Title: Structural and Spectroscopic Characterization of P450 BM3 Mutants with Unprecedented P450 Heme Iron Ligand Sets
Abstract: Two novel P450 heme iron ligand sets were generated by directed mutagenesis of the flavocytochrome P450 BM3 heme domain. The A264H and A264K variants produce Cys-Fe-His and Cys-Fe-Lys axial ligand sets, which were validated structurally and characterized by spectroscopic analysis. EPR and magnetic circular dichroism (MCD) provided fingerprints defining these P450 ligand sets. Near IR MCD spectra identified ferric low spin charge-transfer bands diagnostic of the novel ligands. For the A264K mutant, this is the first report of a Cys-Fe-Lys near-IR MCD band. Crystal structure determination showed that substrate-free A264H and A264K proteins crystallize in distinct conformations, as observed previously in substrate-free and fatty acid-bound wild-type P450 forms, respectively. This, in turn, likely reflects the positioning of the I α helix section of the protein that is required for optimal configuration of the ligands to the heme iron. One of the monomers in the asymmetric unit of the A264H crystals was in a novel conformation with a more open substrate access route to the active site. The same species was isolated for the wildtype heme domain and represents a novel conformational state of BM3 (termed SF2). The "locking" of these distinct conformations is evident from the fact that the endogenous ligands cannot be displaced by substrate or exogenous ligands. The consequent reduction of heme domain conformational heterogeneity will be important in attempts to determine atomic structure of the full-length, multidomain flavocytochrome, and thus to understand in atomic detail interactions between its heme and reductase domains. Two novel P450 heme iron ligand sets were generated by directed mutagenesis of the flavocytochrome P450 BM3 heme domain. The A264H and A264K variants produce Cys-Fe-His and Cys-Fe-Lys axial ligand sets, which were validated structurally and characterized by spectroscopic analysis. EPR and magnetic circular dichroism (MCD) provided fingerprints defining these P450 ligand sets. Near IR MCD spectra identified ferric low spin charge-transfer bands diagnostic of the novel ligands. For the A264K mutant, this is the first report of a Cys-Fe-Lys near-IR MCD band. Crystal structure determination showed that substrate-free A264H and A264K proteins crystallize in distinct conformations, as observed previously in substrate-free and fatty acid-bound wild-type P450 forms, respectively. This, in turn, likely reflects the positioning of the I α helix section of the protein that is required for optimal configuration of the ligands to the heme iron. One of the monomers in the asymmetric unit of the A264H crystals was in a novel conformation with a more open substrate access route to the active site. The same species was isolated for the wildtype heme domain and represents a novel conformational state of BM3 (termed SF2). The "locking" of these distinct conformations is evident from the fact that the endogenous ligands cannot be displaced by substrate or exogenous ligands. The consequent reduction of heme domain conformational heterogeneity will be important in attempts to determine atomic structure of the full-length, multidomain flavocytochrome, and thus to understand in atomic detail interactions between its heme and reductase domains. The cytochromes P450 (P450s) 4The abbreviations used are: P450s, cytochromes P450; MCD, magnetic circular dichroism; WT, wild type; NIR, near-IR; CT, charge transfer; SF, substrate-free conformation; SB, substrate-bound conformation; r.m.s.d., root mean square deviation. are a superfamily of heme b-containing monooxygenase enzymes found in organisms from all domains of life (e.g. Refs. 1Denisov I.G. Makris T.M. Sligar S.G. Schlichtling I. Chem. Rev. 2005; 105: 2253-2277Crossref PubMed Scopus (1658) Google Scholar and 2Munro A.W. Lindsay J.G. Mol. Microbiol. 1996; 20: 1115-1125Crossref PubMed Scopus (136) Google Scholar). They catalyze the oxygenation (often hydroxylation) of a wide range of molecules in nature, exploiting a transient ferryl-oxo heme iron intermediate to facilitate addition of oxygen to the substrate (1Denisov I.G. Makris T.M. Sligar S.G. Schlichtling I. Chem. Rev. 2005; 105: 2253-2277Crossref PubMed Scopus (1658) Google Scholar). They are intensively studied due to their integral roles in, e.g., mammalian drug metabolism, steroid and sterol synthesis, polyketide antibiotic manufacture, and prokaryotic breakdown of recalcitrant pollutants (e.g. Refs. 3Guengerich F.P. Chem. Res. Toxicol. 2001; 14: 611-650Crossref PubMed Scopus (1407) Google Scholar and 4McLean K.J. Sabri M. Marshall K.R. Lawson R.J. Lewis D.G. Clift D. Balding P.R. Dunford A.J. Warman A.J. McVey J.P. Quinn A.M. Sutcliffe M.J. Scrutton N.S. Munro A.W. Biochem. Soc. Trans. 2005; 33: 796-801Crossref PubMed Scopus (94) Google Scholar). The Bacillus megaterium P450 BM3 enzyme is one of the most intensively studied members of the superfamily. It is a rare example of a prokaryotic P450 that obtains electrons for reductive activation of dioxygen from a eukaryotic-type redox partner. The fatty acid hydroxylase P450 receives electrons from NADPH via a FAD- and FMN-containing diflavin reductase (NADPH-cytochrome P450 reductase) that is also fused to the P450 in a single polypeptide chain (5Narhi L.O. Fulco A.J. J. Biol. Chem. 1987; 262: 6683-6690Abstract Full Text PDF PubMed Google Scholar, 6Miles J.S. Munro A.W. Rospendowski B.N. Smith W.E. McKnight J.E. Thomson A.J. Biochem. J. 1992; 288: 503-509Crossref PubMed Scopus (134) Google Scholar, 7Oster T. Boddupalli S.S. Peterson J.A. J. Biol. Chem. 1991; 266: 22718-22725Abstract Full Text PDF PubMed Google Scholar). The fusion arrangement facilitates efficient electron transfer between the redox cofactors in P450 BM3 and affords the enzyme the highest oxygenase rate of any P450 reported to date (>15,000 min-1 with arachidonic acid) (8Noble M.A. Miles C.S. Chapman S.K. Lysek D.A. MacKay A.C. Reid G.A. Hanzlik R.P. Munro A.W. Biochem. J. 1999; 339: 371-379Crossref PubMed Scopus (244) Google Scholar). Substrate binding controls the reduction potential of the heme iron and accelerates FMN-to-heme electron transfer in the presence of fatty acids to ensure coupling of NADPH oxidation to fatty acid hydroxylation (9Daff S.N. Chapman S.K. Turner K.L. Holt R.A. Govindaraj S. Poulos T.L. Munro A.W. Biochemistry. 1997; 36: 13816-13823Crossref PubMed Scopus (208) Google Scholar). The enzyme was shown recently to be functional as a fatty acid hydroxylase in the dimeric form, as demonstrated previously for eukaryotic nitricoxide synthase enzymes (10Neeli R. Girvan H.M. Lawrence A. Warren M.J. Leys D. Scrutton N.S. Munro A.W. FEBS Lett. 2005; 579: 5582-5588Crossref PubMed Scopus (105) Google Scholar, 11Siddhanta U. Presta A. Fan B. Wolan D. Rousseau D.L. Stuehr D.J. J. Biol. Chem. 1998; 273: 18950-18958Abstract Full Text Full Text PDF PubMed Scopus (184) Google Scholar). The P450s are the best characterized of the thiolate-ligated cytochromes, with a loosely associated water molecule generally located in the sixth (distal) position on the heme iron (1Denisov I.G. Makris T.M. Sligar S.G. Schlichtling I. Chem. Rev. 2005; 105: 2253-2277Crossref PubMed Scopus (1658) Google Scholar). This position is vacated in catalysis to allow binding of dioxygen to ferrous iron. Nitric-oxide synthase enzymes have the same heme ligand set and also activate oxygen, and chloroperoxidase (an enzyme involved in antibiotic synthesis in the fungus Caldariomyces fumago) is a further example of an enzyme with a cysteine-coordinated heme iron (12Stuehr D.J. Santolini J. Wang Z.Q. Wei C.C. Adak S. J. Biol. Chem. 2004; 279: 36167-36170Abstract Full Text Full Text PDF PubMed Scopus (426) Google Scholar, 13Sundaramoorthy M. Terner J. Poulos T.L. Structure. 1995; 3: 1367-1377Abstract Full Text Full Text PDF PubMed Scopus (413) Google Scholar). However, relatively few other cysteinate-containing ligand sets are observed naturally. Cys-His coordination was seen in the Rhodovulum sulfidophilum SoxAX enzyme (heme 2) and in cystathionine β-synthase (14Cheesman M.R. Little P.J. Berks B.C. Biochemistry. 2001; 40: 10562-10569Crossref PubMed Scopus (52) Google Scholar, 15Meiyer M. Janosik M. Kery V. Kraus J.P. Burkhard P. EMBO J. 2001; 20: 3910-3916Crossref PubMed Scopus (275) Google Scholar). Cys-Pro (terminal amine) coordination was also seen in the CO-sensing CooA (16Roberts G.P. Kerby R.L. Youn H. Conrad M. J. Inorg. Biochem. 2005; 99: 280-292Crossref PubMed Scopus (86) Google Scholar). Thiolate-ligated hemoproteins have strong spectroscopic signals recognizable by, e.g., UV-visible absorption and EPR spectroscopy (17Lawson R.J. Leys D. Sutcliffe M.J. Kemp C.A. Cheesman M.R. Smith S.J. Clarkson J. Smith W.E. Haq I. Perkins J.B. Munro A.W. . 2004; 43: 12410-12426Google Scholar). However, identifying a ligand trans to thiolate, in absence of structural detail, can be difficult, and was the subject of detailed studies by Dawson and co-workers (18Dawson J.H. Andersson L.A. Sono M. J. Biol. Chem. 1982; 257: 3606-3617Abstract Full Text PDF PubMed Google Scholar, 19Sono M. Hager L.P. Dawson J.H. Biochim. Biophys. Acta. 1991; 1078: 351-359Crossref PubMed Scopus (33) Google Scholar). Magnetic circular dichroism (MCD) in the near-IR region of ferric hemoproteins is also a sensitive technique for identifying heme ligands, using the position of charge-transfer features of high (CT1) and low spin (CTLS) heme to assign ligation (20Cheesman M.R. Zumft W.G. Thomson A.J. Biochemistry. 1998; 37: 3994-4000Crossref PubMed Scopus (69) Google Scholar). In recent work, we generated the A264E mutant of P450 BM3 and demonstrated that it coordinated the heme iron to form a novel Glu-Fe-Cys ligand set. In the substrate-free enzyme, Glu-264 coordination to the heme iron was partial, with the side chain of Glu-264 positioned close to the side chain of the active site residue Phe-87 in a proportion of molecules (21Girvan H.M. Marshall K.R. Lawson R.J. Leys D. Joyce M.G. Clarkson J. Smith W.E. Cheesman M.R. Munro A.W. J. Biol. Chem. 2004; 279: 23274-23286Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). However, binding of fatty acid to the mutant resulted in displacement of the Glu-264 side chain from the Phe-87 vicinity and the complete formation of the new Glu-Fe-Cys ligand set (21Girvan H.M. Marshall K.R. Lawson R.J. Leys D. Joyce M.G. Clarkson J. Smith W.E. Cheesman M.R. Munro A.W. J. Biol. Chem. 2004; 279: 23274-23286Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar, 22Joyce M.G. Girvan H.M. Munro A.W. Leys D. J. Biol. Chem. 2004; 279: 23287-23293Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). In this study, we sought to capitalize on earlier work to use Ala-264 mutants of BM3 to create further novel heme iron ligand sets for structural and mechanistic investigations. We selected A264K/H variants on the basis of natural occurrence of Lys and His coordination in several other hemoproteins. In addition, the different sizes of the Lys/His amino acid side chains posed the interesting possibility that coordination might take place in different conformers of the P450. We present here structures and spectroscopic analysis of both novel P450 heme iron ligand sets. These data enable further development of a diagnostic spectroscopic method for thiolate-ligated hemes, whereby their characteristics can, in many cases, be defined (particularly using EPR and MCD) to facilitate recognition of such species as and when they occur elsewhere in nature. Importantly, structural analysis of these substrate-free A264K/H P450 enzymes indicates that they occupy distinct conformational states considered previously to be associated with the substrate-free (A264H) and fatty acidbound (A264K) forms of the wild-type (WT) P450 BM3. Moreover, we have obtained the structure of a novel substrate-free state for both WT and A264H in which there is reorganization of mobile (mainly helical) structural elements, revealing a more open active site cavity that may be primed for ingress of fatty acid substrates to the active site. Molecular Biology and Protein Production—A264K and A264H mutants were generated in both the heme domain and intact flavocytochrome P450 BM3 using the Stratagene QuikChange™ kit. Primers A264KF (CATTCTTAATTAAGGGTCATGAAACAACAAGTGG) and A264KR (CCACTTGTTGTTTCATGACCCTTAATTAAGAATG) were used to create the A264K mutant in both the heme domain (pBM20) and flavocytochrome plasmids (pBM25). A silent BspH1 site was created to allow verification of the mutant (indicated in bold), and the mutated codon is shown underlined. Primers A264HF (CATTCTTAATTCATGGACACGAAACAACAAGTGG) and A264HR (CCACTTGTTGTTTCGTGTCCATGAATTAAGAATG) were used to create the A264H mutant in plasmids pBM20 and pBM25 (6Miles J.S. Munro A.W. Rospendowski B.N. Smith W.E. McKnight J.E. Thomson A.J. Biochem. J. 1992; 288: 503-509Crossref PubMed Scopus (134) Google Scholar). The mutated codon is underlined. The entire genes were sequenced to ensure that the desired mutation was present and that no spurious mutations occurred. Wild-type and A264K/H heme domains, and their intact flavocytochromes, were expressed in Escherichia coli strain TG1 and purified as described previously (21Girvan H.M. Marshall K.R. Lawson R.J. Leys D. Joyce M.G. Clarkson J. Smith W.E. Cheesman M.R. Munro A.W. J. Biol. Chem. 2004; 279: 23274-23286Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). Spectroscopy and Enzyme Analysis—UV-visible spectra were collected using a Cary UV-50 scanning spectrophotometer (Varian) with a 1-cm path length quartz cuvette. Spectra were recorded for oxidized, reduced (sodium dithionite), and substrate (fatty acid)-bound forms, as described in previous studies (e.g. Refs. 8Noble M.A. Miles C.S. Chapman S.K. Lysek D.A. MacKay A.C. Reid G.A. Hanzlik R.P. Munro A.W. Biochem. J. 1999; 339: 371-379Crossref PubMed Scopus (244) Google Scholar and 21Girvan H.M. Marshall K.R. Lawson R.J. Leys D. Joyce M.G. Clarkson J. Smith W.E. Cheesman M.R. Munro A.W. J. Biol. Chem. 2004; 279: 23274-23286Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). Steady-state kinetic analysis was carried out with WT, A264K, and A264H flavocytochromes as described previously (21Girvan H.M. Marshall K.R. Lawson R.J. Leys D. Joyce M.G. Clarkson J. Smith W.E. Cheesman M.R. Munro A.W. J. Biol. Chem. 2004; 279: 23274-23286Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar), using laurate and arachidonate as substrates to monitor substrate-dependent NADPH oxidation. Reductasedependent cytochrome c reduction was also monitored for WT and mutants as described previously (8Noble M.A. Miles C.S. Chapman S.K. Lysek D.A. MacKay A.C. Reid G.A. Hanzlik R.P. Munro A.W. Biochem. J. 1999; 339: 371-379Crossref PubMed Scopus (244) Google Scholar, 23Neeli R. Roitel O. Scrutton N.S. Munro A.W. J. Biol. Chem. 2005; 280: 17634-17644Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). Reduction of P450s and binding of carbon monoxide was performed as described previously (6Miles J.S. Munro A.W. Rospendowski B.N. Smith W.E. McKnight J.E. Thomson A.J. Biochem. J. 1992; 288: 503-509Crossref PubMed Scopus (134) Google Scholar). Heme concentrations for WT and A26K/H mutants were determined by the pyridine hemochromagen method (24Berry E.A. Trumpower B.L. Anal Biochem. 1987; 161: 1-15Crossref PubMed Scopus (772) Google Scholar). EPR spectra were recorded using an EPR spectrometer comprising an ER200D electromagnet and microwave bridge interfaced to a EMX control system (Bruker Spectrospin), and fitted with a liquid helium flow cryostat (ESR-9, Oxford Instruments) and a dual-mode X-band cavity (Bruker type ER4116DM). Spectra were recorded for WT (400 μm), A264K (745 μm), and A264H (435 μm) heme domains in assay buffer at 10.8 K. MCD spectra were recorded using JASCO J/810 and J/730 dichrographs in the near UV-visible and near-IR regions, respectively, using an Oxford Instrument superconducting solenoid with a 25-mm ambient bore to generate a magnetic field of 6 Tesla. A 0.1-cm path length cuvette was used to record near-IR spectra with sample concentrations the same as those used for EPR spectral collection. UV spectra were recorded for WT (30 μm), A264K (64 μm), and A264H (60 μm) heme domains with 50 mm HEPES in deuterium oxide (pH*, 7.0) as buffer (where pH* is the apparent pH measured in D2O using a standard glass pH electrode). Crystallography and Data Collection—The WT, A264K, and A264H heme domains were crystallized by the sitting drop method at 4 °C. Drops were prepared by addition of 2 μl of the mother liquor to 2 μl of a 15 mg/ml protein solution in 10 mm Tris.HCl (pH 7.5). Wild-type and A264K crystals were obtained in 100 mm cacodylate (pH 6.0) containing 160 mm MgCl2 and 16% polyethylene glycol 3350. Crystals of A264H were obtained in 100 mm cacodylate (pH 6.0) containing 130 mm MgCl2 and 18% polyethylene glycol 3350. Crystals were flash-cooled in liquid nitrogen after brief soaking in mother liquor supplemented with 10% polyethylene glycol 200. Data were collected on a single crystal at the European Synchrotron Radiation Facility, Grenoble ID14.2 (for WT and A264K) and, in case of A264H, for a single crystal at Deutsches Elektronen Synchrotron (DESY) Hamburg, beamline X11. Data were reduced and scaled using DENZO and SCALEPACK (25Otwinowski Z. Minor W. Methods Enzymol. 1997; 276: 307-318Crossref PubMed Scopus (38773) Google Scholar). The WT and A264H structures were solved using the molecular replacement program AMoRe (26Navaza J. Acta Crystallogr. Sect. D Biol. Crystallogr. 2001; 57: 1367-1372Crossref PubMed Scopus (658) Google Scholar) with the WT structure as search model (PDB code 1BU7). The A264K structure was solved using the available A264E structure (PDB code 1SMI) as starting model. Atomic coordinates and B-factors were refined using the maximum likelihood based Refmac5 (27Murshudov G.N. Vagin A.A. Dodson E.J. Acta Crystallogr. Sect. D Biol. Crystallogr. 1997; 53: 240-255Crossref PubMed Scopus (14024) Google Scholar). Data collection statistics and final refinement parameters can be found in Table 1.TABLE 1Crystallographic dataA264KA264HWTSpace groupP212121P21P21Diffraction limit (Å)20-2.420-1.920-1.20Number of reflections39,47981,622312,598I/σI10.211.111.1Rmerge (%)9.57.17.1Completeness (%)96.498.999.2R/Rfree20.3/27.317.7/21.814.5/16.9r.m.s.d. bond lengths (Å)0.0150.0090.014r.m.s.d. bond angles (°)1.5081.1241.565Average B-factor (Å2)41.030.616.8PDB code2ij42ij32ij2 Open table in a new tab The A264K and A264H mutants of P450 BM3 were constructed in both the isolated heme domain (residues 1-472) and in the full-length flavocytochrome, as described under "Materials and Methods." All constructs were expressed in E. coli to similar levels as the WT proteins and were purified in similar yield to WT BM3 and its heme domain, using standard methods (21Girvan H.M. Marshall K.R. Lawson R.J. Leys D. Joyce M.G. Clarkson J. Smith W.E. Cheesman M.R. Munro A.W. J. Biol. Chem. 2004; 279: 23274-23286Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). All proteins had full incorporation of heme cofactor, and the mutant flavocytochromes were replete with FAD and FMN. UV-visible Spectroscopy—UV-visible absorption spectra of the A264K and A264H heme domain mutants were recorded for the oxidized, ligand-free enzymes and compared directly with spectra for the WT P450 BM3 heme domain. The Soret maximum for WT heme domain was at 418 nm, whereas that for the mutants was shifted to 424 nm (A264K) and 427 nm (A264H). The shorter wavelength (δ) band was of greater intensity in the mutants and had a more distinct peak shifted to ∼362 nm from ∼360 nm in the WT heme domain (Fig. 1). Spectral changes were also observed in the visible region (reduced intensity of the α band and a red shift in the β band in both mutants) (Fig. 1, inset). The α/β bands for A264K(H) were at 571/542 nm (576/544 nm) compared with 569/535 nm for WT BM3. Heme band shifts were essentially identical for the A264K/H flavocytochromes (once changes in spectrum due to flavin contribution were accounted for), indicating that the reductase domain does not impact significantly on heme coordination in these enzymes. The shift of the Soret band to longer wavelengths (a type II P450 spectral shift) is consistent with the replacement of the distal water molecule (the sixth ligand to the heme iron) with a stronger field ligand. In light of preceding studies with the A264E enzyme, it appeared clear that the side chains of His-264 and Lys-264 coordinated to the heme iron in the A264H/K mutants, giving rise to distinctive perturbations of the optical spectrum (21Girvan H.M. Marshall K.R. Lawson R.J. Leys D. Joyce M.G. Clarkson J. Smith W.E. Cheesman M.R. Munro A.W. J. Biol. Chem. 2004; 279: 23274-23286Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). In the A264E mutant, Glu-264 partially occupies the distal coordination position on the heme iron in the substrate-free form, but complete occupancy was induced on binding of fatty acid substrates, as verified spectroscopically and by determination of atomic structures for substrate-free and palmitoleate-bound A264E heme domain (21Girvan H.M. Marshall K.R. Lawson R.J. Leys D. Joyce M.G. Clarkson J. Smith W.E. Cheesman M.R. Munro A.W. J. Biol. Chem. 2004; 279: 23274-23286Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar, 22Joyce M.G. Girvan H.M. Munro A.W. Leys D. J. Biol. Chem. 2004; 279: 23287-23293Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). By contrast, addition of various fatty acid substrates (arachidonic acid, lauric acid, and palmitoleic acid) induced no significant spectral change in the A264K/H enzymes, suggesting that coordination of heme iron by the respective side chains was complete in the absence of fatty acids. In addition, negligible spectral perturbation was induced on addition of imidazole or substituted azoles. In parallel studies of steady-state kinetics of NADPH-dependent cytochrome c reduction and fatty acid oxygenation by the A264K/H flavocytochromes, there was no significant stimulation of NADPH oxidation induced by addition of fatty acids (and no hydroxylated products isolated), but levels of cytochrome c reductase activity were essentially identical to those of WT BM3. In addition, neither A264K/H was able to form any significant amount of ferrous-CO complex at either 450 nm or 420 nm on reduction with dithionite and bubbling with carbon monoxide. This suggests that the distal ligand remains firmly bound on reduction and that neither dioxygen (under turnover conditions) nor CO can displace the Lys/His-264 ligands. However, spectral changes observed on reduction suggest that there is some heterogeneity in the reduced species formed, with putative changes in both proximal and distal heme coordinations. The complex nature of these species is currently under investigation, but it is clear that the reduction potential of both mutants is more negative than the wild-type P450, due to incomplete reduction by dithionite. EPR Spectroscopy—EPR spectra of both A264H/K ferric BM3 heme domains contain a single set of rhombic features and show shifts in g-values from the WT P450 (A264K: gz = 2.47, gy = 2.26, and gx = 1.91; A264H: 2.50, 2.26, and 1.89; and WT: 2.42, 2.26, and 1.92) (Fig. 2). The homogeneity of the EPR spectra of the A264K/H mutants contrasts with the heterogeneity observed in the EPR spectrum of substrate-free A264E heme domain, in which signals from both Cys-Fe-H2O and Cys-Fe-Glu components were present (21Girvan H.M. Marshall K.R. Lawson R.J. Leys D. Joyce M.G. Clarkson J. Smith W.E. Cheesman M.R. Munro A.W. J. Biol. Chem. 2004; 279: 23274-23286Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). Thus, these data are consistent with the absence of UV-visible perturbations on fatty acid substrate binding to the oxidized A264K/H heme domains, and indicative that heme iron coordination by the Lys/His-264 ligands is complete for these mutants in both substrate-free and fatty acid-bound forms. The g-values determined indicate a change in heme environment that is consistent with coordination of nitrogenous side chains at the distal position, as was inferred from UV-visible studies. Imidazole complexes of P450 BM3 (CYP102A1) and P450 cam (CYP101A1) have EPR spectra with similar g-values (2.61, 2.25, and 1.83; 2.56, 2.27, and 1.85; respectively) to the A264K/H mutants, as do thiolate/His-coordinated species such as heme 2 in SoxAX (2.53, 2.30, and 1.87) and cytochrome c M60C (2.56, 2.27, and 1.85) (14Cheesman M.R. Little P.J. Berks B.C. Biochemistry. 2001; 40: 10562-10569Crossref PubMed Scopus (52) Google Scholar, 28Wuttke D.S. Preparation, Characterization and Intramolecular Electron-transfer Studies of Ruthenium-modified Cytochromes c. Ph.D. thesis. California Institute of Technology, Pasadena, CA1994Google Scholar). Closer to the g-values observed for A264K are those of ferric CooA (Pro/Cys-) at 2.46, 2.26, and 1.91 (29Dhawan I.K. Shelver D. Thorsteinsson M.V. Roberts G.P. Johnson M.K. Biochemistry. 1999; 38: 12805-12813Crossref PubMed Scopus (49) Google Scholar). MCD—Near IR (NIR) and UV-visible room temperature MCD spectra of A264K and A264H are shown in Fig. 3. In the NIR region, the position of a charge-transfer (CT) band can be diagnostic for the nature of heme iron ligand sets (20Cheesman M.R. Zumft W.G. Thomson A.J. Biochemistry. 1998; 37: 3994-4000Crossref PubMed Scopus (69) Google Scholar). The NIR MCD spectra are characteristic of ferric low spin heme iron in both heme domain mutants (Fig. 3A). Thiolate coordination is indicated by band position and characteristic low intensities by comparison with other low spin hemes (for example histidineligated heme proteins). For A264H, the NIR low spin chargetransfer (CTLS) peak is at 1155 nm, shifted by >70 nm with respect to that for the WT enzyme. This peak suggests heme thiolate and nitrogenous ligation and is comparable to published examples (e.g. myoglobin plus HS-, 1200 nm; WT BM3 plus imidazole (at 4.2 K), 1180 nm; SoxAX heme 2, 1150 nm; ferric CooA (Pro/Cys-), 1190 nm) (14Cheesman M.R. Little P.J. Berks B.C. Biochemistry. 2001; 40: 10562-10569Crossref PubMed Scopus (52) Google Scholar, 29Dhawan I.K. Shelver D. Thorsteinsson M.V. Roberts G.P. Johnson M.K. Biochemistry. 1999; 38: 12805-12813Crossref PubMed Scopus (49) Google Scholar, 30Limburg J. LeBrun L.A. Ortiz de Montellano P.R. Biochemistry. 2005; 44: 4091-4099Crossref PubMed Scopus (19) Google Scholar, 31Gadsby P.M.A. Thomson A.J. J. Am. Chem. Soc. 1990; 112: 5003-5011Crossref Scopus (148) Google Scholar, 32McKnight J. Cheesman M.R. Thomson A.J. Miles J.S. Munro A.W. Eur. J. Biochem. 1993; 213: 683-687Crossref PubMed Scopus (59) Google Scholar). For A264K, the NIR CTLS band is at 1100 nm, shifted 20 nm from the WT value. This shift represents coordination of the K264 side chain to the thiolate-ligated heme iron. This, to our knowledge, is the first report of a cysteine/lysine MCD CTLS band (although a cysteine/amine ligation was observed for CooA (16Roberts G.P. Kerby R.L. Youn H. Conrad M. J. Inorg. Biochem. 2005; 99: 280-292Crossref PubMed Scopus (86) Google Scholar)). MCD spectra for the A264K/H heme domains were recorded in the near-UV-visible region and are shown in Fig. 3B, alongside the WT heme domain spectrum. The A264K and A264H mutants show clear shifts in band positions and relative intensity with respect to WT. The general spectral pattern for each mutant is again indicative of low spin ferric heme, consistent with UV-visible and EPR spectroscopy. The CT2 band has shifted from 575 nm in WT heme domain to 583 nm and 587 nm, respectively, for the A264K and A264H mutants. In studies of ligand complexes of P450 cam (CYP101A1), the CT2 band for unligated P450 was at 575 nm, for the 1-octylamine complex at 580 nm, and for the imidazole complex at 585 nm, similar to our values for the BM3 WT and A264K/H mutants (18Dawson J.H. Andersson L.A. Sono M. J. Biol. Chem. 1982; 257: 3606-3617Abstract Full Text PDF PubMed Google Scholar). The general spectral patterns of both A264K/H mutants reveal the Soret derivative crossover at 425 nm, compared with 419 nm for WT BM3. The 425 nm crossover is indicative of nitrogen coordination to the heme iron. This is similar to the value (426 nm) for the imidazole complex of CYP101A1, with its octylamine complex at 421 nm, and that for unligated P450 at 416 nm (14Cheesman M.R. Little P.J. Berks B.C. Biochemistry. 2001; 40: 10562-10569Crossref PubMed Scopus (52) Google Scholar, 18Dawson J.H. Andersson L.A. Sono M. J. Biol. Chem. 1982; 257: 3606-3617Abstract Full Text PDF PubMed Google Scholar). The feature is of greater intensity in A264K/H than in WT, with a peak-to-trough intensity of ∼90 mm-1 cm-1. Elsewhere in the visible MCD spectra, peaks for the WT BM3 (CYP101A1), A264K (CYP101A1-octylamine), and A264H (CYP101A1-imidazole) are located at 521 nm (518), 526 nm (526), and 533 nm (530), respectively (18Dawson J.H. Andersson L.A. Sono M. J. Biol. Chem. 1982; 257: 3606-3617Abstract Full Text PDF PubMed Google Scholar). Thus, UV-visible MCD spectral features of CYP101A1 imidazole/amine complexes are consistent with distal coordination of BM3 heme iron by Lys-264/His-264 side chains. In general, the shifts in the MCD spectra of the mutants with respect to those of the WT P450 are greater in the His-264 mutant than the Lys-264 mutant, but show the same overall trend. Spectroscopic analysis thus indicated that the A264H/K mutants adopted unprecedented cytochrome P450 heme iron ligand sets in solution state at both ambient and cryogenic temperatures. Crystal structures were determined to ascertain structural properties of the mutant