptides were dried under vacuum and submitted for Edman sequencing at the University of Illinois at Urbana-Champaign Biotechnology Center Protein Sciences Facility. Substrate Properties Control the Fate of Pilin Precursors—Previous work demonstrated that sortase A and sortase D both cleave the major pilin protein precursor BcpA, but left unresolved the substrate requirements of these enzymes. To address this, we used pJB69, encoding bcpA-gst srtD, and transformed this plasmid into B. anthracis Sterne (expressing sortase A) or its isogenic srtA variant (Fig. 1A). Processing of BcpA-GST was monitored by separating whole bacterial extracts on SDS-PAGE followed by immunoblotting with antibodies specific for GST (Fig. 1B). Bacilli expressing both enzymes (A and D) or only sortase D both cut BcpA-GST precursor between the threonine and the glycine of its LPVTG sorting signal and generated GST cleavage products (Fig. 1B). Bacilli lacking sortase A and D cannot cleave this hybrid substrate (4Budzik J.M. Marraffini L.A. Souda P. Whitelegge J.P. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 2008; 105: 10215-10220Crossref PubMed Scopus (74) Google Scholar). In the presence of sortase D, BcpA is polymerized into pili, whereas sortase A is thought to immobilize pili in the cell wall envelope (4Budzik J.M. Marraffini L.A. Souda P. Whitelegge J.P. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 2008; 105: 10215-10220Crossref PubMed Scopus (74) Google Scholar). Pilus assembly requires the YPKN pilin motif and CNA B domain of BcpA (4Budzik J.M. Marraffini L.A. Souda P. Whitelegge J.P. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 2008; 105: 10215-10220Crossref PubMed Scopus (74) Google Scholar). It is not known, however, whether these elements are also required for substrate recognition, defined here as sortase cleavage of the pilin sorting signal (SS). To test this, we generated plasmid pSY8, encoding isdX1SS-gst srtD. Under physiological conditions, bacilli secrete IsdX1 via its N-terminal signal peptide into the extracellular medium, where the soluble protein binds hemoglobin and scavenges heme with its NEAT domain (27Maresso A.W. Garufi G. Schneewind O. PLoS Pathogens. 2008; 4: e1000132Crossref PubMed Scopus (104) Google Scholar). Fusion of IsdX1 to the sorting signal of BcpA (SS) and GST generated a hybrid that was cleaved by bacilli expressing both sortase D and sortase A, or only one of these enzymes, but not by bacilli that lacked sortase A and D (Fig. 1, A and B). To verify that the active site cysteine of sortase D is involved in substrate cleavage, we generated an alanine substitution mutant (DC207A). Although sortase DC207A was expressed at the same level as the wild-type enzyme, the mutant was unable to cleave IsdX1SS-GST substrate (Fig. 1, B and C). Of note, expression of sortase DC207A in wild-type bacilli appeared to reduce the ability of sortase A to cleave IsdX1SS-GST, suggesting that the mutant sortase may interact with the substrate in a manner that interferes with its recognition by the other sortase (Fig. 1, B and C). As a control, expression of sortase DC207A did not affect the abundance of sortase A in bacilli (Fig. 1B). Sortase A, but not sortase D, cleavage of IsdX1SS-GST led to the deposition of IsdX1 in the cell wall envelope of bacilli (Fig. 1C). Together these findings support a model, whereby sortase A acyl intermediates can only be resolved by the nucleophilic attack of lipid II, whereas sortase D intermediates must be resolved by the nucleophilic attack of BcpA unless hydrolysis at the active site thioester precipitates release of product into the extracellular medium (21Oh S.-Y. Budzik J.M. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 2008; 105: 13703-13704Crossref PubMed Scopus (18) Google Scholar). Finally, the pilin sorting signal alone is sufficient for sortase A cleavage of BcpA at the LPVTG motif and, following completion of the transpeptidation reaction, for transfer of the cleaved product into the cell wall envelope. Purification of Anchored Pilin from the Cell Wall Envelope of Bacilli—B. anthracis was transformed with pJB12, a plasmid that encodes bcpA-srtD-bcpB under control of the IPTG-inducible Pspac promoter (6Budzik J.M. Marraffini L.A. Schneewind O. Mol. Microbiol. 2007; 66: 495-510Crossref PubMed Scopus (77) Google Scholar) (Fig. 2A). In the presence of sortase A and D, BcpA was assembled into cell wall-anchored pili as demonstrated by immunogold-electron microscopy (Fig. 2C). Pilus formation was also confirmed by immunoblotting of covalently cross-linked high molecular weight polymers in the stack of SDS-PAGE that had been released from murein sacculi by treatment with mutanolysin (Fig. 2B). In the absence of sortase D (pJB173), sortase A deposited BcpA into the cell wall envelope (Fig. 2B). Sortase A did not form pili from BcpA and instead caused the near uniform distribution of anchored product in the cell wall envelope of bacilli (Fig. 2C). In the absence of both sortase A and sortase D, BcpA was not found in the envelope of bacilli, similar to a B. anthracis control harboring the empty vector plasmid pLM5 (Fig. 2C). To analyze the cell wall anchor structure of BcpA, we engineered BcpAMH6 with an insertion of methionyl-six histidyl (MH6) upstream of the LPVTG motif sorting signal of BcpA (Fig. 2A). Cell wall-anchored BcpAMH6 was detected in mutanolysin extracts of B. anthracis (pJB169) by immunoblot with antibodies specific for BcpA (α-BcpA) or staining with His-HRP (Fig. 2B). Electron microscopy and immunogold labeling with BcpA-specific antibodies revealed gold particle deposition on the surface of bacilli expressing BcpAMH6 (pJB169), but not for B. anthracis harboring the empty vector (pLM5) control (Fig. 2C). In the absence of srtA, BcpA- and BcpAMH6-specific gold conjugate deposits were not detected in the envelope of bacilli (Fig. 2C). As BcpAMH6 is anchored to the cell wall of bacilli in a manner similar to BcpA, we employed this reporter to examine the anchoring of pilin protein to the peptidoglycan. BcpAMH6 was solubilized from purified cell wall of B. anthracis (pJB169) with two different murein hydrolases and released protein was subjected to affinity chromatography on Ni-NTA. PlyL amidase cleaves the amide bond between MurNAc and l-Ala (24Low L.Y. Yang C. Perego M. Osterman A. Liddington R.C. J. Biol. Chem. 2005; 280: 35433-35439Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar) (Fig. 3A). In agreement with the C-terminal cell wall anchor structures proposed in Fig. 3A, PlyL-solubilized BcpAMH6 migrated as a spectrum of fragments on Coomassie-stained SDS-PAGE (49-79 kDa), as ∼19% of wall peptides in B. anthracis peptidoglycan are cross-linked (28Severin A. Tabei K. Tomasz A. Microb. Drug Resist. 2004; 10: 77-82Crossref PubMed Scopus (23) Google Scholar)(Fig. 3B). Purified peptidoglycan of B. anthracis was also digested with mutanolysin, a muramidase that cleaves the repeating disaccharides MurNAc-GlcNAc or MurNAc-GlcNH2 (Fig. 3A) (29Calandra G.B. Cole R. Infect. Immun. 1980; 28: 1033-1037Crossref PubMed Google Scholar, 30Yokogawa K. Kawata S. Nishimura S. Ikeda Y. Yoshimura Y. Antimicrob. Agents Chemother. 1974; 6: 156-165Crossref PubMed Scopus (81) Google Scholar). Muramidase treatment released protein that also migrated as a spectrum fragments on SDS-PAGE (49-79 kDa), albeit that the mobility of these species differed from those of PlyL-solubilized BcpAMH6 (Fig. 3B). Cell Wall Anchor Structure of PlyL-solubilized BcpAMH6—PlyL-solubilized and Ni-NTA-purified BcpAMH6 was cleaved at methionyl residues with CNBr. C-terminal peptides harboring the six-histidyl tag and cell wall anchor structure were purified by a second round of affinity purification on Ni-NTA. Peptides were separated by RP-HPLC with a C18 column. PlyL-released anchor peptides eluted at 35% CH3CN-0.1% formic acid and were analyzed by MALDI-MS and Edman degradation (Fig. 3C and Table 2, and see Table 5). The predominant ions in this spectrum could be explained as BcpAMH6 C-terminal anchor peptides linked to the side-chain amino group of diaminopimelic acid of wall peptides (Table 2). meso-Diaminopimelic acid (m-Dap) is a diamino acid at position 3 of the Bacillus cell wall pentapeptide precursor (l-Ala-d-iGln-m-Dap-d-Ala-d-Ala), and its side-chain amino group is involved in peptidoglycan cross-linking by forming an amide bond with d-Ala at position four of neighboring wall peptides [l-Ala-d-iGln-(l-Ala-d-iGln-m-Dap-d-Ala-)m-Dap-d-Ala-d-Ala] (28Severin A. Tabei K. Tomasz A. Microb. Drug Resist. 2004; 10: 77-82Crossref PubMed Scopus (23) Google Scholar). The predicted m/z of the anchor peptide [l-Ala-d-iGln-(H6GWILPVT-)m-Dap] is 1978.99. Isoforms containing tryptophan oxidation products hydroxytryptophan or N-formylkynurenine are expected at a mass of 1994.98 and 2010.98, respectively (Table 2) (31Taylor S.W. Fahy E. Murray J. Capaldi R.A. Ghosh S.S. J. Biol. Chem. 2003; 278: 19587-19590Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). Formylated, diformylated, and carbamylated anchor peptide species were detected at m/z 2021.9, 2022.8, 2037.9, 2038.88, 2050.89, and 2053.89 (Table 2). Formylation and carbamylation of α-NH2 groups in cell wall anchor peptides are known to occur following CNBr cleavage (70% formic acid) and purification under denaturing conditions in urea buffer. The predominant ion at m/z 1994.89 was fragmented by collision-activated dissociation (CAD) (Fig. 3D). Table 3 summarizes the observed fragment ions and their structural interpretation, which is in agreement with the peptide structure l-Ala-d-iGln-(H6GWILPVT-)m-Dap harboring the tryptophan oxidation product hydroxytryptophan (Table 3 and Fig. 3D). The second most abundant ion at m/z 2065.93 was explained as l-Ala-d-iGln-(H6GWILPVT-)m-Dap-d-Ala, a C-terminal anchor peptide containing d-Ala at position 4 of the cell wall pentapeptide precursor (calculated m/z 2066.02) (Table 2 and Fig. 3D). The structure of ion 2065.93 m/z was also confirmed by tandem mass spectrometry (data not shown).TABLE 2Summary of ions observed in the mass spectrum of PlyL-released BcpAMH6 anchor peptidesm/zΔcalc-obsaThe difference between the calculated and observed ion masses.Proposed structureModificationbModification of αNH2 groups: formylation, HC(O)-, carbamylation, NH2-C(O)-; modification of tryptophan: hydroxytryptophan (HTRP), N-formylkynurenine (NFK).ObservedCalculated1979.881978.99−0.89[l-Ala-d-iGln-(HHHHHHGWILPVT-)m-Dap]none1994.891994.980.09[l-Ala-d-iGln-(HHHHHHGWILPVT-)m-Dap]HTRP2010.902010.980.08[l-Ala-d-iGln-(HHHHHHGWILPVT-)m-Dap]NFK2021.902022.000.10[l-Ala-d-iGln-(HHHHHHGWILPVT-)m-Dap]NH2-C(0)-2022.802022.980.18[l-Ala-d-iGln-(HHHHHHGWILPVT-)m-Dap]HTRP; HC(O)-2037.902037.990.09[l-Ala-d-iGln-(HHHHHHGWILPVT-)m-Dap]HTRP; NH2-C(O)-2038.882038.970.09[l-Ala-d-iGln-(HHHHHHGWILPVT-)m-Dap]NFK; HC(O)-2050.892050.990.10[l-Ala-d-iGln-(HHHHHHGWILPVT-)m-Dap]HTRP; 2 X HC(O)-2053.892053.990.10[l-Ala-d-iGln-(HHHHHHGWILPVT-)m-Dap]NFK; NH2-C(O)-2065.932066.020.09[l-Ala-d-iGln-(HHHHHHGWILPVT-)m-Dap-d-Ala]HTRP2081.922082.020.10[l-Ala-d-iGln-(HHHHHHGWILPVT-)m-Dap-d-Ala]NFK2093.922094.020.10[l-Ala-d-iGln-(HHHHHHGWILPVT-)m-Dap-d-Ala]HTRP; HC(O)-2108.932109.030.10[l-Ala-d-iGln-(HHHHHHGWILPVT-)m-Dap-d-Ala]HTRP; NH2-C(O)-2122.932122.030.10[l-Ala-d-iGln-(HHHHHHGWILPVT-)m-Dap-d-Ala]HTRP; 2 × HC(O)-2124.952125.020.07[l-Ala-d-iGln-(HHHHHHGWILPVT-)m-Dap-d-Ala]NFK; NH2-C(O)-2437.082437.200.12l-Ala-d-iGln-[l-Ala-d-iGln(HHHHHHGWIPLVT -)m-Dap-d-Ala]m-DapHTRP2465.092465.200.11l-Ala-d-iGln-[l-Ala-d-iGln(HHHHHHGWIPLVT -)m-Dap-d-Ala]m-DapHTRP; HC(O)-2480.082480.210.13l-Ala-d-iGln-[l-Ala-d-iGln(HHHHHHGWIPLVT -)m-Dap-d-Ala]m-DapHTRP; NH2-C(O)-2493.072493.210.14l-Ala-d-iGln-[l-Ala-d-iGln(HHHHHHGWIPLVT -)m-Dap-d-Ala]m-DapHTRP; 2 × HC(O)-a The differenc