Get quick answers to your questions about the article from our AI researcher chatbot
{'id': 'https://openalex.org/W2073329740', 'doi': 'https://doi.org/10.1074/jbc.m109.011999', 'title': 'Hyaluronan Molecular Weight Is Controlled by UDP-N-acetylglucosamine Concentration in Streptococcus zooepidemicus', 'display_name': 'Hyaluronan Molecular Weight Is Controlled by UDP-N-acetylglucosamine Concentration in Streptococcus zooepidemicus', 'publication_year': 2009, 'publication_date': '2009-05-19', 'ids': {'openalex': 'https://openalex.org/W2073329740', 'doi': 'https://doi.org/10.1074/jbc.m109.011999', 'mag': '2073329740', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/19451654', 'pmcid': 'https://www.ncbi.nlm.nih.gov/pmc/articles/2709399'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m109.011999', 'pdf_url': 'http://www.jbc.org/article/S0021925820555609/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820555609/pdf', 'any_repository_has_fulltext': True}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5036410856', 'display_name': 'Wendy Yiting Chen', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I4210113188', 'display_name': 'Institute of Bioengineering and Nanotechnology', 'ror': 'https://ror.org/022xyn875', 'country_code': 'SG', 'type': 'facility', 'lineage': ['https://openalex.org/I115228651', 'https://openalex.org/I2801752549', 'https://openalex.org/I4210113188']}, {'id': 'https://openalex.org/I165143802', 'display_name': 'University of Queensland', 'ror': 'https://ror.org/00rqy9422', 'country_code': 'AU', 'type': 'education', 'lineage': ['https://openalex.org/I165143802']}], 'countries': ['AU', 'SG'], 'is_corresponding': False, 'raw_author_name': 'Wendy Yiting Chen', 'raw_affiliation_strings': ['Australian Institute for Bioengineering and Nanotechnology', 'Cooperative Research Centre for Sugar Industry Innovation through Biotechnology, University of Queensland, Queensland 4072, Australia'], 'affiliations': [{'raw_affiliation_string': 'Australian Institute for Bioengineering and Nanotechnology', 'institution_ids': ['https://openalex.org/I4210113188']}, {'raw_affiliation_string': 'Cooperative Research Centre for Sugar Industry Innovation through Biotechnology, University of Queensland, Queensland 4072, Australia', 'institution_ids': ['https://openalex.org/I165143802']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5082228050', 'display_name': 'Esteban Marcellin', 'orcid': 'https://orcid.org/0000-0003-3173-7956'}, 'institutions': [{'id': 'https://openalex.org/I4210113188', 'display_name': 'Institute of Bioengineering and Nanotechnology', 'ror': 'https://ror.org/022xyn875', 'country_code': 'SG', 'type': 'facility', 'lineage': ['https://openalex.org/I115228651', 'https://openalex.org/I2801752549', 'https://openalex.org/I4210113188']}], 'countries': ['SG'], 'is_corresponding': False, 'raw_author_name': 'Esteban Marcellin', 'raw_affiliation_strings': ['Australian Institute for Bioengineering and Nanotechnology'], 'affiliations': [{'raw_affiliation_string': 'Australian Institute for Bioengineering and Nanotechnology', 'institution_ids': ['https://openalex.org/I4210113188']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5113296488', 'display_name': 'Jacky Hung', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I165143802', 'display_name': 'University of Queensland', 'ror': 'https://ror.org/00rqy9422', 'country_code': 'AU', 'type': 'education', 'lineage': ['https://openalex.org/I165143802']}, {'id': 'https://openalex.org/I4210113188', 'display_name': 'Institute of Bioengineering and Nanotechnology', 'ror': 'https://ror.org/022xyn875', 'country_code': 'SG', 'type': 'facility', 'lineage': ['https://openalex.org/I115228651', 'https://openalex.org/I2801752549', 'https://openalex.org/I4210113188']}], 'countries': ['AU', 'SG'], 'is_corresponding': False, 'raw_author_name': 'Jacky Hung', 'raw_affiliation_strings': ['Australian Institute for Bioengineering and Nanotechnology', 'Cooperative Research Centre for Sugar Industry Innovation through Biotechnology, University of Queensland, Queensland 4072, Australia'], 'affiliations': [{'raw_affiliation_string': 'Cooperative Research Centre for Sugar Industry Innovation through Biotechnology, University of Queensland, Queensland 4072, Australia', 'institution_ids': ['https://openalex.org/I165143802']}, {'raw_affiliation_string': 'Australian Institute for Bioengineering and Nanotechnology', 'institution_ids': ['https://openalex.org/I4210113188']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5061172047', 'display_name': 'Lars K. Nielsen', 'orcid': 'https://orcid.org/0000-0001-8191-3511'}, 'institutions': [{'id': 'https://openalex.org/I165143802', 'display_name': 'University of Queensland', 'ror': 'https://ror.org/00rqy9422', 'country_code': 'AU', 'type': 'education', 'lineage': ['https://openalex.org/I165143802']}, {'id': 'https://openalex.org/I4210113188', 'display_name': 'Institute of Bioengineering and Nanotechnology', 'ror': 'https://ror.org/022xyn875', 'country_code': 'SG', 'type': 'facility', 'lineage': ['https://openalex.org/I115228651', 'https://openalex.org/I2801752549', 'https://openalex.org/I4210113188']}], 'countries': ['AU', 'SG'], 'is_corresponding': True, 'raw_author_name': 'Lars Keld Nielsen', 'raw_affiliation_strings': ['Australian Institute for Bioengineering and Nanotechnology', 'Cooperative Research Centre for Sugar Industry Innovation through Biotechnology, University of Queensland, Queensland 4072, Australia'], 'affiliations': [{'raw_affiliation_string': 'Cooperative Research Centre for Sugar Industry Innovation through Biotechnology, University of Queensland, Queensland 4072, Australia', 'institution_ids': ['https://openalex.org/I165143802']}, {'raw_affiliation_string': 'Australian Institute for Bioengineering and Nanotechnology', 'institution_ids': ['https://openalex.org/I4210113188']}]}], 'institution_assertions': [], 'countries_distinct_count': 2, 'institutions_distinct_count': 2, 'corresponding_author_ids': ['https://openalex.org/A5061172047'], 'corresponding_institution_ids': ['https://openalex.org/I165143802', 'https://openalex.org/I4210113188'], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 3.04, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 93, 'citation_normalized_percentile': {'value': 0.99987, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 97, 'max': 98}, 'biblio': {'volume': '284', 'issue': '27', 'first_page': '18007', 'last_page': '18014'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T11131', 'display_name': 'Proteoglycans and glycosaminoglycans research', 'score': 0.9996, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T11131', 'display_name': 'Proteoglycans and glycosaminoglycans research', 'score': 0.9996, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10602', 'display_name': 'Glycosylation and Glycoproteins Research', 'score': 0.9983, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10835', 'display_name': 'Carbohydrate Chemistry and Synthesis', 'score': 0.998, 'subfield': {'id': 'https://openalex.org/subfields/1605', 'display_name': 'Organic Chemistry'}, 'field': {'id': 'https://openalex.org/fields/16', 'display_name': 'Chemistry'}, 'domain': {'id': 'https://openalex.org/domains/3', 'display_name': 'Physical Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/molecular-mass', 'display_name': 'Molecular mass', 'score': 0.75565475}, {'id': 'https://openalex.org/keywords/n-acetylglucosamine', 'display_name': 'N-Acetylglucosamine', 'score': 0.7219641}, {'id': 'https://openalex.org/keywords/acetylglucosamine', 'display_name': 'Acetylglucosamine', 'score': 0.52603346}, {'id': 'https://openalex.org/keywords/hyaluronan-synthase', 'display_name': 'Hyaluronan synthase', 'score': 0.4722352}], 'concepts': [{'id': 'https://openalex.org/C58121356', 'wikidata': 'https://www.wikidata.org/wiki/Q182854', 'display_name': 'Molecular mass', 'level': 3, 'score': 0.75565475}, {'id': 'https://openalex.org/C2778815778', 'wikidata': 'https://www.wikidata.org/wiki/Q284367', 'display_name': 'N-Acetylglucosamine', 'level': 3, 'score': 0.7219641}, {'id': 'https://openalex.org/C2776648616', 'wikidata': 'https://www.wikidata.org/wiki/Q409216', 'display_name': 'Glucuronic acid', 'level': 3, 'score': 0.65739304}, {'id': 'https://openalex.org/C2781088250', 'wikidata': 'https://www.wikidata.org/wiki/Q161219', 'display_name': 'Chitin', 'level': 3, 'score': 0.6257986}, {'id': 'https://openalex.org/C100817775', 'wikidata': 'https://www.wikidata.org/wiki/Q134219', 'display_name': 'Polysaccharide', 'level': 2, 'score': 0.6216048}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.60834074}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.5334594}, {'id': 'https://openalex.org/C2777529286', 'wikidata': 'https://www.wikidata.org/wiki/Q337231', 'display_name': 'Hyaluronic acid', 'level': 2, 'score': 0.5282527}, {'id': 'https://openalex.org/C2909912800', 'wikidata': 'https://www.wikidata.org/wiki/Q284367', 'display_name': 'Acetylglucosamine', 'level': 3, 'score': 0.52603346}, {'id': 'https://openalex.org/C553450214', 'wikidata': 'https://www.wikidata.org/wiki/Q851162', 'display_name': 'Biosynthesis', 'level': 3, 'score': 0.50209165}, {'id': 'https://openalex.org/C2781236742', 'wikidata': 'https://www.wikidata.org/wiki/Q5952725', 'display_name': 'Hyaluronan synthase', 'level': 3, 'score': 0.4722352}, {'id': 'https://openalex.org/C203075996', 'wikidata': 'https://www.wikidata.org/wiki/Q139677', 'display_name': 'Operon', 'level': 4, 'score': 0.42818928}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.39678377}, {'id': 'https://openalex.org/C143065580', 'wikidata': 'https://www.wikidata.org/wiki/Q3285695', 'display_name': 'Mutant', 'level': 3, 'score': 0.37381536}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.34442216}, {'id': 'https://openalex.org/C181199279', 'wikidata': 'https://www.wikidata.org/wiki/Q8047', 'display_name': 'Enzyme', 'level': 2, 'score': 0.21131554}, {'id': 'https://openalex.org/C2779732960', 'wikidata': 'https://www.wikidata.org/wiki/Q408510', 'display_name': 'Chitosan', 'level': 2, 'score': 0.12341711}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.09643471}], 'mesh': [{'descriptor_ui': 'D006820', 'descriptor_name': 'Hyaluronic Acid', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D006820', 'descriptor_name': 'Hyaluronic Acid', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': True}, {'descriptor_ui': 'D018502', 'descriptor_name': 'Streptococcus equi', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D014537', 'descriptor_name': 'Uridine Diphosphate N-Acetylglucosamine', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D000900', 'descriptor_name': 'Anti-Bacterial Agents', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D000900', 'descriptor_name': 'Anti-Bacterial Agents', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015964', 'descriptor_name': 'Gene Expression Regulation, Bacterial', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': False}, {'descriptor_ui': 'D015964', 'descriptor_name': 'Gene Expression Regulation, Bacterial', 'qualifier_ui': 'Q000187', 'qualifier_name': 'drug effects', 'is_major_topic': False}, {'descriptor_ui': 'D015964', 'descriptor_name': 'Gene Expression Regulation, Bacterial', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005822', 'descriptor_name': 'Genetic Vectors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014453', 'descriptor_name': 'Glucuronosyltransferase', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D014453', 'descriptor_name': 'Glucuronosyltransferase', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D014453', 'descriptor_name': 'Glucuronosyltransferase', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000076002', 'descriptor_name': 'Hyaluronan Synthases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006820', 'descriptor_name': 'Hyaluronic Acid', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006820', 'descriptor_name': 'Hyaluronic Acid', 'qualifier_ui': 'Q000096', 'qualifier_name': 'biosynthesis', 'is_major_topic': False}, {'descriptor_ui': 'D013294', 'descriptor_name': 'Lactococcus lactis', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013294', 'descriptor_name': 'Lactococcus lactis', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D013294', 'descriptor_name': 'Lactococcus lactis', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D008828', 'descriptor_name': 'Microbiological Techniques', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008970', 'descriptor_name': 'Molecular Weight', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009561', 'descriptor_name': 'Nisin', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009561', 'descriptor_name': 'Nisin', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D009876', 'descriptor_name': 'Operon', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009876', 'descriptor_name': 'Operon', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D010957', 'descriptor_name': 'Plasmids', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018502', 'descriptor_name': 'Streptococcus equi', 'qualifier_ui': 'Q000254', 'qualifier_name': 'growth & development', 'is_major_topic': False}, {'descriptor_ui': 'D018502', 'descriptor_name': 'Streptococcus equi', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D018502', 'descriptor_name': 'Streptococcus equi', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014537', 'descriptor_name': 'Uridine Diphosphate N-Acetylglucosamine', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 4, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m109.011999', 'pdf_url': 'http://www.jbc.org/article/S0021925820555609/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': True, 'landing_page_url': 'https://europepmc.org/articles/pmc2709399', 'pdf_url': 'https://europepmc.org/articles/pmc2709399?pdf=render', 'source': {'id': 'https://openalex.org/S4306400806', 'display_name': 'Europe PMC (PubMed Central)', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1303153112', 'host_organization_name': 'European Bioinformatics Institute', 'host_organization_lineage': ['https://openalex.org/I1303153112'], 'host_organization_lineage_names': ['European Bioinformatics Institute'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': True, 'landing_page_url': 'https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2709399', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S2764455111', 'display_name': 'PubMed Central', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/19451654', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m109.011999', 'pdf_url': 'http://www.jbc.org/article/S0021925820555609/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 46, 'referenced_works': ['https://openalex.org/W1509786858', 'https://openalex.org/W1553047309', 'https://openalex.org/W160448612', 'https://openalex.org/W1678318463', 'https://openalex.org/W1854736465', 'https://openalex.org/W1963769732', 'https://openalex.org/W1966323379', 'https://openalex.org/W1968598805', 'https://openalex.org/W1970976508', 'https://openalex.org/W1972521495', 'https://openalex.org/W1973684839', 'https://openalex.org/W1975165965', 'https://openalex.org/W1986104277', 'https://openalex.org/W1987893498', 'https://openalex.org/W1988726642', 'https://openalex.org/W1993763664', 'https://openalex.org/W1996973852', 'https://openalex.org/W1999562066', 'https://openalex.org/W2003199291', 'https://openalex.org/W2007224965', 'https://openalex.org/W2011862459', 'https://openalex.org/W2013941038', 'https://openalex.org/W2013962650', 'https://openalex.org/W201398564', 'https://openalex.org/W2015196611', 'https://openalex.org/W2034008313', 'https://openalex.org/W2041310231', 'https://openalex.org/W2045973674', 'https://openalex.org/W2063252040', 'https://openalex.org/W2064808095', 'https://openalex.org/W2065538824', 'https://openalex.org/W2089173063', 'https://openalex.org/W2093763547', 'https://openalex.org/W2100491597', 'https://openalex.org/W2105076243', 'https://openalex.org/W2110873911', 'https://openalex.org/W2111015751', 'https://openalex.org/W2130624989', 'https://openalex.org/W2132644314', 'https://openalex.org/W2134819882', 'https://openalex.org/W2151615110', 'https://openalex.org/W2154601091', 'https://openalex.org/W2409591502', 'https://openalex.org/W2414997889', 'https://openalex.org/W2804007336', 'https://openalex.org/W4241057414'], 'related_works': ['https://openalex.org/W4231519035', 'https://openalex.org/W3025636809', 'https://openalex.org/W2336253660', 'https://openalex.org/W2098444461', 'https://openalex.org/W2076530249', 'https://openalex.org/W2073329740', 'https://openalex.org/W2049400556', 'https://openalex.org/W2030221076', 'https://openalex.org/W1998978625', 'https://openalex.org/W1975203134'], 'abstract_inverted_index': {'The': [0, 13, 92, 114, 219, 232, 311, 333, 816, 1602, 1821, 1861, 1896, 1960, 1998, 2010, 2072, 2119, 2362, 2398, 2524, 2587, 2776, 2902, 2936, 2964, 3230, 3275, 3282, 3426, 3745, 4069, 4111, 4253, 4272, 4303, 4377, 4521, 4561, 4698, 4879, 5011, 5199], 'molecular': [1, 14, 21, 79, 90, 94, 120, 142, 156, 184, 205, 220, 233, 240, 298, 309, 313, 339, 361, 375, 403, 424, 563, 578, 689, 884, 939, 1035, 1071, 1176, 1282, 1369, 1408, 1431, 1568, 3428, 3451, 3632, 3731, 3842, 3958, 3974, 4081, 4093, 4128, 4144, 4211, 4242, 4496, 4506, 4525, 4555, 4562, 4588, 4688, 4701, 4715, 4760, 4784, 4842, 4875, 4882, 4931, 4951, 4986, 5002, 5107, 5135, 5251, 5290, 5431, 5590, 5614], 'weight': [2, 22, 121, 157, 185, 206, 221, 241, 340, 376, 404, 425, 564, 579, 690, 905, 940, 1036, 1072, 1177, 1283, 1370, 1432, 3429, 3452, 3732, 3843, 4082, 4145, 4156, 4212, 4243, 4497, 4507, 4526, 4556, 4563, 4589, 4689, 4702, 4716, 4785, 4876, 4883, 4932, 4952, 5136, 5252, 5591, 5615], 'of': [3, 60, 71, 83, 128, 152, 171, 191, 222, 279, 290, 302, 347, 371, 390, 410, 450, 504, 575, 795, 911, 926, 1021, 1030, 1166, 1183, 1195, 1287, 1303, 1342, 1392, 1423, 1461, 1553, 1559, 1575, 1628, 1671, 1770, 1804, 1825, 1828, 1838, 1856, 2027, 2056, 2064, 2089, 2131, 2146, 2159, 2170, 2177, 2181, 2198, 2206, 2214, 2244, 2271, 2349, 2354, 2360, 2387, 2442, 2508, 2516, 2520, 2533, 2583, 2640, 2697, 2703, 2746, 2760, 2821, 2846, 2889, 2904, 2947, 2967, 2970, 2980, 2983, 3008, 3037, 3045, 3079, 3088, 3119, 3130, 3145, 3161, 3168, 3190, 3195, 3222, 3254, 3362, 3382, 3390, 3449, 3513, 3518, 3533, 3569, 3627, 3637, 3641, 3678, 3685, 3706, 3727, 3760, 3776, 3805, 3827, 3841, 3865, 3876, 3878, 3923, 4005, 4088, 4130, 4146, 4190, 4217, 4230, 4256, 4268, 4297, 4317, 4333, 4386, 4428, 4444, 4452, 4464, 4472, 4523, 4537, 4564, 4590, 4600, 4661, 4674, 4709, 4729, 4844, 4855, 4874, 4894, 4900, 4905, 4938, 5004, 5168, 5206, 5268, 5293, 5319, 5394, 5434, 5577, 5608, 5618], 'hyaluronan': [4, 30, 53, 62, 183, 207, 223, 249, 272, 281, 402, 426, 712], 'is': [5, 122, 133, 224, 341, 352, 446, 492, 565, 580, 691, 718, 874, 878, 887, 906, 1073, 1174, 1178, 1333, 1412, 1463, 1502, 1510, 2975, 3682, 4421, 4438, 4566, 4756, 4764, 4780, 5016, 5037, 5152, 5201, 5217, 5228, 5241, 5253, 5306, 5322, 5330, 5356, 5408], 'important': [6, 225, 566, 581, 4567], 'for': [7, 29, 34, 182, 226, 248, 253, 401, 567, 582, 604, 787, 825, 847, 865, 891, 895, 1222, 1292, 1298, 1465, 1505, 1600, 1633, 1982, 2101, 2258, 2267, 2471, 2551, 2649, 2773, 2830, 2872, 2916, 3127, 3204, 3366, 3523, 3583, 3672, 4023, 4401, 4414, 4568, 4758, 4782, 4890, 5023, 5050, 5237, 5243, 5417, 5574, 5612, 5627], 'its': [8, 227, 586, 4569], 'rheological': [9, 228, 588], 'and': [10, 19, 41, 130, 144, 208, 229, 238, 260, 349, 363, 427, 500, 520, 526, 648, 770, 853, 860, 902, 916, 1064, 1081, 1188, 1350, 1428, 1577, 1655, 1668, 1847, 1852, 1871, 1904, 1986, 2002, 2020, 2123, 2209, 2233, 2356, 2369, 2390, 2405, 2428, 2479, 2488, 2541, 2558, 2579, 2655, 2713, 2765, 2780, 2816, 2875, 2880, 2914, 2956, 2988, 3154, 3199, 3224, 3246, 3265, 3299, 3341, 3343, 3410, 3462, 3502, 3538, 3616, 3639, 3675, 3691, 3704, 3733, 3794, 3848, 3870, 3929, 3966, 3969, 3981, 3999, 4007, 4036, 4076, 4132, 4199, 4348, 4367, 4393, 4419, 4449, 4454, 4466, 4493, 4554, 4572, 4656, 4676, 4777, 4834, 4870, 4902, 4919, 4922, 4978, 4985, 5086, 5143, 5145, 5158, 5213, 5224, 5260, 5317, 5342, 5397, 5429, 5553, 5610, 5616], 'biological': [11, 230, 573, 3577, 4573], 'function.': [12, 231], 'mechanisms': [15, 215, 234, 434], 'underlying': [16, 235], 'chain': [17, 236, 1426, 5231], 'termination': [18, 237, 1427, 5232], 'hence': [20, 239, 1429, 5430], 'control': [23, 186, 242, 405, 3759, 4034, 4694], 'remain': [24, 243], 'poorly': [25, 244], 'understood,': [26, 245], 'not': [27, 246, 889, 1359, 1503, 4115, 4311, 4704, 5104, 5275], 'only': [28, 247, 890, 1360, 4409], 'synthases': [31, 250, 935, 1225, 4595], 'but': [32, 251, 893, 1364, 4239, 4583], 'also': [33, 252, 513, 894, 1074, 1365, 3861, 4474, 4724, 5218], 'other': [35, 217, 254, 436, 4284, 4434, 5221, 5435], 'β-polysaccharide': [36, 255], 'synthases,': [37, 256], 'e.g.': [38, 257, 1079, 3657], 'cellulose,': [39, 258, 900], 'chitin,': [40, 259, 901], '1,3-betaglucan': [42, 261], 'synthases.': [43, 262], 'In': [44, 263, 522, 776, 1012, 1532, 3369, 4085, 4504, 4547, 4575], 'this': [45, 176, 264, 395, 1346, 1400, 1659, 4576, 4845, 5278, 5302, 5407], 'work,': [46, 265], 'we': [47, 266, 1536, 4578, 4681, 5273], 'manipulated': [48, 267, 1537], 'metabolite': [49, 268, 1538], 'concentrations': [50, 269, 1539], 'in': [51, 65, 74, 86, 106, 175, 216, 270, 284, 293, 305, 325, 394, 435, 485, 489, 495, 793, 923, 932, 937, 1069, 1330, 1345, 1397, 1416, 1540, 1549, 1578, 1658, 1778, 1786, 1892, 2044, 2128, 2143, 2156, 2378, 2465, 2742, 2786, 2810, 2836, 2942, 2993, 3124, 3251, 3288, 3336, 3348, 3476, 3515, 3648, 3743, 3773, 3802, 3810, 3833, 3839, 3863, 3915, 4010, 4123, 4320, 4324, 4340, 4430, 4457, 4461, 4476, 4480, 4534, 4541, 4665, 4686, 4690, 4700, 4717, 4731, 4768, 4775, 4865, 4881, 4908, 4912, 4916, 4930, 4943, 5013, 5091, 5149, 5277, 5301, 5351, 5382, 5391, 5437, 5461, 5599], 'the': [52, 57, 61, 107, 138, 146, 169, 179, 189, 271, 276, 280, 326, 357, 365, 388, 398, 408, 486, 501, 505, 538, 568, 763, 779, 796, 871, 896, 912, 1019, 1039, 1163, 1167, 1181, 1193, 1285, 1293, 1299, 1326, 1390, 1402, 1459, 1466, 1514, 1533, 1541, 1546, 1550, 1573, 1614, 1626, 1693, 1787, 1795, 1805, 1818, 1872, 1905, 1930, 2013, 2124, 2138, 2152, 2160, 2167, 2391, 2417, 2445, 2454, 2472, 2480, 2493, 2538, 2743, 2781, 2806, 2863, 2876, 2890, 2961, 3006, 3077, 3162, 3184, 3247, 3333, 3373, 3433, 3437, 3617, 3628, 3651, 3666, 3669, 3676, 3679, 3683, 3686, 3692, 3707, 3720, 3738, 3750, 3758, 3774, 3790, 3795, 3825, 3849, 4024, 4041, 4080, 4086, 4089, 4091, 4118, 4163, 4185, 4257, 4283, 4356, 4361, 4383, 4387, 4406, 4410, 4431, 4436, 4442, 4445, 4477, 4494, 4535, 4580, 4587, 4598, 4658, 4662, 4672, 4693, 4707, 4710, 4841, 4850, 4856, 4936, 4939, 4996, 5001, 5008, 5027, 5031, 5034, 5048, 5100, 5109, 5118, 5147, 5166, 5204, 5209, 5269, 5353, 5376, 5379, 5383, 5392, 5409, 5438, 5578, 5596, 5605, 5628], 'pathway': [54, 273, 1543, 5316, 5440], 'by': [55, 274, 720, 1076, 1180, 1335, 1544, 1835, 2094, 2344, 2410, 2424, 2437, 2452, 2512, 2562, 2854, 2908, 2940, 3139, 3166, 3186, 3304, 3470, 3749, 3926, 3937, 4040, 4593, 4887, 4972, 4995, 5007, 5170, 5246, 5255, 5594], 'overexpressing': [56, 275, 1545, 4274, 4346, 4403, 4416, 4529, 4544, 4973], 'five': [58, 277, 826, 1547, 1783, 3746, 3791, 4659], 'genes': [59, 72, 84, 278, 291, 303, 1548, 1561, 1784, 1806, 2014, 3747, 3793, 4365, 4429, 4660, 4906], 'synthesis': [63, 282, 1476], 'operon': [64, 283, 823, 1552, 1791, 3752, 4433, 4664, 5355], 'Streptococcus': [66, 285, 817, 1304, 2171, 2513], 'equi': [67, 286, 818, 1683], 'subsp.': [68, 287, 819, 1684], 'zooepidemicus.': [69, 288, 2024, 2514], 'Overexpression': [70, 289, 1558, 4229, 4316, 4427, 4451, 4471, 4904, 5292, 5433], 'involved': [73, 85, 292, 304, 792, 4907], 'UDP-glucuronic': [75, 131, 294, 350, 767], 'acid': [76, 132, 295, 351, 459, 714, 768, 1041, 2571, 5309], 'biosynthesis': [77, 88, 296, 307, 794, 4910, 4945], 'decreased': [78, 297], 'weight,': [80, 143, 299, 362, 1569, 3633], 'whereas': [81, 300, 687, 4135, 4175, 4215, 4331, 4360, 5122], 'overexpression': [82, 301, 2434, 3766, 4189, 4216, 4332, 4854], 'UDP-N-acetylglucosamine': [87, 129, 136, 306, 348, 355, 771], 'increased': [89, 308, 4095, 4241, 4411, 4714, 4888, 4982], 'weight.': [91, 310, 885, 1409, 4761, 5291, 5432], 'highest': [93, 312, 4559], 'mass': [95, 314, 3959, 3975, 4011, 4094, 5003], 'observed': [96, 105, 315, 324, 4495, 4725, 5163], 'was': [97, 316, 1456, 1594, 1611, 1623, 1807, 1976, 2015, 2091, 2121, 2126, 2140, 2186, 2219, 2248, 2310, 2393, 2400, 2420, 2435, 2448, 2483, 2527, 2590, 2643, 2778, 2783, 2808, 2865, 2878, 2892, 2906, 2938, 3002, 3032, 3074, 3232, 3249, 3277, 3286, 3302, 3329, 3364, 3376, 3394, 3430, 3548, 3646, 3698, 3767, 3933, 4114, 4260, 4485, 4508, 4532, 4703, 4723, 4965], 'at': [98, 317, 921, 1831, 2069, 2080, 2098, 2221, 2230, 2235, 2264, 2294, 2383, 2395, 2402, 2422, 2457, 2463, 2485, 2645, 2652, 2767, 2850, 2882, 2919, 2997, 3201, 3227, 3296, 3417, 3526], '3.4': [99, 318, 4989], '±': [100, 111, 319, 330, 2502, 3885, 3890, 3892, 3895, 3897, 3900, 3902, 3905, 4098, 4103, 4990], '0.1': [101, 112, 320, 331, 4099, 4104, 4991], 'MDa': [102, 321, 4100, 4105], 'twice': [103, 322, 2785, 5000], 'that': [104, 117, 323, 336, 533, 1068, 1175, 1404, 1420, 1458, 1513, 2688, 4162, 4267, 4586, 4752, 4766, 4961, 5005, 5042, 5133, 5146, 5230, 5327], 'wild-type': [108, 147, 327, 366, 4125, 4258, 4288, 5009, 5150], 'strain,': [109, 328, 4359], '1.8': [110, 329, 4097, 4133], 'MDa.': [113, 332], 'data': [115, 334, 5131], 'indicate': [116, 335, 4017, 5132], '(a)': [118, 337], 'high': [119, 204, 338, 423, 4292, 4400, 4783, 5589], 'achieved': [123, 342, 4290, 4557, 5276], 'when': [124, 343, 4244, 4528, 4543, 5234], 'an': [125, 344, 908, 1597, 1868, 1979, 2095, 2530, 2716, 3404, 4720, 4962, 5051, 5138, 5265, 5422], 'appropriate': [126, 345], 'balance': [127, 346, 5140, 5148], 'achieved,': [134, 353], '(b)': [135, 354], 'exerts': [137, 356], 'dominant': [139, 358], 'effect': [140, 359, 943, 1565, 4078, 4113, 4169, 4179, 4209, 4223, 4235, 4527, 4949, 5300], 'on': [141, 188, 360, 407, 944, 1038, 1566, 1867, 1988, 2032, 2256, 2279, 2828, 2857, 3005, 3035, 3171, 3724, 4013, 4079, 4210, 4295, 4597, 4950], '(c)': [145, 364], 'strain': [148, 367, 1608, 1964, 3580, 3654, 3673, 3689, 4259, 4273, 4289, 4362, 4998, 5385, 5575], 'has': [149, 368, 784, 1219, 1275, 1295, 1551, 1790, 3751, 4432, 4663, 4999, 5160, 5354, 5458], 'suboptimal': [150, 369, 4898], 'levels': [151, 370, 1391, 1422, 1574, 3136, 4463, 4492, 4673, 4899, 4984, 5341], 'UDP-N-acetylglucosamine.': [153, 172, 372, 391], 'Consistent': [154, 373], 'herewith': [155, 374], 'correlated': [158, 377, 1571, 4510], 'strongly': [159, 378, 4509], '(ρ': [160, 379, 4513], '=': [161, 164, 380, 383, 2498, 3589, 3594, 3598, 3602, 3606, 3610, 3614, 3623, 4107, 4171, 4181, 4193, 4197, 4202, 4225, 4237, 4249, 4263, 4279, 4314, 4327, 4343, 4375, 4397, 4425, 4502, 4514, 4517], '0.84,': [162, 381, 4515], 'p': [163, 382, 4037, 4501, 4516], '3': [165, 384, 1301, 1328, 3220, 3337, 4518], '×': [166, 385, 2113, 2500, 2647, 2769, 2868, 3240, 3269, 3307, 4109, 4173, 4204, 4227, 4251, 4329, 4519], '10−5)': [167, 386], 'with': [168, 387, 941, 1353, 1367, 1414, 1572, 1929, 1992, 2007, 2036, 2047, 2193, 2284, 2467, 2529, 2573, 2756, 2799, 2818, 2912, 2960, 3142, 3192, 3219, 3292, 3396, 3444, 3529, 3573, 3769, 3817, 4246, 4511, 4549, 4706, 4927, 5106, 5220, 5311, 5348, 5447], 'concentration': [170, 190, 389, 409, 1194, 1286, 1406, 1460, 2589, 4957], 'Data': [173, 392], 'presented': [174, 393], 'paper': [177, 396], 'represent': [178, 397], 'first': [180, 399], 'model': [181, 400, 3645, 4153, 5021], 'based': [187, 406, 3004, 3034], 'activated': [192, 411, 764, 797, 1184, 1343, 4446, 4601], 'sugar': [193, 412, 765, 1185, 4296, 4602, 5222, 5239, 5248], 'precursors.': [194, 413], 'These': [195, 414], 'results': [196, 415, 936, 4319], 'can': [197, 416], 'be': [198, 417, 4885, 4970, 5264, 5387, 5421, 5450, 5621], 'used': [199, 418, 442, 1595, 1657, 3330, 3543, 3986], 'to': [200, 419, 584, 778, 1284, 1472, 1817, 2067, 2077, 2084, 2211, 2225, 2250, 2262, 2444, 2490, 2536, 2762, 2834, 2950, 2977, 3010, 3040, 3043, 3047, 3082, 3086, 3091, 3279, 3323, 3331, 3359, 3387, 3575, 3823, 4101, 4117, 4184, 4307, 4336, 4355, 4381, 4440, 4670, 4719, 4839, 4849, 4897, 5164, 5203, 5208, 5284, 5287, 5324, 5389, 5425, 5453, 5586], 'engineer': [201, 420, 5587], 'strains': [202, 421, 2026, 3818, 3932, 4402, 4415, 4691, 5111, 5151, 5335], 'producing': [203, 422], 'may': [209, 428, 4884, 5583], 'provide': [210, 429], 'insight': [211, 430], 'into': [212, 431, 1910, 2022, 2061, 2658, 3122, 3755], 'similar': [213, 432, 1034, 1500, 4354, 5126], 'polymerization': [214, 433, 5169], 'polysaccharides.': [218, 437], 'Hyaluronan': [438], '(HA)': [439], '3The': [440], 'abbreviations': [441], 'are:': [443], 'HAhyaluronanGlcUAglucuronic': [444], 'acidGlcglucoseCmchloramphenicol.': [445], 'a': [447, 451, 515, 531, 692, 721, 843, 848, 861, 1013, 1022, 1025, 1170, 1217, 1288, 1336, 1518, 1563, 1713, 1723, 1733, 1743, 1753, 1763, 1779, 1810, 1893, 2189, 2379, 2384, 2544, 2567, 2580, 2593, 2837, 2895, 3149, 3157, 3172, 3211, 3317, 3388, 3397, 3477, 3498, 3530, 3545, 3643, 3701, 3711, 3761, 3803, 3811, 3916, 4074, 4139, 4143, 4151, 4167, 4207, 4220, 4291, 4321, 4337, 4351, 4370, 4458, 4524, 4538, 4683, 4862, 4871, 4891, 4913, 4928, 5038, 5113, 5125, 5235, 5256, 5297, 5307, 5312, 5403], 'linear': [448, 3644, 4152], 'polymer': [449], 'repeating': [452], 'disaccharide,': [453], 'β1–3': [454], 'd-N-acetylglucosamine': [455], '(GlcNAc)': [456], 'β1–4': [457], 'd-glucuronic': [458], '(GlcUA)': [460], '(1.Fong': [461], 'Chong': [462, 1112, 2164], 'B.F.': [463, 2331], 'Blank': [464], 'L.M.': [465, 800, 1127, 5359], 'Mclaughlin': [466], 'R.': [467, 3744, 4737, 5524], 'Nielsen': [468, 803, 1114, 1130, 2332, 2621, 2723, 5362], 'L.K.': [469, 804, 1115, 1131, 2333, 2622, 2724, 5363], 'Appl.': [470, 1102, 1641, 1699, 1916, 3062, 3102, 4807, 5542, 5560], 'Microbiol.': [471, 1104, 1315, 1380, 1642, 1700, 1917, 3063, 3104, 4809, 5544, 5561], 'Biotechnol.': [472, 1089, 1132, 1643, 1701, 1918, 2335, 2627, 2677, 2729, 3064, 4794, 5562], '2005;': [473, 1134, 1644, 1702, 1919, 5545], '66:': [474, 3106], '341-351Crossref': [475], 'PubMed': [476, 557, 660, 707, 739, 757, 811, 959, 983, 1007, 1058, 1108, 1137, 1245, 1269, 1319, 1384, 1450, 1494, 1527, 1591, 1647, 1680, 1705, 1922, 1973, 2327, 2339, 2609, 2632, 2682, 2734, 2931, 3027, 3108, 3489, 3562, 3950, 4623, 4649, 4813, 5078, 5194, 5370, 5482, 5502, 5514, 5548, 5566], 'Scopus': [477, 558, 600, 622, 661, 683, 708, 758, 812, 960, 984, 1008, 1059, 1094, 1122, 1138, 1154, 1246, 1270, 1320, 1385, 1451, 1495, 1528, 1648, 1706, 1923, 2340, 2633, 2683, 2735, 2932, 3068, 3109, 3490, 3563, 3951, 4624, 4650, 4799, 4828, 5079, 5195, 5371, 5515, 5549, 5567], '(283)': [478], 'Google': [479, 560, 602, 624, 646, 663, 685, 710, 740, 760, 814, 962, 986, 1010, 1061, 1096, 1109, 1124, 1140, 1156, 1248, 1272, 1322, 1387, 1453, 1497, 1530, 1592, 1650, 1681, 1708, 1925, 1974, 2328, 2342, 2610, 2635, 2685, 2737, 2934, 3028, 3070, 3111, 3492, 3565, 3953, 4626, 4652, 4801, 4814, 4830, 5081, 5197, 5373, 5483, 5503, 5517, 5551, 5569], 'Scholar)': [480, 761, 1593, 1651, 1926, 1975, 2343, 4750], '(see': [481, 773, 5026], 'Fig.': [482, 774], '1).': [483, 775, 1557], 'Ubiquitous': [484], 'extracellular': [487], 'matrix': [488], 'vertebrates,': [490], 'HA': [491, 512, 529, 562, 583, 717, 780, 828, 883, 913, 934, 1015, 1029, 1168, 1506, 1515, 1542, 1567, 2539, 2588, 2952, 2958, 2973, 2981, 3179, 3284, 3351, 3363, 3465, 3514, 3868, 3924, 4006, 4293, 4352, 4388, 4392, 4565, 4687, 4730, 4759, 4786, 4857, 4866, 4993, 5035, 5101, 5457, 5592, 5619], 'particularly': [493], 'abundant': [494, 898, 5090], 'cartilage,': [496], 'synovial': [497], 'fluid,': [498], 'dermis,': [499], 'vitreous': [502], 'humor': [503], 'eye,': [506], 'where': [507], 'it': [508, 1411, 5582], 'serves': [509], 'specialized': [510], 'functions.': [511, 4574], 'plays': [514], 'critical': [516, 1464], 'role': [517], 'during': [518, 2414, 4001, 4726], 'fertilization': [519], 'embryogenesis.': [521], 'many': [523], 'group': [524], 'A': [525, 1499, 1945, 2306, 3353, 3567], 'C': [527, 1605], 'streptococci,': [528], 'forms': [530], 'capsule': [532, 2540], 'helps': [534], 'these': [535, 1560, 5600, 5603], 'microbes': [536], 'evade': [537], 'host': [539, 1599, 1981], 'immune': [540], 'system': [541, 3402], '(2.Wessels': [542], 'M.R.': [543, 1084, 1101, 3056, 4789, 4806], 'Moses': [544], 'A.E.': [545], 'Goldberg': [546], 'J.B.': [547], 'DiCesare': [548], 'T.J.': [549, 1231], 'Proc.': [550], 'Natl.': [551], 'Acad.': [552], 'Sci.': [553, 679], '1991;': [554, 619], '88:': [555], '8317-8321Crossref': [556], '(281)': [559], 'Scholar).': [561, 711, 815, 1011, 1062, 1157, 1214, 1323, 1388, 1454, 1498, 1531, 1959, 2184, 2523, 2611, 2636, 2738, 2935, 3029, 3071, 3112, 3493, 3566, 3954, 4653, 4831, 5082, 5198, 5374, 5570], 'physiochemical': [569, 1164, 4570], 'as': [570, 572, 1190, 1192, 1200, 1596, 1902, 1978, 2577, 2616, 2668, 3117, 3148, 3424, 3474, 3544, 3550, 3655, 3935, 3987], 'well': [571, 875, 1191], 'properties': [574, 589, 4571], 'HA.': [576], 'High': [577], 'exert': [585], 'unique': [587], '(3.Fouissac': [590], 'E.': [591, 631, 2620, 2722], 'Milas': [592], 'M.': [593, 595, 1640, 1698, 1915, 4741, 5529], 'Rinaudo': [594], 'Macromolecules.': [596], '1993;': [597, 657, 733, 3021, 5476, 5496], '26:': [598], '6945-6951Crossref': [599], '(157)': [601], 'Scholar),': [603, 647, 686, 1273, 2686, 5484, 5518, 5552], 'mucoadherence': [605], '(4.Saettone': [606], 'M.F.': [607, 1233], 'Giannaccini': [608], 'B.': [609, 637, 1113, 2165, 3098, 5519, 5522], 'Chetoni': [610], 'P.': [611, 672, 802, 2624, 2726, 5361], 'Torracca': [612], 'M.T.': [613, 633], 'Monti': [614], 'D.': [615, 1942, 4743, 5535], 'Int.': [616], 'J.': [617, 676, 727, 730, 746, 805, 972, 996, 1047, 1118, 1150, 1234, 1257, 1258, 1313, 1378, 1438, 1439, 1482, 1483, 1586, 1675, 1940, 1968, 2334, 2600, 2628, 2676, 2730, 3018, 3058, 4611, 4612, 4638, 4824, 5067, 5183, 5364, 5470, 5473, 5490, 5493], 'Pharm.': [618], '72:': [620], '131-139Crossref': [621], '(62)': [623, 4651, 5080, 5196], 'Scholar,': [625, 664, 741, 963, 987, 1097, 1110, 1125, 1141, 1249, 2329, 4627, 4802, 4815, 5504], '5.Saso': [626], 'L.': [627, 1962, 3101, 5554], 'Bonanni': [628], 'G.': [629, 2925, 5508], 'Grippa': [630], 'Gatto': [632], 'Leone': [634], 'M.G.': [635, 1204], 'Silvestrini': [636], 'Res.': [638], 'Commun.': [639], 'Mol.': [640, 806, 1314, 1379, 5365], 'Pathol.': [641], 'Pharmacol.': [642], '1999;': [643, 680, 2679, 4641, 5070, 5186], '104:': [644], '277-284PubMed': [645], 'anti-inflammatory': [649], 'effects': [650], '(6.Suzuki': [651], 'Y.': [652], 'Yamaguchi': [653], 'T.': [654, 5531], 'Agents': [655], 'Actions.': [656], '38:': [658], '32-37Crossref': [659], '(73)': [662], '7.Spurlock': [665], 'S.L.': [666], 'Spurlock': [667], 'G.H.': [668], 'Bernstad': [669], 'S.': [670, 1331, 1554, 1606, 1715, 1725, 1735, 1745, 1755, 1765, 1788, 2023, 2028, 4666, 4745, 5014, 5024, 5092, 5098, 5304, 5527, 5541], 'Michanek': [671], 'Chester': [673], 'Jr.,': [674], 'S.T.': [675], 'Equine': [677], 'Vet.': [678], '19:': [681], '338-344Crossref': [682], '(9)': [684], 'low': [688, 1421, 1430, 4778], 'potent': [693], 'signaling': [694], 'molecule': [695], '(8.Lee': [696], 'J.Y.': [697], 'Spicer': [698], 'A.P.': [699, 1227], 'Curr.': [700], 'Opin.': [701], 'Cell': [702], 'Biol.': [703, 731, 747, 973, 997, 1048, 1235, 1259, 1440, 1484, 2601, 3019, 4613, 4639, 5068, 5184, 5474, 5494], '2000;': [704, 1261, 1442, 3105, 4615], '12:': [705], '581-586Crossref': [706], '(453)': [709], 'glucuronic': [713], 'glucose': [715, 2051, 3038, 3083, 3089, 5321, 5395], 'chloramphenicol.': [716], 'produced': [719, 2959, 3925, 4592, 4994, 5006, 5460], 'processive': [722, 1224, 1337, 1474, 4594, 5040], 'synthase': [723, 781, 829, 1016, 1338, 1516, 2974, 4437, 4858, 5036, 5041], '(9.DeAngelis': [724, 5487], 'P.L.': [725, 745, 1046, 5468, 5488, 5537], 'Papaconstantinou': [726, 5469, 5489], 'Weigel': [728, 915, 953, 970, 994, 4636, 5065, 5181, 5471, 5491, 5538], 'P.H.': [729, 743, 954, 971, 995, 1521, 4637, 5066, 5182, 5472, 5492, 5539], 'Chem.': [732, 748, 974, 998, 1049, 1236, 1260, 1441, 1485, 2602, 3020, 4614, 4640, 5069, 5185, 5475, 5495], '268:': [734, 3022, 5477, 5497], '19181-19184Abstract': [735, 5498], 'Full': [736, 752, 754, 978, 980, 1002, 1004, 1053, 1055, 1240, 1242, 1264, 1266, 1445, 1447, 1489, 1491, 2606, 3024, 4618, 4620, 4644, 4646, 5073, 5075, 5189, 5191, 5479, 5499], 'Text': [737, 753, 755, 979, 981, 1003, 1005, 1054, 1056, 1241, 1243, 1265, 1267, 1446, 1448, 1490, 1492, 2607, 3025, 4619, 4621, 4645, 4647, 5074, 5076, 5190, 5192, 5480, 5500], 'PDF': [738, 756, 982, 1006, 1057, 1244, 1268, 1449, 1493, 2608, 3026, 4622, 4648, 5077, 5193, 5481, 5501], '10.Weigel': [742], 'DeAngelis': [744, 1045], '2007;': [749, 5563], '282:': [750], '36777-36781Abstract': [751], '(276)': [759], 'from': [762, 1017, 1339, 1469, 1613, 1625, 1794, 2018, 2301, 2312, 2692, 2954, 3076, 3183, 3356, 3432, 3668, 3819, 4096, 4138, 5019, 5045, 5378], 'precursors,': [766, 4447], '(UDP-GlcUA)': [769], '(UDP-GlcNAc)': [772], 'addition': [777, 1341, 2946], '(hasA),': [782], 'streptococcal': [783, 933, 5171], 'operons': [785], 'encode': [786], 'one': [788, 1853, 5238], 'or': [789, 929, 1024, 1033, 1661, 3829, 4955, 5054, 5443, 5445], 'more': [790, 1171], 'enzymes': [791, 1933, 3877, 5436], 'sugars': [798], '(11.Blank': [799, 5358], 'Hugenholtz': [801, 5360], 'Evol.': [807, 5366], '2008;': [808, 2928, 5367, 5511], '67:': [809, 5368], '13-22Crossref': [810, 5369], '(57)': [813, 2684, 5372], 'zooepidemicus': [820, 1555, 1607, 1716, 1726, 1736, 1746, 1756, 1766, 1789, 2029, 4667, 5015, 5093, 5305], '(S.': [821], 'zooepidemicus)': [822], 'encodes': [824], 'genes:': [827], '(EC': [830, 835, 840, 856, 867], '2.4.1.212;': [831], 'hasA),': [832], 'UDP-glucose': [833, 838, 1348, 1355], 'dehydrogenase': [834, 1356, 3052, 3096], '1.1.1.22;': [836], 'hasB),': [837], 'pyrophosphorylase': [839, 854], '2.7.7.9;': [841], 'hasC),': [842], 'glmU': [844], 'paralog': [845, 863], 'encoding': [846, 864], 'dual': [849], 'function': [850], 'enzyme': [851, 1900, 2995, 3770, 5345], 'acetyltransferase': [852], 'activity': [855, 1358, 2903, 2966, 3001, 3031, 3073, 4937, 5329, 5346, 5413], '2.3.1.4/EC': [857], '2.7.7.23;': [858], 'hasD),': [859], 'pgi': [862, 5328, 5339], 'phosphoglucoisomerase': [866], '5.3.1.9;': [868], 'hasE).': [869], 'Although': [870, 1158, 1215, 1389], 'biosynthetic': [872, 945], 'mechanism': [873, 1218, 1501, 5012], 'established,': [876], 'little': [877], 'known': [879, 3450], 'about': [880, 2078], 'what': [881], 'controls': [882, 1407], 'This': [886, 4967, 5280], 'true': [888], 'HA,': [892, 1325, 2764, 3638], 'highly': [897, 1473, 5313], 'β-polysaccharides:': [899], '1,3-betaglucan.': [903], 'Molecular': [904, 1943], 'partly': [907], 'intrinsic': [909, 3434], 'parameter': [910, 3681], 'synthase.': [914], 'colleagues': [917], 'have': [918, 1066, 4350, 5274, 5336], 'demonstrated': [919, 1067], 'that,': [920], 'least': [922, 2464], 'vitro,': [924], 'mutation': [925, 1020], 'conserved': [927], 'cysteine': [928, 1026], 'polar': [930], 'residues': [931], 'reduced': [938, 1354], 'limited': [942, 4948], 'rate': [946, 2582, 4255, 5167], '(12.Heldermon': [947], 'C.D.': [948], 'Tlapak-Simmons': [949, 966], 'V.L.': [950, 967, 4629, 5058, 5174], 'Baggenstoss': [951, 968, 990, 4630, 5059, 5175], 'B.A.': [952, 969, 991, 3013, 4631, 5060, 5176], 'Glycobiology.': [955], '2001;': [956], '11:': [957], '1017-1024Crossref': [958], '(18)': [961], '13.Kumari': [964], 'K.': [965, 989, 4633, 5062, 5178], '2002;': [975, 1524], '277:': [976], '13943-13951Abstract': [977], '(19)': [985], '14.Kumari': [988], 'Parker': [992], 'A.L.': [993], '2006;': [999, 1151, 1316, 1381, 1486, 4825], '281:': [1000, 1487], '11755-11760Abstract': [1001], '(30)': [1009], 'vertebrate': [1014], 'Xenopus,': [1018], 'serine': [1023], 'residue': [1027], 'yielded': [1028, 4127, 4142], 'higher,': [1031], 'lower,': [1032], 'depending': [1037], 'amino': [1040], 'substitution': [1042], '(15.Pummill': [1043], 'P.E.': [1044], '2003;': [1050, 1119, 2336], '278:': [1051], '19808-19814Abstract': [1052], '(38)': [1060], 'We': [1063, 4654, 5623], 'others': [1065], 'vivo': [1070], 'affected': [1075, 1179], 'culture': [1077, 1160, 3191], 'parameters,': [1078, 3631], 'temperature': [1080, 2392, 3203, 3528], 'aeration': [1082], '(16.Johns': [1083, 4788], 'Goh': [1085, 4790], 'L.T.': [1086, 2505, 4791], 'Oeggerli': [1087, 4792], 'A.': [1088, 4735, 4793, 5533], 'Lett.': [1090, 4795], '1994;': [1091, 3486, 3559, 3947, 4796], '16:': [1092, 1120, 4797], '507-512Crossref': [1093, 4798], '(74)': [1095, 4800], '17.Armstrong': [1098, 4803], 'D.C.': [1099, 4804], 'Johns': [1100, 4805], 'Environ.': [1103, 3103, 4808, 5543], '1997;': [1105, 4810], '63:': [1106, 2680, 4811], '2759-2764Crossref': [1107, 4812], '18.Fong': [1111], 'Biochem.': [1116, 1148, 3485, 3558, 3946, 4822], 'Eng.': [1117, 1149, 2927, 4823, 5510], '153-162Crossref': [1121], '(59)': [1123], '19.Blank': [1126], 'McLaughlin': [1128], 'R.L.': [1129], 'Bioeng.': [1133, 2678], '90:': [1135], '685-693Crossref': [1136], '(54)': [1139, 1271, 4625], '20.Huang': [1142, 4816], 'W.C.': [1143, 4817], 'Chen': [1144, 1146, 4818, 4820], 'S.J.': [1145, 4819], 'T.L.': [1147, 4821], '32:': [1152, 4826], '239-243Crossref': [1153, 4827], '(80)': [1155, 4829], 'changed': [1159], 'conditions': [1161, 2407], 'affect': [1162, 4441, 5165], 'environment': [1165], 'synthase,': [1169], 'likely': [1172, 1504], 'explanation': [1173], 'availability': [1182, 4599], 'substrates': [1186, 4603], '(UDP-GlcUA': [1187], 'UDP-GlcNAc)': [1189], 'possible': [1196, 5229], 'effector': [1197], 'molecules,': [1198], 'such': [1199, 1216], 'free': [1201, 2951], 'UDP': [1202], '(21.Park': [1203], 'Jang': [1205], 'J.D.': [1206], 'Kang': [1207], 'W.K.': [1208], 'Lucky': [1209], 'Limited,': [1210], 'Seoul,': [1211], 'Korea,': [1212], 'U.S.1996Google': [1213], 'been': [1220, 1277, 1296, 5162, 5459], 'suggested': [1221], 'several': [1223, 5285], '(22.Spicer': [1226], 'Kaback': [1228], 'L.A.': [1229], 'Smith': [1230, 3055], 'Seldin': [1232], '1998;': [1237], '273:': [1238], '25117-25124Abstract': [1239], '(133)': [1247], '23.Cartee': [1250], 'R.T.': [1251, 1309, 1374, 1436, 1480, 4605], 'Forsee': [1252, 1310, 1375, 4606], 'W.T.': [1253, 1311, 1376, 1434, 1478, 4607], 'Schutzbach': [1254, 4608], 'J.S.': [1255, 4609], 'Yother': [1256, 1312, 1377, 1437, 1481, 4610], '275:': [1262, 1443, 4616], '3907-3914Abstract': [1263, 4617], 'there': [1274, 1509, 4484, 4763, 5262], 'never': [1276], 'any': [1278], 'direct': [1279], 'evidence': [1280, 4765], 'linking': [1281], 'substrate.': [1289], 'Experimental': [1290], 'support': [1291], 'hypothesis': [1294, 4585], 'obtained': [1297, 1612, 1624, 3446], 'type': [1300, 1327, 3587, 3785, 3928], 'polysaccharide': [1302, 1329, 1366, 1475], 'pneumoniae': [1305, 1332, 5025], '(24.Ventura': [1306, 1371], 'C.L.': [1307, 1372], 'Cartee': [1308, 1373, 1435, 1479], '61:': [1317, 1382], '723-733Crossref': [1318, 1383], '(45)': [1321, 1386], 'Like': [1324], 'synthesized': [1334], 'alternating': [1340], 'sugars,': [1344, 5271], 'case': [1347, 3775], '(UDP-Glc)': [1349], 'UDP-GlcUA.': [1351, 5154], 'Mutants': [1352], '(“hasB”)': [1357], 'produce': [1361], 'less': [1362], 'polysaccharide,': [1363], 'lower': [1368, 4372, 5115], 'UDP-GlcUA': [1393, 1405, 1424, 1462, 2915, 3011, 3048, 4448, 4462, 4489, 4675, 4901, 4909, 4920, 5085, 5142, 5157, 5207, 5259, 5609], 'were': [1394, 1792, 1865, 1874, 1908, 2005, 2030, 2042, 2059, 2074, 2154, 2253, 2276, 2291, 2299, 2376, 2408, 2461, 2476, 2560, 2614, 2662, 2690, 2707, 2740, 2826, 2991, 3115, 3137, 3181, 3208, 3314, 3415, 3467, 3495, 3521, 3542, 3581, 3717, 3735, 3753, 3800, 3815, 3837, 3851, 3860, 3985, 4029], 'below': [1395, 3377], 'detection': [1396, 3378], 'all': [1398, 1983, 3370, 5320], 'strains,': [1399, 3783, 4408, 5121, 5350], 'supports': [1401], 'idea': [1403], 'Moreover,': [1410, 5333], 'consistent': [1413], 'previous': [1415, 3478], 'vitro': [1417], 'studies': [1418], 'showing': [1419], 'cause': [1425], '(25.Forsee': [1433], '25972-25978Abstract': [1444], '(31)': [1452], 'It': [1455, 5227], 'proposed': [1457, 5022], 'successful': [1467], 'transition': [1468, 5020], 'oligosaccharide': [1470], 'lipid': [1471], '(26.Forsee': [1477], '6283-6289Abstract': [1488], '(29)': [1496], 'biosynthesis,': [1507], 'because': [1508], 'no': [1511, 4057, 4178, 4234, 4486], 'indication': [1512], 'needs': [1517], 'primer': [1519], '(27.Weigel': [1520], 'IUBMB': [1522], 'Life.': [1523], '54:': [1525], '201-211Crossref': [1526], '(71)': [1529], 'present': [1534], 'study,': [1535, 4577, 5281], '(Fig.': [1556, 3846, 3857, 3873, 4083, 4213, 4301, 4469, 4696, 4868, 4877, 4924, 4933, 4953, 4958, 5094, 5128], 'had': [1562, 4073, 4166, 4177, 4206, 4219, 4233, 4369, 4947, 5112, 5124, 5296], 'profound': [1564], 'which': [1570, 2252, 5272, 5352], 'UDP-sugars': [1576, 3734, 5046], 'particular,': [1579], 'UDP-GlcNAc.': [1580, 4677, 4903], 'MG1363': [1581, 1965, 2019], '(L.': [1582], 'lactis)': [1583], '(28.Gasson': [1584, 1966], 'M.J.': [1585, 1674, 1967], 'Bacteriol.': [1587, 1676, 1969], '1983;': [1588, 1677, 1970], '154:': [1589, 1678, 1971], '1-9Crossref': [1590, 1679, 1972], 'intermediate': [1598, 1980], 'plasmids.': [1601], 'mucoid': [1603, 5334], 'Group': [1604], 'ATCC': [1609], '35246': [1610], 'American': [1615], 'Type': [1616], 'Culture': [1617], 'Collection': [1618], '(Rockville,': [1619], 'MD).': [1620], 'Plasmid': [1621], 'pNZ8148': [1622, 1710, 1720, 1730, 1740, 1750, 1911, 3756, 4140], 'Dept.': [1627], 'Biophysical': [1629], 'Chemistry,': [1630], 'Netherlands': [1631], 'Institute': [1632], 'Dairy': [1634], 'Research': [1635], '(NIZO)': [1636], '(29.Mierau': [1637, 1912], 'I.': [1638, 1696, 1913, 2319, 3017], 'Kleerebezem': [1639, 1697, 1914], '68:': [1645, 1703, 1920], '705-717Crossref': [1646, 1704, 1921], '(468)': [1649, 1707, 1924], '(Table': [1652, 1800, 3780, 4668], '1).TABLE': [1653], '1Strains': [1654], 'plasmids': [1656, 1985], 'studyStrain': [1660], 'plasmidRelevant': [1662], 'characteristicsaCmr,': [1663], 'chloramphenicol': [1664, 1774, 1996], 'resistance.SourceStrainsL.': [1665], 'lactis': [1666, 1963, 5555], 'MG1363Plasmid-free': [1667], 'prophage-cured': [1669], 'derivative': [1670, 1711, 1721, 1731, 1741, 1751, 1761], 'NCDO': [1672], '712(28.Gasson': [1673], 'Scholar)S.': [1682], 'zooepidemicusHA+': [1685], 'Lac+': [1686], 'EmsATCC': [1687], '35246PlasmidspNZ8148Cmr,': [1688], 'inducible': [1689], 'expression': [1690], 'vector,': [1691], 'carrying': [1692, 4270], 'nisA': [1694], 'promoter(29.Mierau': [1695], 'Scholar)pNZhasACmr,': [1709], 'containing': [1712, 1722, 1732, 1742, 1752, 1762, 2012, 2203, 2813, 3510], 'functional': [1714, 1724, 1734, 1744, 1754, 1764], 'hasA': [1717, 3596, 4191, 4318], 'geneThis': [1718, 1728, 1738, 1748, 1758], 'workpNZhasBCmr,': [1719], 'hasB': [1727, 3600, 4195, 4453], 'workpNZhasCCmr,': [1729], 'hasC': [1737, 3604, 4200, 4275, 4334, 4455, 4473], 'workpNZhasDCmr,': [1739], 'hasD': [1747, 1767, 3163, 3608, 4231, 4347, 4368, 4418, 4530, 4545], 'workpNZhasECmr,': [1749], 'hasE': [1757, 3612, 4218, 4247, 4349, 4366, 4420, 4976, 5123, 5294, 5384], 'workpNZhasEDCmr,': [1759], 'pNZhasE': [1760], 'gene': [1768, 2000, 2469, 3619, 3797, 4859], 'downstream': [1769], 'hasEThis': [1771], 'worka': [1772], 'Cmr,': [1773], 'resistance.': [1775], 'Open': [1776, 1890, 3913], 'table': [1777, 1891, 3914], 'new': [1780, 1894, 3917], 'tab': [1781, 1895, 3918], 'All': [1782, 2289, 2297, 3413], 'found': [1785], 'amplified': [1793], 'genome': [1796], 'using': [1797, 1809, 1876, 1934, 2188, 2492, 2566, 2592, 2664, 2694, 2709, 2894, 3049, 3093, 3151, 3403, 3420, 3436, 3447, 3497, 3650, 3700, 3710, 3719, 3737, 3844, 3853], 'specific': [1798, 2965, 3882], 'primers': [1799, 1883, 1897, 3152], '2).': [1801, 4084, 4697, 4878, 4934], 'PCR': [1802, 1822, 1862, 1906, 3779], 'amplification': [1803], 'performed': [1808, 2187, 3416, 3549, 3582, 3809, 3934, 4030], 'Platinum': [1811], 'TaqDNA': [1812], 'polymerase': [1813], 'kit': [1814, 1880, 2897], '(Invitrogen)': [1815], 'according': [1816], "manufacturer's": [1819], 'instructions.': [1820], 'program': [1823], 'consisted': [1824], '1': [1826, 2144, 2574, 2584, 2847, 2855, 2917, 2968, 2978, 3125, 3128, 4172], 'cycle': [1827, 1855], '2': [1829, 2650, 2695, 3574, 4250], 'min': [1830, 2104, 2260, 2651, 2832, 2848, 2856, 3126], '94': [1832, 1839], '°C,': [1833, 2116, 3243, 3272, 3298, 3310], 'followed': [1834, 2093, 2853, 3165], '30': [1836, 2103, 3252], 'cycles': [1837, 2845], '°C': [1840, 1844, 1849, 1858, 2100, 2266, 2654, 2772, 2871, 2884, 2921, 3419], '(30': [1841, 1845], 's),': [1842, 1846], '52': [1843], '72': [1848, 1857], '(2': [1850], 'min)': [1851], 'final': [1854], '(10': [1859], 'min).': [1860, 2118, 3274, 3312], 'product': [1863, 3123], 'sizes': [1864], 'confirmed': [1866, 2006, 3699, 3709, 3768, 3852], 'agarose': [1869, 3471, 3504, 3854], 'gel,': [1870], 'bands': [1873, 3960, 3976], 'extracted': [1875, 2657], 'QIAquick': [1877], 'Gel': [1878], 'Extraction': [1879], '(Qiagen).TABLE': [1881], '2Oligonucleotide': [1882], 'usedPrimer': [1884], 'nameSequence': [1885], '(5′': [1886], '→': [1887], '3′)Digestion': [1888], 'siteHasAFAGTCCATGGAATACAAAGCGCAAGAAAGGAACNcoIHasARATCGCATGCCTCCCTTGTCAGAACCTAGGSphIHasBFGTCCATGGAAGAAATGAAAATTTCTGTAGCAGGNcoIHasBRATCGCATGCCTAGTCTCTTCCAAAGACATCTSphIHasCFGTCCATGGAAGAACTCATGACAAAGGTCAGAAAAGNcoIHasCRATCGCATGCGCTCTGCAATAGCTAAGCCASphIHasDFGTCCATGGAAAGGAATCAAAACATGAAAAACTACGNcoIHasDRATCTCTAGAACTATAGCTTACTGGGGCTGXbaIHasEDFCATCTAGACGAGGAATCAAAACATGAAAAACTACGXbaIHasEDRCAAAGCTTTATAGCTTACTGGGGCTGATCCGGGTGATGHindIIIHasD_F2ATGCAGTCATGATGGCAGhasD_R2TCCAACCTTTTCTTGGCTGHasEFGTCCATGGAAGGGAGTAAAATAATGTCACATATTACANcoIHasERATCGCATGCTTACAAGCGTGCGTTGASphI': [1889], 'introduced': [1898], 'restriction': [1899, 1932], 'sites': [1901], 'required': [1903], 'fragments': [1907], 'cloned': [1909, 3754, 4655], 'after': [1927], 'digestion': [1928], 'relevant': [1931], 'standard': [1935, 4021], 'recombinant': [1936, 1984], 'DNA': [1937, 3159, 3173, 4754], 'techniques': [1938], '(30.Sambrook': [1939], 'Russell': [1941], 'Cloning:': [1944], 'Laboratory': [1946, 1953], 'Manual.': [1947], '3rd': [1948], 'Ed.': [1949], 'Cold': [1950, 1955], 'Spring': [1951, 1956], 'Harbor': [1952], 'Press,': [1954], 'Harbor,': [1957], 'NY2001Google': [1958], 'plasmid-free': [1961], 'employed': [1977], 'selected': [1987, 2031], 'M17': [1989, 2033, 2045], 'agar': [1990, 2034, 2281], 'supplemented': [1991, 2035, 2046, 2283], '5': [1993, 2048, 2259, 2425, 2429, 2638, 2794, 2831, 2844, 3371, 4203], 'μg': [1994, 2038, 2286, 2366, 3358, 3361, 3381, 3512], 'ml−1': [1995, 2039, 2088, 2287, 2367, 2372, 2441, 2759], '(Cm).': [1997], 'full': [1999], 'sequence': [2001], 'insertion': [2003], 'site': [2004, 5236], 'Sanger': [2008], 'sequencing.': [2009], 'plasmid': [2011, 2216, 3592, 3653, 3671, 3694, 3788, 4033, 4071, 4112, 4158, 4164, 4187, 4269, 4305, 4358, 4695, 4722, 5120], 'subsequently': [2016, 2656], 'isolated': [2017], 'electrotransformed': [2021], 'Recombinant': [2025], '2.5': [2037, 2285, 2365, 4102], 'Cm.': [2040, 2288], 'Cells': [2041, 2739], 'grown': [2043, 2076], 'g': [2049, 2347, 2352, 2648, 2820], 'liter−1': [2050, 2348, 2353, 2359], '(M17G).': [2052], 'After': [2053, 2136, 2861], '12': [2054], 'h': [2055, 2918, 3525], 'incubation,': [2057], 'cells': [2058, 2073, 2153, 2208, 2273], 'inoculated': [2060, 3816], '100': [2062], 'ml': [2063, 2130, 2145, 2243, 2585, 2639, 2696, 3189, 3194, 3253], 'fresh': [2065], 'M17G': [2066, 2246, 2280], '0.05': [2068, 4055], 'A530': [2070, 2081, 2499], 'nm.': [2071, 2082, 2459], 'further': [2075, 3468, 4240, 5288], '0.6': [2079], 'Prior': [2083], 'harvesting,': [2085], '0.4': [2086, 2757], 'mg': [2087, 2358, 2758, 2979, 3129, 3887, 3908], 'hyaluronidase': [2090, 2761], 'added': [2092, 2249], 'additional': [2096], 'incubation': [2097, 2263], '37': [2099, 2265, 2295, 2396, 2653, 2920, 3418], 'another': [2102, 5247], 'before': [2105, 2945], 'centrifugation': [2106, 3305], '(Beckman': [2107, 3234], 'Coulter,': [2108, 3235], 'Avanti': [2109, 3236], 'J-26': [2110, 3237], 'XPI,': [2111, 3238], '5000': [2112, 2768], 'g,': [2114, 2770, 2869, 3241, 3270, 3308], '4': [2115, 2212, 2771, 2803, 2870, 3228, 3242, 3271, 3297, 3309, 4108, 4328], '10': [2117, 2774, 2873, 3205, 3360], 'supernatant': [2120, 2777, 2877], 'discarded,': [2122, 2779], 'pellet': [2125, 2139, 2782, 2807, 3248, 3276, 3285], 'washed': [2127, 2141, 2207, 2784, 3250], '20': [2129, 2346, 2370, 2439, 3244, 3273, 3311], '0.5': [2132, 2147], 'm': [2133, 2148, 2426, 2430, 2575, 2699, 3263, 3290, 3422], 'sucrose': [2134, 2149], 'solution.': [2135, 2150], 'centrifugation,': [2137], 'again': [2142, 3266], 'Finally,': [2151, 2805], 'resuspended': [2155, 2809, 3287], '250': [2157], 'μl': [2158, 2205, 2213, 3517], 'same': [2161], 'solution': [2162, 3256], '(31.Fong': [2163], 'Improving': [2166], 'Cellular': [2168], 'Economy': [2169], 'Zooepidemicus': [2172], 'through': [2173, 2543, 2843, 3210, 3316], 'Metabolic': [2174], 'Engineering.': [2175], 'Department': [2176, 2515], 'Chemical': [2178, 2517], 'Engineering,': [2179, 2518], 'University': [2180, 2519], 'Queensland,': [2182, 2521], 'Brisbane2002Google': [2183], 'Electroporation': [2185], 'Bio-Rad': [2190, 2568], 'Gene': [2191, 2433], 'PulserTM': [2192], 'pulse': [2194, 2240], 'control.': [2195], 'Ice-cold': [2196], 'cuvettes': [2197], 'path': [2199], 'length': [2200], '0.2': [2201], 'cm': [2202, 3507], '40': [2204], 'up': [2210], 'purified': [2215, 3182], 'DNA.': [2217], 'Voltage': [2218], 'set': [2220], '3.0': [2222], 'kV': [2223, 2227], '(equivalent': [2224], '15': [2226, 3188, 3193], 'cm−1),': [2228], 'resistance': [2229], '200': [2231, 3357], 'Ω,': [2232], 'capacitance': [2234], '25': [2236], 'microfarads.': [2237], 'Immediately': [2238], 'following': [2239], 'application,': [2241], '1.0': [2242], 'cold': [2245], 'broth': [2247, 3185], 'cells,': [2251], 'then': [2254], 'held': [2255], 'ice': [2257, 2829, 2858], 'prior': [2261, 2833, 3322], '2–3': [2268], 'h.': [2269], 'Aliquots': [2270], 'electroporated': [2272], '(100': [2274], 'μl)': [2275], 'spread': [2277], 'out': [2278], 'plates': [2282, 2290], 'incubated': [2292], 'overnight': [2293, 3226, 3295], '°C.': [2296, 2397, 3229], 'chemicals': [2298], 'purchased': [2300], 'Sigma-Aldrich,': [2302], 'unless': [2303], 'otherwise': [2304], 'specified.': [2305], 'chemically': [2307, 2747], 'defined': [2308, 2748], 'medium': [2309, 2363, 2749], 'modified': [2311], 'previously': [2313, 3552, 5161], 'described': [2314, 2617, 2669, 3475, 3551, 3936], 'media': [2315], '(32.van': [2316], 'de': [2317, 3015, 3059], 'Rijn': [2318, 3016], 'Kessler': [2320], 'R.E.': [2321], 'Infect.': [2322], 'Immun.': [2323], '1980;': [2324], '27:': [2325], '444-448Crossref': [2326], '33.Chong': [2330], '100:': [2337], '33-41Crossref': [2338], '(58)': [2341], 'adding': [2345, 2438], 'glucose,': [2350, 2557], '4.5': [2351], 'acetate,': [2355, 2555], '50': [2357, 3534], 'uridine.': [2361], 'contained': [2364], 'Cm': [2368], 'ng': [2371, 2440, 3144], 'nisin.': [2373, 4120, 4712], 'Growth': [2374, 2447], 'experiments': [2375], 'conducted': [2377, 2462], '2-liter': [2380], 'bioreactor': [2381], '(Applikon)': [2382], 'working': [2385], 'volume': [2386, 2532], '1.4': [2388], 'liter,': [2389], 'maintained': [2394, 2409, 2421], 'reactor': [2399], 'agitated': [2401], '300': [2403], 'rpm,': [2404], 'anaerobic': [2406], 'top': [2411], 'sparging': [2412], 'nitrogen': [2413], 'fermentation.': [2415], 'During': [2416], 'experiment,': [2418], 'pH': [2419, 2797], '6.7': [2423], 'NaOH': [2427], 'HCl': [2431], 'additions.': [2432], 'induced': [2436], 'nisin': [2443, 4122, 4137, 4176], 'medium.': [2446], 'monitored': [2449], 'every': [2450], 'hour': [2451], 'measuring': [2453, 2957, 3401], 'optical': [2455, 2481], 'density': [2456, 2482], '530': [2458, 2486], 'Experiments': [2460], 'duplicates': [2466], 'independent': [2468], 'insertions': [2470], 'mutant': [2473], 'strains.': [2474, 4271, 4286], 'Samples': [2475, 3207, 3313, 3494, 3509], 'collected': [2477], 'hourly,': [2478], 'measured': [2484, 2561, 2591, 2615, 2907, 2992, 3003, 3033, 3075, 3395, 3630], 'nm': [2487], 'converted': [2489, 3121], 'biomass': [2491, 3871, 4008, 4378, 4394, 4412], 'equation:': [2494], 'Biomass': [2495], '(g': [2496], 'liter−1)': [2497], '0.26': [2501], '0.01': [2503, 4051], '(34.Goh': [2504], 'Fermentation': [2506], 'Studies': [2507], 'Hyaluronic': [2509], 'Acid': [2510], 'Production': [2511], 'Brisbane1998Google': [2522], 'remaining': [2525, 4407], 'sample': [2526, 2864], 'mixed': [2528, 2817, 3218], 'equal': [2531], '0.1%': [2534, 2948, 3196], 'SDS': [2535, 2949, 3198], 'remove': [2537, 2763], 'filtered': [2542, 3209, 3315], 'syringe': [2545], 'filter': [2546, 3213, 3319], '(Millex-GS': [2547, 3320], 'MSE': [2548], '0.45': [2549], 'μm)': [2550], 'cell': [2552, 2641, 2910, 2972, 3132], 'removal.': [2553], 'Lactate,': [2554], 'formate,': [2556], 'ethanol': [2559, 3223], 'high-performance': [2563, 2710, 5629], 'liquid': [2564, 5630], 'chromatography': [2565, 2712, 5631], 'HPX-87': [2569], 'H': [2570], 'column': [2572], 'H2SO4': [2576], 'eluant': [2578], 'flow': [2581], 'min−1.': [2586], 'turbidimetric': [2594], 'quantification': [2595, 3167], 'assay': [2596], '(35.DI': [2597], 'Ferrante': [2598], 'N.': [2599], '1956;': [2603], '220:': [2604], '303-306Abstract': [2605], 'Intracellular': [2612], 'metabolites': [2613, 2689], 'elsewhere': [2618, 2670], '(36.Marcellin': [2619, 2721], 'Abeydeera': [2623, 2725, 5626], 'Krömer': [2625, 2727], 'J.O.': [2626, 2728], '2009;': [2629, 2731], '4:': [2630, 2732], '58-63Crossref': [2631, 2733], '(27)': [2634, 2736], 'Briefly,': [2637], 'suspension': [2642], 'centrifuged': [2644, 2866, 3233, 3267], '50,000': [2646], 'boiling': [2659, 2943], 'ethanol.': [2660], 'Extracts': [2661], 'enriched': [2663], 'SAX': [2665], 'resin': [2666], 'columns': [2667, 2693], '(37.Jensen': [2671], 'N.B.': [2672], 'Jokumsen': [2673], 'K.V.': [2674], 'Villadsen': [2675], '356-362Crossref': [2681], 'except': [2687, 4390], 'eluted': [2691], '0.15': [2698, 3262, 3289, 3421], 'sodium': [2700, 2704], 'citrate': [2701], 'instead': [2702], 'acetate.': [2705], 'Metabolites': [2706], 'analyzed': [2708, 3365, 3469, 3736], 'anion-exchange': [2711], 'quantified': [2714], 'via': [2715], 'integrated': [2717], 'pulsed': [2718], 'amperometric': [2719], 'detector': [2720], 'harvested': [2741], 'exponential': [2744], 'phase': [2745], 'fermentation': [2750, 4141], 'cultures': [2751], '(A530': [2752], '∼': [2753, 3659, 4157], '2.0),': [2754], 'treated': [2755], 'pelleted': [2766], 'min.': [2775, 3206], 'wash': [2787, 2811], 'buffer': [2788, 2812], '(50': [2789], 'mm': [2790, 2795], 'potassium': [2791], 'dihydrogen': [2792], 'phosphate,': [2793], 'EDTA,': [2796], '7,': [2798], '10%': [2800, 4299], 'v/v': [2801], 'glycerol,': [2802], '°C).': [2804], 'protease': [2814], 'inhibitor': [2815], '1.44': [2819], '100-μm': [2822], 'glass': [2823], 'beads.': [2824], 'Tubes': [2825], 'chilled': [2827], 'disruption': [2835], 'Mini': [2838], 'Bead': [2839], 'Beater': [2840], '(Biospec': [2841], 'Products)': [2842], 'beating': [2849], '5,000': [2851], 'rpm': [2852], 'between': [2859, 3688, 3730, 4488, 5141, 5156, 5258], 'cycles.': [2860], 'lysis,': [2862], '(13,000': [2867], 'min),': [2874, 3245], 'aliquoted': [2879], 'stored': [2881], '−80': [2883], 'until': [2885], 'analysis.': [2886, 3324, 5632], 'Protein': [2887], 'content': [2888, 3335, 3347, 3375], 'extracts': [2891], 'determined': [2893, 3138, 3431], 'commercial': [2896], '(DC': [2898], 'protein': [2899, 3334, 3346, 3374], 'assay,': [2900], 'Bio-Rad).': [2901], 'HasA': [2905], 'incubating': [2909, 3200], 'extract': [2911], 'UDP-GlcNAc': [2913, 4512, 4553, 4944, 4956, 4983, 5087, 5144, 5159, 5210, 5428, 5439, 5455, 5611], '(38.Yu': [2922], 'H.': [2923, 5506], 'Stephanopoulos': [2924, 5507], 'Metab.': [2926, 5509], '10:': [2929, 5512], '24-32Crossref': [2930, 5513], '(126)': [2933, 5516], 'reaction': [2937], 'stopped': [2939], 'immersion': [2941], 'water,': [2944], 'molecules': [2953], 'membranes': [2955], 'carbazole': [2962], 'assay.': [2963], 'unit/mg': [2969], 'dry': [2971, 2984, 3280, 3283], 'equivalent': [2976], 'generated/min/mg': [2982], 'cell.': [2985], 'HasB,': [2986], 'HasC,': [2987], 'HasE': [2989, 3072], 'activities': [2990, 3114], 'NADH/NADPH-linked': [2994], 'assays': [2996, 3771], 'room': [2998, 3202, 3527], 'temperature.': [2999], 'HasB': [3000], 'conversion': [3007, 3036, 3044, 3078, 3087], 'UDP-Glc': [3009, 3041, 3046, 3051, 4481, 4917], '(39.Dougherty': [3012], 'van': [3014], '7118-7124Abstract': [3023], 'HasC': [3030], '1-phosphate': [3039], 'coupled': [3042, 3085], 'excess': [3050, 3094], '(40.Grobben': [3053], 'G.J.': [3054], 'Sikkema': [3057], 'Bont': [3060], 'J.A.': [3061], '1996;': [3065], '46:': [3066], '279-284Crossref': [3067], '(121)': [3069], 'fructose': [3080, 5398, 5418], '6-phosphate': [3081, 3084, 3090, 5396], '6-phosphogluconate': [3092], 'glucose-6-phosphate': [3095], '(41.Degeest': [3097], 'De': [3099], 'Vuyst': [3100], '3519-3527Crossref': [3107], '(128)': [3110], 'Specific': [3113], 'expressed': [3116], 'nanomoles': [3118], 'substrate': [3120], 'total': [3131, 3146, 3568, 3804], 'protein.': [3133], 'HasD': [3134], 'transcript': [3135, 5340], 'reverse': [3140, 4384], 'transcription-PCR': [3141], '500': [3143], 'RNA': [3147], 'template': [3150], 'HasD_F2': [3153], 'HasD_R2': [3155], 'amplifying': [3156], '398-bp': [3158], 'fragment': [3160], 'gene,': [3164], 'band': [3169], 'intensity': [3170], 'gel': [3174, 3472, 3855, 3921], '(Scion': [3175], 'Image,': [3176], 'version': [3177], '4.0.3.2).': [3178], 'samples': [3180, 3338, 3466], 'mixing': [3187], 'w/v': [3197, 3258, 3261], '0.22-μm': [3212, 3318], '(Steritop-GP,': [3214], '0.22': [3215], 'μm,': [3216], 'polyethersulfone),': [3217], 'volumes': [3221], 'left': [3225], 'mixture': [3231], '9630': [3239], 'ethanol/saline': [3255], '(75%': [3257], 'ethanol,': [3259], '25%': [3260], 'NaCl)': [3264], '(17,600': [3268, 3306], 'allowed': [3278], 'overnight.': [3281], 'NaCl': [3291, 3423], 'gentle': [3293], 'rocking': [3294], 'undissolved': [3300], 'matter': [3301], 'removed': [3303], 'MSE)': [3321], 'Two-dimensional': [3325], 'Quant': [3326], '(Amersham': [3327], 'Biosciences)': [3328], 'determine': [3332], '(WT,': [3339], 'MT,': [3340], 'HasED)': [3342], 'compared': [3344, 5347], 'against': [3345, 4031], 'two': [3349, 4124, 4941, 5270], 'clinical': [3350], 'samples.': [3352], 'dilution': [3354], 'series': [3355], 'each': [3367, 3626], 'sample.': [3368], 'samples,': [3372], 'limit': [3379], '(1': [3380], 'bovine': [3383], 'serum': [3384], 'albumin)': [3385], 'corresponding': [3386, 3879], 'purity': [3389], '99.5%.': [3391], 'Intrinsic': [3392], 'viscosity': [3393, 3400, 3435], 'Lauda': [3398], 'Processor': [3399], 'Ubbelohde': [3405], 'Dilution': [3406], 'Capillary': [3407], '(0.63-mm': [3408], 'diameter': [3409], '5700-mm3': [3411], 'volume).': [3412], 'measurements': [3414], 'diluent.': [3425], 'average': [3427, 4092], 'Mark-Houwink-Sakurada': [3438], 'equation': [3439], '(Equation': [3440], '1),': [3441], '[η]=0.0292×M−W−0.7848(Eq.': [3442], '1)': [3443, 5029], 'parameters': [3445], 'standards': [3448], '(Healon': [3453], 'GV,': [3454], 'Healon': [3455], 'OVD,': [3456], 'Sigma-Aldrich': [3457], '(cat.': [3458], 'nos.': [3459], 'H9390,': [3460], '53747,': [3461], 'H5388)).': [3463], 'Purified': [3464], 'electrophoresis': [3473, 3856, 3922], 'study': [3479], '(42.Lee': [3480, 3553, 3941], 'H.G.': [3481, 3554, 3942], 'Cowman': [3482, 3555, 3943], 'M.K.': [3483, 3556, 3944], 'Anal.': [3484, 3557, 3945], '219:': [3487, 3560, 3948], '278-287Crossref': [3488, 3561, 3949], '(261)': [3491, 3564, 3952], 'separated': [3496], 'Sub-Cell': [3499], 'GT': [3500], '(Bio-Rad)': [3501], '0.5%': [3503], 'gels': [3505], '(25': [3506], 'long).': [3508], '7': [3511], '14': [3516], 'MilliQ': [3519], 'water': [3520], 'electrophoresed': [3522], '16': [3524], 'constant': [3531], 'voltage': [3532], 'V.': [3535], 'Select-HA': [3536], 'Hiladder': [3537, 3955], 'Mega-HA': [3539, 3970], 'ladder': [3540, 3971], '(Hyalose)': [3541, 3984], 'reference.': [3546], 'Staining': [3547], '26': [3570, 3806], 'batch': [3571, 3807], 'fermentations': [3572, 3808, 4126], '6': [3576, 4226], 'replicates': [3578], 'per': [3579], '8': [3584], 'strains:': [3585], 'wild': [3586, 3784, 3927], '(nWT': [3588], '5),': [3590], 'empty': [3591, 3652, 3670, 3693, 3787, 4032, 4070, 4186, 4304, 4357, 4721, 4851, 5119], '(nMT': [3593], '6),': [3595], '(nA': [3597], '2),': [3599, 3603, 3607, 3611, 3847, 4214], '(nB': [3601], '(nC': [3605], '(nD': [3609], '(nE': [3613], '4),': [3615], 'double': [3618, 3796], 'construct,': [3620, 3798], 'hasED': [3621, 4979, 4997, 5110], '(nED': [3622], '3).': [3624, 3781, 3858], 'For': [3625], 'four': [3629, 5580], 'growth': [3634, 3866, 4254], 'rate,': [3635, 3867], 'yield': [3636, 3640, 3872, 4294, 4325, 4341, 4353, 4373, 4379, 4413, 4867, 5102, 5116, 5127, 5617], 'biomass,': [3642], 'fitted': [3647, 3680], 'R': [3649], 'control,': [3656, 4188, 4853], 'MWi': [3658], 'MWMT': [3660], '+': [3661, 4159], 'ΔMWi,': [3662], 'i.e.': [3663], 'ΔMWi': [3664], 'represents': [3665], 'difference': [3667, 3687], 'i,': [3674], 'significance': [3677, 3684], 'i': [3690], 'strain.': [3695, 5010], 'Variance': [3696], 'homogeneity': [3697], 'Bartlett': [3702], 'test': [3703, 3742], 'normality': [3705], 'residuals': [3708], 'Shapiro-Wilk': [3712], 'test.': [3713], '95%': [3714, 4018], 'confidence': [3715, 4019], 'intervals': [3716, 4020], 'calculated': [3718], 'pooled': [3721], 'residual': [3722], 'error': [3723, 4022], '18': [3725], 'degrees': [3726], 'freedom.': [3728], 'Correlations': [3729], "Spearman's": [3739], 'rank': [3740], 'correlation': [3741, 4487], 'encoded': [3748], 'under': [3757], 'nisin-inducible': [3762], 'promoter.': [3763], 'Following': [3764], 'transformation,': [3765], 'or,': [3772], 'hasD,': [3777], 'quantitative': [3778], 'Eight': [3782], '(WT),': [3786], '(pNZ8148),': [3789], 'individual': [3792, 3834], 'hasED,': [3799], 'characterized': [3801, 3838, 3862], '1.4-liter': [3812], 'bioreactor.': [3813], 'Fermentations': [3814, 3836, 3859], 'separate': [3820], 'transformation': [3821], 'events': [3822], 'avoid': [3824], 'impact': [3826], 'fortuitous': [3828], 'deleterious': [3830], 'random': [3831], 'mutations': [3832], 'colonies.': [3835], 'terms': [3840, 3864], 'viscometry': [3845], 'trends': [3850], 'yield,': [3869, 4309, 4389], '4).TABLE': [3874], '3Activity': [3875], 'overexpressed': [3880, 4657], 'strainsStrainWT': [3881], 'activity-Fold': [3883], 'increaseHasA0.5': [3884], '0.0a10−3': [3886], 'HA.min−1.mg': [3888, 3909], 'protein−1.1.5': [3889], '0.1HasB40.9': [3891], '1.0bnmol.min−1.mg': [3893], 'protein−1.5.0': [3894, 3904], '0.2HasC11.1': [3896], '0.5bnmol.min−1.mg': [3898], 'protein−1.4.7': [3899], '0.6HasE1500': [3901], '200bnmol.min−1.mg': [3903], '0.9a': [3906], '10−3': [3907], 'protein−1.b': [3910], 'nmol.min−1.mg': [3911], 'protein−1.': [3912], 'FIGURE': [3919], '3Agarose': [3920], 'seven': [3930], 'engineered': [3931, 4285], 'Lee': [3938, 5558], 'et': [3939], 'al.': [3940], '(lane': [3956, 3972], '1,': [3957], 'are': [3961, 3977, 4009, 4399, 4837, 5088], '1510,': [3962], '1090,': [3963], '966,': [3964], '572,': [3965], '495': [3967], 'kDa)': [3968, 3983], '15,': [3973], '6100,': [3978], '4570,': [3979], '3050,': [3980], '1520': [3982], 'references.View': [3988], 'Large': [3989, 4061], 'Image': [3990, 4062], 'Figure': [3991, 4063], 'ViewerDownload': [3992, 4064], 'Hi-res': [3993, 4065], 'image': [3994, 4066], 'Download': [3995, 4067], '(PPT)FIGURE': [3996], '4Growth': [3997], 'rates': [3998], 'yields': [4000, 4395], 'mid-exponential': [4002], 'growth.': [4003], 'Yields': [4004], 'percentage': [4012], 'glucose.': [4014], 'Error': [4015], 'bars': [4016], 'mean': [4025], 'estimates.': [4026], 'Statistical': [4027], 'tests': [4028], '(MT)': [4035], 'values': [4038], 'indicated': [4039], 'range:': [4042], '0': [4043], '<': [4044], '***': [4045], '≤': [4046, 4048, 4050, 4052, 4054, 4056, 4059], '0.001': [4047], '**': [4049], '*': [4053], 'asterisk': [4058], '1.View': [4060], '(PPT)': [4068], '(pNZ8148)': [4072], 'large': [4075], 'significant': [4077, 4168, 4423, 4539, 4863, 4872, 4914], 'presence': [4087, 4708], 'plasmid,': [4090], '(p': [4106, 4170, 4180, 4192, 4196, 4201, 4224, 4236, 4248, 4262, 4278, 4313, 4326, 4342, 4374, 4396, 4424], '10−7).': [4110], 'due': [4116, 5388], 'inducer,': [4119], 'Including': [4121], 'masses': [4129], '1.9': [4131], 'MDa,': [4134, 4992], 'excluding': [4136], '2.6.': [4147], 'Assuming': [4148], 'variance': [4149], 'homogeneity,': [4150], 'analysis': [4154], '(molecular': [4155], 'nisin)': [4160], 'showed': [4161], 'alone': [4165, 4232, 4531, 4977], '10−4),': [4174, 4330], '0.962).': [4182], 'Relative': [4183, 4848], '0.012),': [4194], '0.006),': [4198], '10−4)': [4205], 'negative': [4208], 'strong': [4221, 5299], 'positive': [4222], '10−6).': [4228, 4252], '0.843),': [4238], 'combined': [4245], 'marginally': [4261], '0.047)': [4264], 'higher': [4265, 5338, 5344], 'than': [4266, 4282, 4435, 5117, 5401], 'grew': [4276], 'significantly': [4277, 4312, 4371, 4981, 5114], '0.027)': [4280], 'slower': [4281], 'Our': [4287, 5130], 'around': [4298], '(w/w)': [4300], '4).': [4302, 5129], 'appears': [4306, 4380], 'increase': [4308, 4323, 4460, 4479, 4540, 4685, 4699, 4864, 4915, 5381, 5426], 'although': [4310], '0.162).': [4315], '47%': [4322], 'led': [4335], '37%': [4338], 'decrease': [4339, 4929], '0.002).': [4344], 'Strains': [4345], 'expressing': [4363], 'both': [4364, 4391, 4417, 4552, 4975], '0.009).': [4376], 'follow': [4382], 'pattern': [4385], '0.001)': [4398], 'hasA.': [4404], 'Among': [4405], 'statistically': [4422], '0.021).': [4426], 'expected': [4439, 4478], 'level': [4443], 'UPD-GlcNAc.': [4450], 'resulted': [4456, 4475, 4911], 'dramatic': [4459], '11-fold': [4465], '7-fold,': [4467], 'respectively': [4468], '5).': [4470, 5095], 'levels.': [4482], 'However,': [4483], '(or': [4490, 5414], 'UDP-Glc)': [4491], "(Spearman's": [4498], 'ρ': [4499], 'test,': [4500], '0.633).': [4503], 'contrast,': [4505], '10−5).': [4520], 'absence': [4522, 4536], 'mirrored': [4533], 'UDP-GlcNAc,': [4542, 5261], 'alone.': [4546], 'combination': [4548], 'hasE,': [4550], 'however,': [4551, 5282], 'their': [4558], 'values.': [4560], 'explored': [4579], 'commonly': [4581], 'stated': [4582], 'unproven': [4584], 'polysaccharides': [4591], 'depends': [4596], '(23.Cartee': [4604], '43.Tlapak-Simmons': [4628], 'Kumari': [4632, 5061, 5177], 'Heldermon': [4634, 5063, 5179], 'C.': [4635, 5064, 5180], '274:': [4642, 5071, 5187], '4246-4253Abstract': [4643, 5072, 5188], '3),': [4669], 'manipulate': [4671], 'To': [4678], 'our': [4679], 'surprise,': [4680], 'noted': [4682], '41%': [4684], 'harboring': [4692], 'associated': [4705, 4926], 'inducer': [4711], 'Interestingly,': [4713], 'response': [4718], 'heterologous': [4727, 5462], 'production': [4728, 4787], 'Bacillus': [4732], 'subtilis': [4733, 5520], '(44.Sloma': [4734], 'Behr': [4736, 5523], 'Widner': [4738], 'W.': [4739], 'Tang': [4740, 5528], 'Sternberg': [4742, 5534], 'Brown': [4744, 5540], 'Novozymes': [4746], 'Biotech,': [4747], 'Inc.,': [4748], '2003Google': [4749], 'suggesting': [4751, 4960], 'foreign': [4753], 'stress': [4755, 4767, 4846], 'beneficial': [4757, 4781], 'Indeed,': [4762], 'general': [4769], '(plasmid': [4770], 'stress,': [4771], 'aerobic': [4772], 'conditions,': [4773], 'changes': [4774], 'pH,': [4776], 'temperature)': [4779], 'Transcriptome,': [4832], 'proteome,': [4833], 'metabolome': [4835], 'analyses': [4836], 'underway': [4838], 'identify': [4840], 'basis': [4843], 'effect.': [4847], 'vector': [4852], '(hasA)': [4860], 'caused': [4861], '4)': [4869], 'lowering': [4873, 4880, 5411], 'explained': [4886], 'competition': [4889, 5200, 5257], 'fixed': [4892], 'pool': [4893], 'UDP-monomers': [4895], 'leading': [4896], '(hasC)': [4918], '(hasB': [4921], 'hasC)': [4923], '5)': [4925, 4959], 'Increasing': [4935], 'last': [4940], 'steps': [4942], '(hasD)': [4946], '2)': [4954, 5083], 'upstream': [4963], 'step': [4964], 'limiting.': [4966], 'limitation': [4968], 'could': [4969, 5620], 'overcome': [4971], 'hasE;': [4974], 'together': [4980], 'mass.': [4987], 'At': [4988], 'evidently': [5017], 'different': [5018], 'introduction):': [5028], 'With': [5030], 'current': [5032], 'evidence,': [5033], 'monomeric,': [5039], 'polymerize': [5043], 'directly': [5044], 'without': [5047], 'need': [5049], 'initiation': [5052], 'complex': [5053], 'covalent': [5055], 'modifications': [5056], '(43.Tlapak-Simmons': [5057, 5173], 'Both': [5084], 'relatively': [5089], '3)': [5096], 'Unlike': [5097], 'pneumoniae,': [5099], 'did': [5103], 'correlate': [5105], 'weight;': [5108], 'maximum': [5134, 5613], 'requires': [5137], 'optimal': [5139], 'toward': [5153], 'Competition': [5155, 5216], 'HAS': [5172], 'attributed': [5202], 'affinity': [5205], 'binding': [5211], 'site,': [5212], 'vice': [5214], 'versa.': [5215], 'seen': [5219], 'nucleotides': [5223], 'even': [5225], 'UDP.': [5226], 'occurs': [5233], 'nucleotide': [5240], 'blocked': [5242], 'too': [5244], 'long': [5245], 'nucleotide.': [5249], 'If': [5250, 5406], 'dictated': [5254], 'must': [5263, 5386], 'optimum': [5266, 5606], 'ratio': [5267, 5393, 5598, 5607], 'study.': [5279, 5303], 'points': [5283], 'strategies': [5286, 5452], 'enhance': [5289, 5454], '(pgi)': [5295], 'surprisingly': [5298], 'lactic': [5308], 'bacterium': [5310], 'active': [5314], 'Embden-Meyerhof-Parnas': [5315], '∼80%': [5318], 'processed': [5323], 'pyruvate': [5325], 'indicating': [5326], 'inherently': [5331], 'high.': [5332], '4-fold': [5337], '2-fold': [5343], 'non-mucoid': [5349], 'silenced': [5357], 'Hence,': [5375], 'benefit': [5377], '5-fold': [5380], 'shift': [5390], '6-phosphate,': [5399], 'rather': [5400], 'overcoming': [5402], 'metabolic': [5404], 'bottleneck.': [5405], 'case,': [5410], 'phosphofructokinase': [5412], 'increasing': [5415], 'Km': [5416], '6-phosphate)': [5419], 'would': [5420, 5449], 'alternative': [5423, 5451], 'strategy': [5424], 'fructose-6-phosphate,': [5427], '(i.e.': [5441], 'GlmS': [5442], 'GlmM)': [5444], 'feeding': [5446], 'glucosamine': [5448], 'concentration.': [5456], 'hosts,': [5463, 5581], 'including': [5464], 'Enterococcus': [5465], 'faecalis': [5466], '(45.DeAngelis': [5467], '14568-14571Abstract': [5478], 'Escherichia': [5485], 'coli': [5486], '38.Yu': [5505], '(46.Widner': [5521], 'Von': [5525], 'Dollen': [5526], 'Heu': [5530], 'Sloma': [5532], 'Deangelis': [5536], '71:': [5546], '3747-3752Crossref': [5547], '(227)': [5550], '(47.Chien': [5556], 'L.J.': [5557], 'C.K.': [5559], '77:': [5564], '339-346Crossref': [5565], '(87)': [5568], 'Given': [5571], 'superior': [5572], 'tools': [5573], 'engineering': [5576], 'latter': [5579], 'prove': [5584], 'easier': [5585], 'microbial': [5588], 'producers': [5593], 'targeting': [5595], 'UDP-GlcNAc/UDP-GlcUA': [5597], 'hosts.': [5601], 'Using': [5602], 'systems,': [5604], 'determined.': [5622], 'thank': [5624], 'Peter': [5625]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2073329740', 'counts_by_year': [{'year': 2024, 'cited_by_count': 3}, {'year': 2023, 'cited_by_count': 5}, {'year': 2022, 'cited_by_count': 6}, {'year': 2021, 'cited_by_count': 6}, {'year': 2020, 'cited_by_count': 9}, {'year': 2019, 'cited_by_count': 4}, {'year': 2018, 'cited_by_count': 4}, {'year': 2017, 'cited_by_count': 4}, {'year': 2016, 'cited_by_count': 9}, {'year': 2015, 'cited_by_count': 7}, {'year': 2014, 'cited_by_count': 9}, {'year': 2013, 'cited_by_count': 6}, {'year': 2012, 'cited_by_count': 8}], 'updated_date': '2024-12-11T04:36:40.822783', 'created_date': '2016-06-24'}