Get quick answers to your questions about the article from our AI researcher chatbot
{'id': 'https://openalex.org/W2080655657', 'doi': 'https://doi.org/10.1074/mcp.m110.006148', 'title': 'Splicing Factor 2-Associated Protein p32 Participates in Ribosome Biogenesis by Regulating the Binding of Nop52 and Fibrillarin to Preribosome Particles', 'display_name': 'Splicing Factor 2-Associated Protein p32 Participates in Ribosome Biogenesis by Regulating the Binding of Nop52 and Fibrillarin to Preribosome Particles', 'publication_year': 2011, 'publication_date': '2011-05-03', 'ids': {'openalex': 'https://openalex.org/W2080655657', 'doi': 'https://doi.org/10.1074/mcp.m110.006148', 'mag': '2080655657', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/21536856', 'pmcid': 'https://www.ncbi.nlm.nih.gov/pmc/articles/3149089'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/mcp.m110.006148', 'pdf_url': 'http://www.mcponline.org/article/S1535947620301778/pdf', 'source': {'id': 'https://openalex.org/S104550190', 'display_name': 'Molecular & Cellular Proteomics', 'issn_l': '1535-9476', 'issn': ['1535-9476', '1535-9484'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.mcponline.org/article/S1535947620301778/pdf', 'any_repository_has_fulltext': True}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5019806968', 'display_name': 'Harunori Yoshikawa', 'orcid': 'https://orcid.org/0000-0003-3793-6219'}, 'institutions': [{'id': 'https://openalex.org/I92614990', 'display_name': 'Tokyo University of Agriculture and Technology', 'ror': 'https://ror.org/00qg0kr10', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I92614990']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Harunori Yoshikawa', 'raw_affiliation_strings': ['Department of Applied Life Science, United Graduate School of Agriculture, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Applied Life Science, United Graduate School of Agriculture, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509, Japan', 'institution_ids': ['https://openalex.org/I92614990']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5004449159', 'display_name': 'Wataru Komatsu', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I92614990', 'display_name': 'Tokyo University of Agriculture and Technology', 'ror': 'https://ror.org/00qg0kr10', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I92614990']}, {'id': 'https://openalex.org/I78274823', 'display_name': 'Dokkyo Medical University', 'ror': 'https://ror.org/05k27ay38', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I78274823']}, {'id': 'https://openalex.org/I1319490839', 'display_name': 'Ministry of Education, Culture, Sports, Science and Technology', 'ror': 'https://ror.org/048rj2z13', 'country_code': 'JP', 'type': 'government', 'lineage': ['https://openalex.org/I1319490839']}, {'id': 'https://openalex.org/I4210104019', 'display_name': 'Pioneer (Japan)', 'ror': 'https://ror.org/014kzp326', 'country_code': 'JP', 'type': 'company', 'lineage': ['https://openalex.org/I4210104019']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Wataru Komatsu', 'raw_affiliation_strings': ['Department of Applied Life Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Mibu, Tochigi 321-0293, Japan', 'Integrated Proteomics System Project, Pioneer Research on Genome the Frontier, Ministry of Education, Culture, Sports, Science and Technology of Japan, Mibu, Tochigi 321-0293, Japan', 'Present address: Department of Public Health, Dokkyo Medical University School of Medicine, 880 Kitakobayashi, Mibu, Tochigi 321-0293, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Applied Life Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Mibu, Tochigi 321-0293, Japan', 'institution_ids': ['https://openalex.org/I92614990']}, {'raw_affiliation_string': 'Present address: Department of Public Health, Dokkyo Medical University School of Medicine, 880 Kitakobayashi, Mibu, Tochigi 321-0293, Japan', 'institution_ids': ['https://openalex.org/I78274823']}, {'raw_affiliation_string': 'Integrated Proteomics System Project, Pioneer Research on Genome the Frontier, Ministry of Education, Culture, Sports, Science and Technology of Japan, Mibu, Tochigi 321-0293, Japan', 'institution_ids': ['https://openalex.org/I1319490839', 'https://openalex.org/I4210104019']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5045817143', 'display_name': 'Toshiya Hayano', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I92614990', 'display_name': 'Tokyo University of Agriculture and Technology', 'ror': 'https://ror.org/00qg0kr10', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I92614990']}, {'id': 'https://openalex.org/I1319490839', 'display_name': 'Ministry of Education, Culture, Sports, Science and Technology', 'ror': 'https://ror.org/048rj2z13', 'country_code': 'JP', 'type': 'government', 'lineage': ['https://openalex.org/I1319490839']}, {'id': 'https://openalex.org/I4210104019', 'display_name': 'Pioneer (Japan)', 'ror': 'https://ror.org/014kzp326', 'country_code': 'JP', 'type': 'company', 'lineage': ['https://openalex.org/I4210104019']}, {'id': 'https://openalex.org/I135768898', 'display_name': 'Ritsumeikan University', 'ror': 'https://ror.org/0197nmd03', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I135768898', 'https://openalex.org/I4390039241']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Toshiya Hayano', 'raw_affiliation_strings': ['Department of Applied Life Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Mibu, Tochigi 321-0293, Japan', 'Integrated Proteomics System Project, Pioneer Research on Genome the Frontier, Ministry of Education, Culture, Sports, Science and Technology of Japan, Mibu, Tochigi 321-0293, Japan', 'Present address: Department of Biomedical Sciences, College of Life Sciences, Ritsumeikan University, 1-1-1 Nojihigashi, Kusatsu 525-8577, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Applied Life Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Mibu, Tochigi 321-0293, Japan', 'institution_ids': ['https://openalex.org/I92614990']}, {'raw_affiliation_string': 'Integrated Proteomics System Project, Pioneer Research on Genome the Frontier, Ministry of Education, Culture, Sports, Science and Technology of Japan, Mibu, Tochigi 321-0293, Japan', 'institution_ids': ['https://openalex.org/I1319490839', 'https://openalex.org/I4210104019']}, {'raw_affiliation_string': 'Present address: Department of Biomedical Sciences, College of Life Sciences, Ritsumeikan University, 1-1-1 Nojihigashi, Kusatsu 525-8577, Japan', 'institution_ids': ['https://openalex.org/I135768898']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5101912659', 'display_name': 'Yutaka Miura', 'orcid': 'https://orcid.org/0000-0002-8113-8014'}, 'institutions': [{'id': 'https://openalex.org/I4210086780', 'display_name': 'Japan Science and Technology Agency', 'ror': 'https://ror.org/00097mb19', 'country_code': 'JP', 'type': 'government', 'lineage': ['https://openalex.org/I4210086780']}, {'id': 'https://openalex.org/I92614990', 'display_name': 'Tokyo University of Agriculture and Technology', 'ror': 'https://ror.org/00qg0kr10', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I92614990']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Yutaka Miura', 'raw_affiliation_strings': ['Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Agency (JST), Sanbancho 5, Chiyoda-ku, Tokyo 102-0075, Japan', 'Department of Applied Life Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Mibu, Tochigi 321-0293, Japan', 'Department of Applied Life Science, United Graduate School of Agriculture, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509, Japan'], 'affiliations': [{'raw_affiliation_string': 'Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Agency (JST), Sanbancho 5, Chiyoda-ku, Tokyo 102-0075, Japan', 'institution_ids': ['https://openalex.org/I4210086780']}, {'raw_affiliation_string': 'Department of Applied Life Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Mibu, Tochigi 321-0293, Japan', 'institution_ids': ['https://openalex.org/I92614990']}, {'raw_affiliation_string': 'Department of Applied Life Science, United Graduate School of Agriculture, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509, Japan', 'institution_ids': ['https://openalex.org/I92614990']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5034075082', 'display_name': 'Keiichi Homma', 'orcid': 'https://orcid.org/0000-0002-9603-0874'}, 'institutions': [{'id': 'https://openalex.org/I4210158934', 'display_name': 'Research Organization of Information and Systems', 'ror': 'https://ror.org/04p4e8t29', 'country_code': 'JP', 'type': 'facility', 'lineage': ['https://openalex.org/I1319490839', 'https://openalex.org/I4210158934']}, {'id': 'https://openalex.org/I47232531', 'display_name': 'Bank of Japan', 'ror': 'https://ror.org/04zmdqe71', 'country_code': 'JP', 'type': 'other', 'lineage': ['https://openalex.org/I47232531']}, {'id': 'https://openalex.org/I113198587', 'display_name': 'National Institute of Genetics', 'ror': 'https://ror.org/02xg1m795', 'country_code': 'JP', 'type': 'facility', 'lineage': ['https://openalex.org/I113198587', 'https://openalex.org/I1319490839', 'https://openalex.org/I4210158934']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Keiichi Homma', 'raw_affiliation_strings': ['Center for Information Biology-DNA Data Bank of Japan, National Institute of Genetics, Research Organization of Information and Systems, Mishima, Shizuoka 411-8540, Japan'], 'affiliations': [{'raw_affiliation_string': 'Center for Information Biology-DNA Data Bank of Japan, National Institute of Genetics, Research Organization of Information and Systems, Mishima, Shizuoka 411-8540, Japan', 'institution_ids': ['https://openalex.org/I4210158934', 'https://openalex.org/I47232531', 'https://openalex.org/I113198587']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5022011388', 'display_name': 'Keiichi Izumikawa', 'orcid': 'https://orcid.org/0000-0001-7262-5403'}, 'institutions': [{'id': 'https://openalex.org/I4210086780', 'display_name': 'Japan Science and Technology Agency', 'ror': 'https://ror.org/00097mb19', 'country_code': 'JP', 'type': 'government', 'lineage': ['https://openalex.org/I4210086780']}, {'id': 'https://openalex.org/I92614990', 'display_name': 'Tokyo University of Agriculture and Technology', 'ror': 'https://ror.org/00qg0kr10', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I92614990']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Keiichi Izumikawa', 'raw_affiliation_strings': ['Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Agency (JST), Sanbancho 5, Chiyoda-ku, Tokyo 102-0075, Japan', 'Department of Applied Life Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Mibu, Tochigi 321-0293, Japan'], 'affiliations': [{'raw_affiliation_string': 'Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Agency (JST), Sanbancho 5, Chiyoda-ku, Tokyo 102-0075, Japan', 'institution_ids': ['https://openalex.org/I4210086780']}, {'raw_affiliation_string': 'Department of Applied Life Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Mibu, Tochigi 321-0293, Japan', 'institution_ids': ['https://openalex.org/I92614990']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5077124170', 'display_name': 'Hideaki Ishikawa', 'orcid': 'https://orcid.org/0000-0002-5205-7477'}, 'institutions': [{'id': 'https://openalex.org/I4210086780', 'display_name': 'Japan Science and Technology Agency', 'ror': 'https://ror.org/00097mb19', 'country_code': 'JP', 'type': 'government', 'lineage': ['https://openalex.org/I4210086780']}, {'id': 'https://openalex.org/I92614990', 'display_name': 'Tokyo University of Agriculture and Technology', 'ror': 'https://ror.org/00qg0kr10', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I92614990']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Hideaki Ishikawa', 'raw_affiliation_strings': ['Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Agency (JST), Sanbancho 5, Chiyoda-ku, Tokyo 102-0075, Japan', 'Department of Applied Life Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Mibu, Tochigi 321-0293, Japan'], 'affiliations': [{'raw_affiliation_string': 'Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Agency (JST), Sanbancho 5, Chiyoda-ku, Tokyo 102-0075, Japan', 'institution_ids': ['https://openalex.org/I4210086780']}, {'raw_affiliation_string': 'Department of Applied Life Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Mibu, Tochigi 321-0293, Japan', 'institution_ids': ['https://openalex.org/I92614990']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5020151133', 'display_name': 'Naoki Miyazawa', 'orcid': 'https://orcid.org/0000-0003-2983-7106'}, 'institutions': [{'id': 'https://openalex.org/I92614990', 'display_name': 'Tokyo University of Agriculture and Technology', 'ror': 'https://ror.org/00qg0kr10', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I92614990']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Naoki Miyazawa', 'raw_affiliation_strings': ['Department of Applied Life Science, United Graduate School of Agriculture, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Applied Life Science, United Graduate School of Agriculture, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509, Japan', 'institution_ids': ['https://openalex.org/I92614990']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5047381115', 'display_name': 'Hiroyuki Tachikawa', 'orcid': 'https://orcid.org/0000-0002-4815-9964'}, 'institutions': [{'id': 'https://openalex.org/I92614990', 'display_name': 'Tokyo University of Agriculture and Technology', 'ror': 'https://ror.org/00qg0kr10', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I92614990']}, {'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Hiroyuki Tachikawa', 'raw_affiliation_strings': ['Department of Applied Life Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Mibu, Tochigi 321-0293, Japan', 'Present address: Graduate School of Agricultural and Life Sciences, University of Tokyo, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Applied Life Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Mibu, Tochigi 321-0293, Japan', 'institution_ids': ['https://openalex.org/I92614990']}, {'raw_affiliation_string': 'Present address: Graduate School of Agricultural and Life Sciences, University of Tokyo, Japan', 'institution_ids': ['https://openalex.org/I74801974']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5019620890', 'display_name': 'Yoshio Yamauchi', 'orcid': 'https://orcid.org/0000-0001-5559-4596'}, 'institutions': [{'id': 'https://openalex.org/I69740276', 'display_name': 'Tokyo Metropolitan University', 'ror': 'https://ror.org/00ws30h19', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I69740276']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Yoshio Yamauchi', 'raw_affiliation_strings': ['Department of Chemistry, Graduate School of Sciences and Engineering, Tokyo Metropolitan University, 1-1 Minamiosawa, Hachiouji-shi, Tokyo 192-0397, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Chemistry, Graduate School of Sciences and Engineering, Tokyo Metropolitan University, 1-1 Minamiosawa, Hachiouji-shi, Tokyo 192-0397, Japan', 'institution_ids': ['https://openalex.org/I69740276']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5011865780', 'display_name': 'Toshiaki Isobe', 'orcid': 'https://orcid.org/0000-0002-0934-9298'}, 'institutions': [{'id': 'https://openalex.org/I4210086780', 'display_name': 'Japan Science and Technology Agency', 'ror': 'https://ror.org/00097mb19', 'country_code': 'JP', 'type': 'government', 'lineage': ['https://openalex.org/I4210086780']}, {'id': 'https://openalex.org/I69740276', 'display_name': 'Tokyo Metropolitan University', 'ror': 'https://ror.org/00ws30h19', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I69740276']}, {'id': 'https://openalex.org/I1319490839', 'display_name': 'Ministry of Education, Culture, Sports, Science and Technology', 'ror': 'https://ror.org/048rj2z13', 'country_code': 'JP', 'type': 'government', 'lineage': ['https://openalex.org/I1319490839']}, {'id': 'https://openalex.org/I4210104019', 'display_name': 'Pioneer (Japan)', 'ror': 'https://ror.org/014kzp326', 'country_code': 'JP', 'type': 'company', 'lineage': ['https://openalex.org/I4210104019']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Toshiaki Isobe', 'raw_affiliation_strings': ['Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Agency (JST), Sanbancho 5, Chiyoda-ku, Tokyo 102-0075, Japan', 'Department of Chemistry, Graduate School of Sciences and Engineering, Tokyo Metropolitan University, 1-1 Minamiosawa, Hachiouji-shi, Tokyo 192-0397, Japan', 'Integrated Proteomics System Project, Pioneer Research on Genome the Frontier, Ministry of Education, Culture, Sports, Science and Technology of Japan, Mibu, Tochigi 321-0293, Japan'], 'affiliations': [{'raw_affiliation_string': 'Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Agency (JST), Sanbancho 5, Chiyoda-ku, Tokyo 102-0075, Japan', 'institution_ids': ['https://openalex.org/I4210086780']}, {'raw_affiliation_string': 'Department of Chemistry, Graduate School of Sciences and Engineering, Tokyo Metropolitan University, 1-1 Minamiosawa, Hachiouji-shi, Tokyo 192-0397, Japan', 'institution_ids': ['https://openalex.org/I69740276']}, {'raw_affiliation_string': 'Integrated Proteomics System Project, Pioneer Research on Genome the Frontier, Ministry of Education, Culture, Sports, Science and Technology of Japan, Mibu, Tochigi 321-0293, Japan', 'institution_ids': ['https://openalex.org/I1319490839', 'https://openalex.org/I4210104019']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5006967707', 'display_name': 'Nobuhiro Takahashi', 'orcid': 'https://orcid.org/0000-0002-1984-0144'}, 'institutions': [{'id': 'https://openalex.org/I4210086780', 'display_name': 'Japan Science and Technology Agency', 'ror': 'https://ror.org/00097mb19', 'country_code': 'JP', 'type': 'government', 'lineage': ['https://openalex.org/I4210086780']}, {'id': 'https://openalex.org/I92614990', 'display_name': 'Tokyo University of Agriculture and Technology', 'ror': 'https://ror.org/00qg0kr10', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I92614990']}, {'id': 'https://openalex.org/I1319490839', 'display_name': 'Ministry of Education, Culture, Sports, Science and Technology', 'ror': 'https://ror.org/048rj2z13', 'country_code': 'JP', 'type': 'government', 'lineage': ['https://openalex.org/I1319490839']}, {'id': 'https://openalex.org/I4210104019', 'display_name': 'Pioneer (Japan)', 'ror': 'https://ror.org/014kzp326', 'country_code': 'JP', 'type': 'company', 'lineage': ['https://openalex.org/I4210104019']}], 'countries': ['JP'], 'is_corresponding': True, 'raw_author_name': 'Nobuhiro Takahashi', 'raw_affiliation_strings': ['Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Agency (JST), Sanbancho 5, Chiyoda-ku, Tokyo 102-0075, Japan', 'Department of Applied Life Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Mibu, Tochigi 321-0293, Japan', 'Department of Applied Life Science, United Graduate School of Agriculture, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509, Japan', 'Integrated Proteomics System Project, Pioneer Research on Genome the Frontier, Ministry of Education, Culture, Sports, Science and Technology of Japan, Mibu, Tochigi 321-0293, Japan'], 'affiliations': [{'raw_affiliation_string': 'Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Agency (JST), Sanbancho 5, Chiyoda-ku, Tokyo 102-0075, Japan', 'institution_ids': ['https://openalex.org/I4210086780']}, {'raw_affiliation_string': 'Department of Applied Life Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology, Mibu, Tochigi 321-0293, Japan', 'institution_ids': ['https://openalex.org/I92614990']}, {'raw_affiliation_string': 'Department of Applied Life Science, United Graduate School of Agriculture, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509, Japan', 'institution_ids': ['https://openalex.org/I92614990']}, {'raw_affiliation_string': 'Integrated Proteomics System Project, Pioneer Research on Genome the Frontier, Ministry of Education, Culture, Sports, Science and Technology of Japan, Mibu, Tochigi 321-0293, Japan', 'institution_ids': ['https://openalex.org/I1319490839', 'https://openalex.org/I4210104019']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 11, 'corresponding_author_ids': ['https://openalex.org/A5006967707'], 'corresponding_institution_ids': ['https://openalex.org/I4210086780', 'https://openalex.org/I92614990', 'https://openalex.org/I1319490839', 'https://openalex.org/I4210104019'], 'apc_list': {'value': 2800, 'currency': 'USD', 'value_usd': 2800, 'provenance': 'doaj'}, 'apc_paid': {'value': 2800, 'currency': 'USD', 'value_usd': 2800, 'provenance': 'doaj'}, 'fwci': 1.037, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 41, 'citation_normalized_percentile': {'value': 0.903491, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 94, 'max': 95}, 'biblio': {'volume': '10', 'issue': '8', 'first_page': 'M110.006148', 'last_page': 'M110.006148'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T11482', 'display_name': 'RNA modifications and cancer', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T11482', 'display_name': 'RNA modifications and cancer', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10521', 'display_name': 'RNA and protein synthesis mechanisms', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10604', 'display_name': 'RNA Research and Splicing', 'score': 0.9997, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/fibrillarin', 'display_name': 'Fibrillarin', 'score': 0.943284}, {'id': 'https://openalex.org/keywords/ribosome-biogenesis', 'display_name': 'ribosome biogenesis', 'score': 0.73216784}, {'id': 'https://openalex.org/keywords/cajal-body', 'display_name': 'Cajal body', 'score': 0.56488293}, {'id': 'https://openalex.org/keywords/rna-polymerase-i', 'display_name': 'RNA polymerase I', 'score': 0.5329958}, {'id': 'https://openalex.org/keywords/ribosomal-protein', 'display_name': 'Ribosomal protein', 'score': 0.52339846}, {'id': 'https://openalex.org/keywords/small-nuclear-rna', 'display_name': 'Small nuclear RNA', 'score': 0.5143722}, {'id': 'https://openalex.org/keywords/eukaryotic-ribosome', 'display_name': 'Eukaryotic Ribosome', 'score': 0.49930906}, {'id': 'https://openalex.org/keywords/small-nucleolar-rna', 'display_name': 'Small nucleolar RNA', 'score': 0.47787777}, {'id': 'https://openalex.org/keywords/snrnp', 'display_name': 'snRNP', 'score': 0.450129}, {'id': 'https://openalex.org/keywords/transcription', 'display_name': 'Transcription', 'score': 0.43899658}], 'concepts': [{'id': 'https://openalex.org/C2776007122', 'wikidata': 'https://www.wikidata.org/wiki/Q14914390', 'display_name': 'Fibrillarin', 'level': 4, 'score': 0.943284}, {'id': 'https://openalex.org/C183873130', 'wikidata': 'https://www.wikidata.org/wiki/Q30869', 'display_name': 'Nucleolus', 'level': 3, 'score': 0.78628874}, {'id': 'https://openalex.org/C2779419633', 'wikidata': 'https://www.wikidata.org/wiki/Q7322423', 'display_name': 'Ribosome biogenesis', 'level': 5, 'score': 0.73216784}, {'id': 'https://openalex.org/C67905577', 'wikidata': 'https://www.wikidata.org/wiki/Q215980', 'display_name': 'Ribosomal RNA', 'level': 3, 'score': 0.67034614}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.5874671}, {'id': 'https://openalex.org/C11922738', 'wikidata': 'https://www.wikidata.org/wiki/Q3234345', 'display_name': 'Cajal body', 'level': 5, 'score': 0.56488293}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.535973}, {'id': 'https://openalex.org/C25281209', 'wikidata': 'https://www.wikidata.org/wiki/Q3502188', 'display_name': 'RNA polymerase I', 'level': 5, 'score': 0.5329958}, {'id': 'https://openalex.org/C38062823', 'wikidata': 'https://www.wikidata.org/wiki/Q3408228', 'display_name': 'Ribosomal protein', 'level': 5, 'score': 0.52339846}, {'id': 'https://openalex.org/C88478588', 'wikidata': 'https://www.wikidata.org/wiki/Q42244', 'display_name': 'Ribosome', 'level': 4, 'score': 0.51667833}, {'id': 'https://openalex.org/C100299639', 'wikidata': 'https://www.wikidata.org/wiki/Q284578', 'display_name': 'Small nuclear RNA', 'level': 5, 'score': 0.5143722}, {'id': 'https://openalex.org/C129194359', 'wikidata': 'https://www.wikidata.org/wiki/Q2636953', 'display_name': 'Eukaryotic Ribosome', 'level': 5, 'score': 0.49930906}, {'id': 'https://openalex.org/C179255354', 'wikidata': 'https://www.wikidata.org/wiki/Q284416', 'display_name': 'Small nucleolar RNA', 'level': 5, 'score': 0.47787777}, {'id': 'https://openalex.org/C67705224', 'wikidata': 'https://www.wikidata.org/wiki/Q11053', 'display_name': 'RNA', 'level': 3, 'score': 0.46133646}, {'id': 'https://openalex.org/C68483431', 'wikidata': 'https://www.wikidata.org/wiki/Q2076770', 'display_name': 'snRNP', 'level': 5, 'score': 0.450129}, {'id': 'https://openalex.org/C179926584', 'wikidata': 'https://www.wikidata.org/wiki/Q207714', 'display_name': 'Transcription (linguistics)', 'level': 2, 'score': 0.43899658}, {'id': 'https://openalex.org/C54458228', 'wikidata': 'https://www.wikidata.org/wiki/Q237218', 'display_name': 'RNA splicing', 'level': 4, 'score': 0.43773454}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.32904464}, {'id': 'https://openalex.org/C194993378', 'wikidata': 'https://www.wikidata.org/wiki/Q427087', 'display_name': 'Non-coding RNA', 'level': 4, 'score': 0.30275777}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.15588564}, {'id': 'https://openalex.org/C41258723', 'wikidata': 'https://www.wikidata.org/wiki/Q2919111', 'display_name': 'RNA-dependent RNA polymerase', 'level': 4, 'score': 0.13954872}, {'id': 'https://openalex.org/C2780723820', 'wikidata': 'https://www.wikidata.org/wiki/Q1934178', 'display_name': 'Nucleus', 'level': 2, 'score': 0.08970821}, {'id': 'https://openalex.org/C41895202', 'wikidata': 'https://www.wikidata.org/wiki/Q8162', 'display_name': 'Linguistics', 'level': 1, 'score': 0.0}, {'id': 'https://openalex.org/C138885662', 'wikidata': 'https://www.wikidata.org/wiki/Q5891', 'display_name': 'Philosophy', 'level': 0, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D002868', 'descriptor_name': 'Chromosomal Proteins, Non-Histone', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D024101', 'descriptor_name': 'Mitochondrial Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D009687', 'descriptor_name': 'Nuclear Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D012270', 'descriptor_name': 'Ribosomes', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D001667', 'descriptor_name': 'Binding, Competitive', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002460', 'descriptor_name': 'Cell Line', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002466', 'descriptor_name': 'Cell Nucleolus', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002466', 'descriptor_name': 'Cell Nucleolus', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D002868', 'descriptor_name': 'Chromosomal Proteins, Non-Histone', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D020541', 'descriptor_name': 'Coiled Bodies', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D020541', 'descriptor_name': 'Coiled Bodies', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D047468', 'descriptor_name': 'Immunoprecipitation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D024101', 'descriptor_name': 'Mitochondrial Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009687', 'descriptor_name': 'Nuclear Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011485', 'descriptor_name': 'Protein Binding', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D025941', 'descriptor_name': 'Protein Interaction Mapping', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D021381', 'descriptor_name': 'Protein Transport', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012322', 'descriptor_name': 'RNA Precursors', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D012322', 'descriptor_name': 'RNA Precursors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012323', 'descriptor_name': 'RNA Processing, Post-Transcriptional', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016601', 'descriptor_name': 'RNA-Binding Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D016601', 'descriptor_name': 'RNA-Binding Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012270', 'descriptor_name': 'Ribosomes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013347', 'descriptor_name': 'Subcellular Fractions', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D013347', 'descriptor_name': 'Subcellular Fractions', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 4, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/mcp.m110.006148', 'pdf_url': 'http://www.mcponline.org/article/S1535947620301778/pdf', 'source': {'id': 'https://openalex.org/S104550190', 'display_name': 'Molecular & Cellular Proteomics', 'issn_l': '1535-9476', 'issn': ['1535-9476', '1535-9484'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': True, 'landing_page_url': 'https://europepmc.org/articles/pmc3149089', 'pdf_url': 'https://europepmc.org/articles/pmc3149089?pdf=render', 'source': {'id': 'https://openalex.org/S4306400806', 'display_name': 'Europe PMC (PubMed Central)', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1303153112', 'host_organization_name': 'European Bioinformatics Institute', 'host_organization_lineage': ['https://openalex.org/I1303153112'], 'host_organization_lineage_names': ['European Bioinformatics Institute'], 'type': 'repository'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': True, 'landing_page_url': 'https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3149089', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S2764455111', 'display_name': 'PubMed Central', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/21536856', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/mcp.m110.006148', 'pdf_url': 'http://www.mcponline.org/article/S1535947620301778/pdf', 'source': {'id': 'https://openalex.org/S104550190', 'display_name': 'Molecular & Cellular Proteomics', 'issn_l': '1535-9476', 'issn': ['1535-9476', '1535-9484'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 73, 'referenced_works': ['https://openalex.org/W1541379084', 'https://openalex.org/W1564767200', 'https://openalex.org/W1565721167', 'https://openalex.org/W1567493631', 'https://openalex.org/W1880349976', 'https://openalex.org/W1929015554', 'https://openalex.org/W1931585919', 'https://openalex.org/W1967493968', 'https://openalex.org/W1978019342', 'https://openalex.org/W1980417017', 'https://openalex.org/W1982629607', 'https://openalex.org/W1983340117', 'https://openalex.org/W1986406001', 'https://openalex.org/W1991284817', 'https://openalex.org/W1998905553', 'https://openalex.org/W2008050895', 'https://openalex.org/W2011625250', 'https://openalex.org/W2015149117', 'https://openalex.org/W2017099874', 'https://openalex.org/W2018743359', 'https://openalex.org/W2023164416', 'https://openalex.org/W2023256217', 'https://openalex.org/W2033345697', 'https://openalex.org/W2033619275', 'https://openalex.org/W2037036397', 'https://openalex.org/W2046559761', 'https://openalex.org/W2048226905', 'https://openalex.org/W2049850109', 'https://openalex.org/W2051537046', 'https://openalex.org/W2051851894', 'https://openalex.org/W2052505695', 'https://openalex.org/W2053351632', 'https://openalex.org/W2055665236', 'https://openalex.org/W2057702132', 'https://openalex.org/W2072374365', 'https://openalex.org/W2079093549', 'https://openalex.org/W2080667453', 'https://openalex.org/W2082127202', 'https://openalex.org/W2086779374', 'https://openalex.org/W2094867951', 'https://openalex.org/W2096179259', 'https://openalex.org/W2100573143', 'https://openalex.org/W2103685344', 'https://openalex.org/W2106305155', 'https://openalex.org/W2108427723', 'https://openalex.org/W2109048721', 'https://openalex.org/W2113471433', 'https://openalex.org/W2114379621', 'https://openalex.org/W2116178342', 'https://openalex.org/W2117976997', 'https://openalex.org/W2120161238', 'https://openalex.org/W2121577038', 'https://openalex.org/W2121661890', 'https://openalex.org/W2130810762', 'https://openalex.org/W2131870749', 'https://openalex.org/W2134480031', 'https://openalex.org/W2138346848', 'https://openalex.org/W2142791535', 'https://openalex.org/W2143680946', 'https://openalex.org/W2145942144', 'https://openalex.org/W2148507334', 'https://openalex.org/W2150580904', 'https://openalex.org/W2150856613', 'https://openalex.org/W2151078655', 'https://openalex.org/W2153095907', 'https://openalex.org/W2156762274', 'https://openalex.org/W2161497672', 'https://openalex.org/W2161885693', 'https://openalex.org/W2166570887', 'https://openalex.org/W2169781776', 'https://openalex.org/W2183413160', 'https://openalex.org/W2303200129', 'https://openalex.org/W97655474'], 'related_works': ['https://openalex.org/W2748301672', 'https://openalex.org/W2334290187', 'https://openalex.org/W2140748458', 'https://openalex.org/W2106830069', 'https://openalex.org/W2065923747', 'https://openalex.org/W2062663331', 'https://openalex.org/W2042858086', 'https://openalex.org/W1979289925', 'https://openalex.org/W1976144441', 'https://openalex.org/W1969128572'], 'abstract_inverted_index': {'Ribosome': [0, 277], 'biogenesis': [1, 278, 2175], 'starts': [2, 279], 'with': [3, 16, 78, 84, 131, 139, 185, 196, 220, 239, 280, 293, 355, 361, 408, 416, 462, 473, 497, 516, 603, 880, 1057, 1091, 1096, 1107, 1129, 1154, 1354, 1386, 1395, 1465, 1471, 1507, 1561, 1678, 1847, 1893, 1911, 1996, 2241, 2262, 2280, 2315, 2324, 2337, 2358, 2417, 2440, 2534, 2643, 2796, 2814, 3032, 3085, 3108, 3165, 3277, 3292, 3350, 3383, 3400, 3429, 3539, 3642, 3660, 3669, 3692, 3714, 3734, 3749, 3761, 3765, 3777, 3785, 3811, 3837, 3868, 3873, 3888, 3980, 4146, 4156, 4189, 4208, 4213, 4227, 4237, 4253, 4265, 4270, 4286, 4292, 4306, 4313, 4326, 4351], 'transcription': [4, 114, 281, 391, 1141, 1165, 1675, 1946, 2429], 'of': [5, 31, 46, 96, 104, 178, 194, 273, 282, 308, 323, 373, 381, 455, 471, 550, 592, 617, 658, 713, 730, 759, 834, 907, 926, 974, 999, 1011, 1032, 1052, 1082, 1132, 1157, 1214, 1254, 1278, 1433, 1509, 1597, 1663, 1692, 1696, 1709, 1751, 1771, 1776, 1860, 1908, 1941, 1978, 2005, 2019, 2034, 2074, 2102, 2138, 2147, 2163, 2173, 2203, 2277, 2307, 2352, 2377, 2393, 2401, 2472, 2484, 2506, 2543, 2549, 2566, 2578, 2600, 2628, 2635, 2726, 2737, 2757, 2761, 2811, 2921, 3006, 3250, 3315, 3386, 3498, 3575, 3631, 3807, 4006, 4102, 4129], 'the': [6, 21, 25, 28, 32, 43, 148, 157, 167, 179, 202, 228, 231, 259, 271, 283, 298, 302, 305, 309, 320, 425, 434, 444, 456, 479, 505, 508, 536, 548, 596, 722, 875, 971, 980, 1008, 1133, 1158, 1183, 1235, 1241, 1259, 1263, 1276, 1334, 1355, 1452, 1473, 1476, 1533, 1580, 1664, 1673, 1679, 1693, 1707, 1767, 1777, 1789, 1838, 1932, 1937, 1942, 2107, 2131, 2140, 2144, 2164, 2170, 2177, 2227, 2232, 2375, 2394, 2399, 2433, 2450, 2455, 2469, 2473, 2507, 2541, 2544, 2547, 2563, 2567, 2601, 2631, 2644, 2652, 2687, 2712, 2721, 2727, 2735, 2758, 2762, 2868, 2891, 2895, 2901, 2906, 2918, 2922, 2941, 2946, 2982, 3003, 3007, 3063, 3078, 3086, 3093, 3210, 3228, 3251, 3255, 3278, 3284, 3287, 3307, 3356, 3373, 3378, 3387, 3404, 3422, 3480, 3499, 3586, 3636, 3657, 3683, 3687, 3735, 3830, 3891, 3931, 3934, 3938, 3984, 4193, 4201, 4233, 4258, 4288, 4327], 'large': [7, 50, 284, 327, 3259], 'ribosomal': [8, 51, 285, 328, 2166, 2379, 2475, 2569, 3913], 'RNA': [9, 118, 200, 286, 395, 477, 625, 680, 685, 770, 1781, 1825, 2020, 2068, 2476, 2570, 3043, 3914], 'precursor': [10, 287], '(47S': [11, 288], 'pre-rRNA),': [12, 289], 'which': [13, 92, 290, 369, 593, 966, 1028, 1468, 1755, 1905, 2274, 2355, 2413, 2808, 4124], 'soon': [14, 291], 'combines': [15, 292], 'numerous': [17, 294], 'factors': [18, 90, 115, 295, 367, 392], 'to': [19, 208, 218, 224, 264, 296, 485, 495, 501, 541, 624, 652, 660, 702, 721, 803, 960, 970, 1007, 1197, 1199, 1267, 1384, 1568, 1705, 1729, 1753, 1783, 2008, 2143, 2335, 2374, 2651, 3070, 3686, 3707, 3829, 4098, 4123, 4162], 'form': [20, 297, 2009], '90S': [22, 299], 'pre-ribosome': [23, 240, 300, 517], 'in': [24, 71, 147, 166, 227, 258, 301, 348, 424, 443, 504, 535, 595, 705, 843, 874, 1167, 1234, 1258, 1275, 1713, 1732, 1748, 1759, 1780, 1834, 1853, 1936, 2016, 2076, 2106, 2130, 2176, 2364, 2370, 2398, 2432, 2449, 2454, 2511, 2537, 2605, 3022, 3112, 3254, 3257, 3312, 3549, 3720, 3793, 3942, 4012, 4044, 4062, 4168, 4216, 4295, 4319, 4343, 4367], 'nucleolus.': [26, 229, 303, 506, 2178], 'Although': [27, 304, 1690, 1829], 'subsequent': [29, 306, 2233], 'separation': [30, 73, 307, 350], 'pre-90S': [33, 262, 310, 539, 2165], 'particle': [34, 311, 2167], 'into': [35, 312, 2711, 2720, 2917, 3002, 4051], 'pre-40S': [36, 265, 313, 542], 'and': [37, 49, 66, 100, 111, 150, 189, 211, 235, 266, 314, 326, 343, 377, 388, 427, 466, 488, 512, 543, 573, 630, 645, 656, 687, 715, 737, 762, 768, 831, 931, 968, 997, 1023, 1136, 1162, 1201, 1244, 1269, 1304, 1311, 1351, 1378, 1430, 1475, 1537, 1566, 1579, 1628, 1649, 1672, 1809, 1836, 1872, 1903, 1947, 1957, 1975, 1989, 1999, 2096, 2159, 2185, 2192, 2201, 2231, 2272, 2319, 2367, 2437, 2531, 2676, 2691, 2696, 2700, 2702, 2717, 2719, 2754, 2806, 2833, 2867, 2910, 2945, 2981, 3030, 3037, 3053, 3058, 3060, 3081, 3104, 3110, 3130, 3196, 3220, 3248, 3297, 3329, 3337, 3359, 3390, 3407, 3451, 3455, 3465, 3512, 3541, 3554, 3585, 3667, 3679, 3704, 3732, 3782, 3871, 3882, 3886, 3916, 3968, 3987, 4025, 4029, 4049, 4074, 4090, 4144, 4152, 4187, 4203, 4250, 4260, 4303, 4324, 4348, 4372], 'pre-60S': [38, 267, 315, 544], 'particles': [39, 241, 263, 268, 316, 518, 540, 545, 2363], 'is': [40, 251, 317, 528, 699, 1029, 1189, 1250, 1469, 1756, 1831, 1906, 1931, 1972, 2134, 2160, 2275, 2348, 2356, 2368, 2420, 2425, 2479, 2573, 2624, 2809], 'critical': [41, 318, 1252], 'for': [42, 117, 222, 275, 319, 394, 499, 552, 1049, 1191, 2040, 2070, 2136, 2626, 2693, 2698, 2704, 2865, 2934, 2979, 3055, 3062, 3101, 3134, 3162, 3191, 3202, 3344, 3361, 3394, 3410, 3459, 3468, 3486, 3517, 3522, 3546, 3558, 3591, 3621, 3649, 3729, 3757, 3768, 3779, 3787, 3854, 3861, 3912, 3974, 3989, 4038, 4176, 4218, 4244, 4277, 4297, 4321, 4331, 4345, 4355, 4369], 'production': [44, 321, 2376], 'process': [45, 322], 'mature': [47, 324], 'small': [48, 97, 198, 325, 374, 475, 1823, 1991, 2041, 2066, 3041], 'subunits,': [52, 329], 'its': [53, 330, 650, 1089, 1909, 2278, 2812], 'molecular': [54, 331, 1816], 'mechanisms': [55, 332], 'remain': [56, 333], 'undetermined.': [57, 334], 'Here,': [58, 335], 'we': [59, 247, 336, 524, 1841, 2302], 'present': [60, 165, 337, 442, 2619], 'evidence': [61, 338], 'that': [62, 81, 136, 233, 249, 269, 339, 358, 413, 510, 526, 546, 958, 1005, 1425, 1505, 1844, 1984, 2014, 2321, 2424, 2446, 2622, 2658], 'p32,': [63, 340, 678, 1152, 1761, 1773, 1898, 2267, 2801], 'fibrillarin': [64, 341, 1801, 1851, 1889, 2258, 2792], '(FBL),': [65, 342, 1852], 'Nop52': [67, 128, 146, 215, 236, 344, 405, 423, 492, 513, 2338, 2347, 2532, 2835], 'play': [68, 345], 'key': [69, 346], 'roles': [70, 347, 2864, 2978], 'this': [72, 349, 1763, 2300, 2538], 'step.': [74, 351], 'Mass-based': [75, 352], 'analyses': [76, 134, 353, 411], 'combined': [77, 354], 'immunoblotting': [79, 356], 'showed': [80, 357], 'p32': [82, 137, 163, 182, 195, 225, 250, 359, 414, 440, 459, 472, 502, 527, 555, 698, 949, 1126, 1181, 1209, 1249, 1261, 1387, 1565, 1702, 1723, 1750, 1800, 1830, 2242, 2316, 2332, 2623, 2668, 3056], 'associated': [83, 184, 238, 360, 461, 515, 1470, 1897, 2266, 2323, 2357, 2800], '155': [85, 362], 'proteins': [86, 363, 833, 1435, 1651, 1861, 2442, 2760], 'including': [87, 187, 364, 464, 1333, 1399, 1862], '31': [88, 365], 'rRNA-processing': [89, 126, 142, 366, 403, 419], '(of': [91, 368], 'nine': [93, 370], 'were': [94, 102, 371, 379, 2682, 2709, 3013, 3020, 3050, 3068, 3098, 3105, 3153, 3225, 3484, 3532, 3690, 3700, 3712, 3745, 3835, 4082, 4094, 4138, 4154, 4181, 4206, 4235, 4263, 4290, 4310, 4339, 4363], 'components': [95, 372], 'subunit': [98, 375, 1131, 1156, 1982, 2380], 'processome,': [99, 376], 'six': [101, 112, 378, 389], 'those': [103, 380], 'RIX1': [105, 382], 'complex),': [106, 383], '13': [107, 384], 'chromatin': [108, 385], 'remodeling': [109, 260, 386, 537], 'components,': [110, 387], 'general': [113, 390, 1674], 'required': [116, 393, 1190, 2135, 2625], 'polymerase': [119, 396], 'III-mediated': [120, 397], 'transcription.': [121, 398], 'Of': [122, 399], 'these,': [123, 400], 'a': [124, 197, 252, 401, 474, 529, 955, 1000, 1093, 1211, 1251, 1328, 1423, 1427, 1502, 1726, 1786, 1848, 1854, 1857, 1891, 1973, 1976, 2000, 2037, 2099, 2161, 2206, 2260, 2304, 2349, 2421, 2794, 3258, 3351, 3401, 3496, 3504, 3509, 3515, 3804, 3981, 4007, 4045], 'late': [125, 402, 2371, 2451, 2482, 2576], 'factor': [127, 143, 256, 404, 420, 533, 557, 565, 605, 621, 739, 772, 796, 1098, 1109, 1135, 1357, 1429, 1630, 1676, 1797, 1895, 2264, 2798], 'interacted': [129, 406], 'directly': [130, 407, 2240], 'p32.': [132, 409], 'Immunocytochemical': [133, 410], 'demonstrated': [135, 412], 'colocalized': [138, 415], 'an': [140, 417, 804, 1030, 4099], 'early': [141, 203, 418, 480, 1948, 2171, 2632], 'FBL': [144, 221, 234, 274, 421, 498, 511, 551, 1930, 1971, 1994, 2180, 2228, 2775, 2886], 'or': [145, 174, 422, 451, 977, 3072, 3150, 3527, 3635], 'nucleolus': [149, 158, 426, 435, 1943, 1956, 2545], 'Cajal': [151, 428, 3518], 'bodies,': [152, 429], 'but': [153, 430, 1774], 'was': [154, 164, 216, 431, 441, 493, 1703, 2333, 2414, 2641, 2659, 2888, 2915, 2936, 3000, 3207, 3289, 3310, 3370, 3381, 3419, 3427, 3477, 3613, 3640, 3791, 3901, 3940, 4001, 4065, 4125], 'excluded': [155, 432, 2426], 'from': [156, 205, 244, 261, 433, 482, 521, 538, 1437, 1785, 2312, 2427, 2661, 2890, 3155, 3227, 3534, 4079], 'after': [159, 436, 3077, 3092, 3929, 4160], 'actinomycin': [160, 437], 'D': [161, 438], 'treatment.': [162, 439], 'pre-ribosomal': [168, 445, 2362], 'fractions': [169, 446, 4053], 'prepared': [170, 447, 2660, 3226, 3802, 3997, 4095], 'by': [171, 176, 448, 453, 682, 709, 734, 764, 801, 933, 2211, 2684, 2903, 2938, 3015, 3160, 3299, 3488, 3543, 3615, 3702, 3803, 3933, 4067, 4076, 4084, 4096, 4141, 4192, 4211, 4268], 'cell': [172, 449, 1002, 1563, 1791, 1839, 2108, 2931, 3633], 'fractionation': [173, 450], 'separated': [175, 452, 3701, 4050], 'ultracentrifugation': [177, 454, 3900], 'nuclear': [180, 457, 576, 717, 766, 836, 1814, 1826, 2313, 3214, 3302, 3308, 3379, 3505], 'extract.': [181, 458], 'also': [183, 460, 700, 951, 1127, 1274, 1757], 'pre-rRNAs': [186, 207, 463, 484, 2629], '47S/45S': [188, 206, 465, 483], '32S': [190, 212, 467, 489], 'pre-rRNAs.': [191, 468], 'Furthermore,': [192, 469, 1392], 'knockdown': [193, 470, 3057], 'interfering': [199, 476, 582, 1824, 3042], 'slowed': [201, 478], 'processing': [204, 481, 1950, 2328, 2452, 2477, 2571, 2627, 3915], '18S': [209, 486], 'rRNA': [210, 254, 487, 531, 1945, 2075, 2327, 2428, 2508, 2602], 'pre-rRNA.': [213, 490], 'Finally,': [214, 491], 'found': [217, 494, 1383, 1704, 1758, 1843, 2320, 2334], 'compete': [219, 496], 'binding': [223, 500, 626, 657, 686, 712, 802, 2137], 'probably': [226, 503], 'Given': [230, 507], 'fact': [232, 509], 'are': [237, 514, 594, 1699, 2447], 'distinctly': [242, 519], 'different': [243, 520], 'each': [245, 522, 4063, 4080], 'other,': [246, 523], 'suggest': [248, 525], 'new': [253, 530, 2100], 'maturation': [255, 532, 3249], 'involved': [257, 534, 704, 1273, 2369, 2448], 'requires': [270, 547], 'exchange': [272, 549], 'Nop52.': [276, 553], 'Human': [554, 1151, 1722, 1888, 2179, 2257, 2791], '(splicing': [556], '2-associated': [558, 1358], 'protein': [559, 567, 627, 956, 1054, 1087, 1094, 1102, 1195, 1265, 1309, 1314, 1346, 1359, 1371, 1373, 1405, 1424, 1462, 1492, 1504, 1535, 1552, 1564, 1594, 1627, 1632, 1681, 1724, 1799, 1802, 1863, 1870, 1935, 2002, 2141, 2209, 2308, 2397, 2423, 2535, 3588], 'p32)': [560], '1The': [561], 'abbreviations': [562], 'used': [563, 3371, 3420, 3478], 'are:p32splicing': [564], '2–associated': [566, 1798], 'p32FBLfibrillarinPRMTprotein': [568], 'arginine': [569, 1803, 1864], 'methyltransferaseHIVhuman': [570], 'immunodeficiency': [571, 1582, 1599, 1622, 1666, 1806], 'virusGARglycine-': [572], 'arginine-richRBDRNA-binding': [574], 'domainhnRNPheterogeneous': [575], 'ribonucleoproteinMWmolecular': [577], 'weightMS/MStandem': [578], 'mass': [579, 1819], 'spectrometerpre-rRNPpreribosomal': [580], 'ribonucleoproteinsiRNAsmall': [581], 'RNANLSnuclear': [583], 'localization': [584, 1827], 'signal.': [585, 1828], 'contains': [586], '282': [587], 'amino': [588], 'acid': [589, 4087], 'residues,': [590], '73': [591], 'N-terminal': [597], 'mitochondrial': [598, 1312], 'signal': [599], 'sequence.': [600], 'It': [601], 'associates': [602, 1560, 1995], 'splicing': [604, 620, 632, 648, 675, 681, 707, 723, 733, 738, 771, 795, 800, 806, 910, 930, 935, 1097, 1108, 1356, 1428, 1629, 1708, 1768, 1782, 1796, 1894, 2263, 2797], 'ASF/SF2': [606, 659, 684, 714], '(1Krainer': [607], 'A.R.': [608, 728, 757, 791, 903], 'Mayeda': [609, 786, 897], 'A.': [610, 726, 753, 787, 894, 898, 1288, 1292, 2744], 'Kozak': [611], 'D.': [612, 1146, 1294, 2464, 2503, 2558, 2597, 3238], 'Binns': [613], 'G.': [614, 673, 1037, 1339, 2198], 'Functional': [615], 'expression': [616, 906, 2728, 2892, 2923, 2930, 3008, 3143, 4190], 'cloned': [618, 2710, 2916, 3001], 'human': [619, 1083, 1581, 1598, 1621, 1665, 1749, 1772, 1805, 2204, 2350, 2418, 2470, 2564, 3576], 'SF2:': [622], 'homology': [623, 1350], 'VI': [628], '70K,': [629], 'Drosophila': [631], 'regulators.Cell.': [633], '1991;': [634, 2151, 2218], '66:': [635], '383-394Abstract': [636], 'Full': [637, 744, 1066, 1068, 1116, 1118, 1221, 1223, 1639, 1641, 1920, 1922, 2047, 2049, 2289, 2291, 2823, 2825, 3267, 3269, 3600, 3602], 'Text': [638, 745, 1067, 1069, 1117, 1119, 1222, 1224, 1640, 1642, 1921, 1923, 2048, 2050, 2290, 2292, 2824, 2826, 3268, 3270, 3601, 3603], 'PDF': [639, 746, 1070, 1120, 1225, 1643, 1924, 2051, 2293, 2827, 3271, 3604], 'PubMed': [640, 693, 747, 779, 812, 852, 888, 944, 1018, 1071, 1121, 1174, 1226, 1321, 1365, 1447, 1483, 1515, 1544, 1574, 1608, 1644, 1687, 1740, 1925, 1966, 2052, 2085, 2114, 2154, 2221, 2294, 2407, 2519, 2613, 2769, 2828, 2878, 2992, 3272, 3605], 'Scopus': [641, 694, 748, 780, 813, 853, 889, 945, 1019, 1072, 1122, 1175, 1227, 1322, 1366, 1448, 1484, 1516, 1545, 1575, 1645, 1741, 1926, 1967, 2053, 2086, 2115, 2155, 2222, 2295, 2408, 2520, 2614, 2770, 2829, 2879, 2993, 3273, 3606], '(413)': [642], 'Google': [643, 696, 750, 782, 815, 855, 891, 915, 947, 1021, 1074, 1124, 1177, 1229, 1324, 1368, 1450, 1486, 1518, 1547, 1577, 1609, 1647, 1688, 1743, 1928, 1969, 2055, 2088, 2117, 2157, 2224, 2297, 2410, 2491, 2522, 2585, 2616, 2772, 2831, 2881, 2995, 3275, 3608, 3926], 'Scholar)': [644, 1648, 3276], 'regulates': [646, 679], 'pre-mRNA': [647, 661, 732, 878, 909, 928], 'through': [649], 'ability': [651], 'inhibit': [653, 1706], 'both': [654, 1472], 'phosphorylation': [655], '(2Petersen-Mahrt': [662], 'S.K.': [663], 'Estmer': [664], 'C.': [665, 667, 1144, 1302, 3240], 'Ohrmalm': [666], 'Matthews': [668], 'D.A.': [669, 1457, 2838, 2952], 'Russell': [670, 1458], 'W.C.': [671, 1459], 'Akusjävi': [672], 'The': [674, 829, 1342, 1955, 2465, 2524, 2559, 2706, 2912, 2997, 3045, 3066, 3096, 3205, 3213, 3368, 3417, 3424, 3475, 3610, 3697, 3710, 3743, 3826, 3996, 4057, 4136, 4308, 4337, 4361], 'factor-associated': [676], 'protein,': [677, 1027, 1105, 1467, 1850], 'inhibiting': [683], 'phosphorylation.EMBO': [688], 'J.': [689, 1282, 1616, 2110, 2150, 2384, 2496, 2499, 2590, 2593], '1999;': [690, 2488, 2582], '18:': [691], '1014-1024Crossref': [692], '(138)': [695], 'Scholar).': [697, 948, 1125, 1178, 1230, 1325, 1689, 1744, 1929, 1970, 2225, 2298, 2411, 2523, 2617, 2882, 2996, 3609, 3927], 'believed': [701], 'be': [703, 1271], 'alternative': [706, 731, 799, 929, 1192], 'events': [708, 2372], 'regulating': [710], 'competitive': [711], 'heterogeneous': [716, 765, 835, 1813], 'ribonucleoprotein': [718, 1815, 1822, 1913, 2282, 2764, 2816, 3579], '(hnRNP)': [719], 'A1': [720, 736, 830, 877], 'complex': [724], '(3Mayeda': [725], 'Krainer': [727, 756, 790, 902], 'Regulation': [729, 925], 'hnRNP': [735, 876, 881], 'SF2.Cell.': [740], '1992;': [741], '68:': [742, 1606], '365-375Abstract': [743], '(588)': [749], 'Scholar,': [751, 783, 816, 856, 892, 916, 1075, 1519, 1610, 2056, 2089, 2118, 2492, 2586], '4Mayeda': [752], 'Helfman': [754], 'D.M.': [755], 'Modulation': [758], 'exon': [760], 'skipping': [761], 'inclusion': [763], 'ribonucleoprotein-A1': [767], 'premessenger': [769], 'SF2/ASF.Mol.': [773], 'Cell.': [774, 883, 1217, 2873, 2987, 3263], 'Biol.': [775, 884, 1061, 1111, 1634, 1736, 1915, 1962, 2284, 2515, 2609, 2818, 2874, 2988, 3595, 3921], '1993;': [776, 809], '13:': [777, 1219], '2993-3001Crossref': [778], '(202)': [781], '5Sun': [784], 'Q.': [785], 'Hampson': [788], 'R.K.': [789], 'Rottman': [792], 'F.M.': [793], 'General': [794], 'SF2/ASF': [797], 'promotes': [798], 'exonic': [805], 'enhancer.Genes': [807], 'Dev.': [808], '7:': [810], '2598-2608Crossref': [811], '(246)': [814], '6Yang': [817], 'X.': [818], 'Bani': [819], 'M.R.': [820, 1521], 'Lu': [821], 'S.J.': [822, 2120], 'Rowan': [823], 'S.': [824], 'Ben-David': [825], 'Y.': [826, 922, 1207, 1284, 1298, 1300, 1494, 1588, 1879, 2024, 2248, 2748, 2782, 3566], 'Chabot': [827], 'B.': [828, 858, 985, 1409], 'A1B': [832], 'ribonucleoparticles': [837], 'modulate': [838], '5′': [839, 870], 'splice': [840, 871], 'site': [841, 872], 'selection': [842, 873], 'vivo.Proc.': [844], 'Natl.': [845, 937, 1440, 2078, 2214], 'Acad.': [846, 938, 1441, 2079, 2215], 'Sci.': [847, 939, 1442, 1540, 2080, 2216, 2487, 2581], 'U.S.A.': [848, 940, 1443, 2081, 2217], '1994;': [849, 1015, 1362, 1605], '91:': [850], '6924-6928Crossref': [851], '(181)': [854], '7Chabot': [857], 'Blanchette': [859], 'M.': [860, 1659, 1875, 2028, 2244, 2742, 2778, 2840, 2842, 2954, 2956, 3242, 3564], 'Lapierre': [861], 'I.': [862, 2856, 2970, 3236], 'La': [863], 'Branche': [864], 'H.': [865, 1590, 3244], 'An': [866, 2125], 'intron': [867], 'element': [868], 'modulating': [869], 'interacts': [879, 1128, 1153, 1394, 1464, 1506, 1846], 'A1.Mol.': [882], '1997;': [885, 1512], '17:': [886], '1776-1786Crossref': [887], '(111)': [890], '8Hanamura': [893], 'Cáceres': [895], 'J.F.': [896, 1523], 'Franza': [899], 'Jr.,': [900, 2390], 'B.R.': [901], 'Regulated': [904], 'tissue-specific': [905], 'antagonistic': [908], 'factors.RNA.': [911], '1998;': [912, 941, 1480, 1541], '4:': [913], '430-444PubMed': [914], '9Jiang': [917], 'Z.H.': [918], 'Zhang': [919, 1206, 1656], 'W.J.': [920], 'Rao': [921], 'Wu': [923, 1524], 'J.Y.': [924, 1529], 'Ich-1': [927], 'apoptosis': [932, 1203, 1280], 'mammalian': [934, 2103], 'factors.Proc.': [936], '95:': [942], '9155-9160Crossref': [943], '(129)': [946], 'has': [950], 'been': [952, 1382], 'identified': [953, 2416], 'as': [954, 1024, 1103, 2317, 2343, 2444, 2900, 3209, 3231, 3372, 3421, 3479, 3495, 3503, 3508, 3514, 3894, 3903], '(C1QBP)': [957], 'binds': [959, 969, 1006, 1182, 1426], 'complement': [961, 982], 'component': [962, 1977, 2162], '1,': [963], 'q': [964], 'subcomponent,': [965], 'recognizes': [967], 'heavy': [972], 'chain': [973], 'immunoglobulin': [975], 'G': [976, 3127], 'M': [978], 'initiating': [979], 'classical': [981], 'pathway': [983], '(10Ghebrehiwet': [984], 'Lim': [986], 'B.L.': [987], 'Peerschke': [988], 'E.I.': [989], 'Willis': [990], 'A.C.': [991], 'Reid': [992], 'K.B.': [993], 'Isolation,': [994], 'cDNA': [995, 2199, 2681, 2933], 'cloning,': [996], 'overexpression': [998], '33-kD': [1001], 'surface': [1003], 'glycoprotein': [1004], 'globular': [1009], "'heads'": [1010], 'C1q.J.': [1012], 'Exp.': [1013], 'Med.': [1014], '179:': [1016], '1809-1821Crossref': [1017], '(317)': [1020], 'Scholar),': [1022, 1369, 1451, 1487, 1548, 1578, 2158, 2773, 2832], 'hyaluronic': [1025, 1085], 'acid-binding': [1026, 1086, 1101], 'inhibitor': [1031], 'Streptococcus': [1033, 1058], 'pneumoniae': [1034, 1059], 'hyaluronidase': [1035], '(11Yadav': [1036], 'Prasad': [1038], 'R.L.': [1039], 'Jha': [1040], 'B.K.': [1041], 'Rai': [1042], 'V.': [1043, 1045], 'Bhakuni': [1044], 'Datta': [1046, 1078], 'K.': [1047, 1079, 1205, 1290, 2091, 2746, 2844, 2958], 'Evidence': [1048], 'inhibitory': [1050], 'interaction': [1051, 1243, 1306, 1619, 1662], 'hyaluronan-binding': [1053], '1': [1055, 1403, 1491, 1584, 1602, 1625, 1669, 2236, 3166, 3181, 3293, 3334, 3448, 3550, 3661, 3730, 3769, 3953, 3959, 3965, 4026, 4322, 4332, 4356], '(HABP1/p32/gC1qR)': [1056], 'hyaluronidase.J.': [1060], 'Chem.': [1062, 1112, 1635, 1916, 2285, 2819, 3596], '2009;': [1063], '284:': [1064], '3897-3905Abstract': [1065], '(17)': [1073], '12Deb': [1076], 'T.B.': [1077], 'Molecular': [1080], 'cloning': [1081, 2200], 'fibroblast': [1084], 'confirms': [1088], 'identity': [1090], 'P-32,': [1092], 'co-purified': [1095, 1106], 'SF2.': [1099], 'Hyaluronic': [1100], 'P-32': [1104], 'SF2.J.': [1110], '1996;': [1113, 1444, 1636, 2044, 2082], '271:': [1114, 1637], '2206-2212Abstract': [1115], '(141)': [1123], 'B': [1130, 1155, 1336, 1344, 3502], 'CCAAT-binding': [1134, 1139, 1159], 'inhibits': [1137, 1163], 'specifically': [1138], 'factor-mediated': [1140], 'activation': [1142, 1166], '(13Chattopadhyay': [1143], 'Hawke': [1145], 'Kobayashi': [1147], 'R.': [1148, 1407, 2460, 2554, 3246], 'Maity': [1149], 'S.N.': [1150], 'factor,': [1160], 'CBF/NF-Y,': [1161], 'CBF-mediated': [1164], 'vitro.Nucleic': [1168], 'Acids': [1169], 'Res.': [1170], '2004;': [1171, 1318, 1917, 2286, 2404, 2820, 3264], '32:': [1172], '3632-3641Crossref': [1173], '(30)': [1176], 'In': [1179, 1617, 1660, 2299], 'addition,': [1180], 'tumor': [1184], 'suppressor': [1185], 'ARF': [1186, 1236], 'C': [1187, 1237, 1375, 2128], 'terminus,': [1188], 'reading': [1193, 1411], 'frame': [1194, 1412], '(ARF)': [1196], 'localize': [1198], 'mitochondria,': [1200], 'induces': [1202], '(14Itahana': [1204], 'Mitochondrial': [1208], 'Is': [1210], 'Critical': [1212], 'Mediator': [1213], 'ARF-Induced': [1215], 'Apoptosis.Cancer': [1216], '2008;': [1218, 3922], '542-553Abstract': [1220], '(110)': [1228], 'Cancer-derived': [1231], 'point': [1232], 'mutations': [1233], 'terminus': [1238], 'disrupt': [1239], 'simultaneously': [1240], 'ARF-p32': [1242], "ARF's": [1245, 1255], 'apoptotic': [1246, 1256], 'function;': [1247], 'thus,': [1248], 'mediator': [1253], 'function': [1257, 1770, 2015, 2039], 'mitochondria.': [1260], 'links': [1262], 'BH3-only': [1264, 1308], 'Hrk': [1266, 1310], 'mitochondria': [1268, 1474, 1835], 'may': [1270], 'critically': [1272], 'regulation': [1277], 'Hrk-mediated': [1279], '(15Sunayama': [1281], 'Ando': [1283], 'Itoh': [1285], 'N.': [1286, 1887, 2256, 2752, 2790, 2860, 2974, 3572], 'Tomiyama': [1287], 'Sakurada': [1289], 'Sugiyama': [1291], 'Kang': [1293], 'Tashiro': [1295], 'F.': [1296], 'Gotoh': [1297], 'Kuchino': [1299], 'Kitanaka': [1301], 'Physical': [1303, 1530], 'functional': [1305], 'between': [1307, 1532, 1620, 3583], 'pore-forming': [1313], 'p32.Cell': [1315], 'Death': [1316], 'Differ.': [1317], '11:': [1319], '771-781Crossref': [1320], '(64)': [1323], 'So': [1326], 'far,': [1327], 'dozen': [1329], 'other': [1330, 1990], 'intracellular': [1331], 'proteins,': [1332, 1377, 1398], 'lamin': [1335, 1343, 3501], 'receptor': [1337], '(16Simos': [1338], 'Georgatos': [1340], 'S.D.': [1341, 1500], 'receptor-associated': [1345], 'p34': [1347], 'shares': [1348], 'sequence': [1349, 2129], 'antigenic': [1352], 'determinants': [1353], 'p32.FEBS': [1360], 'Lett.': [1361], '346:': [1363], '225-228Crossref': [1364], '(63)': [1367], 'mitogen-activated': [1370], 'kinases,': [1372], 'kinase': [1374], 'family': [1376, 2146], 'matrix': [1379], 'metallopeptidase,': [1380], 'have': [1381, 2733], 'associate': [1385], '(NCBI': [1388], 'Entrez': [1389], 'Gene,': [1390], 'C1QBP).': [1391], 'it': [1393, 1845, 2322, 2345], 'several': [1396, 2359], 'viral': [1397, 1434, 1794], 'herpes': [1400, 1414], 'simplex': [1401, 1415], 'virus': [1402, 1416, 1489, 1550, 1558, 1583, 1600, 1623, 1667, 1807], 'Orf-P': [1404], '(17Bruni': [1406], 'Roizman': [1408], 'Open': [1410], 'P-a': [1413], 'gene': [1417], 'repressed': [1418], 'during': [1419, 2540, 2870, 2984], 'productive': [1420], 'infection': [1421], 'encodes': [1422], 'reduces': [1431], 'synthesis': [1432], 'made': [1436], 'spliced': [1438], 'mRNA.Proc.': [1439], '93:': [1445, 2083], '10423-10427Crossref': [1446], '(71)': [1449], 'adenovirus': [1453], 'polypeptide': [1454], 'V': [1455, 1463], '(18Matthews': [1456], 'Adenovirus': [1460], 'core': [1461], 'p32-a': [1466], 'nucleus.J.': [1477], 'Gen.': [1478], 'Virol.': [1479, 1570, 1604, 1683], '79:': [1481], '1677-1685Crossref': [1482], '(161)': [1485], 'Epstein-Barr': [1488, 1510], 'EBNA': [1490], '(19Wang': [1493], 'Finan': [1495], 'J.E.': [1496], 'Middeldrop': [1497], 'J.M.': [1498, 1527], 'Hayward': [1499], 'p32/TAP,': [1501], 'cellular': [1503, 1680], 'EBNA-1': [1508, 1536], 'virus.Virology.': [1511], '236:': [1513], '18-29Crossref': [1514], '(137)': [1517], '20Chen': [1520], 'Yang': [1522, 2121], 'C.W.': [1525], 'Middeldorp': [1526], 'Chen': [1528], 'association': [1531, 1910, 2279, 2813], 'EBV': [1534], 'p32/TAP/hyaluronectin.J.': [1538], 'Biomed.': [1539], '5:': [1542, 1738], '173-179Crossref': [1543], '(21)': [1546], 'rubella': [1549], 'capsid': [1551, 1559], '(21Beatch': [1553], 'M.D.': [1554, 2062], 'Hobman': [1555], 'T.C.': [1556], 'Rubella': [1557], 'host': [1562, 1790], 'localizes': [1567], 'mitochondria.J.': [1569], '2000;': [1571], '74:': [1572], '5569-5576Crossref': [1573], '(65)': [1576], '(HIV1)': [1585], 'Rev': [1586], '(22Luo': [1587], 'Yu': [1589, 1718], 'Peterlin': [1591, 1720], 'B.M.': [1592, 1721], 'Cellular': [1593], 'modulates': [1595], 'effects': [1596], 'type': [1601, 1624, 1668], 'Rev.J.': [1603], '3850-3856Crossref': [1607], '23Tange': [1611], 'T.O.': [1612], 'Jensen': [1613], 'T.H.': [1614], 'Kjems': [1615], 'vitro': [1618, 1661], 'rev': [1626], 'ASF/SF2-associated': [1631], 'p32.J.': [1633], '10066-10072Abstract': [1638], '(80)': [1646], 'Tat': [1650, 1670], '(24Yu': [1652], 'L.': [1653], 'Loewenstein': [1654], 'P.M.': [1655], 'Z.': [1657, 2022], 'Green': [1658], 'transactivator': [1671], 'TFIIB': [1677], 'TAP.J.': [1682], '1995;': [1684], '69:': [1685], '3017-3023Crossref': [1686], 'most': [1691, 1933], 'physiological': [1694], 'functions': [1695], 'these': [1697], 'interactions': [1698], 'not': [1700, 1775], 'understood,': [1701], 'HIV': [1710, 1730, 1765], 'pre-RNA': [1711], 'transcripts': [1712], 'HIV-transfected': [1714], 'cells': [1715, 2366, 2663, 3019, 3067, 3097, 3152, 3531, 4180, 4205, 4234, 4262, 4289, 4309, 4338, 4362], '(25Zheng': [1716], 'Y.H.': [1717], 'H.F.': [1719], 'relieves': [1725], 'post-transcriptional': [1727], 'block': [1728], 'replication': [1731], 'murine': [1733, 1760], 'cells.Nat.': [1734], 'Cell': [1735, 1961, 2486, 2514, 2580, 2608, 3920], '2003;': [1737, 3597], '611-618Crossref': [1739], '(82)': [1742], 'A': [1745, 2065, 3169, 3296, 3853], 'single': [1746], 'mutation': [1747], 'Gly35': [1752], 'Asp35,': [1754], 'abrogates': [1762], 'effect.': [1764], 'uses': [1766], 'inhibition': [1769], 'mouse': [1778], 'counterpart,': [1779], 'escape': [1784], 'mechanism': [1787], 'underlying': [1788], 'defense': [1792], 'against': [1793, 3493], 'infection.': [1795], 'methyltransferase': [1804, 1865, 1974], 'glycine-': [1808, 2184], 'arginine-rich': [1810, 2186], 'RNA-binding': [1811, 2189], 'domain': [1812, 2190, 2194, 2230], 'weight': [1817], 'tandem': [1818], 'spectrometer': [1820], 'preribosomal': [1821, 1912, 2035, 2281, 2815, 3578], 'predominantly': [1832], 'localized': [1833, 2105], 'on': [1837, 3194, 3556, 3864, 4003, 4183], 'surface,': [1840], 'previously': [1842, 2950], 'nucleolar': [1849, 1992, 2042, 2067, 2148, 2208, 2422, 2441, 2466, 2560, 2633, 3510, 3587], 'subcomplex': [1855], 'containing': [1856, 2894, 3120, 3186, 3333, 3675, 3752, 3849, 3890, 4018, 4239, 4272], 'minimal': [1858], 'set': [1859], '5': [1866, 3192, 3203, 3326, 3629, 3680, 3788, 3846, 3883, 4245], '(PRMT5,': [1867], 'Janus': [1868], 'Kinase-binding': [1869], '1),': [1871], 'PRMT1': [1873], '(26Yanagida': [1874, 2243, 2777], 'Hayano': [1876, 2245, 2779, 2851, 2965], 'T.': [1877, 1881, 1883, 1885, 2030, 2246, 2250, 2252, 2254, 2750, 2780, 2784, 2786, 2788, 2848, 2852, 2854, 2858, 2962, 2966, 2968, 2972, 3562, 3568, 3570], 'Yamauchi': [1878, 2247, 2781, 3565], 'Shinkawa': [1880, 2249, 2783, 3567], 'Natsume': [1882, 2251, 2785], 'Isobe': [1884, 2253, 2749, 2787, 2853, 2967, 3569], 'Takahashi': [1886, 2255, 2751, 2789, 2859, 2973, 3571], 'forms': [1890, 2259, 2793], 'sub-complex': [1892, 2261, 2795], '2': [1896, 2265, 2799, 3650, 3956, 4022, 4130], 'protein/arginine': [1899, 2268, 2802], 'methyltransferases,': [1900, 2269, 2803], 'tubulin': [1901, 2270, 2804], 'α3': [1902, 2271, 2805], 'β1,': [1904, 2273, 2807], 'Independent': [1907, 2276, 2810], 'complexes.J.': [1914, 2283, 2817], '279:': [1918, 2287, 2821], '1607-1614Abstract': [1919, 2288, 2822], '(60)': [1927, 2296, 2830], 'abundant': [1934], 'dense': [1938], 'fibrillar': [1939], 'regions': [1940], 'where': [1944], 'pre-rRNA': [1949], 'take': [1951], 'place': [1952], '(27Warner': [1953], 'J.R.': [1954], 'ribosome': [1958, 2174, 2636, 2871, 2985, 3917], 'formation.Curr.': [1959], 'Opin.': [1960], '1990;': [1963], '2:': [1964], '521-527Crossref': [1965], '(124)': [1968], 'RNP': [1979], 'complexes': [1980, 2013, 2309, 3684, 3699, 3827], '(small': [1981], 'prosessome)': [1983], 'contain': [1985], 'U3,': [1986, 2094], 'U8,': [1987], 'U13,': [1988], 'RNAs.': [1993], 'Nop56,': [1997], 'Nop5/58': [1998], '15.5-kDa': [2001], '(a': [2003], 'counterpart': [2004], 'yeast': [2006, 2353, 2365, 2395, 2474, 2568], 'Snu13p)': [2007], 'box': [2010], 'C/D': [2011], 'snoRNP': [2012, 3253], 'site-specific': [2017, 2071], '2′-O-methylation': [2018], '(28Kiss-László': [2021], 'Henry': [2023], 'Bachellerie': [2025], 'J.P.': [2026, 2196], 'Caizergues-Ferrer': [2027], 'Kiss': [2029], 'Site-specific': [2031], 'ribose': [2032, 2072], 'methylation': [2033, 2073], 'RNA:': [2036], 'novel': [2038], 'RNAs.Cell.': [2043], '85:': [2045], '1077-1088Abstract': [2046], '(667)': [2054], '29Tycowski': [2057], 'K.T.': [2058], 'Smith': [2059], 'C.M.': [2060], 'Shu': [2061], 'Steitz': [2063, 2092, 2123], 'J.A.': [2064, 2093, 2124], 'requirement': [2069], 'Xenopus.Proc.': [2077], '14480-14485Crossref': [2084], '(140)': [2087], '30Tyc': [2090], 'U8': [2095], 'U13': [2097], 'comprise': [2098], 'class': [2101], 'snRNPs': [2104], 'nucleolus.EMBO': [2109], '1989;': [2111], '8:': [2112], '3113-3119Crossref': [2113], '(309)': [2116], '31Baserga': [2119], 'X.D.': [2122], 'intact': [2126, 4204, 4261], 'Box': [2127], 'U3': [2132, 3252], 'snRNA': [2133], 'fibrillarin,': [2139, 2205], 'common': [2142], 'major': [2145, 2759], 'snRNPs.EMBO': [2149], '10:': [2152, 2405], '2645-2651Crossref': [2153], '(132)': [2156], 'formed': [2168], 'at': [2169, 2481, 2546, 2575, 2630, 3198, 3347, 3355, 3364, 3397, 3403, 3413, 3462, 3471, 3617, 3624, 3652, 3724, 3727, 3740, 3771, 3857, 3977, 3983, 3992, 4031, 4041, 4059, 4221, 4247, 4280, 4300, 4334, 4358], 'stages': [2172, 2483, 2577, 2634], '(∼36': [2181], 'kDa)': [2182], 'comprises': [2183], '(GAR)': [2187], 'domain,': [2188, 2436], '(RBD)': [2191], 'methyltransferase-like': [2193], '(32Aris': [2195], 'Blobel': [2197], 'sequencing': [2202], 'conserved': [2207], 'recognized': [2210], 'autoimmune': [2212], 'antisera.Proc.': [2213], '88:': [2219], '931-935Crossref': [2220], '(159)': [2223], 'Both': [2226], 'GAR': [2229], 'spacer': [2234], 'region': [2235], '(residues': [2237], '78–132)': [2238], 'interact': [2239, 2336], 'study,': [2301], 'performed': [2303, 2642, 3792, 3902], 'proteomic': [2305, 2755], 'analysis': [2306, 3490, 3574], 'pulled': [2310], 'down': [2311], 'extract': [2314, 3215, 3218, 3223], 'bait': [2318], 'many': [2325], 'probable': [2326], 'factors.': [2329], 'Among': [2330], 'them,': [2331], '(NNP1/RRP1A)': [2339], 'without': [2340], 'any': [2341], 'cofactors,': [2342], 'does': [2344], 'FBL.': [2346], 'homolog': [2351], 'Rrp1p,': [2354], 'distinct': [2360], '66S': [2361], 'related': [2373], '60S': [2378], '(33Horsey': [2381], 'E.W.': [2382], 'Jakovljevic': [2383], 'Miles': [2385], 'T.D.': [2386], 'Harnpicharnchai': [2387], 'P.': [2388], 'Woolford': [2389], 'J.L.': [2391], 'Role': [2392], 'Rrp1': [2396], 'dynamics': [2400], 'preribosome': [2402], 'maturation.RNA.': [2403], '813-827Crossref': [2406], '(79)': [2409], 'Nop52,': [2412], 'originally': [2415], 'autoantibodies,': [2419], 'sites,': [2430], 'accumulates': [2431], 'granular': [2434], 'external': [2435], 'mainly': [2438], 'co-localizes': [2439], 'such': [2443], 'B23': [2445], 'step': [2453], 'nucleoli': [2456], '(34Savino': [2457, 2551], 'T.M.': [2458, 2494, 2552, 2588], 'Bastos': [2459, 2553], 'Jansen': [2461, 2555], 'E.': [2462, 2556], 'Hernandez-Verdun': [2463, 2502, 2557, 2596], 'antigen': [2467, 2561], 'Nop52p,': [2468, 2562], 'homologue': [2471, 2565], 'RRP1,': [2478, 2572], 'recruited': [2480, 2574], 'nucleogenesis.J.': [2485, 2579], '112:': [2489, 2583], '1889-1900PubMed': [2490, 2584], '35Savino': [2493, 2587], 'Gébrane-Younès': [2495, 2589], 'De': [2497, 2591], 'Mey': [2498, 2592], 'Sibarita': [2500, 2594], 'J.B.': [2501, 2595], 'Nucleolar': [2504, 2598], 'Assembly': [2505, 2599, 3247], 'Processing': [2509, 2603], 'Machinery': [2510, 2604], 'Living': [2512, 2606], 'Cells.J.': [2513, 2607], '2001;': [2516, 2610, 2766], '153:': [2517, 2611], '1097-1110Crossref': [2518, 2612], '(146)': [2521, 2615], 'perinucleolar': [2525], 'bodies': [2526, 3222], 'sequentially': [2527], 'recruit': [2528], 'FBL,': [2529], 'nucleolin,': [2530], 'together': [2533], 'B23,': [2536], 'order,': [2539], 'formation': [2542], 'end': [2548], 'mitosis': [2550], 'Our': [2618], 'study': [2620], 'demonstrates': [2621], 'biogenesis.': [2637], 'Reverse': [2638], 'transcriptase': [2639], '(RT)-PCR': [2640], 'Super': [2645], 'Script': [2646], 'II': [2647], 'kit': [2648], '(Invitrogen)': [2649], 'according': [2650], "manufacturer's": [2653], 'instructions': [2654], 'using': [2655, 2686, 2905, 2940, 3491], 'total': [2656, 3632], 'mRNA': [2657], '293EBNA': [2662, 3148, 3530, 4179], '(Invitrogen).': [2664], 'C-terminally': [2665, 2671], 'FLAG': [2666, 3695, 3892], '(DYKDDDDK)-tagged': [2667], '(p32-FLAG)': [2669], 'cDNA,': [2670, 2675], 'FLAG-tagged': [2672, 2678, 2738, 2774, 2834, 2896, 3525, 3528], 'Guα': [2673], '(FLAG-Guα)': [2674], 'N-terminally': [2677, 2883], 'Guβ': [2679], '(FLAG-Guβ)': [2680], 'amplified': [2683, 2889, 2937], 'PCR': [2685, 2707, 2904, 2913, 2939, 2998], 'primer': [2688, 2907, 2943], 'sets': [2689, 2908], '5′-ATTGAGCTAGCGCCACCATGCTGCCTCTGCTGCGCTGC-3′': [2690], '5′-TCAGTGGATCCCTACTTGTCGTCGTCGTCCTTGTAGTCCTGGCTCTTGACAAAACTCTT-3′': [2692], 'p32-FLAG,': [2694], '5′-ATATAGCTAGCGCCACCATGCCGGGAAAACTCCGTAGTGACGCTGGT-3′': [2695], '5′-ATATAGGATCCTTACTTGTCGTCGTCGTCCTTGTAGTCTTGACCAAATGCTTTACTGAAACTCCGCTT-3′': [2697], 'FLAG-Guα,': [2699], '5′-TATAATGGATCCGCCACCATGGACTACAAGGACGACGACGACAAGATGCCTGGGAAACTCCTCTGG-3′': [2701], '5′-CAACTCGAGTCAGTCAAAACTCCGTTTGTG-3′': [2703], 'FLAG-Guβ.': [2705], 'products': [2708], 'NheI/BamHI': [2713], 'sites': [2714, 2723, 2920, 3005], '(for': [2715, 2724], 'p32-FLAG': [2716], 'FLAG-Guα)': [2718], 'BamHI/XhoI': [2722], 'FLAG-Guβ)': [2725], 'vector': [2729, 2893, 2924, 3009], 'pcDNA3.1(+).': [2730, 2925], 'Previous': [2731], 'reports': [2732], 'described': [2734, 2949, 3232, 3638, 3833, 3895, 3904, 3936], 'construction': [2736], 'nucleolin': [2739], '(FLAG-NCL)': [2740], '(36Yanagida': [2741], 'Shimamoto': [2743], 'Nishikawa': [2745], 'Furuichi': [2747], 'Isolation': [2753], 'characterization': [2756], 'nucleolin-associating': [2763], 'complexes.Proteomics.': [2765], '1:': [2767], '1390-1404Crossref': [2768], '(61)': [2771], '(FLAG-FBL)': [2776], '(FLAG-Nop52)': [2836], '(37Stavreva': [2837, 2951], 'Kawasaki': [2839, 2953], 'Dundr': [2841, 2955], 'Koberna': [2843, 2957], 'Müller': [2845, 2959], 'W.G.': [2846, 2960], 'Tsujimura-Takahashi': [2847, 2961], 'Komatsu': [2849, 2963], 'W.': [2850, 2964], 'Raska': [2855, 2969], 'Misteli': [2857, 2971], 'McNally': [2861, 2975], 'J.G.': [2862, 2976], 'Potential': [2863, 2977], 'ubiquitin': [2866, 2980], 'proteasome': [2869, 2983], 'biogenesis.Mol.': [2872, 2986], '2006;': [2875, 2989], '26:': [2876, 2990], '5131-5145Crossref': [2877, 2991], '(85)': [2880, 2994], 'HA': [2884], '(YPYDVPDYA)-tagged': [2885], '(HA-FBL)': [2887], 'FBL-coded': [2897], 'DNA': [2898, 3016], 'fragment': [2899], 'template': [2902], '5′GAAGAAGGATCCGCCACCATGTACCCATACGACGTGCCTGACTATGCCAAGCCAGGATTCAGTCCCCGT-3′': [2909], '5′-GAAGAAGAATTCTCAGTTCTTCACCTTGGGGGG-3′.': [2911], 'product': [2914, 2999], 'BamHI/EcoRI': [2919], 'To': [2926, 3281, 3304, 3375, 4197, 4255], 'establish': [2927], 'inducible': [2928, 3141], 'FLAG-Nop52': [2929, 2935, 3142], 'lines,': [2932], 'forward': [2942], '5′ATATCAAGCTTGCCAACCATGGACTACAAGGACGACGACGACAAGGTTTCGCGCGTGCAGCTCCCG-3′': [2944], 'reverse': [2947], 'primers': [2948], 'HindIII/BamHI': [3004], 'pcDNA5/FRT/TO.': [3010], 'All': [3011], 'constructs': [3012], 'verified': [3014], 'sequencing.': [3017], 'HeLa': [3018, 3151], 'cultured': [3021, 3100, 3111], '35-mm': [3023, 3071], 'dishes': [3024, 3074], 'until': [3025], 'they': [3026], 'reached': [3027], '80%': [3028], 'confluency,': [3029], 'transfected': [3031, 3083, 4188, 4202, 4259], '2.5': [3033], 'μl': [3034, 3314, 3385, 3431, 3644, 4055], 'Lipofectamine': [3035], '2000': [3036], '50': [3038, 3175, 3670, 3823, 3838, 3874, 4169], 'nm': [3039, 4061], 'stealth': [3040, 3047, 3088], '(siRNA)615.': [3044], 'following': [3046, 3279], 'siRNA': [3048, 3089], 'sequences': [3049], 'used:': [3051], '5′-AUGACAGUCCAACACAAGGGCCUUC-3′': [3052], '5′-GAAGGCCCUUGUGUUGGACUGUCAU-3′': [3054], '5′-AUGCCAACUGCCAAACACGAGGUUC-3′': [3059], '5′-GAACCUCGUGUUUGGCAGUUGGCAU-3′': [3061], 'negative': [3064], 'control.': [3065], 'transferred': [3069, 3706], '90-mm': [3073, 3157, 3536], '24': [3075], 'h': [3076, 3091, 3103, 3651, 3770, 4040, 4333, 4357], 'first': [3079, 3094], 'transfection': [3080, 3521], 'then': [3082, 3099, 3408, 3466, 4311, 4349, 4373], 'again': [3084, 3291], 'same': [3087], '48': [3090, 3523], 'transfection.': [3095], '12': [3102, 3136], 'washed': [3106, 3538, 3746, 3774, 3783, 3866, 4207, 4251, 4264, 4304, 4340, 4364], 'once': [3107, 3668, 3784, 3872, 4252], 'PBS': [3109, 3540, 3786, 4209, 4217, 4238, 4266, 4271, 4296, 4320], "Dulbecco's": [3113], 'modified': [3114], "Eagle's": [3115], 'medium': [3116], '(Invitrogen,': [3117], 'Carlsbad,': [3118], 'CA)': [3119], '10%': [3121, 4085], 'FBS,': [3122], 'streptomycin': [3123], '(0.1': [3124], 'mg/ml),': [3125], 'penicillin': [3126], '(100': [3128, 3815], 'U/ml),': [3129], '1000': [3131], 'mg/L': [3132], 'glucose': [3133], 'additional': [3135], 'h.': [3137], 'Subconfluent': [3138], 'p32-FLAG-transfected': [3139], '293EBNA,': [3140], '(Flp-In': [3144], 'T-REx': [3145], '293)': [3146], 'cells,': [3147, 3149, 4200], 'collected': [3154, 3208, 3298], 'four': [3156], 'dishes,': [3158, 3537], 'lysed': [3159, 3542], 'vortexing': [3161, 3545], '10': [3163, 3442, 3445, 3643, 3758, 3780, 3850, 3855, 4111, 4114, 4177, 4219, 4278, 4298, 4346, 4370], 's': [3164, 3346, 3396, 3461, 3548, 3976], 'ml': [3167, 3294, 3551, 3662, 4005], 'buffer': [3168, 3295, 3317, 3433, 3664, 3814, 3870, 3889, 3944, 4104, 4173], '(16.7': [3170], 'mm': [3171, 3176, 3179, 3182, 3319, 3324, 3327, 3335, 3435, 3440, 3443, 3446, 3449, 3671, 3677, 3681, 3816, 3821, 3824, 3839, 3844, 3847, 3875, 3880, 3884, 3946, 3951, 3954, 3957, 3960, 3966, 4014, 4020, 4023, 4027, 4109, 4112, 4115, 4170], 'Tris-HCl': [3172, 3320, 3436, 3672, 3817, 3840, 3876, 3947, 4015, 4116], '(pH': [3173, 4134, 4174], '8.0),': [3174], 'NaCl,': [3177, 3325, 3441, 3822, 3845, 3881, 4110], '1.67': [3178], 'MgCl2,': [3180, 3328, 3682, 3885], 'phenylmethylsulfonyl': [3183], 'fluoride': [3184], '(PMSF))': [3185], '0.1%': [3187, 3753], 'Triton': [3188, 4242, 4275], 'X-100,': [3189], 'incubated': [3190, 3555, 3641, 3733, 3760, 3836, 3860, 4325, 4350], 'min': [3193, 3363, 3412, 3470, 3560, 3623, 3856, 3863, 3991, 4220, 4246, 4279, 4299, 4347, 4371], 'ice,': [3195, 3865], 'centrifuged': [3197, 3360, 3409, 3467, 3988, 4030], '1,000': [3199], '×': [3200, 3366, 3415, 3473, 3619, 3994, 4036], 'g': [3201, 3620], 'min.': [3204, 3789, 4178], 'supernatant': [3206, 3369, 3418, 3476], 'cytoplasmic': [3211, 3285], 'fraction.': [3212], '(Nu),': [3216], 'nucleoplasmic': [3217], '(NE)': [3219], 'nucleolar/Cajal': [3221], '(NoE)': [3224], 'remaining': [3229], 'pellet': [3230, 3288, 3309, 3380, 3426, 3939], '(38Watkins': [3233], 'N.J.': [3234], 'Lemm': [3235], 'Ingelfinger': [3237], 'Schneider': [3239], 'Hossbach': [3241], 'Urlaub': [3243], 'Lührmann': [3245], 'nucleoplasm': [3256], 'dynamic': [3260], 'multiprotein': [3261], 'complex.Mol.': [3262], '16:': [3265], '789-798Abstract': [3266], '(144)': [3274], 'modifications.': [3280], 'fully': [3282], 'remove': [3283], 'constituents,': [3286], 'suspended': [3290], 'centrifugation': [3300, 3616], '(the': [3301], 'pellet).': [3303], 'prepare': [3305, 3376], 'Nu,': [3306], 'sonicated': [3311, 3391, 3456, 3941], '500': [3313, 3384, 3430, 3693], 'lysis': [3316, 3388, 3552, 3663, 3869], '(50': [3318, 3434], 'pH': [3321, 3437, 3673, 3818, 3841, 3877, 3948, 4016, 4117], '8.0,': [3322, 3438, 3674, 3842, 3878, 3949, 4017, 4118], '150': [3323, 3439, 3676, 3843, 3879], '0.5%': [3330, 4240, 4273], 'IGEPAL': [3331, 3963], 'CA630)': [3332], 'PMSF': [3336, 3450], '20': [3338, 3345, 3395, 3452, 3460, 3969, 3975, 4052], 'U': [3339, 3453, 3970], 'SUPERase·In': [3340], '(Ambion)': [3341], 'three': [3342, 3747, 3775, 3972, 4341, 4365], 'times': [3343, 3393, 3458, 3666, 3748, 3776, 3973, 4342, 4366], '4': [3348, 3398, 3463, 3625, 3653, 3725, 3741, 3978, 4042], '°C': [3349, 3399, 3726, 3979, 4043], 'Bioruptor': [3352, 3402, 3982], '(Cosmo': [3353], 'Bio)': [3354], 'highest': [3357, 3405, 3985], 'setting,': [3358, 3406, 3986], '15': [3362, 3990], '15,000': [3365, 3414, 3472, 3993], 'g.': [3367, 3416, 3474, 3995], 'Nu.': [3374], 'NE,': [3377], 're-suspended': [3382], 'buffer,': [3389, 3553], 'ten': [3392, 3457], '30': [3411, 3469, 3547, 3559, 3622, 3862], 'NE.': [3423], 'resulting': [3425], 'resuspended': [3428], 'NoE': [3432], 'EDTA,': [3444, 3958, 4024, 4113], 'dithiothreitol,': [3447, 3961, 4028], 'Superasin),': [3454], '°C,': [3464, 3859], 'NoE.': [3481], 'These': [3482], 'extracts': [3483], 'examined': [3485], 'cross-contamination': [3487], 'immunoblot': [3489, 4091], 'antibodies': [3492], 'GAPDH': [3494], 'marker': [3497, 3516], 'cytoplasm,': [3500], 'marker,': [3506, 3511], 'Nop58': [3507], 'p80-coilin': [3513], 'bodies.': [3519], 'After': [3520, 3655, 4224, 4283], 'h,': [3524, 3731, 4323], 'protein-': [3526], 'mutant-transfected': [3529], 'harvested': [3533], 'two': [3535], 'vigorous': [3544], 'ice': [3557], '(40Hayano': [3561], 'Yanagida': [3563], 'Proteomic': [3573], 'Nop56p-associated': [3577], 'complexes:': [3580], 'Possible': [3581], 'link': [3582], 'Nop56p': [3584], 'treacle': [3589], 'responsible': [3590], 'Treacher': [3592], 'Collins': [3593], 'syndrome.J.': [3594], '278:': [3598], '34309-34319Abstract': [3599], '(114)': [3607], 'soluble': [3611], 'fraction': [3612, 4064, 4081], 'obtained': [3614], '20,000': [3618], '°C.': [3626, 3654, 3742], 'At': [3627], 'least': [3628, 3728], 'mg': [3630], 'lysate': [3634], 'Nu': [3637, 3998], 'above': [3639, 3834], 'anti-FLAG': [3645], 'M2': [3646], 'agarose': [3647, 3658, 3688, 3831], 'beads': [3648, 3659, 3689, 3832], 'washing': [3656, 4225, 4284], 'five': [3665], 'NaCl': [3678], 'bound': [3685, 3828], 'eluted': [3691, 3698, 3887], 'μg/ml': [3694, 3851], 'peptide.': [3696], 'SDS-PAGE': [3703, 4089], 'electrophoretically': [3705], 'PVDF': [3708], 'membranes.': [3709], 'membranes': [3711, 3744], 'blocked': [3713, 4312], '3%': [3715, 4314], 'nonfat': [3716, 4316], 'dried': [3717, 4317], 'skim': [3718], 'milk': [3719, 4318], 'phosphate-buffered': [3721], 'saline': [3722], '(PBS)': [3723], 'appropriate': [3736, 4328], 'primary': [3737, 4329], 'antibody': [3738, 3763, 4330, 4354], 'overnight': [3739], 'PBST': [3750, 3778, 4228, 4344, 4368], '(PBS': [3751], '(w/v)': [3754, 4230, 4241, 4274, 4315], 'Tween': [3755, 4231], '20)': [3756], 'min,': [3759, 3781], 'secondary': [3762, 4353], 'conjugated': [3764], 'alkaline': [3766, 3812], 'phosphatase': [3767, 3813], 'room': [3772, 4222, 4248, 4281, 4301, 4335, 4359], 'temperature,': [3773], 'Staining': [3790], 'NBT': [3794], '(nitro-blue': [3795], 'tetrazolium': [3796], 'chloride)/BCIP': [3797], '(5-bromo-4-chloro-3′-Indolylphosphatase': [3798], 'p-toluidine': [3799], 'salt)': [3800], 'solution,': [3801], '(1:50)': [3805], 'dilution': [3806], 'NBT/BCIP': [3808], 'stock': [3809], 'solution': [3810], '9.5,': [3819], '100': [3820, 3950, 4019], 'MgCl2).': [3825], 'MgCl2': [3848], 'RNase': [3852], '37': [3858], 'twice': [3867, 4226, 4285, 4305], 'peptide': [3893], 'above.': [3896], 'Sucrose': [3897], 'density': [3898], 'gradient': [3899, 4011], '(41Pestov': [3905], 'D.G.': [3906], 'Lapik': [3907], 'Y.R.': [3908], 'Lau': [3909], 'L.F.': [3910], 'Assays': [3911], 'assembly.Curr.': [3918], 'Protoc.': [3919], '22': [3923], '(Unit': [3924], '22.11)PubMed': [3925], 'Briefly,': [3928], 'removing': [3930], 'cytoplasm': [3932], 'method': [3935], 'above,': [3937], 'sonication': [3943], '(25': [3945], 'KCl,': [3952, 4021], 'NaF,': [3955], '0.05%': [3962], 'CA-630,': [3964], 'PMSF,': [3967], 'SUPERase·In)': [3971], '(1': [3999], 'mg)': [4000], 'overlaid': [4002], '9.5': [4004], '10–30%': [4008], '(w/w)': [4009], 'sucrose': [4010], '25': [4013], '36,000': [4032], 'rpm': [4033], '(average': [4034], '162,000': [4035], 'g)': [4037], '3': [4039], 'Hitachi': [4046], 'P40ST': [4047], 'rotor,': [4048], '(500': [4054], 'each).': [4056], 'absorbance': [4058], '254': [4060], 'measured': [4066], 'Nano-Drop': [4068], 'spectrophotometer': [4069], '(Thermo': [4070], 'SCIENTIFIC,': [4071], 'Wilmington,': [4072], 'USA),': [4073], 'graphed': [4075], 'Excel.': [4077], 'Proteins': [4078], 'precipitated': [4083, 4145], 'trichloroacetic': [4086], 'before': [4088], 'analysis.': [4092], 'RNAs': [4093, 4149], 'addition': [4097], 'equal': [4100], 'volume': [4101, 4128], 'denaturing': [4103], '(7': [4105], 'm': [4106, 4131], 'urea,': [4107], '350': [4108], '1%': [4119], 'SDS,': [4120], '2%': [4121], '2-mercaptoethanol),': [4122], 'added': [4126], '1/10': [4127], 'sodium': [4132, 4171], 'acetate': [4133, 4172], '4.0).': [4135], 'samples': [4137], 'vortexed,': [4139], 'extracted': [4140], 'acidic': [4142], 'phenol-chloroform,': [4143], 'isopropanol.': [4147], 'Ribosomal': [4148], '(18S,': [4150], '28S,': [4151], '32S)': [4153], 'visualized': [4155], '0.02%': [4157], 'methylene': [4158], 'blue': [4159], 'transffered': [4161], 'Hybond': [4163], 'N+': [4164], 'membrane': [4165], '(GE': [4166], 'Healthcare)': [4167], '5.5)': [4175], 'grown': [4182], 'collagen-coated': [4184], 'culture': [4185], 'slides': [4186], 'plasmids': [4191], 'calcium': [4194], 'phosphate': [4195], 'method.': [4196], 'visualize': [4198, 4256], 'whole': [4199], 'followed': [4210, 4267], 'fixation': [4212], '3.7%': [4214, 4293], 'formaldehyde': [4215, 4294], 'temperature.': [4223, 4282, 4336, 4360], '(0.05%': [4229], '20),': [4232], 'permeabilized': [4236], 'X-100': [4243, 4276], 'temperature': [4249, 4302], 'PBST.': [4254, 4307], 'nuclei,': [4257], 'permeabilization': [4269], 'PBST,': [4287], 'fixed': [4291], 'fluorochrome-conjugated': [4352], 'mount': [4374]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2080655657', 'counts_by_year': [{'year': 2024, 'cited_by_count': 1}, {'year': 2023, 'cited_by_count': 4}, {'year': 2022, 'cited_by_count': 5}, {'year': 2021, 'cited_by_count': 2}, {'year': 2019, 'cited_by_count': 5}, {'year': 2018, 'cited_by_count': 1}, {'year': 2017, 'cited_by_count': 2}, {'year': 2016, 'cited_by_count': 5}, {'year': 2015, 'cited_by_count': 7}, {'year': 2014, 'cited_by_count': 3}, {'year': 2013, 'cited_by_count': 3}, {'year': 2012, 'cited_by_count': 1}], 'updated_date': '2024-12-16T10:13:40.090588', 'created_date': '2016-06-24'}