Publication Information

{'id': 'https://openalex.org/W2083106594', 'doi': 'https://doi.org/10.1074/jbc.m103118200', 'title': 'Conformation, Recognition by High Mobility Group Domain Proteins, and Nucleotide Excision Repair of DNA Intrastrand Cross-links of Novel Antitumor Trinuclear Platinum Complex BBR3464', 'display_name': 'Conformation, Recognition by High Mobility Group Domain Proteins, and Nucleotide Excision Repair of DNA Intrastrand Cross-links of Novel Antitumor Trinuclear Platinum Complex BBR3464', 'publication_year': 2001, 'publication_date': '2001-06-01', 'ids': {'openalex': 'https://openalex.org/W2083106594', 'doi': 'https://doi.org/10.1074/jbc.m103118200', 'mag': '2083106594', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/11303029'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m103118200', 'pdf_url': 'http://www.jbc.org/article/S0021925820784929/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820784929/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5037905617', 'display_name': 'Jana Zehnulová', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I202391551', 'display_name': 'Czech Academy of Sciences', 'ror': 'https://ror.org/053avzc18', 'country_code': 'CZ', 'type': 'government', 'lineage': ['https://openalex.org/I202391551']}], 'countries': ['CZ'], 'is_corresponding': False, 'raw_author_name': 'Jana Zehnulova', 'raw_affiliation_strings': ['Institute of Biophysics, Academy of Sciences of the Czech Republic Královopolská 135, CZ-61265 Brno, Czech Republic.'], 'affiliations': [{'raw_affiliation_string': 'Institute of Biophysics, Academy of Sciences of the Czech Republic Královopolská 135, CZ-61265 Brno, Czech Republic.', 'institution_ids': ['https://openalex.org/I202391551']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5020286203', 'display_name': 'Jana Kašpárková', 'orcid': 'https://orcid.org/0000-0002-5279-5381'}, 'institutions': [{'id': 'https://openalex.org/I202391551', 'display_name': 'Czech Academy of Sciences', 'ror': 'https://ror.org/053avzc18', 'country_code': 'CZ', 'type': 'government', 'lineage': ['https://openalex.org/I202391551']}], 'countries': ['CZ'], 'is_corresponding': False, 'raw_author_name': 'Jana Kasparkova', 'raw_affiliation_strings': ['Institute of Biophysics, Academy of Sciences of the Czech Republic Královopolská 135, CZ-61265 Brno, Czech Republic.'], 'affiliations': [{'raw_affiliation_string': 'Institute of Biophysics, Academy of Sciences of the Czech Republic Královopolská 135, CZ-61265 Brno, Czech Republic.', 'institution_ids': ['https://openalex.org/I202391551']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5079185884', 'display_name': 'Nicholas Farrell', 'orcid': 'https://orcid.org/0000-0001-7160-7182'}, 'institutions': [{'id': 'https://openalex.org/I184840846', 'display_name': 'Virginia Commonwealth University', 'ror': 'https://ror.org/02nkdxk79', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I184840846']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Nicholas Farrell', 'raw_affiliation_strings': ['Department of Chemistry, Virginia Commonwealth University, Richmond, Virginia 23284–2006'], 'affiliations': [{'raw_affiliation_string': 'Department of Chemistry, Virginia Commonwealth University, Richmond, Virginia 23284–2006', 'institution_ids': ['https://openalex.org/I184840846']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5081885555', 'display_name': 'Viktor Brabec', 'orcid': 'https://orcid.org/0000-0002-8233-1393'}, 'institutions': [{'id': 'https://openalex.org/I202391551', 'display_name': 'Czech Academy of Sciences', 'ror': 'https://ror.org/053avzc18', 'country_code': 'CZ', 'type': 'government', 'lineage': ['https://openalex.org/I202391551']}], 'countries': ['CZ'], 'is_corresponding': False, 'raw_author_name': 'Viktor Brabec', 'raw_affiliation_strings': ['Institute of Biophysics, Academy of Sciences of the Czech Republic Královopolská 135, CZ-61265 Brno, Czech Republic.'], 'affiliations': [{'raw_affiliation_string': 'Institute of Biophysics, Academy of Sciences of the Czech Republic Královopolská 135, CZ-61265 Brno, Czech Republic.', 'institution_ids': ['https://openalex.org/I202391551']}]}], 'institution_assertions': [], 'countries_distinct_count': 2, 'institutions_distinct_count': 2, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 2.585, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 81, 'citation_normalized_percentile': {'value': 0.793445, 'is_in_top_1_percent': False, 'is_in_top_10_percent': False}, 'cited_by_percentile_year': {'min': 94, 'max': 95}, 'biblio': {'volume': '276', 'issue': '25', 'first_page': '22191', 'last_page': '22199'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10163', 'display_name': 'Metal complexes synthesis and properties', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2730', 'display_name': 'Oncology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10163', 'display_name': 'Metal complexes synthesis and properties', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2730', 'display_name': 'Oncology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T13833', 'display_name': 'Ferrocene Chemistry and Applications', 'score': 0.9993, 'subfield': {'id': 'https://openalex.org/subfields/1605', 'display_name': 'Organic Chemistry'}, 'field': {'id': 'https://openalex.org/fields/16', 'display_name': 'Chemistry'}, 'domain': {'id': 'https://openalex.org/domains/3', 'display_name': 'Physical Sciences'}}, {'id': 'https://openalex.org/T10432', 'display_name': 'DNA and Nucleic Acid Chemistry', 'score': 0.9993, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [], 'concepts': [{'id': 'https://openalex.org/C104451858', 'wikidata': 'https://www.wikidata.org/wiki/Q2714458', 'display_name': 'Nucleotide excision repair', 'level': 4, 'score': 0.7396313}, {'id': 'https://openalex.org/C108204754', 'wikidata': 'https://www.wikidata.org/wiki/Q353392', 'display_name': 'Adduct', 'level': 2, 'score': 0.68530893}, {'id': 'https://openalex.org/C552990157', 'wikidata': 'https://www.wikidata.org/wiki/Q7430', 'display_name': 'DNA', 'level': 2, 'score': 0.6627649}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.66246426}, {'id': 'https://openalex.org/C518104683', 'wikidata': 'https://www.wikidata.org/wiki/Q880', 'display_name': 'Platinum', 'level': 3, 'score': 0.65472203}, {'id': 'https://openalex.org/C512185932', 'wikidata': 'https://www.wikidata.org/wiki/Q28745', 'display_name': 'Nucleotide', 'level': 3, 'score': 0.59462917}, {'id': 'https://openalex.org/C71240020', 'wikidata': 'https://www.wikidata.org/wiki/Q186011', 'display_name': 'Stereochemistry', 'level': 1, 'score': 0.59435076}, {'id': 'https://openalex.org/C134935766', 'wikidata': 'https://www.wikidata.org/wiki/Q210538', 'display_name': 'DNA repair', 'level': 3, 'score': 0.48732886}, {'id': 'https://openalex.org/C2780443040', 'wikidata': 'https://www.wikidata.org/wiki/Q3737863', 'display_name': 'Bifunctional', 'level': 3, 'score': 0.41143}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.23011592}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.08878508}, {'id': 'https://openalex.org/C161790260', 'wikidata': 'https://www.wikidata.org/wiki/Q82264', 'display_name': 'Catalysis', 'level': 2, 'score': 0.075867504}, {'id': 'https://openalex.org/C178790620', 'wikidata': 'https://www.wikidata.org/wiki/Q11351', 'display_name': 'Organic chemistry', 'level': 1, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D004247', 'descriptor_name': 'DNA', 'qualifier_ui': 'Q000187', 'qualifier_name': 'drug effects', 'is_major_topic': True}, {'descriptor_ui': 'D018736', 'descriptor_name': 'DNA Adducts', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D004260', 'descriptor_name': 'DNA Repair', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D006609', 'descriptor_name': 'High Mobility Group Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D009690', 'descriptor_name': 'Nucleic Acid Conformation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D009944', 'descriptor_name': 'Organoplatinum Compounds', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': True}, {'descriptor_ui': 'D001483', 'descriptor_name': 'Base Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001665', 'descriptor_name': 'Binding Sites', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004247', 'descriptor_name': 'DNA', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004247', 'descriptor_name': 'DNA', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D018736', 'descriptor_name': 'DNA Adducts', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006609', 'descriptor_name': 'High Mobility Group Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015335', 'descriptor_name': 'Molecular Probes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009944', 'descriptor_name': 'Organoplatinum Compounds', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009944', 'descriptor_name': 'Organoplatinum Compounds', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m103118200', 'pdf_url': 'http://www.jbc.org/article/S0021925820784929/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/11303029', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m103118200', 'pdf_url': 'http://www.jbc.org/article/S0021925820784929/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'score': 0.66, 'id': 'https://metadata.un.org/sdg/3', 'display_name': 'Good health and well-being'}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 72, 'referenced_works': ['https://openalex.org/W1484753203', 'https://openalex.org/W1525929664', 'https://openalex.org/W1558516755', 'https://openalex.org/W1596262330', 'https://openalex.org/W1920032316', 'https://openalex.org/W1935774199', 'https://openalex.org/W1963658914', 'https://openalex.org/W1967490341', 'https://openalex.org/W1970977612', 'https://openalex.org/W1975853177', 'https://openalex.org/W1983522852', 'https://openalex.org/W1988619957', 'https://openalex.org/W1990250030', 'https://openalex.org/W1991025686', 'https://openalex.org/W1993835846', 'https://openalex.org/W1994982452', 'https://openalex.org/W2001652098', 'https://openalex.org/W2003988120', 'https://openalex.org/W2009215863', 'https://openalex.org/W2009378502', 'https://openalex.org/W2016577283', 'https://openalex.org/W2028130329', 'https://openalex.org/W2031168662', 'https://openalex.org/W2032602394', 'https://openalex.org/W2034742750', 'https://openalex.org/W2036357898', 'https://openalex.org/W2037947598', 'https://openalex.org/W2038822618', 'https://openalex.org/W2039400970', 'https://openalex.org/W2040454299', 'https://openalex.org/W2043382823', 'https://openalex.org/W2043610941', 'https://openalex.org/W2043863819', 'https://openalex.org/W2046104897', 'https://openalex.org/W2048168597', 'https://openalex.org/W2054732334', 'https://openalex.org/W2055080715', 'https://openalex.org/W2057692066', 'https://openalex.org/W2062130291', 'https://openalex.org/W2064286820', 'https://openalex.org/W2068884609', 'https://openalex.org/W2074959313', 'https://openalex.org/W2076966327', 'https://openalex.org/W2077875706', 'https://openalex.org/W2078049644', 'https://openalex.org/W2079832961', 'https://openalex.org/W2080883315', 'https://openalex.org/W2086099971', 'https://openalex.org/W2088445980', 'https://openalex.org/W2092716257', 'https://openalex.org/W2093944971', 'https://openalex.org/W2110023342', 'https://openalex.org/W2119882170', 'https://openalex.org/W2120000242', 'https://openalex.org/W2124308359', 'https://openalex.org/W2131127883', 'https://openalex.org/W2137234355', 'https://openalex.org/W2143918358', 'https://openalex.org/W2172916891', 'https://openalex.org/W2173751778', 'https://openalex.org/W2343187320', 'https://openalex.org/W2402736561', 'https://openalex.org/W2416871311', 'https://openalex.org/W2500898487', 'https://openalex.org/W2507203008', 'https://openalex.org/W4251790937', 'https://openalex.org/W45225952', 'https://openalex.org/W576440591', 'https://openalex.org/W581732000', 'https://openalex.org/W612414919', 'https://openalex.org/W8471709', 'https://openalex.org/W98290483'], 'related_works': ['https://openalex.org/W4372295604', 'https://openalex.org/W4211191096', 'https://openalex.org/W2512850011', 'https://openalex.org/W2170454539', 'https://openalex.org/W2027941205', 'https://openalex.org/W2025388536', 'https://openalex.org/W1977382129', 'https://openalex.org/W1975102042', 'https://openalex.org/W1965761797', 'https://openalex.org/W1965514945'], 'abstract_inverted_index': {'The': [0, 41, 103, 208, 249, 311, 454, 466, 768, 1202, 1330, 1443, 1566, 1622, 2190, 2216, 2366, 2385, 2566, 2809, 2887, 2997, 3059, 3089, 3188, 3504, 3575, 3733, 3850, 3904, 3931, 3948, 4007, 4153, 4176, 4303], 'new': [1, 209, 478, 958], 'antitumor': [2, 183, 210, 391, 887, 1177, 1379, 2000], 'trinuclear': [3, 211, 455], 'platinum': [4, 25, 187, 195, 212, 233, 395, 403, 489, 1076, 1125, 1225, 1250, 1384, 1911, 2004, 2194, 2401, 2420, 2430, 2912, 3087, 3894], 'compound': [5, 213, 456], '[{trans-PtCl(NH3)2}2μ-trans-Pt(NH3)2{H2N(CH2)6NH2}2]4+(designated': [6, 214], 'as': [7, 215, 469, 571, 573, 684, 773, 894, 1136, 1351, 1353, 1914, 1926, 2225, 2262, 2818, 3024, 3321, 3394, 3483, 3611, 4195, 4344], 'BBR3464)': [8, 216], 'is': [9, 17, 30, 47, 217, 225, 238, 255, 459, 471, 982, 1068, 1104, 1208, 1236, 1246, 1454, 1465, 1522, 1538, 1809, 1812, 1883, 2124, 2558, 3727, 3907, 3984, 4330], 'currently': [10, 218, 460], 'in': [11, 97, 123, 170, 219, 305, 331, 378, 461, 500, 566, 666, 676, 791, 803, 889, 905, 963, 983, 1018, 1127, 1160, 1395, 1468, 1506, 1544, 1852, 1865, 2134, 2142, 2153, 2170, 2213, 2375, 2380, 2490, 2536, 2601, 2629, 2654, 2657, 2670, 2895, 2938, 2949, 3026, 3100, 3141, 3145, 3275, 3287, 3380, 3479, 3528, 3613, 3656, 3694, 3706, 3755, 3765, 3799, 3847, 3862, 3869, 3914, 3958, 4067, 4083, 4096, 4111, 4182, 4325, 4336, 4341], 'phase': [12, 220, 462, 560], 'II': [13, 221, 463], 'clinical': [14, 222, 464, 661, 774], 'trials.': [15, 223, 465], 'DNA': [16, 39, 43, 95, 153, 224, 247, 251, 303, 361, 977, 1067, 1113, 1146, 1158, 1204, 1241, 1344, 1374, 1473, 1495, 1504, 1510, 1515, 1584, 1640, 1714, 1763, 1811, 2114, 2143, 2168, 2306, 2313, 2432, 2920, 2995, 3266, 3314, 3475, 3568, 3652, 3725, 3760, 4174, 4219, 4223, 4343], 'generally': [18, 226, 1069], 'considered': [19, 227, 1070], 'the': [20, 36, 50, 63, 66, 70, 162, 165, 228, 244, 258, 271, 274, 278, 370, 373, 472, 487, 656, 957, 964, 988, 1071, 1110, 1152, 1211, 1223, 1240, 1333, 1343, 1348, 1355, 1358, 1382, 1460, 1514, 1530, 1546, 1576, 1705, 1724, 1737, 1740, 1743, 1751, 1755, 1802, 1818, 1821, 1855, 1858, 1862, 1869, 1873, 1890, 1893, 1897, 1999, 2003, 2138, 2145, 2154, 2199, 2214, 2373, 2408, 2411, 2415, 2491, 2498, 2502, 2530, 2583, 2590, 2593, 2602, 2611, 2630, 2640, 2681, 2684, 2692, 2707, 2890, 2905, 2908, 2911, 2919, 2922, 2939, 3083, 3180, 3185, 3196, 3243, 3249, 3311, 3319, 3386, 3449, 3480, 3529, 3597, 3602, 3636, 3707, 3716, 3720, 3731, 3736, 3742, 3749, 3756, 3863, 3870, 3919, 3936, 3951, 3960, 3981, 4053, 4060, 4063, 4068, 4092, 4097, 4104, 4112, 4199, 4306, 4312], 'major': [21, 229, 674, 1072, 1577, 1712, 1756, 2127, 3637], 'pharmacological': [22, 230, 1073], 'target': [23, 231, 1074], 'of': [24, 31, 38, 45, 53, 65, 69, 73, 78, 110, 119, 134, 149, 164, 168, 194, 232, 239, 246, 253, 261, 273, 277, 281, 286, 318, 327, 342, 357, 372, 376, 402, 475, 481, 526, 664, 707, 743, 771, 967, 1075, 1105, 1112, 1157, 1165, 1176, 1206, 1214, 1244, 1336, 1365, 1459, 1502, 1513, 1536, 1570, 1575, 1579, 1624, 1639, 1709, 1716, 1720, 1739, 1747, 1801, 1820, 1857, 1868, 1880, 1884, 1892, 1896, 1900, 1905, 1979, 1991, 2002, 2035, 2109, 2148, 2193, 2201, 2372, 2410, 2429, 2495, 2501, 2533, 2592, 2633, 2680, 2683, 2710, 2889, 2907, 2918, 2979, 3020, 3098, 3206, 3218, 3255, 3310, 3313, 3451, 3459, 3462, 3512, 3517, 3522, 3554, 3606, 3659, 3662, 3723, 3735, 3751, 3758, 3796, 3802, 3812, 3835, 3854, 3892, 3935, 3950, 4173, 4201, 4305, 4311, 4321], 'drugs.': [26, 234], 'As': [27, 235, 1101], 'such': [28, 236, 683, 1102, 1135, 1913, 1925, 2606], 'it': [29, 237, 1103, 1235, 1882, 2562], 'considerable': [32, 240, 1106, 1885], 'interest': [33, 241, 1107, 1886], 'to': [34, 174, 181, 242, 382, 389, 668, 1026, 1108, 1118, 1129, 1170, 1230, 1233, 1370, 1372, 1451, 1471, 1493, 1516, 1854, 1887, 1997, 2130, 2136, 2560, 2589, 2625, 2646, 2687, 2991, 3073, 3238, 3248, 3714, 3730], 'understand': [35, 243, 1109], 'patterns': [37, 245, 1111], 'damage.': [40, 248], 'bifunctional': [42, 250, 1203, 1586], 'binding': [44, 252, 1147, 1159, 1205, 1232, 1242, 1361, 1450, 1470, 1492, 1990, 3795], 'BBR3464': [46, 74, 111, 169, 254, 282, 319, 377, 665, 772, 882, 1207, 1245, 1447, 1537, 1571, 1901, 2174, 2621, 2711, 2980, 3200, 3219, 3463, 3797, 3880, 4322], 'characterized': [48, 256, 893, 1209], 'by': [49, 86, 137, 154, 199, 257, 294, 345, 362, 407, 979, 1123, 1132, 1210, 1248, 1551, 1628, 1636, 1758, 1764, 1806, 1877, 1910, 2144, 2162, 2179, 2259, 2390, 2400, 2407, 2576, 2614, 2691, 2811, 2924, 2958, 3170, 3282, 3441, 3573, 3587, 3690, 3741, 3746, 3879, 3925, 4011, 4170, 4308], 'rapid': [51, 259, 1212, 1449, 1469, 2678], 'formation': [52, 260, 1213], 'long': [54, 262, 1215, 1540, 3805], 'range': [55, 263, 1216, 1541, 3806], 'intra-': [56, 264, 1217], 'and': [57, 80, 92, 205, 265, 288, 300, 413, 524, 568, 691, 696, 705, 741, 788, 1138, 1173, 1218, 1255, 1324, 1338, 1346, 1378, 1508, 1602, 1635, 1728, 1760, 1815, 1918, 1977, 2033, 2121, 2165, 2208, 2223, 2247, 2254, 2311, 2326, 2342, 2356, 2406, 2516, 2574, 2667, 2721, 2742, 2814, 2943, 2985, 3069, 3125, 3137, 3143, 3179, 3193, 3223, 3226, 3230, 3258, 3262, 3285, 3301, 3389, 3445, 3472, 3526, 3556, 3559, 3571, 3585, 3596, 3677, 3688, 3808, 3841, 3867, 3889, 3916, 4051, 4108, 4212, 4220, 4340], 'interstrand': [58, 266, 1219, 1503, 1518, 1564, 3809, 3825], 'cross-links.': [59, 267], 'We': [60, 268, 3763], 'examined': [61, 269, 3007], 'how': [62, 81, 270, 289, 1889, 2157], 'structures': [64, 272, 1891, 1908], 'various': [67, 275, 1894, 1921, 3800], 'types': [68, 276, 1895, 3801], 'intrastrand': [71, 108, 166, 279, 316, 374, 1568, 1587, 1878, 1898, 2107, 2146, 2708, 2977, 2986, 3460, 3807, 3816, 4113, 4177, 4319], 'cross-links': [72, 109, 121, 136, 167, 280, 317, 329, 344, 375, 1220], 'affect': [75, 283, 1902], 'conformational': [76, 115, 284, 323, 1803, 1874, 1903], 'properties': [77, 285, 1904, 2001], 'DNA,': [79, 287, 1234, 1452, 2537, 3514, 3687], 'these': [82, 120, 135, 150, 290, 328, 343, 358, 1366, 1625, 1702, 1992, 2158, 2705, 3021, 3470, 3828, 3855, 3901], 'adducts': [83, 151, 291, 359, 1578, 1588, 1626, 1703, 2159, 3803, 4008], 'are': [84, 292, 1549, 1557, 1572, 2111, 2160, 3818, 3845, 3923, 4193, 4323], 'recognized': [85, 293, 2161], 'high': [87, 138, 295, 346, 418, 426, 432, 886, 1444, 1929], 'mobility': [88, 139, 296, 347, 419, 427, 433, 1930], 'group': [89, 140, 297, 348, 420, 428, 434, 1931], '1': [90, 141, 298, 349, 429, 435, 2202, 2897, 2951, 3119, 3302, 4184], 'protein': [91, 299, 443, 2164, 2393], 'removed': [93, 301, 2112, 2166, 2915, 4010], 'from': [94, 152, 302, 360, 777, 1163, 2113, 2167, 2185, 2301, 2317, 2329, 2345, 2352, 2360, 3272, 3385, 3448], 'during': [96, 304, 2115, 2169], 'vitro': [98, 306, 2171, 3457], 'nucleotide': [99, 155, 307, 363, 421, 2116, 3708], 'excision': [100, 156, 308, 364, 422, 2117, 3376, 3467, 3576, 3638, 3709, 3752], 'repair': [101, 309, 423, 2118, 3458], 'reactions.': [102, 310, 2173], 'results': [104, 122, 159, 312, 330, 367, 654, 1141, 2617, 3798, 4304], 'have': [105, 130, 145, 313, 338, 353, 1142, 2049, 2756, 3831], 'revealed': [106, 314, 1643, 3814], 'that': [107, 161, 315, 369, 956, 1115, 1155, 1164, 1239, 1458, 1526, 1539, 1701, 1810, 2106, 2122, 2414, 2489, 2619, 2703, 3792, 3815, 3882, 4091, 4192], 'create': [112, 320], 'a': [113, 124, 191, 200, 321, 332, 399, 408, 527, 673, 708, 744, 1144, 1171, 1598, 1603, 1980, 2036, 2126, 2677, 2743, 2750, 3086, 3172, 3199, 3240, 3253, 3276, 3589, 3614, 3833, 3885, 4157], 'local': [114, 322], 'distortion,': [116, 324], 'but': [117, 143, 325, 351], 'none': [118, 326], 'stable': [125, 333, 1915, 2713], 'curvature.': [126, 334], 'In': [127, 335, 559, 2045, 2904, 4059], 'addition,': [128, 336, 2046], 'we': [129, 144, 337, 352, 2150, 3830], 'observed': [131, 146, 339, 354, 576, 2600, 3754], 'no': [132, 340, 2605, 3985, 4080], 'recognition': [133, 341], 'proteins,': [142, 350], 'effective': [147, 355], 'removal': [148, 356], 'repair.': [157, 365], 'These': [158, 366, 653, 2616, 3436, 3874, 4207], 'suggest': [160, 368, 655, 1023], 'processing': [163, 371], 'tumor': [171, 379, 891], 'cells': [172, 380], 'sensitive': [173, 381], 'this': [175, 383, 1028, 1807, 3893], 'drug': [176, 384], 'may': [177, 385, 960, 1116, 1368], 'not': [178, 386, 1228, 1237, 2508, 2637, 3975, 4076], 'be': [179, 387, 1517, 2564], 'relevant': [180, 388], 'its': [182, 206, 390, 414], 'effects.': [184, 392], 'Hence,': [185, 393], 'polynuclear': [186, 394, 1124, 1383], 'compounds': [188, 396, 1251, 2195], 'apparently': [189, 397], 'represent': [190, 398, 3085, 3198], 'novel': [192, 400], 'class': [193, 401, 480], 'anticancer': [196, 404, 483, 662], 'drugs': [197, 405, 1077, 2005], 'acting': [198, 406], 'different': [201, 409], 'mechanism': [202, 410, 2128], 'than': [203, 411, 786, 1457, 1525, 1563, 3824, 4204], 'cisplatin': [204, 412, 787, 1137, 1166, 1748, 2110, 2131], 'analogues.': [207, 415], 'cis-diamminedichloroplatinum(II)': [416, 669], 'cross-link': [417], 'base': [424, 1555], 'pair(s)': [425], 'domain': [430, 436, 1933, 2244, 2249], 'A': [431, 2245], 'B': [437, 2250], 'dimethyl': [438], 'sulfate': [439, 2335], 'diethyl': [440, 2338], 'pyrocarbonate': [441, 2339], 'fast': [442, 2392], 'liquid': [444, 2394], 'chromatography': [445, 2395], 'cell-free': [446, 3381], 'extract': [447], 'Chinese': [448], 'hamster': [449], 'ovary': [450], 'bovine': [451], 'serum': [452], 'albumin': [453], '[{trans-PtCl(NH3)2}2μ-trans-Pt(NH3)2{H2N(CH2)6NH2}2]4+(Fig.': [457], '1)': [458, 2176, 2220, 2377, 2656], 'compound,': [467], 'designated': [468], 'BBR3464,': [470, 1150, 2149], 'lead': [473, 1117, 1169], 'representative': [474], 'an': [476, 1024, 1533, 1594, 2731], 'entirely': [477], 'structural': [479, 490, 1870, 2139], 'DNA-modifying': [482], 'agents': [484, 981, 1134, 4191, 4208], 'based': [485, 1631], 'on': [486, 1446, 1529, 1583, 1632, 2431, 2730, 3008, 3132, 3150, 3580], 'poly(di,tri)nuclear': [488], 'motif': [491], '(1Farrell': [492, 795, 897, 1387], 'N.': [493, 511, 547, 796, 853, 871, 898, 938, 994, 1053, 1192, 1273, 1295, 1325, 1388, 1414, 1431, 1481, 3351, 3782], 'Kelland': [494, 544, 797, 899, 1389], 'L.R.': [495, 545, 798, 900, 1390], 'Farrell': [496, 546, 799, 870, 901, 937, 1052, 1191, 1272, 1294, 1391, 1413, 1430, 1480, 3781], 'N.P.': [497, 800, 902, 1079, 1392], 'Platinum-based': [498, 801, 903, 1393], 'Drugs': [499, 802, 904, 1394], 'Cancer': [501, 604, 804, 840, 906, 1396, 2078, 3404, 3494, 3625], 'Therapy.': [502, 805, 907, 1397], 'Humana': [503, 806, 908, 1398, 2880, 4283, 4377], 'Press': [504, 807, 909, 1399, 2881, 4284, 4378], 'Inc.,': [505, 808, 910, 1400], 'Totowa,': [506, 809, 911, 1401, 2883, 4286, 4380], 'NJ2000:': [507, 810, 912, 1402], '321-338Google': [508, 811, 913, 1403], 'Scholar,': [509, 535, 609, 716, 730, 752, 812, 845, 914, 1404, 1425, 1656, 1671, 1685, 1780, 1836, 1949, 1968, 2024, 2069, 2084, 2451, 2466, 2774, 2793, 2835, 2855, 2870, 3043, 3349, 3410, 4027, 4129, 4238, 4258, 4273, 4289, 4367, 4383], '2Farrell': [510], 'Qu': [512, 1189, 1270, 3779], 'Y.': [513, 537, 1190, 1271, 3780], 'Bierbach': [514], 'U.': [515, 2441, 2783, 3364, 3425, 3996, 4040, 4142], 'Valsecchi': [516], 'M.': [517, 596, 623, 832, 1087, 1647, 1662, 1840, 2090, 2233, 2260, 2266, 2284, 2436, 2468, 2478, 2765, 2778, 2797, 2799, 2824, 2826, 2843, 3357, 3991, 4035, 4137, 4227, 4229, 4246, 4355], 'Menta': [518], 'E.': [519, 592, 718, 828], 'Lippert': [520, 701, 737, 1973, 2029], 'B.': [521, 700, 702, 738, 1974, 2030, 2472, 4328], 'Cisplatin:': [522, 703, 739, 1975, 2031], 'Chemistry': [523, 704, 740, 1976, 2032], 'Biochemistry': [525, 706, 742, 1978, 2034], 'Leading': [528, 709, 745, 1981, 2037], 'Anticancer': [529, 710, 746, 1982, 2038], 'Drug.': [530, 711, 747, 1983, 2039], 'Wiley-VCH,': [531, 712, 748, 1984, 2040], 'Weinheim,': [532, 713, 749, 1985, 2041], 'Germany1999:': [533, 714, 750, 1986, 2042], '479-496Google': [534], '3Qu': [536], 'Rauter': [538], 'H.': [539, 1318, 3359], 'Fontes': [540], 'A.P.S.': [541], 'Bandarage': [542], 'R.': [543, 857, 863, 924, 1039, 1283], 'J.': [548, 600, 621, 836, 942, 1057, 1182, 1263, 1287, 1299, 1312, 1415, 1429, 1432, 1788, 1935, 1937, 1941, 2231, 2267, 2285, 2480, 2763, 2847, 3334, 3442, 3772, 4250, 4292, 4359], 'Med.': [549, 1095], 'Chem.': [550, 721, 1612, 1677, 1828, 2269, 2287, 3035, 3336], '2000;': [551, 642, 760], '43:': [552], '3189-3192Crossref': [553], 'PubMed': [554, 648, 726, 763, 947, 1010, 1062, 1197, 1278, 1304, 1421, 1438, 1486, 1617, 1652, 1667, 1681, 1696, 1776, 1793, 1832, 1847, 1945, 1964, 2020, 2065, 2101, 2238, 2278, 2296, 2447, 2462, 2484, 2550, 2770, 2789, 2804, 2831, 2851, 2866, 3039, 3054, 3345, 3370, 3431, 3787, 4002, 4023, 4046, 4125, 4148, 4234, 4254, 4269, 4298, 4363], 'Scopus': [555, 649, 727, 764, 948, 1011, 1063, 1198, 1279, 1305, 1422, 1439, 1487, 1618, 1653, 1668, 1682, 1697, 1777, 1794, 1833, 1848, 1946, 1965, 2021, 2066, 2102, 2239, 2448, 2463, 2485, 2551, 2771, 2790, 2805, 2832, 2852, 2867, 3040, 3055, 3346, 3371, 3432, 3788, 4003, 4024, 4047, 4126, 4149, 4235, 4255, 4270, 4299, 4364], '(65)': [556, 1654], 'Google': [557, 651, 729, 766, 879, 950, 1013, 1065, 1099, 1200, 1281, 1307, 1424, 1441, 1489, 1620, 1655, 1670, 1684, 1699, 1779, 1796, 1835, 1850, 1948, 1967, 2023, 2068, 2083, 2104, 2241, 2279, 2297, 2450, 2465, 2487, 2553, 2773, 2792, 2807, 2834, 2854, 2869, 3042, 3057, 3348, 3373, 3409, 3434, 3499, 3630, 3790, 4005, 4026, 4049, 4128, 4151, 4237, 4257, 4272, 4301, 4366], 'Scholar).': [558, 652, 767, 880, 951, 1014, 1066, 1100, 1201, 1308, 1442, 1490, 1621, 1797, 1988, 2044, 2242, 2554, 2808, 2886, 3058, 3374, 3435, 4006, 4152, 4302], 'I': [561], 'trials,': [562], 'objective': [563], 'partial': [564], 'responses': [565], 'pancreatic': [567], 'lung': [569, 688], 'cancers': [570], 'well': [572, 1352], 'melanoma': [574], 'were': [575, 2196, 2221, 2257, 2299, 2315, 2328, 2344, 2359, 2378, 2388, 2524, 2568, 2599, 2608, 2644, 2712, 2727, 2816, 2899, 2953, 2965, 2989, 3005, 3023, 3066, 3093, 3130, 3164, 3182, 3202, 3236, 3270, 3318, 3378, 3438, 3560, 3578, 3599, 3711, 3877, 3942, 3969, 4009, 4071, 4079, 4109, 4167, 4186], '(4Calvert': [577], 'P.M.': [578, 814], 'Highley': [579, 815], 'M.S.': [580, 816], 'Hughes': [581, 817], 'A.N.': [582, 818], 'Plummer': [583, 819], 'E.R.': [584, 820, 1609], 'Azzabi': [585, 821], 'A.S.T.': [586, 822], 'Verrill': [587, 823], 'M.W.': [588, 824], 'Camboni': [589, 636, 825], 'M.G.': [590, 826], 'Verdi': [591, 827], 'Bernareggi': [593, 634, 829], 'A.': [594, 627, 635, 830, 1285, 1658, 2058, 2073, 2077, 2443, 2474, 2785, 3333, 3366, 3399, 3403, 3414, 3416, 3427, 3446, 3489, 3493, 3620, 3624, 3998, 4031, 4042, 4133, 4144, 4389], 'Zuchetti': [595, 831], 'Robinson': [597, 833], 'A.M.': [598, 834, 2542], 'Carmichael': [599, 835], 'Calvert': [601, 837], 'A.H.': [602, 838], 'Clin.': [603, 839, 1093], 'Res.': [605, 841, 1843, 2079, 2097, 2862, 3405, 3495, 3626, 4265], '1999;': [606, 723, 842, 876, 944, 1007, 1059, 1194, 1275, 1418, 1435, 1483, 1614, 1790, 1961, 2017, 2080, 3367, 3406, 3496, 3627, 3784], '5:': [607, 843], '3796sGoogle': [608, 844], '5Sessa': [610], 'C.': [611, 629, 849, 869, 926, 928, 1041, 1043, 1410, 1784, 2837, 2872, 4240, 4275, 4349, 4369], 'Capri': [612], 'G.': [613, 619, 637, 867, 916, 932, 1031, 1047, 1083, 1408, 2476], 'Gianni': [614], 'L.': [615, 625, 851, 998, 1412, 1645, 1660, 2470], 'Peccatori': [616], 'F.': [617, 873, 940, 992, 1000, 1055, 2841, 4244, 4353], 'Grasselli': [618], 'Bauer': [620, 1783], 'Zucchetti': [622], 'Vigano': [624], 'Gatti': [626, 850], 'Minoia': [628], 'Liati': [630], 'P.': [631, 847, 918, 1033, 2092], 'VandenBosch': [632], 'S.': [633, 639, 855, 865, 934, 936, 1049, 1051, 2442, 2784, 3365, 3426, 3997, 4041, 4143], 'Marsoni': [638], 'Ann.': [640], 'Oncol.': [641], '11:': [643], '977-983Abstract': [644], 'Full': [645, 2273, 2275, 2291, 2293, 3340, 3342], 'Text': [646, 2274, 2276, 2292, 2294, 3341, 3343], 'PDF': [647, 2277, 2295, 3344], '(75)': [650, 1795], 'potential': [657], 'for': [658, 679, 1149, 1328, 1527, 1872, 2510, 2610, 2697, 2714, 2935, 3134, 3166, 3204, 3316, 3565, 3644, 4197], 'genuinely': [659], 'complementary': [660, 2650, 2685, 2972, 3075, 3257, 3946], 'activity': [663, 888, 1178, 1380, 3722], 'comparison': [667, 1128, 3747], '(cisplatin).1': [670], 'Cisplatin': [671, 2182], 'has': [672, 974, 1642, 1994], 'role': [675], 'combination': [677], 'chemotherapy': [678], 'several': [680, 2047, 4189], 'solid': [681], 'tumors,': [682, 687], 'germ': [685], 'cell': [686, 793, 1020, 1120, 3392], 'cancer,': [689, 693, 695], 'head': [690], 'neck': [692], 'ovarian': [694], 'bladder': [697], 'cancer': [698, 968], '(6Rosenberg': [699], '3-30Google': [715], '7Wong': [717], 'Giandomenico': [719], 'C.M.': [720], 'Rev.': [722, 1613], '99:': [724, 1615], '2451-2466Crossref': [725], '(1767)': [728], "8O'Dwyer": [731], 'P.J.': [732, 754], 'Stevenson': [733, 755], 'J.P.': [734, 756], 'Johnson': [735, 757], 'S.W.': [736, 758], '31-72Google': [751], "9O'Dwyer": [753], 'Drugs.': [759], '59:': [761, 2081, 3407, 3497, 3628], '19-27Crossref': [762], '(202)': [765], 'specific': [769], 'choice': [770], 'candidate': [775], 'comes': [776], 'preclinical': [778], 'studies': [779], 'showing': [780], 'cytotoxicity': [781, 1016], 'at': [782, 1732, 1736, 1817, 2198, 2210, 2595, 2694, 2715, 2932, 3220, 3242, 3305, 3562, 3647, 3718, 3900], '10-fold': [783], 'lower': [784], 'concentration': [785, 2200], 'collateral': [789], 'sensitivity': [790], 'cisplatin-resistant': [792], 'lines': [794, 1021, 3393], '4Calvert': [813], '10Perego': [846], 'Caserini': [848, 925, 1040], 'Carenini': [852], 'Romanelli': [854], 'Supino': [856, 923, 1038], 'Colangelo': [858], 'D.': [859, 920, 1035, 1310, 2054, 2839, 3327, 4242, 4351], 'Viano': [860], 'I.': [861, 996], 'Leone': [862], 'Spinelli': [864, 935, 1050], 'Pezzoni': [866, 931, 1046], 'Manzotti': [868, 927, 1042, 1409], 'Zunino': [872, 939, 1054], 'Mol.': [874, 1004, 4293], 'Pharmacol.': [875], '55:': [877, 1008], '528-534PubMed': [878], 'Importantly,': [881], 'also': [883, 1168, 1466, 1749, 2125, 2151, 2424, 3712], 'displays': [884], 'consistently': [885], 'human': [890], 'xenografts': [892], 'mutant': [895, 971, 1019], 'p53': [896, 972, 989], '11Pratesi': [915], 'Perego': [917, 1032], 'Polizzi': [919, 1034], 'Righetti': [921, 1036], 'S.C.': [922, 1037], 'Giuliani': [929, 1044], 'F.C.': [930, 1045], 'Tognella': [933, 1048], 'British': [941, 1056], 'Cancer.': [943, 1058], '80:': [945, 1060], '1912-1919Crossref': [946, 1061], '(121)': [949, 1064], 'This': [952, 1463, 1520, 1989, 2673, 4088], 'important': [953, 1799], 'feature': [954, 1464, 1800], 'suggests': [955], 'agent': [959], 'find': [961], 'utility': [962], 'over': [965, 1731], '60%': [966], 'cases': [969, 985], 'where': [970, 3082, 3195], 'status': [973], 'been': [975, 1995, 2757], 'indicated.': [976], 'damage': [978, 1114], 'chemotherapeutic': [980], 'many': [984], 'mediated': [986], 'through': [987], 'pathway': [990, 1029], '(12Janus': [991], 'Albrechtsen': [993], 'Dornreiter': [995], 'Wiesmüller': [997], 'Grosse': [999], 'Deppert': [1001], 'W.': [1002, 2544], 'Cell.': [1003], 'Life': [1005], 'Sci.': [1006, 2440, 2782, 3363, 3424, 3995, 4039, 4141], '12-27Crossref': [1009], '(122)': [1012], 'Consistently,': [1015], 'displayed': [1017], 'would': [1022], 'ability': [1025], 'bypass': [1027], '(11Pratesi': [1030], '(13Johnson': [1078], 'Butour': [1080], 'J.-L.': [1081], 'Villani': [1082], 'Wimmer': [1084], 'F.L.': [1085], 'Defais': [1086], 'Pierson': [1088], 'V.': [1089, 1091, 1180, 1261, 1291, 1297, 1322, 2229, 2434, 2761, 2776, 2795, 2822, 3770, 3989, 4225], 'Brabec': [1090, 1296], 'Prog.': [1092], 'Biochem.': [1094, 1300, 1417, 1434, 2479, 2846, 4249, 4358], '1989;': [1096, 1649, 1664], '10:': [1097], '1-24Crossref': [1098, 4297], 'differential': [1119], 'signaling': [1121], 'induced': [1122, 1131, 1805, 2141], 'complexes': [1126], 'those': [1130, 1927], 'mononuclear': [1133], 'carboplatin.': [1139], 'Previous': [1140], 'indicated': [1143, 1511], 'unique': [1145, 1174], 'profile': [1148, 1175, 1243], 'strengthening': [1151], 'original': [1153], 'hypothesis': [1154], 'modification': [1156, 2810], 'manners': [1161], 'distinct': [1162, 1172], 'will': [1167], '(14Brabec': [1179, 1260, 3769], 'Kasparkova': [1181, 1262, 1286, 3771], 'Vrana': [1183, 1264, 1292, 3773], 'O.': [1184, 1186, 1265, 1267, 1293, 1316, 1320, 3774, 3776], 'Novakova': [1185, 1266, 3775], 'Cox': [1187, 1268, 3777], 'J.W.': [1188, 1269, 3778], 'Biochemistry.': [1193, 1274, 1482, 1648, 1663, 1692, 1772, 1789, 2061, 2234, 2458, 2766, 2800, 2827, 3783, 4019, 4121, 4230, 4390], '38:': [1195, 1276, 1484, 1791, 3785], '6781-6790Crossref': [1196, 1277, 3786], '(215)': [1199, 1280, 3789, 4048, 4150], '(CLs).': [1221], 'Since': [1222], 'central': [1224, 3902, 4064], 'unit': [1226], 'does': [1227, 3974], 'contribute': [1229, 1369, 1371], 'covalent': [1231], 'surprising': [1238], 'shared': [1247], 'dinuclear': [1249], 'with': [1252, 1597, 2383, 2512, 2522, 2526, 2571, 2648, 2737, 2749, 2902, 2921, 2926, 2956, 2969, 2993, 3001, 3095, 3184, 3210, 3252, 3264, 3466, 3501, 3601, 3632, 3650, 3682, 3748, 3944, 3967, 3971, 3977, 4057, 4073, 4188, 4217, 4332, 4346], 'simple': [1253], 'diamine': [1254], 'polyamine': [1256], '(spermidine,': [1257], 'spermine)': [1258], 'linkers': [1259], 'Scholar,15Zaludova': [1282], 'Zakovska': [1284], 'Balcarova': [1288], 'Z.': [1289], 'Kleinwachter': [1290], 'Eur.': [1298], '1997;': [1301, 2098], '246:': [1302], '508-517Crossref': [1303], '(114)': [1306], '2T.': [1309], 'McGregor,': [1311], 'Kasparkova,': [1313], 'K.': [1314], 'Neplechova,': [1315], 'Novakova,': [1317], 'Penazova,': [1319], 'Vrana,': [1321], 'Brabec,': [1323], 'Farrell,': [1326], 'submitted': [1327], 'publication.': [1329], 'incorporation': [1331], 'into': [1332], 'linker': [1334], 'backbone': [1335], 'charge': [1337, 1445], 'hydrogen-bonding': [1339], 'capacity': [1340], 'dramatically': [1341], 'increases': [1342], 'affinity': [1345], 'affects': [1347], 'charge/lipophilicity': [1349], 'balance': [1350], 'increasing': [1354, 3096], 'distance': [1356], 'between': [1357, 1589, 2981, 3896, 3909, 4164], 'two': [1359, 2503, 3859, 3897, 4093], 'platinum-DNA': [1360], 'coordination': [1362], 'spheres.': [1363], 'All': [1364], 'features': [1367], 'differentiating': [1373], 'binding,': [1375], 'cellular': [1376], 'uptake,': [1377], 'within': [1381, 1723], 'family': [1385], 'itself': [1386], '17Roberts': [1405], 'J.D.': [1406, 1427], 'Beggiolin': [1407], 'Piazzoni': [1411], 'Inorg.': [1416, 1433], '77:': [1419, 1436, 3429], '47-50Crossref': [1420], '(72)': [1423], '18Roberts': [1426], 'Peroutka': [1428], '51-57Crossref': [1437], '(109)': [1440], 'facilitates': [1448], 'which': [1453, 1545, 1581, 3719, 3959, 3973], 'significantly': [1455, 1523], 'faster': [1456], 'neutral': [1461], 'cisplatin.': [1462], 'manifested': [1467], 'single-stranded': [1472, 2367, 4218, 4337], '(19Kloster': [1474], 'M.B.G.': [1475], 'Hannis': [1476], 'J.C.': [1477], 'Muddiman': [1478], 'D.C.': [1479], '14731-14737Crossref': [1485], '(74)': [1488], 'Bifunctional': [1491], 'duplex': [1494, 1596, 4105], 'preferentially': [1496, 4216], 'involves': [1497], 'guanine': [1498, 2504], '(G)': [1499, 2505], 'residues.': [1500], 'Quantitation': [1501, 3811], 'cross-linking': [1505, 3813], 'natural': [1507], 'linear': [1509, 3207, 3474], '∼20%': [1512], 'cross-linked.': [1519], 'value': [1521], 'higher': [1524], 'cisplatin;': [1528], 'other': [1531, 4203], 'hand,': [1532], 'intriguing': [1534], 'aspect': [1535], 'delocalized': [1542], 'CLs': [1543, 1569, 1879, 1899, 2108, 2147, 2709, 3461, 3817, 4320], 'platinated': [1547, 2386, 2492, 2515, 2641, 2909, 3703, 3920, 3952, 3978, 4101], 'sites': [1548, 2540, 3608, 3922], 'separated': [1550, 3271, 3579, 3924], 'one': [1552, 2596, 2620, 3926], 'or': [1553, 1559, 2975, 3064, 3079, 3215, 3228, 3820, 3927, 3940, 3955, 4161, 4315], 'more': [1554, 1561, 3822], 'pairs': [1556], 'equally': [1558, 3819], 'even': [1560, 3821, 4102], 'probable': [1562, 3823], 'adducts.': [1565, 3826], '(platinum,platinum)': [1567], 'thus': [1573], 'analogues': [1574], 'cisplatin,': [1580, 1881], 'forms': [1582], '∼90%': [1585], 'neighboring': [1590, 3910], 'purine': [1591], 'residues,': [1592], 'affording': [1593], 'unwound': [1595], 'directional': [1599, 1916], 'fixed': [1600], 'kink': [1601], 'widened,': [1604], 'shallow': [1605], 'minor': [1606, 1744], 'groove': [1607, 1757], '(20Jamieson': [1608], 'Lippard': [1610, 1674, 1690, 1770, 1825, 1958, 1971, 2014, 2027, 2059, 2456, 3032, 4017, 4119], 'S.J.': [1611, 1675, 1691, 1771, 1826, 1959, 1972, 2015, 2028, 2060, 2457, 3033, 4018, 4120], '2467-2498Crossref': [1616], '(2639)': [1619], 'structure': [1623], 'determined': [1627, 3745], 'phasing': [1629], 'assay': [1630, 3468], 'gel': [1633, 2580], 'electrophoresis': [1634, 3016], 'chemical': [1637, 4171, 4190, 4309], 'probes': [1638, 4172, 4310], 'conformation': [1641], '(21Marrot': [1644], 'Leng': [1646, 1661, 1839, 2232, 2435, 2764, 2777, 2798, 2825, 3990, 4034, 4136, 4228], '28:': [1650, 1665], '1454-1461Crossref': [1651], '22Schwartz': [1657], 'Marrot': [1659], '7975-7978Crossref': [1666], '(47)': [1669], '23Bellon': [1672], 'S.F.': [1673, 1687, 1767, 1824, 3031], 'Biophys.': [1676, 1827, 3034], '1990;': [1678, 1829, 1844, 2459, 2481, 3036, 4020, 4122, 4295, 4391], '35:': [1679, 1830, 2063, 3037], '179-188Crossref': [1680, 1831, 3038], '(155)': [1683, 1834, 3041], '24Bellon': [1686], 'Coleman': [1688, 1768], 'J.H.': [1689, 1769], '1991;': [1693, 1773, 4043, 4145], '30:': [1694, 1774], '8026-8035Crossref': [1695, 1775], '(293)': [1698, 1778], 'Scholar)': [1700, 2105, 2298, 2488, 3500, 3631, 3791], 'induce': [1704], 'overall': [1706], 'helix': [1707, 1752], 'bend': [1708], '32–34°': [1710], 'toward': [1711, 1754], 'groove,': [1713], 'unwinding': [1715], '13°,': [1717], 'severe': [1718], 'perturbation': [1719], 'hydrogen': [1721], 'bonding': [1722], '5′-coordinated': [1725], 'GC': [1726], 'bp,': [1727], 'distortion': [1729], 'extended': [1730], 'least': [1733, 2716], '4–5': [1734], 'bp': [1735, 2893], 'site': [1738, 1819, 3739], 'CL.': [1741, 3088], 'Similarly,': [1742], '1,3-intrastrand': [1745], 'CL': [1746, 2978, 3217, 3906, 4114, 4163], 'bends': [1750], 'axis': [1753], '∼35°': [1759], 'locally': [1761, 1813], 'unwinds': [1762], '∼23°': [1765], '(24Bellon': [1766], '25Teuben': [1781], 'J.M.': [1782], 'Wang': [1785], 'A.H.J.': [1786], 'Reedijk': [1787, 2230, 2762], '12305-12312Crossref': [1792], 'Another': [1798], 'alteration': [1804, 1875], 'lesion': [1808], 'denatured': [1814], 'flexible': [1816], 'adduct': [1822, 3891], '(23Bellon': [1823, 3030], '26Anin': [1837], 'M.F.': [1838], 'Nucleic': [1841, 2095, 2860, 4263], 'Acids': [1842, 2096, 2861, 4264], '18:': [1845], '4395-4400Crossref': [1846], '(63)': [1849], 'Scholar),': [1851, 4050], 'contrast': [1853], 'case': [1856, 2906], '1,2-intrastrand': [1859, 3905], 'adduct.': [1860], 'Given': [1861], 'recent': [1863], 'advances': [1864], 'our': [1866, 3766], 'understanding': [1867], 'basis': [1871], 'caused': [1876], 'examine': [1888], 'DNA.': [1906], 'Some': [1907], 'altered': [1909], 'adducts,': [1912], 'bending': [1917], 'unwinding,': [1919], 'attract': [1920], 'damaged': [1922], 'DNA-binding': [1923], 'proteins': [1924, 1993, 3099], 'containing': [1928, 2976, 3104, 4156, 4318], '(HMG)': [1932], '(27Zlatanova': [1934], 'Yaneva': [1936], 'Leuba': [1938], 'S.H.': [1939], 'FASEB': [1940], '1998;': [1942, 2270, 2288], '12:': [1943], '791-799Crossref': [1944], '(117)': [1947, 2103], '28Ohndorf': [1950], 'U.M.': [1951, 2007], 'Rould': [1952, 2008], 'M.A.': [1953, 2009, 4029, 4131], 'He': [1954, 2010], 'Q.': [1955, 2011], 'Pabo': [1956, 2012], 'C.O.': [1957, 2013], 'Nature.': [1960, 2016, 3050], '399:': [1962, 2018], '708-712Crossref': [1963, 2019], '(530)': [1966, 2022], '29Zamble': [1969, 2025], 'D.B.': [1970, 2026, 2052], '73-110Google': [1987, 2043], 'postulated': [1996], 'mediate': [1998], '(28Ohndorf': [2006], 'reports': [2048], 'demonstrated': [2050, 3764], '(30Zamble': [2051], 'Mu': [2053, 3326], 'Reardon': [2055, 3330, 3444], 'J.T.': [2056, 2071, 3331, 3397, 3487, 3618], 'Sancar': [2057, 2076, 3332, 3402, 3447, 3492, 3623], '1996;': [2062, 2863, 4266], '10004-10013Crossref': [2064], '(311)': [2067], '31Reardon': [2070], 'Vaisman': [2072, 3398, 3488, 3619], 'Chaney': [2074, 3400, 3490, 3621], 'S.G.': [2075, 3401, 3491, 3622], '3968-3971PubMed': [2082, 3408, 3498, 3629], '32Moggs': [2085], 'J.G.': [2086, 4385], 'Szymkowski': [2087], 'D.E.': [2088], 'Yamada': [2089], 'Karran': [2091], 'Wood': [2093], 'R.D.': [2094], '25:': [2099], '480-490Crossref': [2100], '(NER)': [2119], 'reactions': [2120, 3377], 'NER': [2123, 2172, 3317], 'contributing': [2129], 'resistance.': [2132], 'Therefore,': [2133], 'addition': [2135], 'examining': [2137], 'alterations': [2140], 'investigated': [2152], 'present': [2155], 'work': [2156], 'HMG1': [2163, 2243, 2248, 2303], '(Fig.': [2175, 2219], 'was': [2177, 2183, 2351, 2398, 2423, 2507, 2623, 2701, 2914, 3464, 3569, 3609, 3641, 3744, 3963, 4055, 4106], 'prepared': [2178, 2197, 2258, 3384], 'standard': [2180], 'methods.': [2181], 'obtained': [2184], 'Sigma': [2186, 2346], '(Prague,': [2187, 2347], 'Czech': [2188, 2348], 'Republic).': [2189, 2349], 'stock': [2191], 'solutions': [2192], '×': [2203], '10−3min': [2204], '10': [2205, 2662, 2936, 3105, 3110, 3298, 3510, 3645, 3657], 'mm': [2206, 2659, 2663, 3106, 3111, 3114, 3117, 3120, 3291, 3296, 3299, 3303, 3533, 3538, 3541, 3544, 3547, 3550, 3664, 3673], 'NaClO4': [2207], 'stored': [2209, 3286], '4': [2211], '°C': [2212, 2689, 2696, 2934, 3564, 3649], 'dark.': [2215, 2940], 'synthetic': [2217, 3836], 'oligodeoxyribonucleotides': [2218], 'synthesized': [2222], 'purified': [2224, 3281], 'described': [2226, 2263, 2758, 2819, 3025, 3322, 3395, 3484, 3612], 'previously': [2227, 2264, 2759, 2820, 3027, 3323, 3485], '(33Brabec': [2228, 2760], '1992;': [2235, 2767], '31:': [2236, 2768], '12397-12402Crossref': [2237, 2769], '(136)': [2240, 2772], '(HMG1domA)': [2246], '(HMG1domB)': [2251], '(residues': [2252], '1–84': [2253], '85–180,': [2255], 'respectively)': [2256], 'Stros': [2261], '(34Stros': [2265, 2283], 'Biol.': [2268, 2286, 3335], '273:': [2271, 2289], '10355-10361Abstract': [2272, 2290], 'Scholar);': [2280], 'their': [2281, 2970, 3074, 3945], 'sequences': [2282, 3844, 3864], 'derived': [2300], 'rat': [2302], 'cDNA.': [2304], 'T4': [2305, 2308, 2312, 2960, 2994, 3265, 3651, 3724, 3759], 'ligase,': [2307], 'polynucleotide': [2309, 2961], 'kinase,': [2310], 'polymerase': [2314, 3653, 3726, 3761], 'purchased': [2316], 'New': [2318], 'England': [2319], 'Biolabs': [2320], '(Beverly,': [2321], 'MA).': [2322], 'Acrylamide,': [2323], 'bis(acrylamide),': [2324], 'urea,': [2325], 'NaCN': [2327, 2929, 4012], 'Merck': [2330], 'KgaA': [2331], '(Darmstadt,': [2332], 'Germany).': [2333, 2365], 'Dimethyl': [2334], '(DMS),': [2336], 'KMnO4,': [2337, 2812, 4210], '(DEPC),': [2340], 'KBr,': [2341], 'KHSO5': [2343], '[γ-32P]ATP': [2350, 2957], 'Amersham': [2353, 2732], 'Pharmacia': [2354, 2733], 'Biotech.ATP': [2355], 'deoxyribonucleoside': [2357], 'triphosphates': [2358], 'Roche': [2361], 'Molecular': [2362, 3173, 3590], 'Biochemicals': [2363], '(Mannheim,': [2364], 'oligonucleotides': [2368, 2387, 2417, 2567, 2612, 2686, 3061, 3190], '(the': [2369], 'top': [2370, 2493, 2518, 2631, 2642, 3852, 3875, 3933, 4069], 'strands': [2371, 2494, 2519, 2632, 2643, 2651, 2653, 2888, 2946, 2948, 2973, 3076, 3853, 3876, 3934, 4070, 4099], 'duplexes': [2374, 2497, 2891, 2988, 3004, 3090, 3209, 3856, 3937, 3957, 4155, 4179, 4317], 'Fig.': [2376, 2655, 2896, 2950, 3848, 4183, 4326], 'reacted': [2379, 2525, 3970], 'stoichiometric': [2381], 'amounts': [2382], 'BBR3464.': [2384, 2615], 'repurified': [2389], 'ion-exchange': [2391], '(FPLC).': [2396], 'It': [2397, 2422, 2700], 'verified': [2399, 2425, 2702], 'flameless': [2402, 2722], 'atomic': [2403, 2723], 'absorption': [2404, 2724], 'spectrophotometry': [2405, 2725], 'measurements': [2409, 2726], 'optical': [2412], 'density': [2413], 'modified': [2416, 2613, 3234, 3878], 'contained': [2418, 3509, 3858, 3884], 'three': [2419, 3928, 4085], 'atoms.': [2421], 'using': [2426, 2959, 3171, 3469, 3588, 3701], 'DMS': [2427, 2528, 4074], 'footprinting': [2428], '(35Brabec': [2433, 3988], 'Proc.': [2437, 2779, 3360, 3421, 3992, 4036, 4138], 'Natl.': [2438, 2780, 3361, 3422, 3993, 4037, 4139], 'Acad.': [2439, 2781, 3362, 3423, 3994, 4038, 4140], '1993;': [2444, 2786, 2801, 2828, 3999, 4231], '90:': [2445, 2787, 4000], '5345-5349Crossref': [2446, 2788, 4001], '(266)': [2449, 2791, 4004], '36Comess': [2452], 'K.M.': [2453, 4014, 4116], 'Costello': [2454, 4015, 4117], 'C.E.': [2455, 4016, 4118], '29:': [2460, 4021, 4123, 4392], '2102-2110Crossref': [2461, 4022, 4124], '(85)': [2464, 4025, 4127], '37Lemaire': [2467], 'Thauvette': [2469], 'Deforesta': [2471], 'Viel': [2473], 'Beauregard': [2475], 'Potier': [2477], '267:': [2482], '431-439Crossref': [2483], '(95)': [2486], 'all': [2496, 2634, 4084], 'N7': [2499, 2531, 2557, 3982], 'position': [2500, 2532, 3983], 'residues': [2506, 2535, 3861, 3899, 4066, 4095, 4166, 4335], 'accessible': [2509, 3987], 'reaction': [2511, 2917, 3505, 3530], 'DMS.': [2513, 2527], 'Briefly,': [2514, 3635], 'nonmodified': [2517, 2584], '(5′': [2520], 'end-labeled': [2521, 2901, 2955, 3068, 3237, 3966], '32P)': [2523], 'methylates': [2529], 'G': [2534, 2598, 2627, 2982, 3794, 3860, 3898, 3911, 3921, 3979, 4065, 4094, 4165], 'producing': [2538], 'alkali-labile': [2539], '(38Maxam': [2541], 'Gilbert': [2543], 'Methods': [2545], 'Enzymol.': [2546], '1980;': [2547, 3428], '65:': [2548], '499-560Crossref': [2549], '(9015)': [2552], 'However,': [2555, 2604], 'if': [2556], 'coordinated': [2559, 2624], 'platinum,': [2561], 'cannot': [2563], 'methylated.': [2565], 'then': [2569, 3138, 4052], 'treated': [2570, 4056, 4187], 'hot': [2572], 'piperidine': [2573], 'analyzed': [2575, 4169], 'denaturing': [2577, 3278, 3582, 3696], '24%': [2578], 'polyacrylamide': [2579, 3011, 3157, 3279, 3583, 3697], 'electrophoresis.': [2581], 'For': [2582], 'oligonucleotides,': [2585, 2910, 3261], 'shortened': [2586], 'fragments': [2587], 'due': [2588], 'cleavage': [2591], 'strand': [2594, 3962], 'methylated': [2597], 'gel.': [2603, 3698], 'bands': [2607, 3181, 3598], 'detected': [2609], 'indicate': [2618], 'molecule': [2622], 'both': [2626], 'resides': [2628], 'duplexes.': [2635, 4087], 'If': [2636], 'stated': [2638], 'otherwise,': [2639], 'allowed': [2645, 2990], 'anneal': [2647], 'unplatinated': [2649, 3003, 4061], '(bottom': [2652, 2947], '50': [2658, 3113, 3515, 3663, 3675], 'NaCl': [2660], 'plus': [2661], 'Tris-HCl': [2664, 3292, 3665], '(pH': [2665, 2930, 3108, 3293, 3535, 3666], '7.4)': [2666], 'used': [2668, 3203, 3713, 4194], 'immediately': [2669], 'further': [2671, 3642, 4168], 'experiments.': [2672], 'annealing': [2674, 3288], 'procedure': [2675], 'included': [2676], 'heating': [2679], 'mixture': [2682], '60': [2688], 'followed': [2690], 'incubation': [2693, 2925], '25': [2695], '2': [2698, 4327], 'h.': [2699, 2718], 'under': [2704], 'conditions': [2706], '24': [2717], 'FPLC': [2719, 2735], 'purification': [2720, 3312], 'carried': [2728], 'out': [2729], 'Biotech': [2734], 'system': [2736], 'MonoQ': [2738], 'HR': [2739], '5/5': [2740], 'column': [2741], 'Unicam': [2744], '939': [2745], 'AA': [2746], 'spectrometer': [2747], 'equipped': [2748], 'graphite': [2751], 'furnace,': [2752], 'respectively.': [2753, 3232, 3930], 'Other': [2754, 3018, 3308], 'details': [2755, 3019, 3309], '35Brabec': [2775], '39Brabec': [2794], 'Sip': [2796, 2823, 4226], '32:': [2802, 2829, 4232], '11676-11681Crossref': [2803, 2830, 4233], '(112)': [2806, 2833, 4236], 'DEPC,': [2813, 4211], 'KBr/KHSO5': [2815], 'performed': [2817, 3379, 3610], '(39Brabec': [2821, 4224], '40Bailly': [2836, 4239], 'Gentle': [2838, 4241, 4350], 'Hamy': [2840, 4243, 4352], 'Purcell': [2842, 4245, 4354], 'Waring': [2844, 2873, 4247, 4276, 4356, 4370], 'M.J.': [2845, 2874, 4248, 4277, 4357, 4371], '1994;': [2848, 4251, 4360], '300:': [2849, 4252, 4361], '165-173Crossref': [2850, 4253, 4362], '(35)': [2853, 4256, 4365], '41Ross': [2856, 4259], 'S.A.': [2857, 4260], 'Burrows': [2858, 4261], 'C.J.': [2859, 4262], '24:': [2864, 4267], '5062-5063Crossref': [2865, 4268], '(51)': [2868, 4271], '42Bailly': [2871, 4274, 4368], 'Fox': [2875, 4278, 4372], 'K.R.': [2876, 4279, 4373], 'Drug-DNA': [2877, 4280, 4374], 'Interaction': [2878, 4281, 4375], 'Protocols.': [2879, 4282, 4376], 'Inc,': [2882, 4285, 4379], 'NJ1997:': [2884, 4287, 4381], '51-79Google': [2885, 4288, 4382], '(22': [2892], 'shown': [2894, 3846, 4181], 'B)': [2898, 2952, 4185], '5′': [2900, 2954, 3067, 3247, 3737, 3965], '[γ-32P]ATP.': [2903], 'complex': [2913, 3895], 'after': [2916, 4103], 'probe': [2923], '0.2': [2927, 3122], 'm': [2928], '11)': [2931], '45': [2933], 'h': [2937], 'Unplatinated': [2941, 2984], '15-': [2942], '19–22-mer': [2944], 'single': [2945, 3886], 'kinase.': [2962], 'Then': [2963], 'they': [2964, 3883], 'annealed': [2966, 3070, 3251], '(see': [2967, 3071, 3477], 'above)': [2968, 3072, 3478], 'phosphorylated': [2971], '(unplatinated': [2974], 'residues).': [2983], 'CL-containing': [2987], 'react': [2992, 3976, 4215], 'ligase.': [2996, 3267], 'resulting': [2998], 'samples': [2999, 3949], 'along': [3000], 'ligated': [3002, 3263], 'subsequently': [3006], '8%': [3009], 'native': [3010, 3156], '(mono:bis(acrylamide)': [3012, 3159], 'ratio': [3013, 3160], '=': [3014, 3161], '29:1)': [3015], 'gels.': [3017], 'experiments': [3022], 'published': [3028], 'papers': [3029], '43Koo': [3044], 'H.S.': [3045], 'Wu': [3046], 'H.M.': [3047], 'Crothers': [3048], 'D.M.': [3049], '1986;': [3051], '320:': [3052], '501-506Crossref': [3053], '(886)': [3056], '20-mer': [3060, 3189], '5′-d(AGAAGAAGACCAGAGAGAGG),': [3062], '5′-d(AGAAGAACACAAGAGAGAGG),': [3063], '5′-d(AGAAGAACAACAGAGAGAGG)': [3065], '5′-d(CCTCTCTCTG*G*TCTTCTTCT),': [3077], '5′-d(CCTCTCTCTTG*TG*TTCTTCT),': [3078], '5′-d(CCTCTCTCTG*TTG*TTCTTCT)': [3080], 'respectively,': [3081], 'asterisks': [3084, 3197], '(0.4': [3091], 'nm)': [3092], 'incubated': [3094, 3131, 3561, 3643], 'concentrations': [3097], '20-μl': [3101], 'sample': [3102, 4054], 'volumes': [3103], 'HEPES': [3107, 3534], '7.5),': [3109], 'MgCl2,': [3112, 3300, 3542], 'LiCl,': [3115], '100': [3116, 3295], 'NaCl,': [3118, 3297], 'spermidine,': [3121], 'mg/ml': [3123], 'BSA,': [3124, 3555, 3680], '0.05%': [3126], 'Nonidet': [3127], 'P40.': [3128], 'Samples': [3129], 'ice': [3133], '30': [3135, 3563, 3648], 'min': [3136, 3646], 'made': [3139, 3740], '7%': [3140], 'sucrose': [3142], '0.017%': [3144], 'xylene': [3146], 'cyanol': [3147], 'prior': [3148], 'loading': [3149], 'prerun,': [3151], 'precooled': [3152], '(4': [3153], '°C)': [3154], '6%': [3155, 3277], 'gels': [3158, 3584], '29:1).': [3162], 'Gels': [3163], 'electrophoresed': [3165], '3': [3167], 'h,': [3168], 'visualized': [3169, 3586, 3689], 'Dynamics': [3174, 3591], 'PhosphorImager': [3175, 3592], '(Storm': [3176, 3593], '860': [3177, 3594], 'system),': [3178, 3595], 'quantitated': [3183, 3600], 'ImageQuant': [3186, 3603], 'software.': [3187, 3604], '5′d(CCTCTCTCTTG*G*TTCTTCTT),': [3191], '5′d(CCTCTCTCTTG*TG*TTCTTCT),': [3192], '5′d(CCTCTCTCTTG*TTTG*TTCTCT),': [3194], 'CL,': [3201, 3250], 'preparation': [3205], '148-bp': [3208, 3473], 'centrally': [3211], 'located': [3212], '1,2-,': [3213, 3887, 4159], '1,3-,': [3214, 3888, 4160], '1,5-intrastrand': [3216, 3890, 3917, 4162], 'nucleotides': [3221], '75': [3222, 3225, 3229], '76,': [3224], '77,': [3227], '78,': [3231], 'Uniquely': [3233], '20-mers': [3235, 3704], 'introduce': [3239], 'radiolabel': [3241], '11th': [3244], 'phosphodiester': [3245], 'bond': [3246], 'set': [3254], 'five': [3256], 'partially': [3259], 'overlapping': [3260], 'Full-length': [3268], 'substrates': [3269, 3315, 3476], 'unligated': [3273], 'products': [3274, 3577, 3753], 'gel,': [3280], 'electroelution,': [3283], 'reannealed,': [3284], 'buffer': [3289, 3531, 3660], '(50': [3290], '7.9),': [3294, 3536], 'dithiothreitol)': [3304], '−20': [3306], '°C.': [3307], 'same': [3320, 3481], '(44Matsunaga': [3324], 'T.': [3325, 3353, 3443], 'Park': [3328], 'C.-H.': [3329], '1995;': [3337], '270:': [3338], '20862-20869Abstract': [3339], '(181)': [3347], '45Buschta-Hedayat': [3350], 'Buterin': [3352], 'Hess': [3354], 'M.T.': [3355], 'Missura': [3356], 'Naegeli': [3358], '96:': [3368], '6090-6095Crossref': [3369], '(96)': [3372], 'Oligonucleotide': [3375], 'extracts': [3382, 3437], '(CFEs)': [3383], 'HeLa': [3387], 'S3': [3388], 'CHO': [3390], 'AA8': [3391], '(31Reardon': [3396, 3486, 3617], '46Manley': [3411], 'J.L.': [3412], 'Fire': [3413], 'Cano': [3415], 'Sharp': [3417], 'P.A.': [3418], 'Gefter': [3419], 'M.L.': [3420], '3855-3859Crossref': [3430], '(735)': [3433], 'kindly': [3439], 'provided': [3440], 'University': [3450], 'North': [3452], 'Carolina': [3453], '(Chapel': [3454], 'Hill,': [3455], 'NC).In': [3456], 'measured': [3465], 'CFEs': [3471], 'way': [3482], 'small': [3502, 3633], 'modifications.': [3503, 3634], 'mixtures': [3506], '(25': [3507], 'μl)': [3508], 'fmol': [3511], 'radiolabeled': [3513], 'μg': [3516, 3553, 3684], 'CFE,': [3518], '20': [3519, 3678], 'μm': [3520], 'each': [3521], 'dATP,': [3523], 'dCTP,': [3524], 'dGTP,': [3525], 'TTP': [3527], '(23': [3532], '44': [3537], 'KCl,': [3539], '4.8': [3540], '0.16': [3543], 'EDTA,': [3545, 3674], '0.52': [3546], 'dithiothreitol,': [3548], '1.5': [3549], 'ATP,': [3551], '5': [3552], '2.5%': [3557], 'glycerol)': [3558], '40': [3566], 'min.': [3567], 'deproteinized': [3570], 'precipitated': [3572], 'ethanol.': [3574], '10%': [3581, 3695], 'Mapping': [3605], 'incision': [3607, 3738], 'previous': [3615, 3767], 'report': [3616], 'product': [3639], '(gel-purified)': [3640], '(0.15': [3654], 'units)': [3655], 'μl': [3658], 'composed': [3661], '8.8),': [3667], '15': [3668], 'mm(NH4)2SO4,': [3669], '7': [3670], 'mmMgCl2,': [3671], '0.1': [3672], 'mmβ-mercaptoethanol,': [3676], 'μg/ml': [3679], 'supplemented': [3681], '0.5': [3683], 'ofSmaI-digested': [3685], 'pBluescript': [3686], 'autoradiography': [3691], 'following': [3692], 'resolution': [3693], 'Similar': [3699], 'analyses': [3700], 'radiolabeled,': [3702], '(used': [3705], 'assays)': [3710], 'identify': [3715], 'nucleotide(s)': [3717], 'exonuclease': [3721], 'blocked': [3728], '3′': [3729], 'lesion.': [3732], 'location': [3734], 'excinuclease': [3743], 'length': [3750], 'absence': [3757], 'digestion.': [3762], 'paper': [3768], 'preferential': [3793], 'including': [3804], 'CLs.': [3810], 'Considering': [3827], 'facts': [3829], 'designed': [3832], 'series': [3834], 'oligodeoxyribonucleotide': [3837], 'duplexes,': [3838, 4062], 'TGGT,': [3839, 3865, 3938, 3953], 'TGTGT,': [3840, 3866, 3939, 3954], 'TGTTTGT,': [3842], 'whose': [3843], '1.': [3849], 'pyrimidine-rich': [3851], 'only': [3857, 3964], 'TGTTGT': [3868], 'center': [3871], '(Fig.1,': [3872], 'bold).': [3873], 'so': [3881], 'sequences.': [3903], 'formed': [3908, 4107], 'sites,': [3912], 'whereas,': [3913], '1,3-': [3915], 'CLs,': [3918], 'nucleotides,': [3929], 'cross-linked': [3932, 4086, 4178], 'TGTTTGT': [3941, 3956], 'hybridized': [3943], 'strands.': [3947], 'upper': [3961, 4098], '32P': [3968], 'DMS,': [3972], 'because': [3980], 'longer': [3986, 4081], '(36Comess': [4013, 4115], '47Lemaire': [4028, 4130], 'Schwartz': [4030, 4132], 'Rahmouni': [4032, 4134], 'A.R.': [4033, 4135], '88:': [4044, 4146], '1982-1985Crossref': [4045, 4147], 'piperidine.': [4058], 'reactive': [4072, 4082], '(data': [4075], 'shown).': [4077], 'They': [4078, 4214], 'observation': [4089], 'confirms': [4090], 'remained': [4100], 'involved': [4110], 'oligonucleotide': [4154], 'site-specific': [4158], 'conformation.': [4175], '(22-bp,': [4180], 'tools': [4196], 'monitoring': [4198], 'existence': [4200], 'conformations': [4202], 'canonical': [4205], 'B-DNA.': [4206], 'include': [4209], 'bromine.': [4213], 'distorted': [4221, 4342], 'double-stranded': [4222], '48Nielsen': [4290], 'P.E.': [4291], 'Recognit.': [4294], '3:': [4296], '(130)': [4300], 'analysis': [4307], 'TGGT(22),': [4313], 'TGTGT(22),': [4314], 'TGTTTGT(22)': [4316], 'summarized': [4324], 'KMnO4': [4329], 'hyperreactive': [4331], 'thymine': [4333], '(T)': [4334], 'nucleic': [4338], 'acids': [4339], 'compared': [4345], 'B-DNA': [4347], '(40Bailly': [4348], '49McCarthy': [4384], 'Williams': [4386], 'L.D.': [4387], 'Rich': [4388], '6071-6081Cr': [4393]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2083106594', 'counts_by_year': [{'year': 2023, 'cited_by_count': 4}, {'year': 2022, 'cited_by_count': 1}, {'year': 2021, 'cited_by_count': 3}, {'year': 2017, 'cited_by_count': 3}, {'year': 2016, 'cited_by_count': 2}, {'year': 2014, 'cited_by_count': 3}, {'year': 2013, 'cited_by_count': 2}, {'year': 2012, 'cited_by_count': 1}], 'updated_date': '2025-01-21T07:44:28.089968', 'created_date': '2016-06-24'}