Publication Information

{'id': 'https://openalex.org/W2079039801', 'doi': 'https://doi.org/10.1074/jbc.m203310200', 'title': 'Bicalutamide Functions as an Androgen Receptor Antagonist by Assembly of a Transcriptionally Inactive Receptor', 'display_name': 'Bicalutamide Functions as an Androgen Receptor Antagonist by Assembly of a Transcriptionally Inactive Receptor', 'publication_year': 2002, 'publication_date': '2002-07-01', 'ids': {'openalex': 'https://openalex.org/W2079039801', 'doi': 'https://doi.org/10.1074/jbc.m203310200', 'mag': '2079039801', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/12015321'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m203310200', 'pdf_url': 'http://www.jbc.org/article/S0021925819663763/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819663763/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5020020693', 'display_name': 'David Masiello', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I1316535847', 'display_name': 'Beth Israel Deaconess Medical Center', 'ror': 'https://ror.org/04drvxt59', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I1316535847']}, {'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'David Masiello', 'raw_affiliation_strings': ['Cancer Biology Program, Hematology-Oncology Division, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts 02215'], 'affiliations': [{'raw_affiliation_string': 'Cancer Biology Program, Hematology-Oncology Division, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts 02215', 'institution_ids': ['https://openalex.org/I1316535847', 'https://openalex.org/I136199984']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5103575319', 'display_name': 'Shinta Cheng', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}, {'id': 'https://openalex.org/I1316535847', 'display_name': 'Beth Israel Deaconess Medical Center', 'ror': 'https://ror.org/04drvxt59', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I1316535847']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Shinta Cheng', 'raw_affiliation_strings': ['Cancer Biology Program, Hematology-Oncology Division, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts 02215'], 'affiliations': [{'raw_affiliation_string': 'Cancer Biology Program, Hematology-Oncology Division, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts 02215', 'institution_ids': ['https://openalex.org/I136199984', 'https://openalex.org/I1316535847']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5043769628', 'display_name': 'Glenn J. Bubley', 'orcid': 'https://orcid.org/0000-0002-3062-643X'}, 'institutions': [{'id': 'https://openalex.org/I1316535847', 'display_name': 'Beth Israel Deaconess Medical Center', 'ror': 'https://ror.org/04drvxt59', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I1316535847']}, {'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Glenn J. Bubley', 'raw_affiliation_strings': ['Cancer Biology Program, Hematology-Oncology Division, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts 02215'], 'affiliations': [{'raw_affiliation_string': 'Cancer Biology Program, Hematology-Oncology Division, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts 02215', 'institution_ids': ['https://openalex.org/I1316535847', 'https://openalex.org/I136199984']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5039806235', 'display_name': 'Michael L. Lu', 'orcid': 'https://orcid.org/0000-0002-4659-943X'}, 'institutions': [{'id': 'https://openalex.org/I1283280774', 'display_name': "Brigham and Women's Hospital", 'ror': 'https://ror.org/04b6nzv94', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I1283280774', 'https://openalex.org/I48633490']}, {'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Michael L. Lu', 'raw_affiliation_strings': ["Department of Urology, Brigham and Women's Hospital and Harvard Medical School, Boston, Massachusetts 02115"], 'affiliations': [{'raw_affiliation_string': "Department of Urology, Brigham and Women's Hospital and Harvard Medical School, Boston, Massachusetts 02115", 'institution_ids': ['https://openalex.org/I1283280774', 'https://openalex.org/I136199984']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5087350413', 'display_name': 'Steven P. Balk', 'orcid': 'https://orcid.org/0000-0002-4546-7371'}, 'institutions': [{'id': 'https://openalex.org/I1316535847', 'display_name': 'Beth Israel Deaconess Medical Center', 'ror': 'https://ror.org/04drvxt59', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I1316535847']}, {'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Steven P. Balk', 'raw_affiliation_strings': ['Cancer Biology Program, Hematology-Oncology Division, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts 02215'], 'affiliations': [{'raw_affiliation_string': 'Cancer Biology Program, Hematology-Oncology Division, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts 02215', 'institution_ids': ['https://openalex.org/I1316535847', 'https://openalex.org/I136199984']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 3, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 8.966, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 228, 'citation_normalized_percentile': {'value': 0.999935, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 98, 'max': 99}, 'biblio': {'volume': '277', 'issue': '29', 'first_page': '26321', 'last_page': '26326'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10543', 'display_name': 'Prostate Cancer Treatment and Research', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2740', 'display_name': 'Pulmonary and Respiratory Medicine'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10543', 'display_name': 'Prostate Cancer Treatment and Research', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2740', 'display_name': 'Pulmonary and Respiratory Medicine'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T10756', 'display_name': 'Estrogen and related hormone effects', 'score': 0.9965, 'subfield': {'id': 'https://openalex.org/subfields/1311', 'display_name': 'Genetics'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11146', 'display_name': 'Hormonal and reproductive studies', 'score': 0.9953, 'subfield': {'id': 'https://openalex.org/subfields/2712', 'display_name': 'Endocrinology, Diabetes and Metabolism'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/bicalutamide', 'display_name': 'Bicalutamide', 'score': 0.98674077}, {'id': 'https://openalex.org/keywords/dihydrotestosterone', 'display_name': 'Dihydrotestosterone', 'score': 0.46868092}], 'concepts': [{'id': 'https://openalex.org/C2780962315', 'wikidata': 'https://www.wikidata.org/wiki/Q1988832', 'display_name': 'Bicalutamide', 'level': 5, 'score': 0.98674077}, {'id': 'https://openalex.org/C61367390', 'wikidata': 'https://www.wikidata.org/wiki/Q416601', 'display_name': 'Androgen receptor', 'level': 4, 'score': 0.89874744}, {'id': 'https://openalex.org/C77445288', 'wikidata': 'https://www.wikidata.org/wiki/Q637488', 'display_name': 'Coactivator', 'level': 4, 'score': 0.6566602}, {'id': 'https://openalex.org/C2780192828', 'wikidata': 'https://www.wikidata.org/wiki/Q181257', 'display_name': 'Prostate cancer', 'level': 3, 'score': 0.6369851}, {'id': 'https://openalex.org/C2777911890', 'wikidata': 'https://www.wikidata.org/wiki/Q62614', 'display_name': 'Androgen', 'level': 3, 'score': 0.5845063}, {'id': 'https://openalex.org/C2777899217', 'wikidata': 'https://www.wikidata.org/wiki/Q4759439', 'display_name': 'Androgen deprivation therapy', 'level': 4, 'score': 0.58074033}, {'id': 'https://openalex.org/C134018914', 'wikidata': 'https://www.wikidata.org/wiki/Q162606', 'display_name': 'Endocrinology', 'level': 1, 'score': 0.54677546}, {'id': 'https://openalex.org/C2779723316', 'wikidata': 'https://www.wikidata.org/wiki/Q6459234', 'display_name': 'LNCaP', 'level': 4, 'score': 0.51285267}, {'id': 'https://openalex.org/C126322002', 'wikidata': 'https://www.wikidata.org/wiki/Q11180', 'display_name': 'Internal medicine', 'level': 1, 'score': 0.5039241}, {'id': 'https://openalex.org/C2779322244', 'wikidata': 'https://www.wikidata.org/wiki/Q574820', 'display_name': 'Antiandrogen', 'level': 4, 'score': 0.48580623}, {'id': 'https://openalex.org/C502942594', 'wikidata': 'https://www.wikidata.org/wiki/Q3421914', 'display_name': 'Cancer research', 'level': 1, 'score': 0.47539648}, {'id': 'https://openalex.org/C2779881493', 'wikidata': 'https://www.wikidata.org/wiki/Q411054', 'display_name': 'Dihydrotestosterone', 'level': 4, 'score': 0.46868092}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.40736794}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.36067596}, {'id': 'https://openalex.org/C71924100', 'wikidata': 'https://www.wikidata.org/wiki/Q11190', 'display_name': 'Medicine', 'level': 0, 'score': 0.27141273}, {'id': 'https://openalex.org/C86339819', 'wikidata': 'https://www.wikidata.org/wiki/Q407384', 'display_name': 'Transcription factor', 'level': 3, 'score': 0.18207672}, {'id': 'https://openalex.org/C71315377', 'wikidata': 'https://www.wikidata.org/wiki/Q11364', 'display_name': 'Hormone', 'level': 2, 'score': 0.1785784}, {'id': 'https://openalex.org/C121608353', 'wikidata': 'https://www.wikidata.org/wiki/Q12078', 'display_name': 'Cancer', 'level': 2, 'score': 0.12563029}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.09798655}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.07679254}], 'mesh': [{'descriptor_ui': 'D000726', 'descriptor_name': 'Androgen Antagonists', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': True}, {'descriptor_ui': 'D059002', 'descriptor_name': 'Androgen Receptor Antagonists', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D000813', 'descriptor_name': 'Anilides', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': True}, {'descriptor_ui': 'D014158', 'descriptor_name': 'Transcription, Genetic', 'qualifier_ui': 'Q000187', 'qualifier_name': 'drug effects', 'is_major_topic': True}, {'descriptor_ui': 'D000726', 'descriptor_name': 'Androgen Antagonists', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000813', 'descriptor_name': 'Anilides', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001517', 'descriptor_name': 'Coleoptera', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005047', 'descriptor_name': 'Etoposide', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005047', 'descriptor_name': 'Etoposide', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D051548', 'descriptor_name': 'Histone Acetyltransferases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008297', 'descriptor_name': 'Male', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051379', 'descriptor_name': 'Mice', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009570', 'descriptor_name': 'Nitriles', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D056920', 'descriptor_name': 'Nuclear Receptor Coactivator 1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051958', 'descriptor_name': 'Nuclear Receptor Coactivator 2', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017430', 'descriptor_name': 'Prostate-Specific Antigen', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017430', 'descriptor_name': 'Prostate-Specific Antigen', 'qualifier_ui': 'Q000096', 'qualifier_name': 'biosynthesis', 'is_major_topic': False}, {'descriptor_ui': 'D011471', 'descriptor_name': 'Prostatic Neoplasms', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011471', 'descriptor_name': 'Prostatic Neoplasms', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D011471', 'descriptor_name': 'Prostatic Neoplasms', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D011817', 'descriptor_name': 'Rabbits', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011944', 'descriptor_name': 'Receptors, Androgen', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011944', 'descriptor_name': 'Receptors, Androgen', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D011993', 'descriptor_name': 'Recombinant Fusion Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011993', 'descriptor_name': 'Recombinant Fusion Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D011993', 'descriptor_name': 'Recombinant Fusion Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D014105', 'descriptor_name': 'Tosyl Compounds', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014157', 'descriptor_name': 'Transcription Factors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014157', 'descriptor_name': 'Transcription Factors', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D014157', 'descriptor_name': 'Transcription Factors', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D014158', 'descriptor_name': 'Transcription, Genetic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014162', 'descriptor_name': 'Transfection', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m203310200', 'pdf_url': 'http://www.jbc.org/article/S0021925819663763/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/12015321', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m203310200', 'pdf_url': 'http://www.jbc.org/article/S0021925819663763/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'id': 'https://metadata.un.org/sdg/3', 'display_name': 'Good health and well-being', 'score': 0.69}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 44, 'referenced_works': ['https://openalex.org/W1209284060', 'https://openalex.org/W1595712080', 'https://openalex.org/W1674624604', 'https://openalex.org/W1816722347', 'https://openalex.org/W1948383940', 'https://openalex.org/W1977704448', 'https://openalex.org/W1980226373', 'https://openalex.org/W2001034975', 'https://openalex.org/W2003964366', 'https://openalex.org/W2005658600', 'https://openalex.org/W2008498145', 'https://openalex.org/W2009402948', 'https://openalex.org/W2022110250', 'https://openalex.org/W2022635468', 'https://openalex.org/W2023396505', 'https://openalex.org/W2030819637', 'https://openalex.org/W2031454470', 'https://openalex.org/W2036054914', 'https://openalex.org/W2036744671', 'https://openalex.org/W2038052756', 'https://openalex.org/W2043848949', 'https://openalex.org/W2061686178', 'https://openalex.org/W2066570340', 'https://openalex.org/W2068113812', 'https://openalex.org/W2072354324', 'https://openalex.org/W2072891243', 'https://openalex.org/W2079196098', 'https://openalex.org/W2082610063', 'https://openalex.org/W2088002379', 'https://openalex.org/W2094838095', 'https://openalex.org/W2097637056', 'https://openalex.org/W2117325725', 'https://openalex.org/W2120040531', 'https://openalex.org/W2136294116', 'https://openalex.org/W2142614941', 'https://openalex.org/W2144908726', 'https://openalex.org/W2145772312', 'https://openalex.org/W2164472870', 'https://openalex.org/W2166912270', 'https://openalex.org/W2168011358', 'https://openalex.org/W2340534380', 'https://openalex.org/W2340799873', 'https://openalex.org/W82857747', 'https://openalex.org/W90846558'], 'related_works': ['https://openalex.org/W4220880667', 'https://openalex.org/W3148026613', 'https://openalex.org/W2911495509', 'https://openalex.org/W2413023094', 'https://openalex.org/W2165911768', 'https://openalex.org/W2165611177', 'https://openalex.org/W2090356696', 'https://openalex.org/W2065658150', 'https://openalex.org/W2065112594', 'https://openalex.org/W2063882679'], 'abstract_inverted_index': {'Prostate': [0, 187], 'cancers': [1, 188, 401, 544, 615], '(PCa)': [2, 189], 'that': [3, 79, 161, 190, 266, 348, 502, 545, 624, 639, 803, 825, 847, 856, 957, 1147, 1183, 1465, 1519, 1567, 2654, 2829, 2872, 2965, 3044, 3250, 3451, 3461, 3481, 3742, 3756, 3901, 3948, 3977, 4014, 4117, 4150, 4186, 4320, 4342, 4369, 4486, 4497, 4558, 4574, 4727, 4746, 4877, 4954, 4968, 5061, 5118, 5160, 5190], 'relapse': [4, 191, 499, 546], 'after': [5, 192, 547, 1110], 'androgen': [6, 14, 193, 201, 376, 408, 424, 456, 495, 548, 811, 859, 986, 1296, 3178, 4908, 5194], 'deprivation': [7, 194, 409, 496, 549, 812, 4909], 'therapy': [8, 195, 517, 550, 813, 1113, 1177, 4910], 'invariably': [9, 196, 498], 'express': [10, 197, 710], 'high': [11, 198, 4333], 'levels': [12, 199, 3219, 3970, 4931], 'of': [13, 34, 134, 151, 156, 166, 183, 200, 221, 321, 338, 343, 353, 370, 399, 416, 442, 464, 621, 739, 937, 1106, 1295, 1334, 1394, 1559, 1970, 1976, 1984, 1987, 2002, 2028, 2119, 2138, 2145, 2154, 2171, 2176, 2248, 2278, 2330, 2337, 2343, 2347, 2355, 2366, 2374, 2378, 2387, 2442, 2483, 2491, 2496, 2627, 2687, 2738, 2772, 2799, 2815, 2848, 2880, 3053, 3148, 3164, 3177, 3195, 3622, 3647, 3657, 3684, 3868, 3874, 3923, 3937, 3971, 3988, 4033, 4104, 4160, 4169, 4198, 4226, 4254, 4281, 4290, 4312, 4362, 4524, 4532, 4545, 4589, 4738, 4779, 4806, 4814, 4865, 4889, 4893, 4932, 4937, 4944, 4980, 5046, 5054, 5093, 5138, 5164, 5177, 5192], 'receptor': [15, 136, 202, 323, 377, 385, 457, 462, 468, 2393, 5077, 5142], '(AR)': [16, 203], 'and': [17, 31, 77, 102, 129, 153, 173, 204, 218, 264, 289, 316, 340, 360, 405, 448, 526, 528, 558, 629, 731, 831, 939, 1153, 1225, 1263, 1283, 1288, 1397, 1481, 1525, 1572, 1627, 1745, 1837, 1856, 1930, 1936, 2010, 2052, 2070, 2113, 2133, 2142, 2200, 2220, 2254, 2257, 2273, 2291, 2322, 2340, 2371, 2417, 2432, 2445, 2459, 2481, 2499, 2510, 2518, 2616, 2642, 2745, 2783, 2818, 2824, 2956, 2982, 3021, 3078, 3131, 3134, 3327, 3412, 3438, 3469, 3480, 3583, 3593, 3663, 3681, 3751, 3840, 3994, 4076, 4106, 4132, 4234, 4326, 4355, 4507, 4592, 4614, 4765, 4799, 4879, 4884, 5011, 5080, 5096, 5158, 5166, 5216], 'AR-regulated': [18, 205, 711], 'genes.': [19, 206], 'Most': [20, 207], 'do': [21, 208, 4668], 'not': [22, 122, 209, 309, 1529, 2708, 2747, 2832, 3037, 3049, 3485, 3640, 3861, 3890, 3907, 3914, 3934, 4011, 4017, 4121, 4136, 4215, 4327, 4529, 4553, 4563, 4600, 4669, 4732, 4802, 4832, 4850, 5084, 5110, 5121], 'respond': [23, 210, 406, 513, 842, 4194], 'to': [24, 57, 110, 211, 244, 297, 407, 421, 454, 504, 514, 535, 632, 702, 725, 810, 814, 829, 843, 853, 861, 926, 947, 965, 990, 1160, 1174, 1251, 1267, 1389, 1564, 1570, 1690, 1699, 1959, 2012, 2107, 2182, 2190, 2203, 2297, 2465, 2488, 2513, 2516, 2520, 2639, 3048, 3063, 3140, 3160, 3258, 3262, 3268, 3276, 3308, 3313, 3456, 3476, 3567, 3589, 3746, 3758, 3763, 3952, 3968, 4006, 4040, 4171, 4195, 4201, 4275, 4303, 4331, 4501, 4537, 4579, 4651, 4671, 4782, 4818, 4834, 4844, 4856, 4960, 4974, 5073, 5086, 5131], 'secondary': [25, 212, 515, 844, 1175, 1938], 'hormonal': [26, 213, 516, 845, 1176], 'therapies,': [27, 214, 410], 'including': [28, 215, 3489, 4963], 'AR': [29, 35, 49, 59, 71, 83, 93, 127, 146, 170, 216, 222, 236, 246, 258, 270, 280, 314, 333, 357, 379, 383, 626, 641, 700, 722, 733, 804, 854, 863, 928, 949, 955, 1100, 1116, 1162, 1181, 1188, 1234, 1240, 1254, 1268, 1274, 1319, 1454, 1475, 1522, 1563, 1574, 1581, 1647, 1652, 1692, 1934, 2356, 2633, 2659, 2689, 2700, 2727, 2734, 2800, 2809, 2834, 2851, 2871, 2967, 2997, 3032, 3054, 3064, 3069, 3076, 3088, 3117, 3129, 3260, 3274, 3306, 3413, 3442, 3454, 3467, 3477, 3591, 3765, 3830, 3839, 3852, 3863, 3905, 3924, 3966, 3982, 4019, 4043, 4059, 4081, 4098, 4162, 4176, 4204, 4324, 4344, 4378, 4489, 4516, 4534, 4555, 4577, 4590, 4598, 4653, 4673, 4724, 4744, 4763, 4785, 4867, 4949, 4956, 5068, 5107, 5125, 5129, 5153, 5165, 5181, 5203], 'antagonists,': [30, 217], 'the': [32, 45, 91, 111, 126, 149, 164, 219, 232, 278, 298, 313, 336, 351, 445, 455, 465, 625, 640, 699, 732, 862, 1115, 1278, 1284, 1331, 1520, 1557, 1562, 1645, 1650, 1691, 1859, 1933, 1967, 2013, 2020, 2046, 2056, 2067, 2073, 2116, 2152, 2323, 2484, 2524, 2529, 2628, 2632, 2646, 2658, 2688, 2792, 2812, 2846, 2859, 2966, 2980, 2996, 3086, 3115, 3128, 3153, 3161, 3175, 3196, 3211, 3217, 3309, 3316, 3321, 3416, 3420, 3445, 3449, 3466, 3590, 3620, 3625, 3747, 3759, 3764, 3828, 3866, 3872, 3884, 3930, 3938, 4002, 4031, 4058, 4102, 4124, 4141, 4157, 4167, 4182, 4218, 4252, 4288, 4321, 4332, 4343, 4363, 4481, 4487, 4492, 4509, 4514, 4533, 4538, 4566, 4575, 4596, 4611, 4622, 4652, 4659, 4663, 4672, 4723, 4736, 4742, 4747, 4762, 4772, 4783, 4807, 4839, 4853, 4859, 4886, 4890, 4942, 4955, 4975, 5074, 5088, 5094, 5136, 5152, 5161, 5175], 'mechanisms': [33, 220, 1249, 1566], 'activation': [36, 223, 816, 1483, 1636, 3113, 3194, 4805, 5090, 5182], 'in': [37, 73, 115, 148, 224, 260, 302, 335, 564, 728, 737, 808, 820, 930, 934, 951, 959, 982, 1104, 1144, 1242, 1256, 1474, 1514, 1576, 1642, 1895, 1927, 1948, 1951, 1980, 2093, 2100, 2135, 2185, 2231, 2275, 2523, 2620, 2660, 2690, 2701, 2736, 2758, 2769, 2791, 2811, 2837, 2854, 2857, 2968, 2972, 2979, 2991, 3014, 3033, 3046, 3055, 3174, 3210, 3220, 3288, 3598, 3619, 3660, 3690, 3865, 3871, 3926, 3954, 4001, 4038, 4048, 4101, 4292, 4345, 4491, 4503, 4508, 4582, 4595, 4610, 4621, 4666, 4722, 4768, 4823, 4838, 4902, 4918, 4925, 4946, 4976, 5018, 5071, 5101, 5154, 5170, 5179, 5196, 5208], 'these': [38, 225, 510, 521, 542, 613, 720, 924, 1141, 1247, 3041, 3149, 3617, 3685, 3910, 4147, 4259, 4559, 4571, 4874, 5115], 'clinically': [39, 226, 617], 'androgen-independent': [40, 75, 185, 227, 262, 372, 557, 634, 647, 708, 729, 839, 931, 952, 1243, 1257, 1571, 1577, 1806, 2691, 2705, 2722, 3691, 3927, 4187, 4212, 4227, 5155, 5171, 5209], 'tumors': [41, 228, 512, 709], 'are': [42, 229, 403, 450, 523, 616, 940, 1291, 4214, 4237, 4242, 4881, 4928], 'unclear.': [43, 230], 'Bicalutamide,': [44, 231], 'most': [46, 233, 646, 707, 1271, 4870], 'widely': [47, 234, 1272], 'used': [48, 235, 1273, 2630, 3267, 3566], 'antagonist,': [50, 237], 'is': [51, 238, 642, 735, 806, 954, 1528, 1907, 2873, 2883, 3118, 3651, 4517, 4599, 4604, 4615, 4654, 4876], 'a': [52, 98, 167, 181, 239, 285, 354, 368, 459, 560, 935, 1229, 1237, 1391, 1457, 1841, 1937, 1981, 2309, 2344, 2375, 2388, 2661, 2869, 3119, 3462, 3473, 3601, 3753, 3921, 3985, 3997, 4373, 4583, 4759, 4780, 5047, 5066, 5139, 5148], 'competitive': [53, 240, 1293], 'antagonist': [54, 241, 1117, 1182, 1393, 4375, 4978, 5126], 'shown': [55, 242, 534, 1328, 1387, 2695, 4047], 'previously': [56, 243], 'stabilize': [58, 245], 'association': [60, 247, 3135, 3443], 'with': [61, 248, 500, 719, 835, 975, 985, 1114, 1178, 1262, 1456, 1469, 1531, 1805, 1810, 1858, 1898, 1914, 1932, 1956, 1973, 1999, 2007, 2025, 2034, 2115, 2218, 2228, 2236, 2271, 2300, 2308, 2327, 2352, 2384, 2402, 2423, 2439, 2472, 2494, 2664, 2704, 2721, 2765, 2960, 2988, 2995, 3010, 3061, 3136, 3223, 3256, 3294, 3404, 3444, 3578, 3600, 3761, 3833, 3838, 3845, 3909, 4072, 4083, 4094, 4140, 4173, 4521, 4548, 4565, 4741, 4826, 4907, 4920, 5198], 'cytosolic': [62, 249], 'heat': [63, 250, 1458], 'shock': [64, 251, 1459], 'protein': [65, 101, 252, 288, 1460, 2348, 2379, 3171, 3561], 'complexes.': [66, 253], 'This': [67, 254, 1164, 1553, 4830, 5042], 'study': [68, 255, 1554], 'found': [69, 78, 256, 265, 971, 1103], 'nuclear': [70, 84, 257, 271, 467, 1477, 2697, 2733, 2752, 2808, 2835, 2993, 3001, 3016, 3051, 3065, 3068, 4964], 'expression': [72, 179, 259, 366, 805, 1582, 1638, 2735, 2810, 3052, 3683, 3842, 4936, 5163], 'bicalutamide-treated': [74, 261, 2702, 2719, 2819, 4546], 'PCa': [76, 117, 263, 304, 449, 501, 565, 648, 840, 932, 953, 1258, 1807, 2088, 2692, 2706, 2723, 2855, 3285, 3692, 4188, 4213, 4903, 5157, 5172], 'bicalutamide': [80, 120, 162, 267, 307, 349, 1388, 1560, 1811, 1918, 2039, 2122, 2210, 2655, 2757, 2766, 2830, 2849, 2887, 2951, 3011, 3071, 3142, 3218, 3251, 3272, 3439, 3452, 3570, 3638, 4051, 4109, 4170, 4199, 4247, 4256, 4272, 4300, 4313, 4334, 4354, 4370, 4527, 4815, 4845, 4863, 4945, 4981, 5062, 5082, 5103, 5119, 5178, 5199], 'could': [81, 121, 268, 308, 3180, 3571, 3627, 3831, 3849, 3906, 3964, 4055, 4356, 4786, 4899, 4971], 'stimulate': [82, 123, 269, 310, 3572, 3641, 3862, 3935, 4530, 4554, 4803], 'translocation.': [85, 272, 3066], 'Moreover,': [86, 273, 698, 1140, 2950, 4543], 'specific': [87, 274], 'DNA': [88, 172, 275, 359, 1479, 1685, 1972, 2629, 3123, 3145, 3431, 4379, 4580, 5132], 'binding': [89, 109, 276, 296, 453, 860, 1297, 1468, 1686, 1694, 3146, 3261, 3275, 3307, 3455, 3562, 3595, 3656, 3745, 3749, 3762, 4380, 4531, 4541, 4624, 4650, 4675, 4730, 4749, 4775, 4778, 4789, 4970, 5130], 'by': [90, 105, 277, 292, 452, 645, 817, 1151, 1920, 1965, 2130, 2168, 2242, 2613, 2756, 2774, 2875, 2886, 3114, 3184, 3302, 3487, 3606, 3631, 3654, 3769, 4063, 4155, 4165, 4239, 4246, 4265, 4271, 4287, 4316, 4359, 4376, 4606, 4754, 5127, 5183], 'bicalutamide-liganded': [92, 279, 1521, 3829, 3904, 3941, 4488, 4515, 4567, 4576, 4597, 4743, 4784, 4810], 'was': [94, 103, 281, 290, 1585, 1688, 1996, 2023, 2091, 2148, 2162, 2240, 2295, 2317, 2325, 2351, 2486, 2636, 2754, 2865, 2976, 3158, 3172, 3208, 3266, 3484, 3564, 3612, 3886, 4010, 4024, 4129, 4152, 4185, 4268, 4295], 'demonstratedin': [95, 282], 'vivo': [96, 283, 4977], 'using': [97, 284, 1840, 2055, 2645, 3028], 'VP16-AR': [99, 286, 3168, 3197, 3581], 'fusion': [100, 287, 3170, 3199, 3586], 'confirmed': [104, 291], 'chromatin': [106, 293, 3303], 'immunoprecipitation': [107, 294, 3265, 3304], 'showing': [108, 295], 'prostate-specific': [112, 299, 387, 715], 'antigen': [113, 300, 388, 716], 'enhancer': [114, 301, 3311, 3430], 'LNCaP': [116, 303, 1889, 2087, 2179, 2860, 2867, 2954, 2969, 3281, 3422, 4219, 4232, 4266, 4282, 4346], 'cells.': [118, 305, 2843, 3956], 'Nonetheless,': [119, 306], 'interactions': [124, 311], 'between': [125, 312, 3127, 3465, 3616, 4130], 'N': [128, 315, 3130, 3162, 3468, 4535, 4612, 4660, 4725], 'C': [130, 317, 3132, 3470, 3993], 'termini': [131, 318, 3471], 'or': [132, 140, 319, 327, 414, 518, 556, 852, 962, 1649, 1917, 2035, 2038, 2083, 2121, 2207, 2839, 3282, 3296, 3419, 3426, 3492, 3870, 3892, 3903, 3917, 3940, 4200, 4550, 4656, 4770, 4790, 4809, 4828, 4858, 4912, 5099], 'recruitment': [133, 320], 'steroid': [135, 322, 384, 460, 1155, 1908, 2191, 2973, 3289, 3648], 'coactivator': [137, 176, 324, 363, 386, 3137, 3658, 3736, 4560, 4793, 5168], 'proteins': [138, 325, 3587, 3618, 3737, 3932, 3963, 4192, 4561, 4939, 5169], '(SRC-1': [139, 326], '-2),': [141, 328], 'although': [142, 329, 4231], 'SRC': [143, 330, 3931, 3962, 4191, 4938], 'transfection': [144, 331, 3877, 3979, 4119, 4848], 'augmented': [145, 332], 'activity': [147, 334, 950, 961, 1241, 1255, 1325, 1533, 1575, 3060, 3084, 3207, 3255, 3479, 3646, 3854, 3864, 3882, 3894, 3925, 3936, 3983, 4061, 4082, 4088, 4100, 4159, 4822, 4888, 4979], 'presence': [150, 337, 3873, 4103], 'dihydrotestosterone': [152, 339, 393, 832], 'inhibitory': [154, 341, 4310], 'concentrations': [155, 342, 3990, 4009, 4036, 4257, 4273, 4301, 4335, 4361, 4813], 'bicalutamide.': [157, 344, 3297, 3875, 4092, 4921], 'These': [158, 345, 799, 2826, 3735, 3898, 4339, 5057, 5145], 'results': [159, 346, 2063, 2730, 2827, 3024, 3899, 4148, 4875, 5116], 'demonstrate': [160, 347, 4485, 4953, 5117], 'stimulates': [163, 350, 3453, 5135], 'assembly': [165, 352, 5137], 'transcriptionally': [168, 355, 704, 4518, 4584, 5140], 'inactive': [169, 356, 3173, 4585, 5141], 'on': [171, 358, 444, 1246, 1561, 1893, 2850, 3085, 3144, 4181, 4258, 4617, 5143], 'support': [174, 361, 3915, 5147], 'altered': [175, 362, 976], '(or': [177, 364, 5200], 'corepressor)': [178, 365], 'as': [180, 367, 706, 714, 1236, 1814, 1862, 1924, 2040, 2072, 3920, 4285, 4372, 4602, 4662, 4846, 5049, 5065, 5105, 5123], 'mechanism': [182, 369, 945, 1238, 3922, 5051, 5188], 'bicalutamide-resistant': [184, 371, 1573, 5055, 5156], 'PCa.': [186, 373, 1244, 1578, 3928, 4228, 5056, 5210], 'prostate': [374, 400, 447, 543, 2760, 2813, 2841, 2861, 3056, 3955, 4220], 'cancer(s)': [375], 'human': [378, 1580, 1742], 'androgen-responsive': [380, 1708, 2531], 'element': [381, 2532], 'N-terminal': [382, 1651, 1844, 2357, 3592, 3772, 4748, 4773, 5089], 'charcoal-dextran-stripped': [389, 1900], 'fetal': [390], 'calf': [391], 'serum': [392], 'phosphate-buffered': [394], 'saline': [395], 'luciferase': [396, 3602], 'The': [397, 440, 1270, 1452, 1683, 1702, 2062, 2086, 2506, 2729, 2788, 3167, 3644, 4309, 4587, 4719, 4869], 'majority': [398], '(PCa)1': [402], 'androgen-dependent': [404], 'which': [411, 1290, 1527, 1906, 1995, 2527, 2635, 3319, 3912, 4128, 4926, 5102], 'include': [412], 'orchiectomy': [413], 'administration': [415], 'leutinizing': [417], 'hormone-releasing': [418], 'hormone': [419, 461, 554, 850, 3649, 4914, 4916], 'agonists': [420], 'suppress': [422], 'testicular': [423], 'production': [425, 851, 4236, 4264, 5195], '(1Catalona': [426], 'W.J.': [427], 'N.': [428, 757, 1009, 1052, 3714], 'Engl.': [429, 758, 1010], 'J.': [430, 654, 667, 669, 759, 786, 882, 913, 1011, 1034, 1060, 1061, 1210, 1344, 1424, 1434, 1439, 1498, 1499, 1535, 1613, 1667, 1723, 2549, 2580, 2667, 2889, 2899, 2904, 2918, 2933, 3343, 3374, 3502, 3520, 3788, 4404, 4414, 4419, 4446, 4447, 4461, 4632], 'Med.': [431, 760, 1012, 1089], '1994;': [432], '331:': [433], '996-1004Crossref': [434], 'PubMed': [435, 489, 583, 607, 674, 764, 794, 888, 918, 1016, 1044, 1069, 1093, 1215, 1310, 1355, 1447, 1507, 1548, 1619, 1678, 1734, 1770, 1795, 1884, 2560, 2586, 2604, 2680, 2912, 2945, 3241, 3354, 3380, 3398, 3511, 3531, 3553, 3676, 3730, 3799, 3820, 4427, 4455, 4474, 4643, 4693, 4714, 4996, 5037], 'Scopus': [436, 584, 608, 675, 765, 795, 889, 919, 1017, 1045, 1070, 1094, 1216, 1311, 1356, 1448, 1508, 1549, 1620, 1679, 1735, 1771, 1796, 1885, 2561, 2587, 2605, 2681, 2913, 2946, 3242, 3355, 3381, 3399, 3532, 3554, 3677, 3731, 3800, 3821, 4428, 4456, 4475, 4644, 4694, 4715, 4997, 5038], '(266)': [437], 'Google': [438, 490, 586, 595, 610, 677, 696, 767, 797, 891, 921, 1019, 1047, 1072, 1096, 1138, 1218, 1313, 1358, 1380, 1421, 1450, 1510, 1551, 1622, 1681, 1737, 1773, 1798, 1835, 1887, 2563, 2589, 2607, 2683, 2915, 2948, 3109, 3244, 3357, 3383, 3401, 3512, 3534, 3556, 3679, 3712, 3733, 3802, 3823, 4401, 4430, 4458, 4477, 4646, 4696, 4717, 4999, 5040], 'Scholar).': [439, 491, 611, 697, 798, 922, 1097, 1139, 1219, 1314, 1381, 1451, 1511, 1552, 1623, 1682, 1738, 1799, 1888, 2608, 2684, 2949, 3110, 3245, 3402, 3557, 3734, 3824, 4478, 4647, 4718, 5041], 'effects': [441, 1558, 3143, 4253, 4311], 'androgens': [443, 824, 3947], 'normal': [446, 2759, 2838], 'mediated': [451, 3653, 3767, 4605], '(AR),': [458], 'member': [463], 'larger': [466], 'superfamily': [469], '(2Quigley': [470], 'C.A.,': [471], 'De': [472], 'Bellis': [473], 'A.': [474, 680, 690, 782, 1024, 1030, 1587, 1780, 1791, 1880, 3716, 5009, 5214], 'Marschke': [475], 'K.B.': [476, 2566, 3360], 'el': [477], 'Awady': [478], 'M.K.': [479], 'Wilson': [480, 1342, 3500, 3518, 3546, 3705, 4630], 'E.M.': [481, 1343, 3501, 3519, 3547, 3706, 4631], 'French': [482, 3703], 'F.S.': [483, 3704], 'Endocr.': [484, 3671], 'Rev.': [485, 602, 3672], '1995;': [486, 693, 761, 791, 1013, 1347, 1767, 3523], '16:': [487], '271-321Crossref': [488], 'Unfortunately,': [492], 'patients': [493, 841, 938, 983, 1107, 1804, 2703, 2720, 3221, 4904], 'receiving': [494], 'therapies': [497, 531], 'tends': [503], 'be': [505, 703, 726, 827, 991, 1260, 1390, 3181, 3628, 3950, 4357, 4752, 4900], 'aggressive.': [506], 'In': [507, 1098, 1382, 3434, 3636, 4067, 4138, 4229, 4479, 4922, 5113], 'some': [508, 838], 'cases,': [509], 'relapsed': [511, 614, 1109], 'chemotherapy,': [519], 'but': [520, 979, 2699, 2882, 3179, 3624, 3889, 4085, 4217, 4581, 4735, 5133], 'responses': [522, 925, 964, 1221, 3967], 'generally': [524, 941, 1223, 2694], 'partial': [525, 1224, 3082, 3253], 'transient,': [527, 1226], 'no': [529, 3080, 3427, 3613], 'current': [530], 'have': [532, 551, 801, 970, 1276, 1386, 1517, 2693, 3025, 3738, 4367, 5109, 5206], 'been': [533, 552, 1277, 1327, 2709, 3026, 3688, 4733, 5111], 'prolong': [536], 'survival': [537], 'at': [538, 1992, 2159, 2225, 2259, 2305, 2319, 2449, 2461, 3002, 4035, 4052, 4089, 4248, 4299, 4351], 'this': [539, 836, 2535, 3224, 3247, 3325, 3482, 3573, 3642, 3770, 4522, 4603, 4897, 4923, 5187], 'stage.': [540], 'Therefore,': [541, 2712, 3139, 3246, 3957, 4251], 'termed': [553], 'refractory': [555], 'represent': [559, 2625], 'major': [561, 2530, 3322, 3474], 'clinical': [562], 'challenge': [563], '(3Bubley': [566], 'G.J.': [567, 744, 912, 996, 1209, 1371, 1412, 1871, 3100, 4392], 'Balk': [568, 755, 907, 1007, 1131, 1204, 1372, 1413, 1828, 1872, 3101, 4393], 'S.P.': [569, 756, 1008, 1132, 1373, 1414, 1829, 1873, 3102, 4394], 'Hematol.': [570], 'Oncol.': [571, 591, 884], 'Clin.': [572, 883, 1374, 1415, 3103, 4395], 'North': [573], 'Am.': [574], '1996;': [575, 1792, 2552, 3346], '10:': [576], '713-725Abstract': [577], 'Full': [578, 580, 1350, 1352, 1673, 1675, 1729, 1731, 2555, 2557, 3349, 3351, 3508, 3526, 3528, 3725, 3727, 3794, 3796, 4638, 4640, 5032, 5034], 'Text': [579, 581, 1351, 1353, 1674, 1676, 1730, 1732, 2556, 2558, 3350, 3352, 3509, 3527, 3529, 3726, 3728, 3795, 3797, 4639, 4641, 5033, 5035], 'PDF': [582, 1354, 1677, 1733, 2559, 3353, 3510, 3530, 3729, 3798, 4642, 5036], '(20)': [585], 'Scholar,': [587, 596, 678, 768, 892, 1020, 1048, 1073, 1359, 1422, 1774, 2564, 2590, 2916, 3358, 3384, 3513, 3535, 3803, 4402, 4431, 4459, 4697, 5000, 5020], '4Jenster': [588], 'G.': [589, 686, 877, 904, 1036, 1201, 1369, 1410, 1432, 2897, 2924, 3098, 3809, 4390, 4412, 4682], 'Semin.': [590], '1999;': [592, 1135, 1307, 1504, 1832, 3550, 3673, 3817, 4452, 4690, 4711], '26:': [593], '407-421PubMed': [594], '5Feldman': [597], 'B.J.': [598], 'Feldman': [599, 1086], 'D.': [600, 1087], 'Nature': [601], 'Cancer.': [603, 670], '2001;': [604, 1670, 1726, 1881, 3709, 3722, 4993], '1:': [605], '34-45Crossref': [606], '(1966)': [609], 'Although': [612, 3929, 4797], 'androgen-independent,': [618], 'many': [619], 'lines': [620, 1516, 4209], 'evidence': [622], 'indicate': [623, 4573], 'remains': [627, 1184, 1523], 'active': [628, 705, 1332, 2878, 4349], 'may': [630, 1568, 4751, 5063, 5173, 5205], 'contribute': [631, 1569, 4973], 'their': [633, 980, 2784], 'growth.': [635], 'Immunohistochemical': [636, 2685], 'data': [637, 2746, 4184, 4482, 5058], 'show': [638], 'highly': [643], 'expressed': [644, 2071], '(6van': [649], 'der': [650, 1603, 2568, 3362], 'Kwast': [651], 'T.H.': [652], 'Schalken': [653], 'Ruizeveld': [655], 'de': [656, 1488, 4436], 'Winter': [657], 'J.A.': [658, 1541, 1605, 2673, 3537, 4467, 4629], 'van': [659, 1593, 1602, 1608, 2567, 2571, 2574, 2929, 3361, 3365, 3368], 'Vroonhoven': [660], 'C.C.': [661, 2573, 3367], 'Mulder': [662, 1437, 1542, 1611, 2674, 2902, 2936, 4417, 4468], 'E.': [663, 772, 1438, 1543, 1612, 2675, 2903, 2928, 2937, 3515, 3539, 4418, 4469], 'Boersma': [664], 'W.': [665, 906, 1203, 1303, 3811, 4684], 'Trapman': [666, 1433, 1497, 2579, 2898, 2932, 3373, 4413, 4445], 'Int.': [668], '1991;': [671], '48:': [672], '189-193Crossref': [673], '(340)': [676], '7Hobisch': [679], 'Culig': [681], 'Z.': [682, 1022, 4989], 'Radmayr': [683, 1031], 'C.': [684, 780, 867, 873, 1032, 1337, 1428, 1599, 2893, 2920, 2926, 4408], 'Bartsch': [685, 1035], 'Klocker': [687, 1037], 'H.': [688, 1038, 1050, 1776], 'Hittmair': [689, 1029], 'Cancer': [691, 1133, 1375, 1416, 1754, 1830, 3104, 3707, 4396], 'Res.': [692, 1134, 1376, 1417, 1831, 2599, 2940, 3105, 3393, 3708, 4397], '55:': [694], '3068-3072PubMed': [695], 'appears': [701, 724, 989], 'genes': [712, 4506], 'such': [713, 972], '(PSA).': [717], 'Consistent': [718, 834, 2959, 3844, 4520], 'observations,': [721, 1248], 'mRNA': [723], 'increased': [727, 807, 1171, 3682, 4935, 5162], 'PCa,': [730], 'gene': [734, 2536, 3326, 3604], 'amplified': [736], '∼30%': [738], 'cases': [740, 2740], '(8Taplin': [741, 993], 'M.E.': [742, 748, 910, 994, 1000, 1120, 1207, 1367, 1408, 1817, 3096, 4388], 'Bubley': [743, 911, 995, 1121, 1208, 1370, 1411, 1818, 1870, 3099, 4391], 'Shuster': [745, 997, 1362, 1403, 3091, 4383], 'T.D.': [746, 998, 1363, 1404, 3092, 4384], 'Frantz': [747, 999], 'Spooner': [749, 1001], 'A.E.': [750, 1002], 'Ogata': [751, 1003], 'G.K.': [752, 1004], 'Keer': [753, 1005], 'H.N.': [754, 1006], '332:': [762, 1014], '1393-1398Crossref': [763, 1015], '(1040)': [766, 1018], '9Visakorpi': [769], 'T.': [770, 784, 3720], 'Hyytinen': [771], 'Koivisto': [773], 'P.': [774, 898, 1195, 1299, 1301, 1492, 1601, 3805, 4440, 4678, 4985, 5014], 'Tanner': [775], 'M.': [776, 871, 881, 900, 1056, 1128, 1197, 1341, 1751, 1825, 1865, 3499, 5024, 5026, 5217], 'Keinanen': [777], 'R.': [778, 894, 1191], 'Palmberg': [779], 'Palotie': [781], 'Tammela': [783], 'Isola': [785], 'Kallioniemi': [787], 'O.P.': [788], 'Nat.': [789, 1088], 'Genet.': [790], '9:': [792, 5030], '401-406Crossref': [793], '(1241)': [796], 'findings': [800, 3042, 4340, 4572, 5146], 'suggested': [802, 4368], 'response': [809, 1172, 3974, 4004, 4114, 4145, 4855], 'enhance': [815, 3965, 4885], 'residual': [818, 4948, 5184], 'androgens,': [819, 4934], 'particular': [821, 3661], 'weak': [822, 1323, 3329], 'adrenal-derived': [823], 'can': [826, 2656, 2952, 3072, 3949, 4499, 4957], 'converted': [828, 3951], 'testosterone': [830], '(DHT).': [833], 'hypothesis,': [837], 'agents': [846], 'antagonize': [848], 'adrenal': [849, 5193], 'antagonists': [855, 1275, 1294, 3488], 'directly': [857], 'block': [858, 3074, 4057, 4787, 4819], '(10Scher': [864], 'H.I.': [865], 'Liebertz': [866], 'Kelly': [868], 'W.K.': [869], 'Mazumdar': [870], 'Brett': [872], 'Schwartz': [874, 880], 'L.': [875, 879, 902, 1199, 3235], 'Kolvenbag': [876, 903, 1200, 1368, 1409, 3097, 4389], 'Shapiro': [878], '1997;': [885, 1377, 1418, 2583, 2601, 3106, 3377, 3395, 4398], '15:': [886], '2928-2938Crossref': [887], '(200)': [890], '11Joyce': [893], 'Fenton': [895, 1192], 'M.A.': [896, 1193, 1361, 1402, 3090, 4382], 'Rode': [897, 1194], 'Constantine': [899, 1196], 'Gaynes': [901, 1198], 'DeWolf': [905, 1202], 'S.': [908, 1058, 1081, 1205, 1790, 1879, 2592, 3386, 3718, 4701, 5006, 5013], 'Taplin': [909, 1206, 1366, 1407, 3095, 4387], 'Urol.': [914, 1211, 3237], '1998;': [915, 1212, 3791], '159:': [916, 1213], '149-153Crossref': [917, 1214], '(186)': [920, 1217], 'However,': [923, 1220, 2804, 3111, 3858, 3996, 4513, 4648, 5070], 'further': [927, 1227, 1555, 3269, 3447, 3958, 4972], 'blockade': [929, 4325], 'occur': [933], 'minority': [936], 'transient.': [942], 'An': [943], 'alternative': [944], 'proposed': [946, 1250], 'explain': [948], 'mutations': [956, 1101, 1142, 1235], 'result': [958, 3248], 'constitutive': [960], 'enhanced': [963, 3879, 3980], 'other': [966, 1154, 2778], 'hormones.': [967], 'Several': [968], 'groups': [969], 'mutant': [973, 1145, 1399, 2870], 'ARs': [974, 1146, 1400], 'ligand': [977, 1467, 1693, 3594, 3748, 3869, 4540, 4623, 4674, 4755], 'responses,': [978], 'frequency': [981], 'treated': [984, 1809, 1913, 2114, 2638, 2764, 2793, 3222, 3293, 4071, 4906], 'ablation': [987], 'monotherapy': [988], 'low': [992], '12Culig': [1021], 'Hobisch': [1023], 'Cronauer': [1025], 'M.V.': [1026], 'Cato': [1027], 'A.C.': [1028], 'Eberle': [1033], 'Mol.': [1039, 1064, 1442, 1502, 2581, 2907, 3375, 3548, 3814, 4422, 4450, 4687, 4708, 4990, 5016, 5027], 'Endocrinol.': [1040, 2582, 3376, 3549], '1993;': [1041, 1066, 3505], '7:': [1042], '1541-1550Crossref': [1043], '(400)': [1046], '13Suzuki': [1049], 'Sato': [1051], 'Watabe': [1053], 'Y.': [1054, 1662, 1718, 5022], 'Masai': [1055], 'Seino': [1057], 'Shimazaki': [1059], 'Steroid': [1062, 1440, 1500, 1614, 2905, 4420, 4448], 'Biochem.': [1063, 1441, 1501, 1615, 2597, 2906, 2938, 3391, 4421, 4449], 'Biol.': [1065, 1345, 1443, 1503, 1668, 1724, 2550, 2908, 3344, 3503, 3521, 3789, 3816, 4423, 4451, 4633, 4689, 4710, 4992], '46:': [1067], '759-765Crossref': [1068], '(219)': [1071], '14Zhao': [1074], 'X.Y.': [1075], 'Malloy': [1076], 'P.J.': [1077], 'Krishnan': [1078], 'A.V.': [1079], 'Swami': [1080], 'Navone': [1082], 'N.M.': [1083], 'Peehl': [1084], 'D.M.': [1085, 4705], '2000;': [1090, 4635], '6:': [1091], '703-706Crossref': [1092], '(444)': [1095], 'contrast,': [1099, 1383, 3435, 3637, 4068, 4480], 'were': [1102, 1148, 1222, 1630, 1640, 1749, 1812, 1838, 1854, 1891, 1911, 1946, 1963, 2048, 2064, 2104, 2128, 2188, 2215, 2267, 2383, 2398, 2430, 2434, 2457, 2469, 2508, 2611, 2724, 2763, 2786, 2795, 3292, 3299, 3576, 3836, 4261, 4314, 4816], '∼40%': [1105], 'who': [1108], 'initial': [1111], 'combined': [1112], 'flutamide': [1118, 1152, 1287, 1335, 3493], '(15Taplin': [1119, 1816], 'G.J.,': [1122, 1819], 'Ko,': [1123, 1820], 'Y.J.': [1124, 1821], 'Small': [1125, 1822], 'E.J.': [1126, 1823], 'Upton': [1127, 1824], 'Rajeshkumar': [1129, 1826], 'B.': [1130, 1827, 3696, 3813, 4627, 4686], '59:': [1136, 1833], '2511-2515PubMed': [1137, 1834], 'resulted': [1143, 2990, 3013], 'strongly': [1149, 3182, 3629], 'activated': [1150, 2874], 'hormones,': [1156], 'indicating': [1157, 1228, 4319, 4557, 4967], 'selective': [1158, 5067, 5075], 'pressure': [1159], 'maintain': [1161, 2657], 'activity.': [1163, 4045, 4868, 4950], 'flutamide-treated': [1165], 'patient': [1166], 'population': [1167], 'also': [1168, 3012, 3652, 4296, 4958, 5059], 'had': [1169, 3058, 3252, 4079], 'an': [1170, 1180, 2172, 3277, 3405, 4607, 4618, 4836, 5106, 5124], 'rate': [1173], 'bicalutamide,': [1179, 1289, 3045, 4034, 4127], 'effective': [1185], 'against': [1186], 'identified': [1187, 1398], 'mutants': [1189], '(11Joyce': [1190], 'limited': [1230], 'overall': [1231], 'role': [1232, 4760, 5150], 'for': [1233, 1239, 1253, 1265, 1329, 1741, 1989, 2050, 2066, 2110, 2123, 2164, 2197, 2211, 2222, 2262, 2452, 2502, 2631, 2726, 2780, 3305, 4021, 4126, 4175, 4761, 4841, 4862, 4873, 5052, 5151, 5219], 'Based': [1245], 'account': [1252, 1264], 'should': [1259, 4193], 'consistent': [1261, 1530], 'resistance': [1266], 'antagonists.': [1269, 4205], 'steroidal': [1279], 'drug': [1280, 3225], 'cyproterone': [1281, 3490], 'acetate': [1282, 1316, 3491], 'nonsteroidal': [1285], 'drugs': [1286], 'all': [1292], '(16Reid': [1298], 'Kantoff': [1300], 'Oh': [1302], 'Investig.': [1304], 'New': [1305], 'Drugs.': [1306], '17:': [1308], '271-284Crossref': [1309], '(53)': [1312], 'Cyproterone': [1315], 'has': [1317, 1326, 2707, 3079, 3687, 4224, 4731], 'significant': [1318], 'agonist': [1320, 1324, 3059, 3083, 3254, 4619, 5108], 'activity,': [1321, 4526, 4556], 'whereas': [1322], 'hydroxyflutamide,': [1330], 'metabolite': [1333, 2879], '(17Wong': [1336], 'Kelce': [1338, 3544], 'W.R.': [1339, 3545], 'Sar': [1340, 3498], 'Chem.': [1346, 1669, 1725, 2551, 3345, 3504, 3522, 3790, 4634], '270:': [1348, 1768, 3524], '19998-20003Abstract': [1349], '(307)': [1357], '18Fenton': [1360], 'Fertig': [1364, 1405, 3093, 4385], 'A.M.': [1365, 1406, 3094, 4386], '3:': [1378, 1419, 3107, 4399], '1383-1388PubMed': [1379, 1420, 3108, 4400], 'previous': [1384, 2961, 3846], 'studies': [1385, 1513, 2652, 2686, 3459, 3975, 4115], 'pure': [1392, 4374], 'wild': [1395, 3030], 'type': [1396, 3031], '(18Fenton': [1401, 3089, 4381], '19Veldscholte': [1423, 4403], 'Berrevoets': [1425, 1495, 1536, 2668, 2890, 2925, 4405, 4443, 4462], 'C.A.': [1426, 1496, 1537, 2669, 2891, 4406, 4444, 4463], 'Ris-Stalpers': [1427, 2892, 2919, 4407], 'Kuiper': [1429, 1596, 2894, 2921, 4409], 'G.G.': [1430, 1597, 2895, 2922, 4410], 'Jenster': [1431, 2896, 2923, 4411], 'Brinkmann': [1435, 1538, 1588, 2670, 2900, 2934, 4415, 4464, 5215], 'A.O.': [1436, 1485, 1539, 1590, 2671, 2901, 2935, 4416, 4433, 4465], '1992;': [1444, 1545, 2677, 2909, 4424, 4471], '41:': [1445, 2910, 4425], '665-669Crossref': [1446, 2911, 4426], '(367)': [1449, 2914, 4429], 'unliganded': [1453, 3902, 3939, 4808], 'associates': [1455], '90': [1461], '(HSP90)': [1462], 'chaperone': [1463], 'complex': [1464, 2663], 'facilitates': [1466], 'subsequent': [1470], 'conformational': [1471], 'changes': [1472], 'resulting': [1473], 'homodimerization,': [1476, 3125], 'translocation,': [1478], 'binding,': [1480, 3124, 4756], 'transcriptional': [1482, 1532, 3112, 3478, 3645, 3853, 3881, 4044, 4060, 4099, 4158, 4525, 4804, 4821, 4887, 5167], '(20Brinkmann': [1484], 'Blok': [1486, 4434], 'L.J.': [1487, 4435], 'Ruiter': [1489, 4437], 'P.E.': [1490, 2594, 3388, 4438], 'Doesburg': [1491, 4439], 'Steketee': [1493, 4441], 'K.': [1494, 1778, 3543, 4442], '69:': [1505, 4453], '307-313Crossref': [1506, 4454], '(257)': [1509, 4457], 'Previous': [1512, 2650, 3458, 4365], 'cell': [1515, 2014, 2089, 2312, 2863, 4208, 4222, 4283, 5097], 'indicated': [1518, 1968, 2117, 3043, 3249, 3900, 4149, 4341], 'cytoplasmic-': [1524], 'HSP90-associated,': [1526], '(21Veldscholte': [1534, 2666], 'Grootegoed': [1540, 2672, 4466], 'Biochemistry.': [1544, 2676, 4470], '31:': [1546, 2678, 4472], '2393-2399Crossref': [1547, 2679, 4473], '(255)': [1550, 2682, 4476], 'examined': [1556, 2725, 2741, 3301], 'identify': [1565], 'A': [1579, 3558, 4178], 'vector,': [1583], 'pSVARo,': [1584], 'from': [1586, 1631, 1750, 1803, 2081, 2718, 3315, 3415, 4211], '(22Brinkmann': [1589], 'Faber': [1591, 2577, 3371], 'P.W.': [1592, 1869, 2578, 3372], 'Rooij': [1594, 2575, 2930, 3369], 'H.C.': [1595, 2576, 2931, 3370], 'Ris': [1598], 'Klaassen': [1600], 'Korput': [1604, 2569, 3363], 'Voorhorst': [1606], 'M.M.': [1607], 'Laar': [1609], 'J.H.': [1610], '1989;': [1616], '34:': [1617], '307-310Crossref': [1618], '(279)': [1621], 'pRL-CMV,': [1624], 'pG5-Luc,': [1625], 'pBind,': [1626], 'pACT': [1628, 1643], 'vectors': [1629, 1639, 1740, 3579], 'Promega': [1632], '(Madison,': [1633], 'WI).': [1634], 'VP16': [1635, 3155], 'domain-AR': [1637], 'generated': [1641], 'containing': [1644], 'full-length': [1646, 3087, 3116, 3165], '(pACT-hAR)': [1648], '(amino': [1653, 1696], 'acids': [1654, 1697], '1–505,': [1655], 'pACT-ARN)': [1656], '(23Lu': [1657, 1713], 'M.L.': [1658, 1714], 'Schneider': [1659, 1715], 'M.C.': [1660, 1716], 'Zheng': [1661, 1717], 'Zhang': [1663, 1719], 'X.': [1664, 1720], 'Richie': [1665, 1721], 'J.P.': [1666, 1722], '276:': [1671, 1727], '13442-13451Abstract': [1672, 1728], '(212)': [1680, 1736], 'Gal4': [1684], 'domain': [1687, 1695, 3157, 3750, 4625, 4676], 'fused': [1689, 3159], '661–919)': [1698], 'generate': [1700], 'pBind-ARLBD.': [1701], 'ARE4-Luc': [1703], 'reporter': [1704, 2058, 3603, 4505], 'contained': [1705, 3424], 'four': [1706, 2739], 'tandem': [1707, 3607], 'elements': [1709, 3609], 'cloned': [1710], 'into': [1711, 2245], 'pGL3': [1712], 'Expression': [1739], 'SRC1': [1743], '(pSG5-SRC1)': [1744], 'murine': [1746], 'GRIP1': [1747], '(pCMV-GRIP1)': [1748], 'Brown': [1752, 5025, 5218], '(Dana-Farber': [1753], 'Institute,': [1755], 'Boston,': [1756], 'MA)': [1757], '(24Onate': [1758], 'S.A.': [1759, 3775], 'Tsai': [1760, 1762, 3780, 3782], 'S.Y.': [1761, 3781], 'M.J.': [1763, 3783], "O'Malley": [1764, 3669, 3786], 'B.W.': [1765, 3670, 3787], 'Science.': [1766], '1354-1357Crossref': [1769], '(2058)': [1772], '25Hong': [1775], 'Kohli': [1777], 'Trivedi': [1779], 'Johnson': [1781, 3697], 'D.L.': [1782], 'Stallcup': [1783], 'M.R.': [1784], 'Proc.': [1785, 1874], 'Natl.': [1786, 1875], 'Acad.': [1787, 1876], 'Sci.': [1788, 1877], 'U.': [1789, 1878], '93:': [1793], '4948-4952Crossref': [1794], '(614)': [1797], 'Bone': [1800], 'marrow': [1801, 2715], 'biopsies': [1802, 2716], 'being': [1808, 2998, 3766, 4905], 'obtained': [1813, 2717, 3027, 4037], 'described': [1815, 1863], 'Scholar)': [1836], 'immunostained': [1839, 1857], 'rabbit': [1842, 2358, 2389], 'anti-AR': [1843], 'antibody': [1845, 1935, 2360, 2394, 3407], '(PG-21,': [1846, 2361], 'Upstate': [1847, 2362], 'Biotechnology,': [1848], 'Lake': [1849], 'Placid,': [1850], 'NY).': [1851], 'Mouse': [1852], 'prostates': [1853, 2785], 'harvested': [1855], 'same': [1860, 2647], 'antibody,': [1861], '(26Stanbrough': [1864], 'Leav': [1866], 'I.': [1867], 'Kwan': [1868], '98:': [1882], '10823-10828Crossref': [1883], '(142)': [1886], 'cells': [1890, 1945, 2047, 2180, 2244, 2856, 2970, 3035, 3286, 3418, 3423, 3835, 4070, 4189, 4260, 4267, 4291, 4347, 4547, 4824], 'grown': [1892, 2181, 2971, 3287], 'coverslips': [1894], 'RPMI': [1896, 2094], '1640': [1897], '10%': [1899, 1957, 2008, 2482], 'FCS': [1901, 1958, 2096], '(CS-FCS,': [1902], 'Hyclone,': [1903], 'Logan': [1904], 'UT),': [1905], 'hormone-depleted.': [1909], 'Cells': [1910, 1962, 2127, 3575], 'then': [1912, 1997, 2105, 2149, 2201, 2216, 2268, 2435, 2470, 2643, 3300], 'DHT': [1915, 2037, 2120, 2206, 2989, 3185, 3295, 3437, 3632, 3953, 3989, 4008, 4075, 4105, 4143, 4174, 4842, 4857], '(Sigma)': [1916], '(provided': [1919], 'Astra-Zeneca,': [1921], 'Wilmington,': [1922], 'DE)': [1923], 'indicated,': [1925], 'fixed': [1926, 2221], 'PBS/4%': [1928], 'paraformaldehyde,': [1929], 'stained': [1931], 'goat': [1939], 'anti-mouse': [1940], 'fluorescein': [1941], 'isothiocyanate': [1942], 'conjugate.': [1943], 'CV1': [1944], 'cultured': [1947, 2092], '24-well': [1949], 'plates': [1950, 2187], "Dulbecco's": [1952, 2003, 2029], 'modified': [1953, 2004, 2030], "Eagle's": [1954, 2005, 2031], 'medium': [1955, 2006, 2022, 2193, 2975, 3291], '∼90%': [1960], 'confluence.': [1961], 'transfected': [1964, 3029, 3577, 4825], 'mixing': [1966], 'amounts': [1969], 'plasmid': [1971], '1.5': [1974], 'μl': [1975, 1986, 2158, 2170, 2336, 2342, 2373, 2441], 'LipofectAMINE': [1977], '2000': [1978], '(Invitrogen)': [1979], 'final': [1982], 'volume': [1983], '100': [1985, 2208, 2249, 2446, 4276], 'Opti-MEM': [1988], '25': [1990, 4090], 'min': [1991, 2166, 2224, 2454, 2504], 'room': [1993, 2226], 'temperature,': [1994], 'mixed': [1998], '0.5': [2000, 2136, 2173], 'ml': [2001, 2027, 2137, 2144, 2247, 2277, 2771], 'CS-FCS': [2009, 2033, 2109], 'added': [2011, 2163, 4317], 'culture': [2015, 2021], 'wells.': [2016], 'After': [2017, 2042, 2233], '24': [2018, 2044, 2111, 2125], 'h,': [2019, 2045], 'replaced': [2024], '0.2': [2026], 'medium/10%': [2032], 'without': [2036], 'indicated.': [2041], 'another': [2043, 2124, 5050], 'assayed': [2049], 'firefly': [2051], 'Renillaluciferase': [2053], 'activities': [2054], 'Dual-Luciferase': [2057], 'assay': [2059, 3563], 'system': [2060], '(Promega).': [2061], 'normalized': [2065], 'internalRenilla': [2068], 'control': [2069], 'mean': [2074], 'relative': [2075, 4843], 'light': [2076], 'units': [2077], 'plus': [2078], 'standard': [2079], 'deviation': [2080], 'triplicate': [2082], 'quadruplicate': [2084], 'samples.': [2085], 'line': [2090, 2864, 4223], '1640/10%': [2095, 2195], 'until': [2097], '70–80%': [2098], 'confluent': [2099], '10-cm': [2101, 2186], 'plates.': [2102], 'They': [2103, 3298], 'transferred': [2106], 'RPMI-160/10%': [2108], 'h': [2112, 2199, 3004], 'amount': [2118], 'h.': [2126], 'recovered': [2129], 'trypsin,': [2131], 'washed,': [2132], 'resuspended': [2134, 2274], 'PBS/5': [2139], 'mm': [2140, 2250, 2284, 2287, 2404, 2407, 2412, 2425, 2428, 2447], 'EDTA,': [2141, 2285], '0.7': [2143], '95%': [2146], 'ethanol': [2147], 'added.': [2150], 'On': [2151], 'day': [2153, 2779], 'analysis,': [2155], 'RNase': [2156], '(2.5': [2157], '10': [2160, 2204, 2223, 2255, 2283, 2328, 2424, 2453, 4064, 4073, 4352], 'mg/ml)': [2161], '30': [2165, 2260], 'followed': [2167], '5': [2169, 3856, 3896, 4053, 4077], 'mg/ml': [2174], 'solution': [2175], 'propidium': [2177], 'iodide.': [2178], '∼80%': [2183], 'confluence': [2184], 'switched': [2189], 'hormone-depleted': [2192, 2974, 3290], '(RPMI': [2194], 'CS-FCS)': [2196], '48': [2198], 'exposed': [2202], 'nm': [2205, 4065, 4074], 'μm': [2209, 4054, 4091, 4108, 4134, 4277, 4305, 4353], 'varying': [2212], 'times.': [2213], 'Plates': [2214], 'rinsed': [2217], 'PBS': [2219, 2272, 2773], 'temperature': [2227], '1%': [2229, 2418, 2443], 'formaldehyde': [2230], 'PBS.': [2232], 'rinsing': [2234], 'twice': [2235, 2270], 'ice-cold': [2237], 'PBS,': [2238], 'cross-linking': [2239], 'terminated': [2241], 'scraping': [2243], '1': [2246, 2427, 2503, 4133], 'Tris,': [2251, 2288, 2408, 2426], 'pH': [2252, 2289, 2409], '9.4,': [2253], 'mmdithiothreitol': [2256], 'incubating': [2258], '°C': [2261, 2451, 2463, 2501], '15': [2263], 'min.': [2264], 'Cell': [2265, 2315], 'pellets': [2266], 'washed': [2269, 2399], '0.3': [2276], 'lysis': [2279], 'buffer': [2280], '(1%': [2281], 'SDS,': [2282], '50': [2286, 2406, 2489], '8.1,': [2290], 'protease': [2292], 'inhibitors).': [2293], 'Chromatin': [2294, 3264], 'sheared': [2296, 2331, 2367], '300–1000': [2298], 'bp': [2299], 'three': [2301, 2400, 2437], 'sequential': [2302], '10-s': [2303], 'pulses': [2304], '70%': [2306], 'power': [2307], 'microtip': [2310], 'ultrasonic': [2311], 'dismembrator': [2313], '(Fisher).': [2314], 'debris': [2316], 'pelleted': [2318], '10,000': [2320], '×g,': [2321], 'supernatant': [2324], 'precleared': [2326], 'μg': [2329, 2365], 'salmon': [2332, 2368], 'sperm': [2333, 2369], 'DNA,': [2334, 2370], '20': [2335, 2341, 2372], 'nonimmune': [2338], 'sera,': [2339], '50%': [2345, 2376], 'slurry': [2346, 2377], 'A-Sepharose.': [2349, 2380], 'Immunoprecipitation': [2350], '500': [2353, 2385], 'ng': [2354, 2386], 'polyclonal': [2359], 'Biotechnology),': [2363], '2': [2364, 2781, 2985, 3003], 'Control': [2381], 'immunoprecipitations': [2382], 'anti-platelet-derived': [2390], 'growth': [2391, 2955, 3409, 4284], 'factor': [2392, 3410], '(Upstate': [2395], 'Biotechnology).': [2396], 'Precipitates': [2397], 'times': [2401, 2438], '300': [2403], 'NaCl,': [2405], '8.0,': [2410], '2.7': [2411], 'KCl,': [2413], '0.05%': [2414], 'Tween': [2415], '20,': [2416], 'deoxycholate.': [2419], 'Three': [2420], 'additional': [2421], 'washes': [2422], 'EDTA': [2429], 'performed,': [2431], 'beads': [2433], 'eluted': [2436], '35': [2440], 'SDS': [2444], 'NaHCO3': [2448], '37': [2450], 'each.': [2455, 2505], 'Eluates': [2456], 'pooled': [2458], 'incubated': [2460], '65': [2462], 'overnight': [2464], 'reverse': [2466, 2640], 'cross-links.': [2467], 'Products': [2468], 'purified': [2471], 'QIAquick': [2473], 'PCR': [2474, 2492, 2609], 'purification': [2475], 'spin': [2476], 'resin': [2477], '(Qiagen,': [2478], 'Valencia,': [2479], 'CA),': [2480], 'eluate': [2485], 'subjected': [2487], 'cycles': [2490], 'amplification': [2493], 'steps': [2495], '95,': [2497], '55,': [2498], '72': [2500], 'primers': [2507], 'TGAGAAACCTGAGATTAGGA': [2509], 'ATCTCTCTCAGATCCAGGCT,': [2511], 'corresponding': [2512], 'nucleotides': [2514], '−4270': [2515], '−4250': [2517], '−4065': [2519], '−4045,': [2521], 'respectively,': [2522], 'PSA': [2525, 2648, 2957, 3310, 3429, 4235, 4263, 4511], 'enhancer,': [2526, 3446], 'flank': [2528], '(ARE)': [2533], 'regulating': [2534, 3324], '(27Schuur': [2537, 3331], 'E.R.': [2538, 3332], 'Henderson': [2539, 2547, 3333, 3341], 'G.A.': [2540, 3334], 'Kmetec': [2541, 3335], 'L.A.': [2542, 3336], 'Miller': [2543, 3337], 'J.D.': [2544, 3338], 'Lamparski': [2545, 3339], 'H.G.': [2546, 3340], 'D.R.': [2548, 3342], '271:': [2553, 3347], '7043-7051Abstract': [2554, 3348], '(260)': [2562, 3356], '28Cleutjens': [2565, 3359], 'H.A.': [2570, 3364], 'Eekelen': [2572, 3366], '11:': [2584, 3378], '148-161Crossref': [2585, 3379], '(294)': [2588, 3382], '29Zhang': [2591, 3385], 'Murtha': [2593, 3387], 'Young': [2595, 3389], 'C.Y.': [2596, 3390], 'Biophys.': [2598, 2939, 3392], 'Commun.': [2600, 2941, 3394], '231:': [2602, 3396], '784-788Crossref': [2603, 3397], '(41)': [2606, 3400], 'products': [2610], 'analyzed': [2612], 'gel': [2614], 'electrophoresis': [2615], 'ethidium': [2617], 'bromide': [2618], 'staining': [2619], '5%': [2621, 2626], 'agarose': [2622], 'gels.': [2623], 'Inputs': [2624], 'immunoprecipitations,': [2634], 'similarly': [2637, 3191, 3565, 3878, 4096], 'cross-links': [2641], 'PCR-amplified': [2644], 'primers.': [2649], 'biochemical': [2651], 'showed': [2653, 2806, 2964, 3460, 3976, 4116], 'cytoplasmic': [2662], 'HSP90': [2665], 'strong': [2696, 2732, 2807], 'expression,': [2698, 3070], 'specifically': [2710], 'examined.': [2711, 2787, 2866], 'tumor-containing': [2713], 'bone': [2714], 'expression.': [2728], 'demonstrated': [2731, 2828], 'each': [2737], '(Fig.': [2742, 2821, 2984, 3005, 3018, 3200, 3855, 3895, 3991, 4306, 4336], '1,': [2743, 2822], 'A–C,': [2744], 'shown).': [2748, 2803, 3038, 4137], 'To': [2749, 2844, 3825], 'determine': [2750, 3568, 3826], 'whether': [2751, 3271, 3569, 3827, 3961, 4027], 'localization': [2753, 2853], 'inhibited': [2755, 4245, 4269, 4298], 'epithelium,': [2761, 3057], 'mice': [2762, 2794, 2820], '(1': [2767], 'mg': [2768], '0.1': [2770, 4131], 'intraperitoneal': [2775], 'injection': [2776], 'every': [2777], 'weeks),': [2782], 'seminal': [2789], 'vesicles': [2790], 'markedly': [2796, 4122, 4851], 'shrunken,': [2797], 'indicative': [2798], 'inhibition': [2801, 4322, 4864, 5191], '(not': [2802], 'immunohistochemistry': [2805], 'epithelium': [2814], 'both': [2816, 3436], 'untreated': [2817, 3421], 'E': [2823], 'F).': [2825], 'did': [2831, 3639, 3860, 3913, 3933, 4016, 4120, 4528, 4552, 4562, 4801, 4831, 4849], 'prevent': [2833], 'translocation': [2836, 3017], 'malignant': [2840], 'epithelial': [2842], 'assess': [2845, 3141, 3270], 'effect': [2847, 3885], 'cellular': [2852], 'vitro,': [2858], 'cancer': [2862, 4221], 'expresses': [2868], '8-hydroxyflutamide': [2876], '(the': [2877], 'flutamide)': [2881], 'still': [2884, 3945, 4086, 4929], 'blocked': [2885], '(19Veldscholte': [2888], '30Veldscholte': [2917], 'Claassen': [2927], '1990;': [2942, 3238], '173:': [2943], '534-540Crossref': [2944], '(860)': [2947], 'inhibit': [2953, 4041, 4791], 'production.': [2958], 'studies,': [2962, 4146], 'immunofluorescence': [2963], 'diffusely': [2977], 'distributed': [2978], 'cytoplasm': [2981], 'nucleus': [2983, 4493], 'A).': [2986, 3857, 4279], 'Treatment': [2987, 3009], 'rapid': [2992, 3015], 'accumulation': [2994], 'almost': [2999], 'completely': [3000, 3073, 4056], '2,': [3006, 3019], 'B': [3007], 'andC).': [3008], 'D': [3020], 'E).': [3022], 'Similar': [3023], 'HeLa': [3034], '(data': [3036, 4135], 'Taken': [3039, 4569], 'together,': [3040, 4570], 'addition': [3047], 'blocking': [3050, 4947, 5180], 'respect': [3062, 3257], 'Despite': [3067], 'DHT-stimulated': [3075, 3851, 3880, 3981, 4042, 4820, 4866], 'transactivation': [3077, 3156], 'detectable': [3081, 3428, 3614, 4087], 'multistep': [3120], 'process': [3121], 'involving': [3122], 'interaction': [3126, 3464, 3483, 3615, 3626, 3773, 4594, 4740, 4767], 'termini,': [3133], 'proteins.': [3138], 'independent': [3147], 'latter': [3150, 3771], 'protein-protein': [3151], 'interactions,': [3152], 'heterologous': [3154], 'terminus': [3163, 4536, 4613, 4661, 4726], 'AR.': [3166, 4568], '(2–919)': [3169, 3198], 'absence': [3176, 3621, 3867], 'stimulated': [3183, 3273, 3441, 3486, 3630, 4062, 4097, 4238], '(Fig.3': [3186, 3432], 'A,': [3187, 3202, 4050], 'left': [3188, 3634, 3999], 'panel).': [3189, 3204, 3635], 'Bicalutamide': [3190], 'induced': [3192], 'substantial': [3193, 4080, 4930], '3': [3201], 'right': [3203], 'Importantly,': [3205, 4896, 5186], 'maximal': [3206], 'seen': [3209], 'micromolar': [3212], 'concentration': [3213], 'range,': [3214], 'well': [3215], 'within': [3216], '(31Cockshott': [3226], 'I.D.': [3227], 'Cooper': [3228], 'K.J.': [3229], 'Sweetmore': [3230], 'D.S.': [3231], 'Blacklock': [3232], 'N.J.': [3233, 3666], 'Denis': [3234], 'Eur.': [3236], '18:': [3239], '10-17Crossref': [3240], '(52)': [3243], 'stimulating': [3259], 'DNA.': [3263, 5144], 'endogenous': [3278, 4510], 'androgen-regulated': [3279], 'gene.': [3280], 'DU145': [3283, 3417], '(AR-negative)': [3284], '(−4270': [3312], '−4045': [3314], 'start': [3317], 'site),': [3318], 'contains': [3320], 'ARE': [3323], 'multiple': [3328], 'AREs': [3330, 4502], 'Immunoprecipitates': [3403], 'irrelevant': [3406], '(anti-platelet-derived': [3408], 'receptor)': [3411], 'immunoprecipitates': [3414], 'little': [3425], 'B).': [3433, 3897, 4111, 4308], 'treatments': [3440], 'supporting': [3448], 'conclusion': [3450], 'AREs.': [3457], 'ligand-dependent': [3463, 3655, 3744], 'made': [3472], 'contribution': [3475], '(32Wong': [3494], 'C.I.': [3495, 3541], 'Zhou': [3496, 3516], 'Z.X.': [3497, 3517], '268:': [3506], '19004-19012Abstract': [3507], '33Langley': [3514], '29983-29990Abstract': [3525], '(235)': [3533], '34Kemppainen': [3536], 'Langley': [3538], 'Wong': [3540], 'Bobseine': [3542], '13:': [3551], '440-454Crossref': [3552], '(0)': [3555], 'mammalian': [3559], 'two-hybrid': [3560], 'interaction.': [3574, 3643], 'encoding': [3580], '(2–505)': [3582], 'Gal4-AR': [3584], '(661–919)': [3585], '(corresponding': [3588], 'domains,': [3596], 'respectively)': [3597], 'conjunction': [3599, 4139, 4919, 5197], 'regulated': [3605], 'Gal4-responsive': [3608], '(pG5-Luc).': [3610], 'There': [3611], 'ligand,': [3623], '(Fig.4,': [3633], 'receptors': [3650], 'proteins,': [3659, 4962], 'SRC-1': [3662, 3841, 3848, 3859, 3916, 3978, 4015, 4028, 4118, 4151, 4549, 4649, 4667, 4729, 4739, 4774, 4788, 4798, 4827, 4847, 4878], '-2': [3664, 4551, 4800, 4880], '(35McKenna': [3665], 'Lanz': [3667], 'R.B.': [3668], '20:': [3674], '321-344Crossref': [3675], '(1655)': [3678], 'Scholar),': [3680], 'coactivators': [3686, 4883], 'reported': [3689, 4483], '(36Gregory': [3693], 'C.W.,': [3694], 'He,': [3695], 'R.T.': [3698], 'Ford': [3699], 'O.H.': [3700], 'Mohler': [3701], 'J.L.': [3702], '61:': [3710], '4315-4319PubMed': [3711], 'Scholar,37Fujimoto': [3713], 'Mizokami': [3715], 'Harada': [3717], 'Matsumoto': [3719], 'Urology.': [3721], '58:': [3723], '289-294Abstract': [3724], '(107)': [3732], 'leucine-X-X-leucine-leucine': [3739], '(LXXLL)': [3740], 'motifs': [3741, 4665], 'mediate': [3743], 'contain': [3752], 'distinct': [3754], 'site': [3755, 4721, 4750], 'binds': [3757, 4578], 'N-terminal,': [3760], 'primarily': [3768, 4154, 4655], '(38Onate': [3774], 'Boonyaratanakornkit': [3776], 'V.': [3777], 'Spencer': [3778], 'T.E.': [3779], 'Edwards': [3784], 'D.P.': [3785], '273:': [3792], '12101-12108Abstract': [3793], '(347)': [3801], '39Alen': [3804], 'Claessens': [3806, 4679, 4702], 'F.': [3807, 4680, 4703], 'Verhoeven': [3808, 4681], 'Rombauts': [3810, 4683], 'Peeters': [3812, 4685], 'Cell.': [3815, 4688, 4709, 4991, 5028], '19:': [3818, 4691, 4712], '6085-6097Crossref': [3819, 4692], '(217)': [3822, 4695], 'interact': [3832, 4564], 'SRC-1,': [3834], 'cotransfected': [3837], 'vectors.': [3843], 'reports,': [3847], 'augment': [3850], 'SRC-2': [3876, 3918, 4095], '(although': [3883], 'more': [3887, 4202, 4495, 5201], 'modest)': [3888], 'ligand-independent': [3891], 'bicalutamide-mediated': [3893], 'associate': [3908], 'coactivators,': [3911], 'overexpression': [3919, 4029], 'AR,': [3942, 4811, 5095], 'castrated': [3943], 'males': [3944], 'produce': [3946], 'experiments': [3959], 'addressed': [3960], 'lower': [3969, 4007, 4084], 'DHT.': [3972, 4022, 4066], 'Dose': [3973], 'over': [3984], 'broad': [3986], 'range': [3987], '5,': [3992], 'D).': [3995], 'marked': [3998], 'shift': [4000], 'dose': [4003, 4113, 4144, 4854], 'curve': [4005], 'observed,': [4012], 'suggesting': [4013], 'increase': [4018, 4837], 'affinity': [4020, 4840], 'It': [4023], 'next': [4025], 'determined': [4026], 'diminished': [4030], 'ability': [4032, 4168], 'vivo,': [4039], 'As': [4046], 'Fig.6': [4049], 'SRC-1-transfected': [4069], 'μmbicalutamide': [4078], 'Cotransfection': [4093], '1–5': [4107], '(Fig.6': [4110], 'Further': [4112], 'alter': [4123, 4852], 'IC50': [4125, 4861], 'above': [4142, 4183], 'functioning': [4153], 'augmenting': [4156], 'agonist-bound': [4161], 'rather': [4163], 'than': [4164], 'decreasing': [4166], 'compete': [4172], 'binding.': [4177], 'prediction': [4179], 'based': [4180], 'overexpressing': [4190], 'higher': [4196, 4255, 4360, 4812], 'doses': [4197], 'potent': [4203, 5202], 'Such': [4206], 'AR-expressing': [4207], 'derived': [4210], 'available,': [4216], 'features': [4225], 'particular,': [4230], 'proliferation': [4233], 'DHT,': [4240, 4318], 'they': [4241], 'only': [4243], 'partially': [4244], '5–10': [4249], 'μm.': [4250], 'assessed.': [4262], 'progressively': [4270, 4297], 'up': [4274, 4302], '(Fig.7': [4278], 'Inhibition': [4280], 'assessed': [4286], 'percentage': [4289], 'S': [4293], 'phase': [4294], '40–80': [4304], '7': [4307, 4337], 'abrogated': [4315], 'reflected': [4323], 'nonspecific': [4328], 'toxicity': [4329], 'due': [4330], 'C).': [4338], 'remained': [4348], 'even': [4350], 'antagonized': [4358], 'drug.': [4364], 'reports': [4366, 4952], 'functioned': [4371], 'preventing': [4377, 5128], '20Brinkmann': [4432], '21Veldscholte': [4460], 'here': [4484], 'localizes': [4490], 'and,': [4494], 'importantly,': [4496], 'it': [4498], 'bind': [4500, 4670, 4959], 'episomal': [4504], 'promoter.': [4512], 'inactive.': [4519], 'lack': [4523, 4588, 4737], 'C-terminal': [4539, 4593, 4766], 'domain.': [4542], 'cotransfection': [4544], 'conformation.': [4586], 'N-': [4591, 4764], 'surprising': [4601], 'LXXLL-like': [4608], 'motif': [4609], 'dependent': [4616], 'conformation': [4620], '(40He': [4626], 'Kemppainen': [4628], '275:': [4636], '22986-22994Abstract': [4637], '(364)': [4645], 'exclusively': [4657], 'through': [4658], 'LXXLL': [4664], '(39Alen': [4677], '41Bevan': [4698], 'C.L.': [4699], 'Hoare': [4700], 'Heery': [4704], 'Parker': [4706], 'M.G.': [4707], '8383-8392Crossref': [4713], '(334)': [4716], 'precise': [4720], 'mediates': [4728], 'identified,': [4734], 'indicates': [4745], 'affected': [4753], 'possibly': [4757], 'reflecting': [4758], 'positioning': [4769], 'exposing': [4771], 'site.': [4776], 'Alternatively,': [4777], 'corepressor': [4781, 4961, 4965, 4969, 5048], 'its': [4792], 'functions': [4794, 5104], '(see': [4795], 'below).': [4796], 'needed': [4817], '-2.': [4829], 'appear': [4833, 5085], 'reflect': [4835], 'apparent': [4860], 'straightforward': [4871], 'explanation': [4872], 'rate-limiting': [4882], 'small': [4891], 'fraction': [4892], 'DHT-liganded': [4894], 'ARs.': [4895], 'enhancement': [4898], 'relevant': [4901], '(castration': [4911], 'luteinizing': [4913], 'releasing': [4915], 'agonist)': [4917], 'setting,': [4924], 'there': [4927], 'circulating': [4933], 'would': [4940, 5043], 'diminish': [4941], 'efficacy': [4943, 5176, 5207], 'Recent': [4951], '(NCoR),': [4966], '(42Yu': [4982], 'X.,': [4983], 'Li,': [4984], 'Roeder': [4986], 'R.G.': [4987], 'Wang': [4988], '21:': [4994], '4614-4625Crossref': [4995], '(91)': [4998], '43Cheng,': [5001], 'S.,': [5002, 5004], 'Brzostek,': [5003], 'Lee,': [5005], 'R.,': [5007], 'Hollenberg,': [5008], 'N.,': [5010], 'Balk,': [5012], '(2002)': [5015], 'Endocrinol.,': [5017], 'pressGoogle': [5019], '44Shang': [5021], 'Myers': [5023], '2002;': [5029], '601-610Abstract': [5031], '(563)': [5039], 'suggest': [5044, 5060, 5159], 'down-regulation': [5045], 'development': [5053], 'function': [5064, 5091, 5122], 'modulator.': [5069], 'contrast': [5072], 'estrogen': [5076], 'modulators': [5078], 'tamoxifen': [5079], 'raloxifene,': [5081], 'does': [5083, 5120], 'activate': [5087], '(AF-1)': [5092], 'types': [5098], 'tissues': [5100], 'identified.': [5112], 'summary,': [5114], 'instead': [5134], 'continued': [5149], 'decrease': [5174], 'androgens.': [5185], 'predicts': [5189], 'antagonists)': [5204], 'We': [5211], 'thank': [5212], 'Drs.': [5213], 'kindly': [5220], 'supplying': [5221], 'reagents.': [5222]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2079039801', 'counts_by_year': [{'year': 2024, 'cited_by_count': 7}, {'year': 2023, 'cited_by_count': 8}, {'year': 2022, 'cited_by_count': 6}, {'year': 2021, 'cited_by_count': 11}, {'year': 2020, 'cited_by_count': 8}, {'year': 2019, 'cited_by_count': 9}, {'year': 2018, 'cited_by_count': 6}, {'year': 2017, 'cited_by_count': 8}, {'year': 2016, 'cited_by_count': 6}, {'year': 2015, 'cited_by_count': 12}, {'year': 2014, 'cited_by_count': 9}, {'year': 2013, 'cited_by_count': 9}, {'year': 2012, 'cited_by_count': 16}], 'updated_date': '2024-12-16T04:54:09.468706', 'created_date': '2016-06-24'}