Transmembrane Tumor Necrosis Factor (TNF)-α Inhibits Adipocyte Differentiation by Selectively Activating TNF Receptor 1

Name: Work Video:
Duration: 3 min 30 s
Haiyan Xu; Jaswinder K. Sethi; Gökhan S. Hotamışlıgil
{'id': 'https://openalex.org/W2076458548', 'doi': 'https://doi.org/10.1074/jbc.274.37.26287', 'title': 'Transmembrane Tumor Necrosis Factor (TNF)-α Inhibits Adipocyte Differentiation by Selectively Activating TNF Receptor 1', 'display_name': 'Transmembrane Tumor Necrosis Factor (TNF)-α Inhibits Adipocyte Differentiation by Selectively Activating TNF Receptor 1', 'publication_year': 1999, 'publication_date': '1999-09-01', 'ids': {'openalex': 'https://openalex.org/W2076458548', 'doi': 'https://doi.org/10.1074/jbc.274.37.26287', 'mag': '2076458548', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/10473584'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.37.26287', 'pdf_url': 'http://www.jbc.org/article/S0021925819552140/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819552140/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5100608541', 'display_name': 'Haiyan Xu', 'orcid': 'https://orcid.org/0000-0003-1339-4638'}, 'institutions': [{'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Haiyan Xu', 'raw_affiliation_strings': ['Harvard School of Public Health, Division of Biological Sciences and Department of Nutrition, Boston, Massachusetts 02115, USA.'], 'affiliations': [{'raw_affiliation_string': 'Harvard School of Public Health, Division of Biological Sciences and Department of Nutrition, Boston, Massachusetts 02115, USA.', 'institution_ids': ['https://openalex.org/I136199984']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5105768948', 'display_name': 'Jaswinder K. Sethi', 'orcid': 'https://orcid.org/0000-0003-4157-0475'}, 'institutions': [{'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Jaswinder K. Sethi', 'raw_affiliation_strings': ['From the Harvard School of Public Health, Division of Biological Sciences and Department of Nutrition, Boston, Massachusetts 02115'], 'affiliations': [{'raw_affiliation_string': 'From the Harvard School of Public Health, Division of Biological Sciences and Department of Nutrition, Boston, Massachusetts 02115', 'institution_ids': ['https://openalex.org/I136199984']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5006982292', 'display_name': 'Gökhan S. Hotamışlıgil', 'orcid': 'https://orcid.org/0000-0003-2906-1897'}, 'institutions': [{'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Gökhan S. Hotamisligil', 'raw_affiliation_strings': ['From the Harvard School of Public Health, Division of Biological Sciences and Department of Nutrition, Boston, Massachusetts 02115'], 'affiliations': [{'raw_affiliation_string': 'From the Harvard School of Public Health, Division of Biological Sciences and Department of Nutrition, Boston, Massachusetts 02115', 'institution_ids': ['https://openalex.org/I136199984']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 4.323, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 144, 'citation_normalized_percentile': {'value': 0.971693, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 97, 'max': 98}, 'biblio': {'volume': '274', 'issue': '37', 'first_page': '26287', 'last_page': '26295'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10528', 'display_name': 'Adipokines, Inflammation, and Metabolic Diseases', 'score': 0.9996, 'subfield': {'id': 'https://openalex.org/subfields/2713', 'display_name': 'Epidemiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10528', 'display_name': 'Adipokines, Inflammation, and Metabolic Diseases', 'score': 0.9996, 'subfield': {'id': 'https://openalex.org/subfields/2713', 'display_name': 'Epidemiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T10371', 'display_name': 'Immune Response and Inflammation', 'score': 0.9895, 'subfield': {'id': 'https://openalex.org/subfields/2403', 'display_name': 'Immunology'}, 'field': {'id': 'https://openalex.org/fields/24', 'display_name': 'Immunology and Microbiology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11020', 'display_name': 'Immune Cell Function and Interaction', 'score': 0.9835, 'subfield': {'id': 'https://openalex.org/subfields/2403', 'display_name': 'Immunology'}, 'field': {'id': 'https://openalex.org/fields/24', 'display_name': 'Immunology and Microbiology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/cell-surface-receptor', 'display_name': 'Cell surface receptor', 'score': 0.47993332}], 'concepts': [{'id': 'https://openalex.org/C17991360', 'wikidata': 'https://www.wikidata.org/wiki/Q21173843', 'display_name': 'Tumor necrosis factor alpha', 'level': 2, 'score': 0.81183314}, {'id': 'https://openalex.org/C170493617', 'wikidata': 'https://www.wikidata.org/wiki/Q208467', 'display_name': 'Receptor', 'level': 2, 'score': 0.69125766}, {'id': 'https://openalex.org/C122927707', 'wikidata': 'https://www.wikidata.org/wiki/Q2824461', 'display_name': 'Adipogenesis', 'level': 3, 'score': 0.6650969}, {'id': 'https://openalex.org/C24530287', 'wikidata': 'https://www.wikidata.org/wiki/Q424204', 'display_name': 'Transmembrane protein', 'level': 3, 'score': 0.64986145}, {'id': 'https://openalex.org/C2776175234', 'wikidata': 'https://www.wikidata.org/wiki/Q357519', 'display_name': 'Adipocyte', 'level': 3, 'score': 0.5910252}, {'id': 'https://openalex.org/C2778690821', 'wikidata': 'https://www.wikidata.org/wiki/Q212354', 'display_name': 'Cytokine', 'level': 2, 'score': 0.5574068}, {'id': 'https://openalex.org/C171089720', 'wikidata': 'https://www.wikidata.org/wiki/Q193583', 'display_name': 'Adipose tissue', 'level': 2, 'score': 0.51611435}, {'id': 'https://openalex.org/C81885089', 'wikidata': 'https://www.wikidata.org/wiki/Q189082', 'display_name': 'Cell culture', 'level': 2, 'score': 0.5108432}, {'id': 'https://openalex.org/C134018914', 'wikidata': 'https://www.wikidata.org/wiki/Q162606', 'display_name': 'Endocrinology', 'level': 1, 'score': 0.4955088}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.48139787}, {'id': 'https://openalex.org/C197462201', 'wikidata': 'https://www.wikidata.org/wiki/Q2476074', 'display_name': 'Cell surface receptor', 'level': 3, 'score': 0.47993332}, {'id': 'https://openalex.org/C126322002', 'wikidata': 'https://www.wikidata.org/wiki/Q11180', 'display_name': 'Internal medicine', 'level': 1, 'score': 0.46454573}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.42959017}, {'id': 'https://openalex.org/C1491633281', 'wikidata': 'https://www.wikidata.org/wiki/Q7868', 'display_name': 'Cell', 'level': 2, 'score': 0.4150116}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.33627295}, {'id': 'https://openalex.org/C71924100', 'wikidata': 'https://www.wikidata.org/wiki/Q11190', 'display_name': 'Medicine', 'level': 0, 'score': 0.23237649}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.19570136}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.07086152}], 'mesh': [{'descriptor_ui': 'D017667', 'descriptor_name': 'Adipocytes', 'qualifier_ui': 'Q000166', 'qualifier_name': 'cytology', 'is_major_topic': True}, {'descriptor_ui': 'D002454', 'descriptor_name': 'Cell Differentiation', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D018124', 'descriptor_name': 'Receptors, Tumor Necrosis Factor', 'qualifier_ui': 'Q000819', 'qualifier_name': 'agonists', 'is_major_topic': True}, {'descriptor_ui': 'D014409', 'descriptor_name': 'Tumor Necrosis Factor-alpha', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D017667', 'descriptor_name': 'Adipocytes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015703', 'descriptor_name': 'Antigens, CD', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001483', 'descriptor_name': 'Base Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002454', 'descriptor_name': 'Cell Differentiation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002478', 'descriptor_name': 'Cells, Cultured', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017931', 'descriptor_name': 'DNA Primers', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051379', 'descriptor_name': 'Mice', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018124', 'descriptor_name': 'Receptors, Tumor Necrosis Factor', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D047888', 'descriptor_name': 'Receptors, Tumor Necrosis Factor, Type I', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014409', 'descriptor_name': 'Tumor Necrosis Factor-alpha', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.37.26287', 'pdf_url': 'http://www.jbc.org/article/S0021925819552140/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/10473584', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.37.26287', 'pdf_url': 'http://www.jbc.org/article/S0021925819552140/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'display_name': 'Good health and well-being', 'id': 'https://metadata.un.org/sdg/3', 'score': 0.43}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 51, 'referenced_works': ['https://openalex.org/W1521975179', 'https://openalex.org/W1555113073', 'https://openalex.org/W1764140709', 'https://openalex.org/W1904335787', 'https://openalex.org/W1971762417', 'https://openalex.org/W1974033843', 'https://openalex.org/W1978979241', 'https://openalex.org/W1979709754', 'https://openalex.org/W1982995422', 'https://openalex.org/W1985412384', 'https://openalex.org/W1994212260', 'https://openalex.org/W1996083519', 'https://openalex.org/W2006659499', 'https://openalex.org/W2014458095', 'https://openalex.org/W2015032393', 'https://openalex.org/W2022801078', 'https://openalex.org/W2022930571', 'https://openalex.org/W2023687907', 'https://openalex.org/W2025001072', 'https://openalex.org/W2025700635', 'https://openalex.org/W2026596659', 'https://openalex.org/W2031442174', 'https://openalex.org/W2035238675', 'https://openalex.org/W2036842448', 'https://openalex.org/W2041130899', 'https://openalex.org/W2053200285', 'https://openalex.org/W2054704603', 'https://openalex.org/W2056732254', 'https://openalex.org/W2065271302', 'https://openalex.org/W2065697164', 'https://openalex.org/W2066160102', 'https://openalex.org/W2067024450', 'https://openalex.org/W2067057146', 'https://openalex.org/W2070476305', 'https://openalex.org/W2080094558', 'https://openalex.org/W2085486418', 'https://openalex.org/W2086255604', 'https://openalex.org/W2091759162', 'https://openalex.org/W2093871599', 'https://openalex.org/W2098542111', 'https://openalex.org/W2119920165', 'https://openalex.org/W2120282627', 'https://openalex.org/W2120897861', 'https://openalex.org/W2129316761', 'https://openalex.org/W2143950659', 'https://openalex.org/W2146735845', 'https://openalex.org/W2150571795', 'https://openalex.org/W2170436510', 'https://openalex.org/W2174322658', 'https://openalex.org/W2176176727', 'https://openalex.org/W4237567990'], 'related_works': ['https://openalex.org/W3217615580', 'https://openalex.org/W3145437501', 'https://openalex.org/W2921972886', 'https://openalex.org/W2908320623', 'https://openalex.org/W2626142573', 'https://openalex.org/W2116726599', 'https://openalex.org/W2113286739', 'https://openalex.org/W2084245009', 'https://openalex.org/W2045047231', 'https://openalex.org/W184720341'], 'abstract_inverted_index': {'Tumor': [0, 238], 'necrosis': [1, 239, 477, 482, 489, 518, 524], 'factor': [2, 240, 478, 483, 490, 525], 'α': [3, 241, 479, 484, 491, 526], '(TNFα)': [4, 242], 'is': [5, 25, 45, 199, 243, 263, 283, 437, 569, 616, 625, 693, 807, 1208, 1226, 1395, 1588, 1605, 2025, 2037, 2153, 3870, 3998, 4077, 4116, 4134, 4270, 4298], 'a': [6, 20, 26, 244, 258, 264, 498, 515, 534, 687, 800, 1072, 1589, 1608, 1994, 2052, 2342, 2376, 2526, 2620, 2663, 3186, 3250, 3273, 3282, 3305, 3402, 3430, 3557, 3574, 3600, 3665, 3694, 3721, 3821, 3845, 4021, 4058, 4068, 4109, 4135, 4179], 'potent': [7, 245], 'cytokine': [8, 246], 'with': [9, 247, 1917, 2187, 2223, 2254, 2292, 2341, 2358, 2525, 2721, 2885, 3026, 3106, 3214, 3265, 3288, 3445, 3507, 3541, 3546, 3587, 3592, 3603, 3614, 3617, 3621, 3664, 4079, 4118, 4183, 4301], 'multiple': [10, 248], 'biological': [11, 249, 538, 1029, 1068], 'activities': [12, 59, 250, 297, 539], 'and': [13, 111, 173, 181, 205, 251, 349, 411, 419, 443, 586, 622, 631, 811, 823, 1034, 1047, 1187, 1195, 1213, 1373, 1471, 1525, 1533, 1629, 1713, 2068, 2088, 2101, 2123, 2141, 2160, 2175, 2208, 2231, 2239, 2303, 2336, 2389, 2508, 2546, 2575, 2610, 2614, 2631, 2660, 2710, 2714, 2731, 2775, 2799, 2858, 2862, 2950, 2978, 3031, 3115, 3163, 3234, 3291, 3316, 3336, 3346, 3369, 3436, 3453, 3485, 3516, 3543, 3570, 3589, 3619, 3696, 3738, 3765, 3780, 3787, 3850, 3923, 3953, 3972, 4016, 4033, 4192, 4357], 'exists': [14, 252, 681], 'in': [15, 63, 75, 96, 129, 149, 159, 202, 253, 301, 313, 334, 367, 387, 397, 440, 572, 628, 682, 892, 983, 997, 1001, 1009, 1055, 1122, 1189, 1230, 1334, 1404, 1456, 1539, 1595, 1602, 1607, 1631, 1687, 1773, 1912, 1948, 1954, 1998, 2107, 2157, 2190, 2244, 2264, 2268, 2289, 2320, 2477, 2583, 2619, 2809, 2902, 3298, 3329, 3356, 3499, 3523, 3530, 3563, 3714, 3728, 3746, 3773, 3783, 3844, 3865, 3895, 3915, 3935, 3958, 3995, 4030, 4041, 4108, 4167, 4205, 4241, 4267, 4294, 4325], 'two': [16, 254, 683, 955, 1040, 1059, 1117, 4195], 'forms': [17, 255, 684, 957], 'as': [18, 235, 256, 473, 514, 579, 685, 897, 1333, 1770, 1772, 2045, 2679, 2746, 3458, 3633, 3701, 4020, 4121, 4178, 4219, 4252, 4304], 'follows:': [19, 257, 686], '17-kDa': [21, 259, 688], 'soluble': [22, 190, 260, 428, 689, 2327], 'form': [23, 33, 42, 69, 261, 271, 280, 307, 690, 3724, 3753], 'that': [24, 39, 169, 182, 188, 197, 262, 277, 407, 420, 426, 435, 692, 805, 968, 1063, 1223, 1281, 1328, 1586, 2028, 2150, 2161, 3976, 4103], 'cleaved': [27, 265, 694, 4334], 'product': [28, 266, 2874, 2965], 'of': [29, 43, 60, 70, 93, 98, 104, 113, 179, 189, 211, 267, 281, 298, 308, 331, 336, 342, 351, 417, 427, 449, 517, 519, 537, 575, 792, 813, 948, 954, 958, 979, 987, 1031, 1053, 1058, 1075, 1185, 1193, 1337, 1401, 1458, 1469, 1473, 1507, 1529, 1592, 1600, 1610, 1838, 1848, 1943, 1951, 1993, 2004, 2042, 2056, 2063, 2081, 2167, 2227, 2271, 2378, 2462, 2480, 2520, 2634, 2647, 2666, 2742, 2748, 2759, 2786, 2871, 2910, 2939, 3022, 3039, 3067, 3127, 3166, 3171, 3252, 3276, 3307, 3340, 3366, 3573, 3678, 3711, 3725, 3754, 3777, 3834, 3848, 3855, 3886, 3908, 3926, 3956, 3980, 3989, 4012, 4018, 4036, 4045, 4057, 4075, 4091, 4094, 4126, 4215, 4263, 4275, 4287, 4344, 4365, 4379], 'the': [30, 40, 58, 99, 109, 114, 147, 150, 160, 208, 268, 278, 296, 337, 347, 352, 385, 388, 398, 446, 573, 696, 702, 790, 909, 946, 966, 977, 1191, 1196, 1211, 1291, 1335, 1399, 1505, 1527, 2040, 2061, 2079, 2090, 2164, 2191, 2195, 2224, 2234, 2265, 2269, 2339, 2350, 2478, 2518, 2547, 2571, 2728, 2756, 2776, 2787, 2865, 2872, 2906, 2911, 2917, 2985, 3034, 3040, 3046, 3118, 3128, 3134, 3154, 3161, 3167, 3172, 3179, 3215, 3321, 3377, 3708, 3735, 3739, 3774, 3828, 3852, 3873, 3921, 3927, 3978, 3987, 4010, 4055, 4124, 4184, 4206, 4264, 4276, 4329, 4363], '26-kDa': [31, 269, 697, 4187], 'transmembrane': [32, 41, 61, 68, 270, 279, 299, 306, 487, 698, 1224, 1282, 1402, 2082, 2151, 3712, 3723], '(mTNFα).': [34, 272], 'It': [35, 273, 568, 680, 1461, 2024], 'has': [36, 274, 528, 795, 889, 990, 1078, 1200, 1462, 1680, 3757], 'been': [37, 275, 530, 796, 890, 991, 1079, 1201, 1681, 3758, 4202], 'suggested': [38, 276], 'TNFα': [44, 62, 71, 225, 282, 300, 309, 463, 501, 615, 950, 959, 1225, 1283, 1451, 1587, 1601, 1679, 1849, 1997, 2035, 2083, 2152, 2328, 2791, 3713, 3727, 3755, 3779, 3860, 4062, 4353], 'mainly': [46, 284], 'responsible': [47, 120, 285, 358, 2093], 'for': [48, 121, 175, 286, 359, 413, 1996, 2094, 2127, 2145, 2205, 2210, 2233, 2308, 2316, 2362, 2366, 2514, 2543, 2566, 2641, 2677, 2726, 2734, 2772, 2782, 3314, 3441, 3491, 3698, 4308], 'localized': [49, 287, 949, 2038], 'responses': [50, 288, 794, 816, 826, 996, 1077], 'via': [51, 289], 'cell-cell': [52, 290], 'contact.': [53, 291], 'Here,': [54, 292], 'we': [55, 293, 2076, 3717, 3819, 4087, 4321], 'have': [56, 220, 294, 458, 533, 803, 1221, 1279, 1322, 2077, 3718, 4201], 'examined': [57, 295, 2078, 4323], 'cultured': [64, 203, 302, 441, 1688, 2085, 2158, 3715], 'adipocytes.': [65, 303, 2216], 'A': [66, 304], 'non-cleavable': [67, 305, 499, 3722, 3752, 3829, 4265], '(mTNFΔ1–9K11E)': [72, 310, 2792, 3756], 'was': [73, 124, 171, 185, 311, 362, 409, 423, 2229, 2373, 2400, 2410, 2424, 2439, 2453, 2552, 2556, 2654, 2675, 2744, 2780, 2793, 2849, 2875, 2882, 2900, 2941, 2966, 2974, 3024, 3070, 3104, 3175, 3232, 3327, 3489, 3554, 3662, 3691, 3862, 3940, 4024, 4105, 4164, 4176, 4249, 4292], 'expressed': [74, 312, 627, 3720, 4177], 'several': [76, 314, 576, 1508, 3729], 'preadipocyte': [77, 130, 315, 368, 2103, 3730, 3742, 3899], 'cell': [78, 131, 161, 316, 369, 399, 633, 703, 821, 972, 981, 1011, 1715, 2104, 2178, 2201, 2221, 2531, 2658, 3189, 3731, 3743, 3900, 3917, 4243, 4247], 'lines': [79, 132, 162, 317, 370, 400, 2105, 2179, 2202, 3744, 3901, 4248], 'using': [80, 318, 2098, 2194, 2702, 2954, 3481, 3682], 'retroviral': [81, 319, 2912, 3041, 3129, 3822], 'gene': [82, 320, 2921, 3049, 3137, 3670], 'transfer.': [83, 321], 'In': [84, 143, 192, 322, 381, 430, 985, 1204, 1500, 2073, 3816, 4189], 'wild': [85, 323, 485, 510, 4185], 'type': [86, 324, 486, 511, 4186], 'preadipocytes': [87, 325, 2241], 'carrying': [88, 326], 'both': [89, 327, 1010, 1032, 1287, 1329, 3909, 4027, 4190], 'TNF': [90, 118, 135, 154, 328, 356, 373, 392, 492, 1042, 1060, 1403, 1944, 2091, 2398, 2673, 3577, 3910, 3929], 'receptors,': [91, 329], 'expression': [92, 330, 1506, 1598, 3155, 3180, 3364, 3657, 3823, 3843, 3888, 3983, 3994, 4015, 4044, 4261], 'mTNFΔ1–9K11E': [94, 128, 198, 332, 366, 436, 2897, 3656, 3887, 3939, 3957, 3985, 4019, 4046, 4104, 4174, 4191, 4290, 4330], 'resulted': [95, 333], 'inhibition': [97, 178, 335, 416, 1472], 'differentiation': [100, 338, 2165, 2228, 2743], 'program.': [101, 339], 'The': [102, 117, 340, 355, 952, 1028, 1051, 1183, 1597, 2394, 2406, 2418, 2433, 2447, 2554, 2579, 2622, 2669, 2740, 2784, 2846, 2869, 2879, 2894, 2937, 2960, 3019, 3065, 3101, 3655, 3688, 3751, 3858, 3931, 4072, 4173, 4259], 'extent': [103, 341], 'this': [105, 122, 183, 343, 360, 421, 1911, 2074, 3817, 4085, 4168], 'varied': [106, 344], 'depending': [107, 345, 1289], 'on': [108, 346, 971, 1290, 1465, 1835, 2065, 2084, 2286, 2984, 3401, 3497, 4048], 'nature': [110, 348], 'strength': [112, 350], 'adipogenic': [115, 209, 353, 447, 2306], 'stimuli.': [116, 354], 'receptor': [119, 136, 357, 374, 493, 496, 2092, 2709, 4163], 'function': [123, 361, 1850], 'determined': [125, 363, 2089, 3692, 3914, 4025, 4253], 'by': [126, 214, 364, 452, 619, 705, 1039, 1088, 1216, 2097, 2169, 2314, 2426, 2441, 2455, 2755, 2795, 2851, 2877, 2891, 2943, 2976, 2980, 3110, 3122, 3177, 3480, 3556, 3672, 3693, 3703, 3760, 3877, 3891, 3984, 4009, 4026, 4054, 4067, 4123, 4254, 4280, 4284, 4306], 'expressing': [127, 365, 3938, 3945], 'lacking': [133, 163, 371, 401], 'either': [134, 372, 2356, 3977], '1': [137, 375, 2383, 2392, 2515, 2667, 3344, 3347, 3442, 3513, 3882, 3903, 3949, 3968, 4097, 4129, 4316, 4371], '(TNFR1),': [138, 376], '2': [139, 377, 2347, 2493, 2499, 2505, 2567, 2602, 2608, 3253, 3544, 3590], '(TNFR2),': [140, 378], 'or': [141, 379, 2011, 2364, 3659, 3749, 3991], 'both.': [142, 380], 'order': [144, 382], 'to': [145, 187, 229, 383, 425, 467, 532, 798, 906, 993, 1081, 1228, 1326, 1397, 1683, 1938, 2007, 2039, 2213, 2301, 2305, 2310, 2569, 2662, 2737, 3159, 3293, 3295, 3361, 3376, 3429, 3771, 3825, 3919, 4212, 4272, 4338], 'confirm': [146, 384, 3160, 4084], 'results': [148, 195, 386, 433, 1947], 'same': [151, 389, 2266], 'cellular': [152, 390, 1076, 1292, 4037, 4092], 'background,': [153, 391], 'receptors': [155, 393, 1061, 1118, 1288, 1330, 3911], 'were': [156, 394, 904, 1331, 2180, 2203, 2242, 2262, 2278, 2299, 2332, 2354, 2472, 2533, 2581, 2629, 2639, 2700, 2719, 2770, 3157, 3247, 3263, 3286, 3302, 3319, 3354, 3373, 3399, 3427, 3456, 3478, 3495, 3521, 3537, 3582, 3610, 3628, 3889, 3912, 4007], 'also': [157, 395, 570, 626, 808, 1120, 1630, 1946, 3841, 3913, 4165, 4250, 4322], 'reconstituted': [158, 396], 'corresponding': [164, 402, 2192, 3317], 'receptors.': [165, 403, 3930], 'These': [166, 404, 1116, 2147, 3733, 4209], 'experiments': [167, 405, 2340, 3360], 'demonstrated': [168, 406, 1222, 1585, 1841, 3890], 'TNFR1': [170, 408, 1044, 1186, 2940, 3023, 4004], 'necessary': [172, 410], 'sufficient': [174, 412, 1396], 'mediating': [176, 414, 814, 1190], 'mTNFΔ1–9K11E-induced': [177, 415], 'adipogenesis': [180, 418], 'action': [184, 422, 1475, 1686, 2036], 'similar': [186, 424, 815, 1007, 4251], 'TNFα.': [191, 429], 'conclusion,': [193, 431], 'our': [194, 432, 2108, 4268, 4326], 'indicate': [196, 434], 'biologically': [200, 438, 809, 2155], 'active': [201, 439, 810, 1537, 2156], 'adipocytes': [204, 442, 636, 1689, 2087, 2159, 2168, 2468, 4095], 'can': [206, 444, 1005, 1036, 1065, 1119, 1284, 1503], 'alter': [207, 445], 'program': [210, 448, 2166], 'these': [212, 450, 3996], 'cells': [213, 451, 630, 2261, 2277, 2749, 3231, 3246, 3262, 3285, 3353, 3520, 3536, 3609, 3737, 3789, 3849, 3867, 3937, 3960, 3997, 4032, 4050, 4359, 4369], 'selectively': [215, 453, 2170], 'activating': [216, 454, 1231, 2171], 'TNFR1.': [217, 455, 2172], 'This': [218, 456, 3553, 3839, 3974, 4114, 4296], 'may': [219, 457, 975, 2050], 'physiological': [221, 459], 'implications': [222, 460], 'where': [223, 461, 900, 2034], 'local': [224, 462, 2058], 'actions': [226, 464, 978, 1192], 'are': [227, 465, 1086, 4210], 'thought': [228, 466], 'be': [230, 468, 907, 1037, 2008, 2031, 2051, 4052, 4213, 4273, 4332], 'generated': [231, 469, 3759], 'at': [232, 470, 701, 2280, 2334, 2349, 2375, 2382, 2386, 2391, 2517, 2535, 2559, 2616, 3249, 3304, 3438, 3560, 4000, 4335], 'sites': [233, 471, 4218, 4337], 'such': [234, 472, 578, 896, 2044, 2057], 'adipose': [236, 474, 1603, 2046], 'tissue.': [237, 475, 2047], 'tumor': [476, 481, 488, 521, 523], 'secreted': [480], 'peroxisome': [494], 'proliferator-activated': [495], 'γ': [497], 'murine': [500, 2326, 2789, 3068, 3726], 'mutant': [502, 3830, 4266], "Dulbecco's": [503, 2245], 'modified': [504, 2246, 3508], "Eagle's": [505, 2247], 'medium': [506, 2248, 2267, 2321, 2651], 'phosphate-buffered': [507, 3509], 'saline': [508, 3510], 'lipopolysaccharide': [509], 'Originally': [512], 'identified': [513, 3864], 'mediator': [516, 1591, 2055], 'certain': [520], 'cells,': [522, 3185, 4194], '(TNFα)1': [527], 'now': [529], 'shown': [531, 804, 1682, 4040], 'wide': [535], 'array': [536, 1074], '(1Beutler': [540, 589, 637], 'B.': [541, 590, 638, 838, 864, 1244, 1297, 1724, 1742, 1748, 2823, 3793], 'Cerami': [542, 591, 639], 'A.': [543, 592, 640, 927, 1142, 1355, 1546, 1704, 1726, 1750, 1756, 1821, 2993, 3010, 3205, 4146, 4148], 'Annu.': [544, 593, 641], 'Rev.': [545, 594, 642], 'Immunol.': [546, 595, 643, 936, 1022, 1094, 1151, 1364, 1383, 1441], '1989;': [547, 596, 644], '7:': [548, 597, 645], '625-655Crossref': [549, 598, 646], 'PubMed': [550, 563, 599, 612, 647, 660, 675, 762, 784, 856, 882, 940, 1102, 1155, 1178, 1262, 1315, 1368, 1387, 1445, 1484, 1497, 1520, 1557, 1578, 1624, 1650, 1673, 1708, 1736, 1765, 1786, 1809, 1830, 1863, 1888, 1901, 1932, 1966, 1987, 2021, 2694, 2841, 2932, 3014, 3060, 3096, 3148, 3209, 3391, 3419, 3471, 3650, 3811, 4157, 4232, 4403], 'Scopus': [551, 564, 600, 648, 661, 676, 763, 785, 857, 883, 941, 1103, 1156, 1179, 1263, 1316, 1369, 1388, 1446, 1485, 1521, 1558, 1579, 1625, 1651, 1674, 1709, 1766, 1787, 1810, 1864, 1933, 1967, 2695, 2842, 2933, 3015, 3061, 3097, 3149, 3210, 3392, 3420, 3472, 3651, 3812, 4158, 4233, 4404], '(1494)': [552, 601, 649], 'Google': [553, 566, 602, 613, 650, 663, 678, 765, 787, 859, 885, 943, 1026, 1105, 1114, 1158, 1181, 1265, 1274, 1318, 1371, 1390, 1448, 1487, 1498, 1523, 1560, 1581, 1627, 1653, 1676, 1711, 1737, 1768, 1789, 1812, 1831, 1866, 1889, 1902, 1935, 1969, 1988, 2022, 2697, 2844, 2935, 3017, 3063, 3099, 3151, 3212, 3394, 3422, 3474, 3653, 3814, 4160, 4235, 4406], 'Scholar,': [554, 603, 651, 664, 766, 860, 1106, 1159, 1266, 1488, 1561, 1654, 1738, 1790, 1813, 1867, 1890, 1970, 4407], '2Grunfeld': [555, 652], 'C.': [556, 653, 770, 1421, 1423, 1477, 1779, 1792], 'Feingold': [557, 654, 1478], 'K.R.': [558, 655, 1479], 'Biotherapy.': [559, 656, 1480], '1991;': [560, 657, 1481, 3011, 3093], '3:': [561, 658, 1482], '143-158Crossref': [562, 659, 1483], '(171)': [565, 662, 1486], 'Scholar).': [567, 614, 679, 788, 886, 1027, 1115, 1182, 1275, 1319, 1449, 1499, 1582, 1677, 1832, 1936, 1989, 2023, 2698, 2845, 2936, 3018, 3064, 3100, 3152, 3395, 3423, 3475, 3654, 3815, 4161, 4236], 'implicated': [571, 891], 'pathogenesis': [574], 'diseases': [577], 'septic': [580], 'shock,': [581], 'rheumatoid': [582], 'arthritis,': [583], 'autoimmune': [584], 'disorders,': [585], 'insulin': [587, 1474, 1593, 1685, 1843, 1952, 2000, 2323, 2372, 2708], 'resistance': [588, 1594, 1953, 2920, 3048, 3136], '3Hotamisligil': [604, 1489], 'G.S.': [605, 666, 1490, 1511, 1544, 1571, 1615, 1635, 1691, 1802, 1858, 1896, 1957, 2014, 2689, 3382, 3410, 3462], 'Spiegelman': [606, 669, 1491, 1514, 1549, 1618, 1642, 1696, 1803, 1960, 2015, 3385, 3413, 3465], 'B.M.': [607, 670, 1492, 1515, 1550, 1619, 1643, 1697, 1804, 1961, 2016, 3386, 3414, 3466], 'Diabetes.': [608, 1493, 1826, 1884, 2017], '1994;': [609, 1494, 1554, 1705, 1806, 2018], '43:': [610, 1495, 2019], '1271-1278Crossref': [611, 1496, 2020], 'primarily': [617], 'produced': [618, 3876, 4279], 'activated': [620], 'macrophages': [621, 3880, 4282], 'lymphocytes': [623], 'but': [624, 999, 4360], 'endothelial': [629], 'other': [632, 1084, 1714, 4336], 'types': [634, 1012, 1716, 3918], 'including': [635, 817, 1467], '4Hotamisligil': [665], 'Shargill': [667, 1512, 1616, 1958, 3383, 3411, 3463], 'N.S.': [668, 1513, 1617, 1959, 3384, 3412, 3464], 'Science.': [671, 1516, 1620, 1962, 3387, 3415, 3467], '1993;': [672, 1517, 1621, 1730, 1963, 3206, 3388, 3416, 3468], '259:': [673, 1518, 1622, 1964, 3389, 3417, 3469], '87-91Crossref': [674, 1519, 1623, 1965, 3390, 3418, 3470], '(6088)': [677, 1522, 1626, 1968, 3393, 3421, 3473], '(sTNFα)': [691], 'from': [695, 2182, 2402, 2412, 2474, 2636, 2656, 3072, 3229, 3769, 4245, 4355, 4367], 'protein': [699, 2635, 4023, 4047, 4175, 4181, 4239, 4260, 4291, 4378], '(mTNFα)': [700], 'surface': [704], 'TNFα-converting': [706], 'enzyme': [707], '(5Moss': [708], 'M.L.': [709, 3196], 'Jin': [710], 'S.L.': [711], 'Milla': [712], 'M.E.': [713], 'Burkhart': [714], 'W.': [715, 745, 842, 870, 1248, 1303, 1434, 2827, 3799], 'Carter': [716], 'H.L.': [717], 'Chen': [718, 3000], 'W.J.': [719], 'Clay': [720], 'W.C.': [721], 'Didsbury': [722], 'J.R.': [723, 1798], 'Hassler': [724], 'D.': [725, 1417, 1548, 1974, 3077, 3198], 'Hoffman': [726], 'C.R.': [727], 'Kost': [728], 'T.A.': [729], 'Lambert': [730], 'M.H.': [731], 'Leesnitzer': [732], 'M.A.': [733], 'McCauley': [734], 'P.': [735, 848, 866, 1169, 1254, 1299, 1411, 1637, 2833, 3795, 4223], 'McGeehan': [736], 'G.': [737, 743, 844, 915, 923, 931, 1018, 1020, 1130, 1138, 1146, 1250, 1343, 1351, 1359, 1380, 1740, 1881, 2124, 2142, 2829, 4389], 'Mitchell': [738], 'J.': [739, 755, 868, 871, 935, 1021, 1109, 1150, 1172, 1269, 1301, 1304, 1363, 1382, 1440, 1551, 1572, 1644, 1667, 1727, 1759, 1869, 1926, 1978, 3639, 3644, 3797, 3800, 4151, 4227, 4392], 'Moyer': [740], 'M.': [741, 768, 828, 834, 836, 919, 933, 1108, 1134, 1148, 1163, 1234, 1240, 1242, 1268, 1347, 1361, 1378, 1415, 1658, 1744, 1873, 1879, 1982, 2119, 2137, 2813, 2819, 2821, 2989, 3643, 4387], 'Pahel': [742], 'Rocque': [744], 'Overton': [746], 'L.K.': [747], 'Schoenen': [748], 'F.': [749], 'Seaton': [750], 'T.': [751, 1426, 1871, 2116, 2134, 3081], 'Su': [752], 'J.L.': [753], 'Warner': [754], 'Becherer': [756], 'J.D.': [757], 'Nature.': [758, 1859, 2690], '1997;': [759, 937, 1023, 1152, 1175, 1365, 1384, 1442, 1575, 1827, 1860, 1885, 2691, 3647], '385:': [760], '733-736Crossref': [761], '(1476)': [764], '6Kriegler': [767], 'Ferez': [769], 'DeFay': [771], 'K.': [772, 846, 929, 1014, 1144, 1167, 1171, 1252, 1357, 1794, 1819, 1823, 1875, 1877, 2111, 2115, 2129, 2133, 2805, 2831, 3675], 'Albert': [773], 'I.': [774], 'Lu': [775], 'S.D.': [776, 2779], 'Cell.': [777, 849, 1255, 2834, 3091], '1988;': [778], '53:': [779], '45-53Abstract': [780], 'Full': [781, 853, 877, 879, 1099, 1259, 1310, 1312, 1733, 2838, 3806, 3808, 4398, 4400], 'Text': [782, 854, 878, 880, 1100, 1260, 1311, 1313, 1734, 2839, 3807, 3809, 4399, 4401], 'PDF': [783, 855, 881, 1101, 1261, 1314, 1735, 2840, 3810, 4402], '(930)': [786], 'Although': [789], 'majority': [791], 'TNFα-induced': [793], 'attributed': [797, 1080], 'sTNFα,': [799, 2648], 'few': [801], 'studies': [802, 1220, 1321, 1584, 1834, 2148], 'mTNFα': [806, 888, 969, 980, 989, 1033, 2049, 2064], 'capable': [812], 'apoptosis,': [818], 'proliferation,': [819], 'B': [820, 2919, 3334], 'activation,': [822], 'some': [824, 893], 'inflammatory': [825, 995], '(7Grell': [827, 1233, 2812], 'Douni': [829, 920, 1135, 1235, 1348, 2814], 'E.': [830, 862, 921, 1136, 1236, 1295, 1349, 1413, 1746, 2815, 3791], 'Wajant': [831, 1237, 2816], 'H.': [832, 925, 1140, 1238, 1353, 1436, 1720, 1754, 1758, 2113, 2131, 2817, 2925, 3053, 3141], 'Lohden': [833, 1239, 2818], 'Clauss': [835, 1241, 2820], 'Maxeiner': [837, 1243, 2822], 'Georgopoulos': [839, 1245, 2824], 'S.': [840, 913, 1128, 1246, 1341, 1703, 2118, 2136, 2825, 3009, 3204, 3641, 4385], 'Lesslauer': [841, 1247, 2826], 'Kollias': [843, 930, 1019, 1145, 1249, 1358, 1379, 1880, 2828], 'Pfizenmaier': [845, 928, 1143, 1170, 1251, 1356, 2830], 'Schearich': [847, 1253, 2832], '1995;': [850, 874, 1111, 1256, 1271, 1307, 1647, 1670, 2835, 3803, 4395], '83:': [851, 1257, 2836], '793-802Abstract': [852, 1258, 2837], '(1151)': [858, 1264, 2843], '8Decoster': [861], 'Vanhaesebroeck': [863, 1296, 3792], 'Vandenabeele': [865, 1298, 3794], 'Grooten': [867, 1300, 3796], 'Fiers': [869, 1302, 1433, 2802, 3798], 'Biol.': [872, 1305, 1728, 3092, 3646, 3801, 4393], 'Chem.': [873, 1306, 1729, 3802, 4394], '270:': [875, 1308, 3804, 4396], '18473-18478Abstract': [876, 1309, 3805], '(105)': [884, 1317, 3813], 'Furthermore,': [887, 965], 'disease': [894], 'states': [895], 'experimental': [898, 1338, 1405, 4327], 'hepatitis': [899, 1339], 'serum': [901, 2258, 2296, 3551, 3568, 3597], 'sTNFα': [902, 1004, 1035, 1194, 1229, 2005, 4340, 4366], 'levels': [903, 2003, 3365, 3885, 3907, 4006], 'found': [905], 'within': [908], 'normal': [910], 'range': [911], '(9Kusters': [912, 1127, 1340], 'Tiegs': [914, 1129, 1342], 'Alexopoulou': [916, 1131, 1344], 'L.': [917, 1016, 1132, 1345, 1376, 1752, 2121, 2139, 2806], 'Pasparakis': [918, 1133, 1346, 1377, 1878], 'Kunstle': [922, 1137, 1350], 'Bluethmann': [924, 1139, 1352, 1435], 'Wendel': [926, 1141, 1354], 'Grell': [932, 1147, 1162, 1360], 'Eur.': [934, 1149, 1362, 1381, 1439], '27:': [938, 1153, 1366, 1385, 1443], '2870-2875Crossref': [939, 1154, 1367], '(173)': [942, 1157, 1370], 'Scholar),': [944, 1391, 1903, 3213], 'indicating': [945], 'relevance': [947], 'responses.': [951], 'existence': [953], 'different': [956, 4246], 'makes': [960], 'its': [961, 2095, 3835], 'physiology': [962], 'more': [963, 2318], 'complicated.': [964], 'fact': [967], 'relies': [970], 'contact-dependent': [973], 'signaling': [974, 1198], 'render': [976], 'type-specific': [982], 'vivo.': [984], 'support': [986], 'this,': [988], 'reported': [992, 4221], 'trigger': [994], 'astrocytes': [998], 'not': [1000, 1909, 3962, 4171, 4257, 4349], 'neurons,': [1002], 'whereas': [1003, 1071, 1392], 'induce': [1006], 'effects': [1008, 1085, 1400, 1464, 2062, 2080, 3710], '(10Akassoglou': [1013], 'Probert': [1015], 'Kontogeorgos': [1017], '158:': [1024], '438-445PubMed': [1025], 'functions': [1030, 2096], 'signaled': [1038], 'distinct': [1041, 1067], 'receptors:': [1043], '(55': [1045], 'kDa)': [1046, 4381], 'TNFR2': [1048, 1089, 1188, 1232, 1393, 3069, 3932, 3964, 3981, 3993], '(75': [1049], 'kDa).': [1050], 'lack': [1052], 'homology': [1054], 'intracellular': [1056], 'domains': [1057], 'indicates': [1062, 3975], 'they': [1064], 'mediate': [1066, 1398], 'activities.': [1069], 'Indeed,': [1070], 'broad': [1073], 'TNFR1,': [1082, 3368, 3747, 3990], 'many': [1083, 1125], 'mediated': [1087], '(11Tartaglia': [1090], 'L.A.': [1091, 2991], 'Goeddel': [1092, 3002], 'D.V.': [1093, 3003], 'Today.': [1095], '1992;': [1096, 1783, 4154], '13:': [1097], '151-153Abstract': [1098], '(1002)': [1104], '12Grell': [1107, 1267], 'Inflammat.': [1110, 1270], '47:': [1112, 1272], '8-17PubMed': [1113, 1273], 'act': [1121], 'concert': [1123], 'under': [1124, 2764, 3630], 'circumstances': [1126], '13Lazdins': [1160], 'J.K.': [1161, 1976], 'Walker': [1164], 'M.R.': [1165], 'Woods-Cook': [1166], 'Scheurich': [1168], 'Exp.': [1173], 'Med.': [1174], '185:': [1176], '81-90Crossref': [1177], '(62)': [1180], 'role': [1184, 1455, 1995], 'downstream': [1197], 'mechanisms': [1199, 1214], 'studied': [1202], 'extensively.': [1203], 'contrast,': [1205], 'little': [1206], 'information': [1207], 'available': [1209], 'regarding': [1210], 'pathways': [1212], 'utilized': [1215], 'mTNFα.': [1217, 4188], 'Some': [1218], 'early': [1219], 'superior': [1227], 'However,': [1276, 2060], 'subsequent': [1277, 3454], 'reports': [1278], 'indicated': [1280, 2351], 'signal': [1285], 'through': [1286, 3236], 'context': [1293], '(8Decoster': [1294, 3790], 'Other': [1320], 'used': [1323, 2232, 2374, 2640, 2676, 2781, 3490, 4137], 'TNFR-deficient': [1324], 'mice': [1325, 1916], 'demonstrate': [1327, 1910, 2149, 3920], 'required': [1332], 'case': [1336], 'Scholar)': [1372, 1524, 1628, 1712, 1769], 'arthritis': [1374], '(14Alexopoulou': [1375], '2588-2592Crossref': [1386], '(122)': [1389], 'alone': [1394, 3947], 'cerebral': [1406], 'malaria': [1407], '(15Lucas': [1408], 'R.': [1409, 1664, 1718, 3079], 'Juillard': [1410], 'Decoster': [1412, 2798], 'Redard': [1414], 'Burger': [1416], 'Donati': [1418], 'Y.': [1419], 'Giroud': [1420], 'Monso-Hinard': [1422], 'De': [1424], 'Kesel': [1425], 'Buurman': [1427], 'W.A.': [1428], 'Moore': [1429], 'M.W.': [1430, 1569, 1856, 2687], 'Dayer': [1431], 'J.M.': [1432, 1660, 1825], 'Grau': [1437], 'G.E.': [1438], '1719-1725Crossref': [1444], '(164)': [1447], 'Soluble': [1450, 1678], 'plays': [1452], 'an': [1453], 'important': [1454], 'regulation': [1457, 3925, 3979], 'energy': [1459, 1541, 2069], 'metabolism.': [1460], 'profound': [1463], 'adipocytes,': [1466, 1501, 3716], 'mobilization': [1468], 'triglycerides': [1470], '(2Grunfeld': [1476], 'it': [1502, 2162, 3869], 'regulate': [1504], 'genes': [1509], '(4Hotamisligil': [1510, 1614, 1956, 3381, 3409, 3461], 'modulate': [1526], 'secretion': [1528, 2646], 'free': [1530], 'fatty': [1531, 4311], 'acids': [1532, 3763], 'leptin': [1534], 'which': [1535, 2624, 2915, 3044, 3132, 4101, 4133], 'play': [1536], 'roles': [1538], 'systemic': [1540], 'balance': [1542], '(16Hotamisligil': [1543], 'Budavari': [1545], 'Murray': [1547, 1692], 'Clin.': [1552, 1573, 1645, 1668, 1760, 1927], 'Invest.': [1553, 1574, 1646, 1669, 1761, 1928], '94:': [1555], '1543-1549Crossref': [1556], '(726)': [1559], '17Kirchgessner': [1562], 'T.G.': [1563], 'Uysal': [1564], 'K.T.': [1565, 1852, 1892, 2683], 'Wiesbrock': [1566, 1853, 1893, 2684], 'S.M.': [1567, 1854, 1894, 2685], 'Marino': [1568, 1855, 2686], 'Hotamisligil': [1570, 1801, 1857, 1895, 2688], '100:': [1576], '2777-2782Crossref': [1577], '(375)': [1580], 'Recent': [1583], 'candidate': [1590, 2054], 'obesity.': [1596], 'level': [1599, 3934, 3966, 4240, 4262], 'tissue': [1604], 'elevated': [1606], 'variety': [1609], 'rodent': [1611, 1839], 'obesity': [1612, 1840, 1919, 1955, 2029], 'models': [1613, 1837], 'obese': [1632], 'humans': [1633], '(18Hotamisligil': [1634], 'Arner': [1636], 'Caro': [1638], 'J.F.': [1639], 'Atkinson': [1640], 'R.L.': [1641], '95:': [1648, 1671], '2409-2415Crossref': [1649], '(2948)': [1652], '19Kern': [1655], 'P.A.': [1656], 'Saghizadeh': [1657], 'Ong': [1659], 'Bosch': [1661], 'R.J.': [1662], 'Deem': [1663], 'Simsolo': [1665], 'R.B.': [1666], '2111-2119Crossref': [1672], '(1161)': [1675], 'inhibit': [1684], '(20Hotamisligil': [1690], 'D.L.': [1693], 'Choy': [1694], 'L.N.': [1695], 'Proc.': [1698, 3004, 3199], 'Natl.': [1699, 3005, 3200], 'Acad.': [1700, 3006, 3201], 'Sci.': [1701, 3007, 3202], 'U.': [1702, 3008, 3203], '91:': [1706], '4854-4858Crossref': [1707], '(1035)': [1710], '(21Feinstein': [1717], 'Kanety': [1719], 'Papa': [1721], 'M.Z.': [1722], 'Lunenfeld': [1723], 'Karasik': [1725], '268:': [1731], '26055-26058Abstract': [1732], '22Kroder': [1739], 'Bossenmaier': [1741], 'Kellerer': [1743], 'Capp': [1745], 'Stoyanov': [1747], 'Muhlhofer': [1749], 'Berti': [1751], 'Horikoshi': [1753], 'Ullrich': [1755], 'Haring': [1757], '1996;': [1762, 4229], '97:': [1763], '1471-1477Crossref': [1764], '(201)': [1767], 'well': [1771, 2285], 'whole': [1774], 'animals': [1775], '(23Lang': [1776], 'C.H.': [1777], 'Dobrescu': [1778], 'Bagby': [1780], 'G.J.': [1781], 'Endocrinology.': [1782, 1805, 1897, 1983], '130:': [1784], '43-52Crossref': [1785], '(400)': [1788], '24Hofmann': [1791], 'Lorenz': [1793], 'Braithwaite': [1795], 'S.S.': [1796], 'Colca': [1797], 'Palazuk': [1799], 'B.J.': [1800], '134:': [1807], '264-270Crossref': [1808], '(349)': [1811], '25Miles': [1814], 'P.D.': [1815], 'Romeo': [1816], 'O.M.': [1817], 'Higo': [1818], 'Cohen': [1820], 'Rafaat': [1822], 'Olefsky': [1824], '46:': [1828, 1886], '1678-1683Crossref': [1829], 'Several': [1833], 'various': [1836], 'increased': [1842], 'sensitivity': [1844], 'upon': [1845], 'genetic': [1846, 1939], 'loss': [1847], '(26Uysal': [1851, 2682], '389:': [1861, 2692], '610-614Crossref': [1862, 2693], '(1890)': [1865, 2696], '27Ventre': [1868], 'Doebber': [1870], 'Wu': [1872], 'MacNaul': [1874], 'Stevens': [1876], 'Moller': [1882], 'D.E.': [1883], '1526-1531Crossref': [1887], '28Uysal': [1891], '1998;': [1898, 1929, 1984], '139:': [1899, 1985, 3648], '4832-4838Crossref': [1900], 'although': [1904], 'one': [1905, 2032, 2220, 3875], 'recent': [1906], 'report': [1907], 'could': [1908, 4051, 4331], 'TNFR': [1913], '−/−': [1914], 'R2−/−': [1915], 'dietary': [1918], '(29Schreyer': [1920], 'S.A.': [1921], 'Chua': [1922], 'S.C.': [1923], 'LeBoeuf': [1924], 'R.C.': [1925], '102:': [1930], '402-411Crossref': [1931], '(161)': [1934], 'Similar': [1937], 'studies,': [1940], 'pharmacological': [1941], 'blocking': [1942], 'activity': [1945, 3690], 'significant': [1949], 'reversal': [1950], '30Cheung': [1971], 'A.T.': [1972], 'Ree': [1973], 'Kolls': [1975], 'Fuselier': [1977], 'Coy': [1979], 'D.H.': [1980], 'Bryer-Ash': [1981], '4928-4935Crossref': [1986], 'Despite': [1990], 'strong': [1991], 'evidence': [1992], 'obesity-related': [1999], 'resistance,': [2001], 'circulating': [2002], 'appear': [2006], 'very': [2009], 'low': [2010], 'undetectable': [2012], '(3Hotamisligil': [2013], 'therefore': [2026], 'possible': [2027], 'might': [2030], 'example': [2033], 'site(s)': [2041], 'production,': [2043], 'Thus,': [2048], 'potential': [2053, 3709, 3924], 'events.': [2059], 'adipocyte': [2066, 4310], 'biology': [2067], 'metabolism': [2070], 'remain': [2071], 'unknown.': [2072], 'study,': [2075, 3818], '3T3-F442A': [2086, 3736, 3936], 'TNFR1−/−,': [2099, 2173, 2237], 'TNFR2−/−,': [2100, 2174, 2238], 'TNFR1−/−R2−/−': [2102, 2176, 2240, 4049], 'developed': [2106, 3741], 'laboratory.': [2109], '2J.': [2110], 'Sethi,': [2112, 2130], 'Xu,': [2114, 2132], 'Uysal,': [2117, 2135], 'Wiesbrock,': [2120, 2138], 'Scheja,': [2122, 2140], 'Hotamisligil,': [2125, 2143], 'submitted': [2126, 2144], 'publication.2J.': [2128], 'publication.': [2146], 'indeed': [2154, 4299], 'alters': [2163], 'fibroblast': [2177, 2200], 'established': [2181, 2204], 'day': [2183], '16–17': [2184], 'mouse': [2185, 2712, 2955], 'embryos': [2186], 'targeted': [2188], 'mutations': [2189], 'TNFR(s)': [2193], 'classic': [2196], '3T3': [2197], 'protocol.': [2198], 'Multiple': [2199], 'each': [2206, 2218, 2637, 2657, 2773], 'genotype': [2207], 'tested': [2209], 'their': [2211], 'capacity': [2212], 'differentiate': [2214], 'into': [2215, 2864, 2905, 2968, 3033, 3117, 3182], 'For': [2217, 2275, 3259], 'genotype,': [2219], 'line': [2222, 2659, 3190], 'highest': [2225], 'rate': [2226], 'selected': [2230], 'experiments.': [2235], '3T3-F442A,': [2236], 'grown': [2243, 2300, 3496], '(DMEM,': [2249], 'Life': [2250, 3448], 'Technologies,': [2251, 3686], 'Inc.)': [2252, 3687], 'supplemented': [2253, 2291], '10%': [2255, 2293], 'bovine': [2256, 3550, 3567, 3596], 'calf': [2257, 2295], '(HyClone).': [2259, 2297], 'Infected': [2260], 'maintained': [2263, 3355], 'presence': [2270, 2479, 3922, 3988, 4011, 4364], 'appropriate': [2272, 3357], 'selection': [2273, 3326], 'drugs.': [2274], 'differentiation,': [2276], 'seeded': [2279, 3248], '1.5': [2281], '×': [2282, 2470, 2537, 2561, 3254, 3309], '105': [2283, 3255, 3310], 'per': [2284, 2523, 2761, 3256, 3311], '6-well': [2287, 3500], 'plates': [2288], 'DMEM': [2290, 3270, 3290], 'cosmic': [2294], 'Cells': [2298, 2353, 2718, 3301, 3494, 3581], 'confluency': [2302, 2335, 3297], 'exposed': [2304], 'reagents': [2307], '3': [2309, 3539, 3952], '4': [2311, 2317, 3277], 'days,': [2312, 3331], 'followed': [2313, 2890, 3555, 4066], 'culturing': [2315], 'days': [2319, 2348], 'containing': [2322, 2549, 2750, 3272, 3406, 3512, 3532, 3548, 3565, 3594], 'only.': [2324], 'Recombinant': [2325], '(Genzyme,': [2329, 3579], 'MA)': [2330], 'treatments': [2331], 'started': [2333], 'continued': [2337], 'throughout': [2338, 3359], 'new': [2343], 'dose': [2344], 'applied': [2345], 'every': [2346], 'concentrations.': [2352], 'then': [2355, 2883, 3583], 'stained': [2357, 2720], 'oil': [2359, 2722], 'red': [2360, 2723], 'O': [2361, 2724], 'microscopy': [2363], 'processed': [2365], 'RNA': [2367, 3371, 3906], 'collection.': [2368], 'Unless': [2369, 3350], 'otherwise': [2370, 3351], 'indicated,': [2371, 3352], 'concentration': [2377, 3275], '5': [2379, 2496, 3505, 3527, 3585, 3971], 'μg/ml,': [2380], 'dexamethasone': [2381], 'μm,': [2384], 'isobutylmethylxanthine': [2385], '0.5': [2387, 2502, 2605], 'mm,': [2388], 'BRL49653': [2390], 'μm.': [2393], 'polyclonal': [2395, 2419, 2434, 2448, 2670, 2703, 4059], 'rabbit': [2396, 2420, 2435, 2449, 2671, 2704, 3575, 4060], 'anti-murine': [2397, 2450, 2672, 3576, 4061], 'antibody': [2399, 2423, 2438, 2452, 2674, 3578, 4063], 'purchased': [2401, 2411], 'Genzyme': [2403], '(Cambridge,': [2404], 'MA).': [2405, 3580], 'fluorescein-conjugated': [2407, 3604, 4069], 'anti-rabbit': [2408, 3605, 4070], 'IgG': [2409, 3606], 'Jackson': [2413], 'ImmunoResearch': [2414], '(West': [2415], 'Grove,': [2416], 'PA).': [2417], 'anti-human': [2421], 'aP2': [2422, 4314], 'provided': [2425, 2440, 2454, 2794], 'Dr.': [2427, 2442, 2456, 2796, 2800, 3673], 'Rex': [2428], 'Parker': [2429], '(Bristol-Myers': [2430], 'Squibb': [2431], 'Co.).': [2432], 'anti-rat': [2436], 'Na,K-ATPase': [2437, 4127], 'Lorraine': [2443], 'Santy': [2444], '(Harvard': [2445], 'University).': [2446], 'ACRP30': [2451], 'Philip': [2457], 'Scherer': [2458], '(Albert': [2459], 'Einstein': [2460], 'College': [2461], 'Medicine,': [2463], 'New': [2464], 'York).': [2465], 'Fully': [2466], 'differentiated': [2467], '(1': [2469], '107)': [2471], 'collected': [2473, 2655, 3233], '10-cm': [2475], 'dishes': [2476], 'breaking': [2481], 'buffer': [2482, 2585], '(500': [2483], 'mm': [2484, 2487, 2494, 2497, 2590, 2593, 2597, 3514, 3518, 3534], 'KCl,': [2485], '250': [2486], 'sucrose,': [2488], '25': [2489], 'mmTris·HCl,': [2490], 'pH': [2491], '8.0,': [2492], 'EGTA,': [2495], 'EDTA,': [2498], 'μg/ml': [2500, 2503, 2510, 2603, 2606, 2612, 3278], 'aprotinin,': [2501, 2604], 'leupeptin,': [2504, 2607], 'μm': [2506], 'pepstatin,': [2507], '200': [2509, 2611], 'Pefabloc).': [2511], 'After': [2512, 3281, 3424, 3502, 3599], 'homogenization': [2513], 'min': [2516, 2524, 3528], 'speed': [2519], '25,000': [2521], 'rpm': [2522, 2618], 'Polytron': [2527], '(model': [2528], 'PT3000,': [2529], 'Brinkmann),': [2530], 'lysates': [2532], 'centrifuged': [2534, 2558, 2615], '4,700': [2536], 'g': [2538, 2562], '(Megafuge': [2539], '3.0R,': [2540], 'Heraeus': [2541], 'Instruments)': [2542], '100': [2544, 2592, 2596], 'min,': [2545], 'pellet': [2548], 'plasma': [2550, 4080, 4119, 4138], 'membranes': [2551, 2574, 4120], 'collected.': [2553], 'supernatant': [2555, 3228, 3267], 'further': [2557], '450,000': [2560], '(L8-M': [2563], 'ultracentrifuge,': [2564], 'Beckman)': [2565], 'h': [2568], 'precipitate': [2570], 'remaining': [2572], 'subcellular': [2573], 'harvest': [2576], 'cytosolic': [2577, 4302, 4309], 'material.': [2578], 'pellets': [2580], 'extracted': [2582, 3374], 'lysis': [2584], '(1%': [2586], 'Triton': [2587], 'X-100,': [2588], '50': [2589, 3533], 'Hepes,': [2591], 'sodium': [2594, 2598], 'pyrophosphate,': [2595], 'fluoride,': [2599], '10': [2600], 'mmEDTA,': [2601], 'μmpepstatin,': [2609], 'Pefabloc)': [2613], '14,000': [2617], 'microcentrifuge.': [2621], 'supernatants,': [2623], 'contain': [2625], 'solubilized': [2626], 'membrane': [2627, 2790, 3432, 4022, 4139, 4207], 'proteins,': [2628], 'collected,': [2630], 'equal': [2632], 'amounts': [2633], 'fraction': [2638, 4115, 4169, 4297], 'immunoblot': [2642, 4034, 4089], 'analysis.': [2643], 'To': [2644, 3706, 4083], 'analyze': [2645], '48-h': [2649], 'conditioned': [2650, 4346], '(10': [2652], 'ml)': [2653], 'concentrated': [2661, 4345], 'final': [2664, 2961, 3274], 'volume': [2665], 'ml.': [2668], 'immunoprecipitation,': [2678], 'described': [2680, 3459, 3634], 'previously': [2681, 3460, 3635, 3781, 4220], 'Immunoblots': [2699], 'performed': [2701, 4088], 'antibodies': [2705], 'against': [2706], 'human': [2707, 3187], 'aP2,': [2711], 'ACRP30,': [2713], 'rat': [2715], 'Na,K-ATPase,': [2716], 'respectively.': [2717, 3349], '(Sigma)': [2725, 2733, 3325, 3335], 'visualizing': [2727], 'lipid': [2729, 2752], 'droplets': [2730, 2753], 'hematoxylin': [2732], 'nuclei': [2735, 2760], 'according': [2736, 3375], 'conventional': [2738], 'methods.': [2739], 'percentage': [2741], 'calculated': [2745], 'number': [2747, 2758, 3847], 'visible': [2751], 'divided': [2754], 'total': [2757, 4242], 'microscopic': [2762], 'field,': [2763], '400-fold': [2765], 'magnification.': [2766], 'Three': [2767], 'representative': [2768], 'fields': [2769], 'counted': [2771], 'sample,': [2774], 'mean': [2777], '±': [2778], 'comparisons.': [2783], 'cDNA': [2785, 2898, 2938, 2957, 3066, 3451], 'noncleavable': [2788], 'Els': [2797], 'Walter': [2801], '(Gent': [2803], 'University,': [2804], 'Ledeganckstraat,': [2807], 'Belgium)': [2808], 'vector': [2810, 2867, 3661, 3946, 4356], 'pSV235': [2811], 'coding': [2847, 2880, 3020, 3102], 'region': [2848, 2881, 3021], 'amplified': [2850], 'polymerase': [2852], 'chain': [2853], 'reaction': [2854], '(5′': [2855, 2947], 'primer,': [2856, 2860, 2948, 2952], 'CTAGATCTCCCTCCAGAAAAGACA,': [2857], '3′': [2859, 2951], 'GGATCCAGAGTAAAGGGTCAGAGTG)': [2861], 'cloned': [2863, 2901, 2967, 3032, 3116, 3168], 'PCRII': [2866, 2969], '(Invitrogen).': [2868], 'integrity': [2870, 3162], 'PCR': [2873, 2964], 'confirmed': [2876, 4122, 4305], 'sequencing.': [2878], 'excised': [2884, 3025, 3105], 'Xba': [2886], 'I/Bam': [2887], 'HI': [2888, 3108], 'digestion': [2889, 3030, 3114], 'Klenow': [2892, 3111, 3123], 'fill-in.': [2893], '0.76-kilobase': [2895], 'pair': [2896, 2963], 'fragment': [2899], 'sense': [2903], 'orientation': [2904, 3165], 'Sna': [2907, 3035], 'BI': [2908], 'site': [2909, 3038, 3126], 'vector,': [2913, 3042, 3130], 'pBabe-hygro,': [2914], 'contains': [2916, 3045, 3133], 'hygromycin': [2918, 3333], '(32Morgenstern': [2922, 3050, 3138], 'J.P.': [2923, 3051, 3139], 'Land': [2924, 3052, 3140], 'Nucleic': [2926, 3054, 3142], 'Acids': [2927, 3055, 3143], 'Res.': [2928, 3056, 3144, 4153], '1990;': [2929, 3057, 3145], '18:': [2930, 3058, 3146], '3587-3596Crossref': [2931, 3059, 3147], '(1895)': [2934, 3062, 3150], 'obtained': [2942, 3071], 'performing': [2944], 'reverse': [2945], 'transcription-PCR': [2946], 'TGCGAGGTCCTGGAGGACC,': [2949], 'AAGGTTGTGGGTGTGGCTTTAT)': [2953], 'spleen': [2956], '(strain': [2958], 'C57BL/6).': [2959], '1.37-kilobase': [2962], 'vector.': [2970], 'One': [2971], 'point': [2972], 'mutation': [2973], 'detected': [2975, 4107, 4166, 4204, 4293], 'sequencing': [2977], 'corrected': [2979, 3697], 'site-directed': [2981], 'mutagenesis': [2982], 'based': [2983], 'published': [2986], 'sequence': [2987, 3103], '(33Lewis': [2988], 'Tartaglia': [2990], 'Lee': [2992], 'Bennett': [2994], 'G.L.': [2995], 'Rice': [2996], 'G.C.': [2997], 'Wong': [2998], 'G.H.': [2999], 'E.Y.': [3001], '88:': [3012], '2830-2834Crossref': [3013], '(576)': [3016], 'Nae': [3027], 'I/Eco': [3028], 'RI': [3029, 3037, 3113, 3125], 'BI/Eco': [3036], 'pBabe-puro,': [3043], 'puromycin': [3047], 'Immunex': [3073], '(34Goodwin': [3074], 'R.G.': [3075], 'Anderson': [3076], 'Jerzy': [3078], 'Davis': [3080], 'Brannan': [3082], 'C.I.': [3083], 'Copeland': [3084], 'N.G.': [3085], 'Jenkins': [3086], 'N.A.': [3087], 'Smith': [3088], 'C.A.': [3089], 'Mol.': [3090], '11:': [3094], '3020-3026Crossref': [3095], '(158)': [3098], 'Bam': [3107], '(followed': [3109, 3121], 'fill-in)/Eco': [3112, 3124], 'Sal': [3119], 'I': [3120], 'pBabe-bleo,': [3131], 'bleomycin': [3135], 'All': [3153], 'constructs': [3156], 'sequenced': [3158], 'correct': [3164], 'cDNAs.': [3169], 'Packaging': [3170], 'viral': [3173, 3266], 'particles': [3174], 'achieved': [3176], 'transfecting': [3178], 'plasmids': [3181], 'Bosc': [3183], '23': [3184], 'kidney': [3188], '(35Pear': [3191], 'W.S.': [3192], 'Nolan': [3193], 'G.P.': [3194], 'Scott': [3195], 'Baltimore': [3197], '90:': [3207], '8392-8396Crossref': [3208], '(2292)': [3211], 'Cell': [3216, 3645], 'Phect': [3217], 'calcium': [3218], 'phosphate': [3219], 'coprecipitation': [3220], 'kit': [3221, 3684], '(Amersham': [3222], 'Pharmacia': [3223], 'Biotech).': [3224], 'Forty-eight': [3225], 'hours': [3226, 3242], 'post-transfection,': [3227], 'packaging': [3230], 'filtered': [3235], 'sterile': [3237], '0.45-μm': [3238], 'syringe': [3239], 'filters.': [3240], 'Twenty-four': [3241], 'before': [3243], 'infection,': [3244, 3260], 'recipient': [3245, 3261], 'density': [3251, 3306, 4111], '75': [3257, 3312], 'cm2.': [3258], 'incubated': [3264], 'plus': [3268], 'fresh': [3269, 3289], '(3:1)': [3271], 'Polybrene': [3279], '(Sigma).': [3280], '24-h': [3283], 'incubation,': [3284], 'fed': [3287], 'allowed': [3292, 3842], 'grow': [3294], '80%': [3296], '2–3': [3299], 'days.': [3300], 're-seeded': [3303], '6': [3308], 'cm2': [3313], 'selection,': [3315], 'antibiotics': [3318, 3358], 'added': [3320], 'following': [3322], 'day.': [3323], 'Puromycin': [3324], 'completed': [3328], '3–4': [3330], 'while': [3332], 'zeocin': [3337], '(a': [3338], 'derivative': [3339], 'bleomycin,': [3341], 'Invitrogen)': [3342], 'lasted': [3343], 'week': [3345], 'month,': [3348], 'maintain': [3362], 'stable': [3363], 'mTNFΔ1–9K11E,': [3367], 'TNFR2.': [3370], 'samples': [3372], 'guanidinium': [3378], 'thiocyanate': [3379], 'method': [3380], 'Following': [3396, 3526], 'denaturation,': [3397], 'RNAs': [3398, 3426], 'loaded': [3400], '1%': [3403], 'agarose': [3404], 'gel': [3405], '3%': [3407, 3524], 'formaldehyde': [3408], 'electrophoresis,': [3425], 'transferred': [3428], 'biotran': [3431], '(ICN),': [3433], 'UV': [3434], 'cross-linked,': [3435], 'baked': [3437], '80': [3439], '°C': [3440], 'h.': [3443], 'Hybridization': [3444], '[α-32P]dCTP': [3446], '(NEN': [3447], 'Science': [3449], 'Products)-labeled': [3450], 'probes': [3452], 'washings': [3455], 'done': [3457], 'Northern': [3476, 3892], 'blots': [3477], 'quantitated': [3479, 4283], 'NIH': [3482], 'image': [3483], 'program,': [3484], '18': [3486], 'S': [3487], 'rRNA': [3488], 'loading': [3492], 'adjustment.': [3493], 'coverslips': [3498], 'plates.': [3501], 'being': [3503], 'rinsed': [3504, 3538], 'times': [3506, 3540, 3545, 3586, 3591, 3613], '(PBS': [3511], 'MgCl2': [3515], '0.1': [3517], 'CaCl2),': [3519], 'fixed': [3522], 'paraformaldehyde.': [3525], 'incubation': [3529, 3559, 3602], 'PBS': [3531, 3542, 3547, 3564, 3588, 3593], 'NH4Cl,': [3535], '0.5%': [3549, 3566, 3595], 'albumin.': [3552, 3598], '45-min': [3558], 'room': [3561], 'temperature': [3562], 'albumin': [3569], '1:500': [3571], 'dilution': [3572], 'washed': [3584, 3611], '30-min': [3601], '(Jackson': [3607], 'ImmunoResearch),': [3608], '8': [3612], 'PBS,': [3615], 'once': [3616], 'water': [3618], 'mounted': [3620], 'fluoromount-G': [3622], '(Southern': [3623], 'Biotechnology': [3624], 'Associates,': [3625], 'Inc.).': [3626], 'Photographs': [3627], 'taken': [3629], 'fluorescence': [3631, 4076], 'microscope': [3632], '(36Gutierrez': [3636], 'J.A.,': [3637], 'Yu,': [3638], 'Rivera': [3640], 'Wessling-Resnick': [3642], '895-905Crossref': [3649], '(79)': [3652], 'construct': [3658], 'control': [3660], 'cotransfected': [3663], 'NF-κB': [3666], 'promoter-driven': [3667], 'luciferase': [3668, 3689], 'reporter': [3669], '(provided': [3671], 'Christopher': [3674], 'Glass,': [3676], 'University': [3677], 'California,': [3679], 'San': [3680], 'Diego)': [3681], 'LipofectAMINE-plus': [3683], '(Life': [3685], 'luminometer': [3695], 'transfection': [3699], 'efficiency': [3700], 'assessed': [3702], 'β-galactosidase': [3704], 'assays.': [3705], 'study': [3707], 'ectopically': [3719], 'lines.': [3732], 'include': [3734], 'newly': [3740], 'deficient': [3745], 'TNFR2,': [3748], 'both.2': [3750], 'deleting': [3761], 'amino': [3762], '1–9': [3764], 'mutating': [3766], 'residue': [3767], '11': [3768], 'Lys': [3770], 'Glu': [3772], 'N-terminal': [3775], 'part': [3776], 'mature': [3778], 'characterized': [3782], 'L929,': [3784], 'CT6,': [3785], 'PC60-R55/R75,': [3786], 'U937': [3788], 'chose': [3820], 'system': [3824, 3840, 4269], 'express': [3826], 'constitutively': [3827], '(Fig.1': [3831], 'A)': [3832], 'because': [3833], 'high': [3836, 4110], 'integration': [3837], 'efficiency.': [3838], 'large': [3846], 'prevented': [3851], 'common': [3853], 'problem': [3854], 'clonal': [3856], 'variability.': [3857], 'exogenous': [3859], 'message': [3861], 'readily': [3863], 'infected': [3866, 3898], 'since': [3868], 'larger': [3871], 'than': [3872, 3943], 'endogenous': [3874, 4277], 'LPS-stimulated': [3878, 4281], 'Raw264.7': [3879], '(Fig.': [3881, 3902, 3948, 3967, 4096, 4128, 4315, 4370], 'B).': [3883, 3904], 'Comparable': [3884], 'blot': [3893], 'analysis': [3894, 4035, 4090, 4343], 'all': [3896, 3916], 'stably': [3897], 'Messenger': [3905], 'relevant': [3928], 'mRNA': [3933, 3965, 3982, 4005], 'substantially': [3941], 'higher': [3942], 'those': [3944], 'B,': [3950, 3969], 'lanes': [3951, 3970], '4).': [3954], 'Expression': [3955], 'TNFR1−/−': [3959], 'did': [3961, 4348, 4361], 'affect': [3963], '6).': [3973], 'requires': [3986], 'base-line': [3992], 'already': [3999], 'maximum': [4001], 'levels.': [4002], 'Endogenous': [4003], 'unaffected': [4008], 'mTNFΔ1–9K11E.': [4013], 'Proper': [4014], 'localization': [4017], 'indirect': [4028], 'immunofluorescence': [4029], 'intact': [4031], 'fractions.': [4038, 4208], 'As': [4039], 'Fig.1': [4042], 'C,': [4043], 'visualized': [4053], 'use': [4056], '(left': [4064], 'panel)': [4065, 4100, 4132], 'IgG.': [4071], 'peripheral': [4073], 'distribution': [4074], 'consistent': [4078], 'membrane-associated': [4081], 'localization.': [4082], 'further,': [4086], 'fractions': [4093], 'D,': [4098, 4130, 4317], 'top': [4099, 4373], 'showed': [4102], 'predominantly': [4106], 'membrane-containing': [4112], 'fraction.': [4113], 'enriched': [4117, 4300], 'detection': [4125], 'middle': [4131], 'commonly': [4136], 'marker': [4140], '(37Mahadik': [4141], 'S.P.': [4142], 'Bharucha': [4143], 'V.A.': [4144], 'Stadlin': [4145], 'Ortiz': [4147], 'Karpiak': [4149], 'S.E.': [4150], 'Neurosci.': [4152], '32:': [4155], '209-220Crossref': [4156], '(36)': [4159], 'Insulin': [4162], '(data': [4170, 4256], 'shown).': [4172, 4258], '25-kDa': [4180], 'compared': [4182], 'wtTNFα-expressing': [4193, 4368], 'additional': [4196], 'smaller': [4197], 'molecular': [4198], 'weight': [4199], 'bands': [4200], 'consistently': [4203], 'likely': [4211], 'products': [4214], 'alternative': [4216], 'initiation': [4217], '(38Tang': [4222], 'Hung': [4224], 'M.C.': [4225], 'Klostergaard': [4226], 'Biochemistry.': [4228], '35:': [4230], '8226-8233Crossref': [4231], '(35)': [4234], 'Transmembrane': [4237], 'TNFΔ1–9K11E': [4238], 'extracts': [4244], 'immunoblotting': [4255, 4307], 'estimated': [4271], '5%': [4274], 'counterpart': [4278], 'densitometry': [4285], 'scanning': [4286], 'immunoblots.': [4288], 'No': [4289], 'cytosol.': [4295], 'proteins': [4303], 'acid-binding': [4312], 'protein,': [4313], 'bottom': [4318], 'panel).': [4319, 4374], 'Finally,': [4320], 'whether': [4324], 'system,': [4328], 'aberrantly': [4333], 'yield': [4339], 'products.': [4341], 'Immunoblot': [4342], 'media': [4347], 'reveal': [4350], 'any': [4351], 'detectable': [4352], 'immunoreactivity': [4354], 'mTNFΔ1–9K11E-expressing': [4358], 'show': [4362], 'E,': [4372], 'ACRP30/AdipoQ': [4375], '(adipocyte': [4376], 'complement-related': [4377], '30': [4380], '(39Scherer': [4382], 'P.E.': [4383], 'Williams': [4384], 'Fogliano': [4386], 'Baldini': [4388], 'Lodish': [4390], 'H.F.': [4391], '26746-26749Abstract': [4397], '(2724)': [4405], '41Hu': [4408]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2076458548', 'counts_by_year': [{'year': 2024, 'cited_by_count': 2}, {'year': 2023, 'cited_by_count': 10}, {'year': 2022, 'cited_by_count': 2}, {'year': 2021, 'cited_by_count': 8}, {'year': 2020, 'cited_by_count': 4}, {'year': 2019, 'cited_by_count': 3}, {'year': 2018, 'cited_by_count': 3}, {'year': 2017, 'cited_by_count': 6}, {'year': 2016, 'cited_by_count': 5}, {'year': 2015, 'cited_by_count': 5}, {'year': 2014, 'cited_by_count': 2}, {'year': 2013, 'cited_by_count': 4}, {'year': 2012, 'cited_by_count': 7}], 'updated_date': '2024-12-12T05:03:19.454234', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
