Title: Hodgkin's Lymphoma Cell Lines Express a Fusion Protein Encoded by Intergenically Spliced mRNA for the Multilectin Receptor DEC-205 (CD205) and a Novel C-type Lectin Receptor DCL-1
Abstract: Classic Hodgkin's lymphoma (HL) tissue contains a small population of morphologically distinct malignant cells called Hodgkin and Reed-Sternberg (HRS) cells, associated with the development of HL. Using 3′-rapid amplification of cDNA ends (RACE) we identified an alternative mRNA for the DEC-205 multilectin receptor in the HRS cell line L428. Sequence analysis revealed that the mRNA encodes a fusion protein between DEC-205 and a novel C-type lectin DCL-1. Although the 7.5-kb DEC-205 and 4.2-kb DCL-1 mRNA were expressed independently in myeloid and B lymphoid cell lines, the DEC-205/DCL-1 fusion mRNA (9.5 kb) predominated in the HRS cell lines (L428, KM-H2, and HDLM-2). The DEC-205 and DCL-1 genes comprising 35 and 6 exons, respectively, are juxtaposed on chromosome band 2q24 and separated by only 5.4 kb. We determined the DCL-1 transcription initiation site within the intervening sequence by 5′-RACE, confirming that DCL-1 is an independent gene. Two DEC-205/DCL-1 fusion mRNA variants may result from cotranscription of DEC-205 and DCL-1, followed by splicing DEC-205 exon 35 or 34–35 along with DCL-1 exon 1. The resulting reading frames encode the DEC-205 ectodomain plus the DCL-1 ectodomain, the transmembrane, and the cytoplasmic domain. Using DCL-1 cytoplasmic domain-specific polyclonal and DEC-205 monoclonal antibodies for immunoprecipitation/Western blot analysis, we showed that the fusion mRNA is translated into a DEC-205/DCL-1 fusion protein, expressed in the HRS cell lines. These results imply an unusual transcriptional control mechanism in HRS cells, which cotranscribe an mRNA containing DEC-205 and DCL-1 prior to generating the intergenically spliced mRNA to produce a DEC-205/DCL-1 fusion protein. Classic Hodgkin's lymphoma (HL) tissue contains a small population of morphologically distinct malignant cells called Hodgkin and Reed-Sternberg (HRS) cells, associated with the development of HL. Using 3′-rapid amplification of cDNA ends (RACE) we identified an alternative mRNA for the DEC-205 multilectin receptor in the HRS cell line L428. Sequence analysis revealed that the mRNA encodes a fusion protein between DEC-205 and a novel C-type lectin DCL-1. Although the 7.5-kb DEC-205 and 4.2-kb DCL-1 mRNA were expressed independently in myeloid and B lymphoid cell lines, the DEC-205/DCL-1 fusion mRNA (9.5 kb) predominated in the HRS cell lines (L428, KM-H2, and HDLM-2). The DEC-205 and DCL-1 genes comprising 35 and 6 exons, respectively, are juxtaposed on chromosome band 2q24 and separated by only 5.4 kb. We determined the DCL-1 transcription initiation site within the intervening sequence by 5′-RACE, confirming that DCL-1 is an independent gene. Two DEC-205/DCL-1 fusion mRNA variants may result from cotranscription of DEC-205 and DCL-1, followed by splicing DEC-205 exon 35 or 34–35 along with DCL-1 exon 1. The resulting reading frames encode the DEC-205 ectodomain plus the DCL-1 ectodomain, the transmembrane, and the cytoplasmic domain. Using DCL-1 cytoplasmic domain-specific polyclonal and DEC-205 monoclonal antibodies for immunoprecipitation/Western blot analysis, we showed that the fusion mRNA is translated into a DEC-205/DCL-1 fusion protein, expressed in the HRS cell lines. These results imply an unusual transcriptional control mechanism in HRS cells, which cotranscribe an mRNA containing DEC-205 and DCL-1 prior to generating the intergenically spliced mRNA to produce a DEC-205/DCL-1 fusion protein. Classic Hodgkin's lymphoma (HL) 1The abbreviations used are: HL, Hodgkin's lymphoma; HRS, Hodgkin and Reed-Sternberg; APC, antigen-presenting cell; DC, dendritic cell; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase; CRD, carbohydrate recognition domain; TM, transmembrane domain; CP, cytoplasmic domain; HRP, horseradish peroxidase; mAb, monoclonal antibody; MMR, macrophage mannose receptor; PLA2R, phospholipase A2 receptor; ELISA, enzyme-linked immunosorbent assay; PBS, phosphate-buffered saline; SP, signal peptide. is a common malignant lymphoma characterized by the presence of a small population (<1%) of putative malignant cells, the morphologically distinct Hodgkin and Reed-Sternberg (HRS) cells. Recent advances in cell isolation techniques and molecular biology has identified Ig gene rearrangements within the majority of individual HRS cells, suggesting their B cell origin (1Marafioti T. Hummel M. Foss H.D. Laumen H. Korbjuhn P. Anagnostopoulos I. Lammert H. Demel G. Theil J. Wirth T. Stein H. Blood. 2000; 95: 1443-1450Crossref PubMed Google Scholar). These are surrounded by a large population of apparently non-malignant lymphocytes and histiocytes, whose proliferation is likely to be mediated by the wide range of cytokines and chemokines released by the HRS cells (reviewed in Refs. 2Skinnider B.F. Mak T.W. Blood. 2002; 99: 4283-4297Crossref PubMed Scopus (432) Google Scholar and 3Kuppers R. Rajewsky K. Annu. Rev. Immunol. 1998; 16: 471-493Crossref PubMed Scopus (276) Google Scholar). HRS cells have many characteristics in common with antigen-presenting cells (APCs) such as activated B cells and dendritic cells (DCs) (4Sorg U.R. Morse T.M. Patton W.N. Hock B.D. Angus H.B. Robinson B.A. Colls B.M. Hart D.N. Pathology. 1997; 29: 294-299Abstract Full Text PDF PubMed Scopus (41) Google Scholar). Indeed, the HRS cell lines (L428, HDLM-2, and/or KM-H2) express cell surface molecules required for costimulation/proliferation of T cells (major histocompatibility complex class II, CD40, CD80, and CD86) (5Delabie J. Ceuppens J.L. Vandenberghe P. de Boer M. Coorevits L. De Wolf-Peeters C. Blood. 1993; 82: 2845-2852Crossref PubMed Google Scholar, 6Uehira K. Amakawa R. Ito T. Uehira T. Ozaki Y. Shimizu T. Fujimoto M. Inaba M. Fukuhara S. Int. J. Hematol. 2001; 73: 236-244Crossref PubMed Scopus (14) Google Scholar, 7Gruss H.J. Hirschstein D. Wright B. Ulrich D. Caligiuri M.A. Barcos M. Strockbine L. Armitage R.J. Dower S.K. Blood. 1994; 84: 2305-2314Crossref PubMed Google Scholar), cell adhesion molecules involved in DC-T cell interactions (LFA-1, CD11c, and ICAM-1–3) (8Ellis P.A. Hart D.N. Colls B.M. Nimmo J.C. MacDonald J.E. Angus H.B. Clin. Exp. Immunol. 1992; 90: 117-123Crossref PubMed Scopus (23) Google Scholar, 9McKenzie J.L. Egner W. Calder V.L. Hart D.N. Immunology. 1992; 77: 345-353PubMed Google Scholar), and the DC-associated molecules (CD83 and fascin) (6Uehira K. Amakawa R. Ito T. Uehira T. Ozaki Y. Shimizu T. Fujimoto M. Inaba M. Fukuhara S. Int. J. Hematol. 2001; 73: 236-244Crossref PubMed Scopus (14) Google Scholar, 10Hock B.D. Kato M. McKenzie J.L. Hart D.N. Int. Immunol. 2001; 13: 959-967Crossref PubMed Scopus (115) Google Scholar). They also produce inflammatory cytokines (e.g. tumor necrosis factor-α and lymphotoxin) (11Kretschmer C. Jones D.B. Morrison K. Schluter C. Feist W. Ulmer A.J. Arnoldi J. Matthes J. Diamantstein T. Flad H.D. Am. J. Pathol. 1990; 137: 341-351PubMed Google Scholar), non-inflammatory cytokines (e.g. granulocyte macrophage-colony stimulating factor and interleukins 5 and 13) (12Paietta E. Racevskis J. Stanley E.R. Andreeff M. Papenhausen P. Wiernik P.H. Cancer Res. 1990; 50: 2049-2055PubMed Google Scholar, 13Kapp U. Yeh W.C. Patterson B. Elia A.J. Kagi D. Ho A. Hessel A. Tipsword M. Williams A. Mirtsos C. Itie A. Moyle M. Mak T.W. J. Exp. Med. 1999; 189: 1939-1946Crossref PubMed Scopus (230) Google Scholar), and chemokines (e.g. TARC) (14van den Berg A. Visser L. Poppema S. Am. J. Pathol. 1999; 154: 1685-1691Abstract Full Text Full Text PDF PubMed Scopus (310) Google Scholar), which are associated with APCs. L428 cells have been used successfully in our laboratory to produce monoclonal antibodies (mAb) against DC differentiation antigens such as CMRF-44 (15Hock B.D. Starling G.C. Daniel P.B. Hart D.N. Immunology. 1994; 83: 573-581PubMed Google Scholar) and CMRF-56 (16Hock B.D. Fearnley D.B. Boyce A. McLellan A.D. Sorg R.V. Summers K.L. Hart D.N. Tissue Antigens. 1999; 53: 320-334Crossref PubMed Scopus (54) Google Scholar) and to clone the DC-associated molecules such as DEC-205 type I transmembrane multilectin receptor (17Kato M. Neil T.K. Clark G.J. Morris C.M. Sorg R.V. Hart D.N. Immunogenetics. 1998; 47: 442-450Crossref PubMed Scopus (58) Google Scholar) and the adenosylhomocysteine hydrolase-like molecule DCAL/AHCYL-1 (18Dekker J.W. Budhia S. Clark G.J. Hart D.N.J. Kato M. Immunogenetics. 2002; 53: 993-1001Crossref PubMed Scopus (23) Google Scholar). We have investigated cell surface molecules on HRS cell lines with a view to identifying novel molecules related to APC function. These molecules might also be candidate targets for antibody-based HL immunotherapy. Indeed, CD20, CD25, and CD30 reagents (markers for B cells and activated lymphocytes) have been investigated in this regard (19Falini B. Pileri S. Pizzolo G. Durkop H. Flenghi L. Stirpe F. Martelli M.F. Stein H. Blood. 1995; 85: 1-14Crossref PubMed Google Scholar, 20Strauchen J.A. Pathol. Annu. 1989; 24: 149-165PubMed Google Scholar, 21Keilholz U. Szelenyi H. Siehl J. Foss H.D. Knauf W. Thiel E. Leuk. Lymphoma. 1999; 35: 641-642Crossref PubMed Scopus (27) Google Scholar), but molecules more restricted to HRS cells might be preferred as targets for more specific therapeutics. During the cloning of DEC-205 from the L428 cell line by 3′-rapid amplification of cDNA ends (RACE) (17Kato M. Neil T.K. Clark G.J. Morris C.M. Sorg R.V. Hart D.N. Immunogenetics. 1998; 47: 442-450Crossref PubMed Scopus (58) Google Scholar), we discovered an alternatively spliced novel DEC-205 mRNA. This mRNA encodes the intact DEC-205 ectodomain but included unique sequences encoding for an additional carbohydrate recognition domain (CRD) and a transmembrane (TM) and a cytoplasmic (CP) domain derived from a newly identified type I transmembrane C-type lectin DCL-1. A partial cDNA sequence (KIAA0022) of DCL-1 was identified by random sequencing of a KG-1 cDNA library (22Nomura N. Miyajima N. Sazuka T. Tanaka A. Kawarabayasi Y. Sato S. Nagase T. Seki N. Ishikawa K. Tabata S. DNA Res. 1994; 1: 27-35Crossref PubMed Scopus (272) Google Scholar). Here, we describe the characterization of the DEC-205/DCL-1 fusion mRNA and protein. Its apparently selective expression in HRS cells may make it a useful target for both antibody- and T cell-mediated immunotherapy. Cell Lines—The human hematopoietic cell lines, HEL, KG-1, K562, THP-1, U937, Mann, Daudi, Raji, WT49, Mann, Molt-4, Jurkat, HL-60, and HSB-2 were obtained from the American Type Culture Collection (Rockville, MD). L428 cells were provided by V. Diehl (Klinik fur Innere Medizin, Cologne, Germany) (23Schaadt M. Diehl V. Stein H. Fonatsch C. Kirchner H.H. Int. J. Cancer. 1980; 26: 723-731Crossref PubMed Scopus (113) Google Scholar). HDLM-2 (24Diehl V. Pfreundschuh M. Fonatsch C. Stein H. Falk M. Burrichter H. Schaadt M. Cancer Surv. 1985; 4: 399-419PubMed Google Scholar) and KM-H2 cells (25Kamesaki H. Fukuhara S. Tatsumi E. Uchino H. Yamabe H. Miwa H. Shirakawa S. Hatanaka M. Honjo T. Blood. 1986; 68: 285-292Crossref PubMed Google Scholar) were obtained from the German Collection of Microorganism and Cell Culture (Braunschweig, Germany). Mono Mac 6 cells (26Ziegler-Heitbrock H.W. Thiel E. Futterer A. Herzog V. Wirtz A. Riethmuller G. Int. J. Cancer. 1988; 41: 456-461Crossref PubMed Scopus (492) Google Scholar) were provided by E. M. Schneider (Dusseldorf, Germany). All cell lines were maintained in RPMI 1640 (Invitrogen, Melbourne, Victoria, Australia), 10% (v/v) fetal calf serum (Invitrogen), 100 units/ml penicillin, and 100 μg/ml streptomycin, except for HDLM-2 cells, which were maintained in 20% (v/v) fetal calf serum. These cells were subjected to RNA preparation using TRIzol (Invitrogen) for RT-PCR and Northern blot analysis. Antibodies and Other Reagents—The mAb MMRI-7 against human DEC-205 was produced in our laboratory (27Kato M. MacDonald K. Munster D. Clark G. Hart D.N.J. Mason D. Leucocyte Typing VII. Oxford University Press, Oxford2002: 298-300Google Scholar). MMRI-7 binds to an epitope within DEC-205 CRDs 1 and 2. The other anti-human DEC-205 mAb, M335, was provided by R. J. Armitage (Immunex, Seattle, WA) through the 7th International Workshop on Human Leukocyte Differentiation Antigens. M335 binds to an epitope within DEC-205 cysteine-rich domain (27Kato M. MacDonald K. Munster D. Clark G. Hart D.N.J. Mason D. Leucocyte Typing VII. Oxford University Press, Oxford2002: 298-300Google Scholar). Goat anti-mouse IgG was purchased from Dako (Botany, New South Wales, NSW, Australia). Horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG-Fc-specific and protein A-conjugated agarose beads were from Sigma (Castle Hill, NSW, Australia). HRP-conjugated sheep anti-rabbit IgG was from Silenus (Melbourne, Victoria, Australia). ELISA plates (Maxsorb) were from Nalge Nunc International (Rochester, NY). Prestained protein standards (Benchmark Prestained Protein Ladder) and DNA ladder (1-kb ladder) were from Invitrogen. Molecular biological enzymes (e.g. restriction enzymes, polymerases, and ligase) were obtained from Invitrogen, Promega (Sydney, NSW, Australia) or Roche Applied Science (Castle Hill, NSW, Australia). Unless specified, general chemicals were obtained from Sigma or BDH (Poole, England). Rabbit polyclonal peptide antisera against the DEC-205 CP domain and the DCL-1 CP were produced by immunizing New Zealand White rabbits with diphtheria toxoid-conjugated synthetic peptide CEDEIMLPSFHD and CGEENEYPYQFD (Minotopes, Clayton, Victoria, Australia), respectively, using a conventional schedule with Freund adjuvant at the Herston Medical Research Institute (Herston, Queensland, Australia). To assess the titer of the antibodies against CP peptides, an ELISA plate was coated with streptavidin (Sigma) and biotinylated peptides for DEC-205 CP (biotin-SGSGEDEIMLPSFHD) and DCL-1 CP (biotin-SGSGEENEYPYQFD) captured. The plate was blocked with 1% (w/v) sodium caseinate (Sigma) in PBS and 0.1% (w/v) Tween 20 (PBS/Tween) and incubated with serially diluted antisera. After washing the plate with PBS/Tween, bound antibody was detected with HRP-sheep anti-rabbit IgG and o-phenylenediamine hydrochloride and quantitated with 492 nm using an ELISA reader. There was no cross-reactivity detected between these two rabbit CP antibodies at the dilutions used in the experiments described (data not shown). 3′-Rapid Amplification of cDNA Ends—The 3′-end of DEC-205 mRNA was obtained by 3′-RACE, which was performed as described previously (17Kato M. Neil T.K. Clark G.J. Morris C.M. Sorg R.V. Hart D.N. Immunogenetics. 1998; 47: 442-450Crossref PubMed Scopus (58) Google Scholar). Briefly, L428 mRNA was reverse-transcribed with an oligo(dT) adaptor primer. The obtained L428 cDNA pool was subjected to PCR using a DEC-205-specific forward primer and an adaptor primer and cloned into pBluescript SKII (Stratagene, La Jolla, CA). The clones were analyzed by restriction enzyme mapping and sequencing using a BigDye Terminator kit on an ABI Prism 377 automated sequencer (PE Applied Biosystems, Scoresby, Victoria, Australia) by Australian Genome Research Facility (University of Queensland, St. Lucia, Queensland, Australia). RT-PCR Analysis—PCR was performed on the L428 cDNA pool using DEC-205-specific forward primers (078, 088, 090, 092, and 094, nested within various parts of the DEC-205 ectodomain) in combination with either DEC-205-specific reverse primer (085, nested within DEC-205 CP) or DCL-1-specific reverse primer (086, nested within DCL-1 ectodomain) with an Expand Long Template PCR system (Roche Applied Science) (Table I). The PCR reactions were fractionated in 0.8% (w/v) agarose in Tris acetate buffer (40 mm Tris acetate, 1 mm EDTA, pH 7.6) and visualized with ethidium bromide. The PCR products obtained by the primer combination 078/085 and 078/086 were cloned into pGEM-T Easy vector (Promega) and sequenced.Table IThe DNA sequences of oligonucleotides primers used in this studyPrimerSequence (5′→3′)Accession numberPosition (orientation)061CATCTGGGCCTTTCCATTGCTAY314007286-306 (reverse)062GACCATGGAGCGGACATGATAAY314007216-236 (forward)063GGCTCTACCATCTGGGTTTGTAY3140071811-1831 (forward)078GAAATGGTTGACTACAAAGAAGAAF0113334200-4222 (forward)085ACCAAATCAGTCCGCCCATGAGAAAF0113335095-5118 (reverse)086ATCATGTCCGCTCCATGGTCAGTAAY314007212-235 (reverse)088TATTCAGAAGTTAAAAGCAGAAF0113333327-3347 (forward)090CCAAAAGGCCGTACTCCAAAAAF0113332430-2450 (forward)092GGAGGAAAACTGAATGACGCAAF0113331518-1538 (forward)094GAAAACGGTTGTGAAGATAATAF011333690-710 (forward)199GCTCCATGGTCAGTACACTGAAY314007206-226 (reverse) Open table in a new tab Northern Blot Analysis—Approximately 10 μg of total RNA from cultured cell lines was fractionated in formaldehyde-denatured 1% (w/v) agarose gel and transferred to a Hybond N+ cationic nylon membrane (Amersham Biosciences, Sydney, NSW, Australia). The 864-bp DEC-205 cDNA probe nested within DEC-205 CRD1 and -2 was PCR-amplified using primers 094 and 095 on the DEC-205 cDNA clone pCRD1/2-Ig (27Kato M. MacDonald K. Munster D. Clark G. Hart D.N.J. Mason D. Leucocyte Typing VII. Oxford University Press, Oxford2002: 298-300Google Scholar) and Taq polymerase (Roche Applied Science). The 1617-bp DCL-1 cDNA probe was PCR-amplified using DCL-1-specific primers 062 and 063 on the pBS30-1 (Fig. 1). These probes were purified using a QIAquick PCR purification kit (Qiagen, Clifton Hill, Victoria, Australia) and labeled with [α-32P]dATP (Amersham Biosciences) using a Strip-EZ DNA StipAble DNA probe Synthesis and Removal kit (Ambion, Austin, TX). The membrane was hybridized sequentially with these probes and exposed to a Kodak BioMax MS x-ray film at –70 °C using an intensifying screen (Amersham Biosciences). The final wash was 0.1 × SSC (1 × SSC is 0.15 m NaCl, 15 mm sodium citrate, pH 7.0) and 0.5% (w/v) SDS at 68 °C. After each probing, the membrane was chemically stripped according to the manufacture's instructions and used for hybridization with the other probes. 5′-RACE—RNA ligase-mediated 5′-RACE was performed using a FirstChoice RLM-RACE kit (Ambion). Briefly, total RNA from HL-60 was treated sequentially with calf intestinal alkaline phosphatase and tobacco acid pyrophosphatase to select and to remove the cap structure of full-length mRNA. The RNA adaptor was ligated to the RNA using T4 RNA ligase, and the RNA was subjected to cDNA synthesis with random decamer or DCL-1-specific primer 061 and Thermoscript reverse transcriptase (Invitrogen). The cDNA was subjected to two rounds of PCR using DCL-1-specific primers 086 and 099 in combination with the 5′-RACE outer primer and inner primer (provided by the kit), respectively. The PCR product was cloned into pGEM-T Easy vector and sequenced. Preparation of Cell Lysate—Approximately 107 cells were lysed with 1 ml of 0.15 m NaCl, 25 mm Tris-HCl, pH 7.4, 1% (v/v) Triton X-100, 0.5% (w/v) sodium deoxycholate, 0.1% (w/v) SDS, and a mixture of protease inhibitors (Complete, EDTA-free, Roche Applied Science) and incubated on ice for 10 min with occasional vortexing. After centrifugation at 12,000 × g for 20 min at 4 °C, the supernatant was collected and used directly for immunoprecipitation/Western blotting or sandwich ELISA analysis described below. Immunoprecipitation/Western Blot Analysis—The cell extract was precleared with a non-immune rabbit serum and protein A-Sepharose (Sigma) for 1 h at 4 °C and subjected to immunoprecipitation using the rabbit peptide antisera against DEC-205 CP or DCL-1 CP with protein A-Sepharose overnight at 4 °C. The beads were washed with a wash buffer (0.15 m NaCl, 25 mm Tris-HCl, pH 7.5, 0.2% (v/v) Triton X-100, and 0.5% (w/v) sodium deoxycholate), and eluted with SDS-PAGE sample buffer (2% (w/v) SDS, 62.5 mm Tris-HCl, pH 6.8, 0.01% (w/v) bromphenol blue, and 10% (v/v) glycerol) by heating at 95 °C for 5 min. The samples were subjected to Laemmli discontinuous SDS-PAGE with 10% (v/v) polyacrylamide separating gel (28Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207856) Google Scholar) in the non-reducing condition and transferred to a polyvinylidene fluoride membrane (PVDF-Plus, Osmonics, Westborough, MA). The membrane was blocked with 5% (w/v) nonfat dry milk in PBS/Tween (BLOTTO), incubated with a mixture of DEC-205 mAbs (MMRI-7 and M335, 5 μg/ml each) overnight at 4 °C, and washed with PBS/Tween. The membrane was incubated with HRP-anti-goat mouse IgG, and the bound enzyme was detected with enhanced chemiluminescence (SuperSignal West Pico, Pierce, Rockford, IL) on a Kodak X-Omat XB-1 x-ray film. Sandwich ELISA—An ELISA plate was coated with 10 μg/ml goat anti-mouse IgG in PBS, washed with PBS/Tween, and blocked with BLOTTO. To the plate a mixture of DEC-205 mAb (MMRI-7 and M335, 2 μg/ml each) was added and incubated for 1 h at room temperature. The plate was washed and incubated with the serially diluted cell extracts overnight at 4 °C. The plate was washed with PBS/Tween and incubated with either rabbit peptide antibodies against DEC-205 CP or DCL-1 CP (1:1000 dilution in PBS/Tween) or non-immune rabbit serum for 1 h at room temperature, and, after washing with PBS/Tween, the plate was incubated with HRP-conjugated goat anti-rabbit IgG in 5% mouse serum and PBS/Tween. The plate was developed with o-phenylenediamine dihydrochloride and quantitated at 492 nm. Identification of the cDNA Clone Encoding DEC-205/DCL-1 Fusion—To obtain the 3′-end of human DEC-205 mRNA, we performed 3′-RACE (17Kato M. Neil T.K. Clark G.J. Morris C.M. Sorg R.V. Hart D.N. Immunogenetics. 1998; 47: 442-450Crossref PubMed Scopus (58) Google Scholar). This resulted in amplification of a PCR product of ∼3 kb (data not shown). When we cloned the PCR product and analyzed several clones by restriction enzyme analysis, however, we realized that there were two distinct sequences within the PCR product. The clone pB30-3 contained the authentic DEC-205 sequence encoding the DEC-205 CRD 8–10, TM, and CP (17Kato M. Neil T.K. Clark G.J. Morris C.M. Sorg R.V. Hart D.N. Immunogenetics. 1998; 47: 442-450Crossref PubMed Scopus (58) Google Scholar). The other clone pB30-1, however, encoded DEC-205 CRD 8–10 followed by a unique sequence distinct from the DEC-205 TM and CP sequence (Fig. 1A). The junction of the DEC-205 and unique sequence was located within the connecting region (spacer 11) between the DEC-205 CRD10 and TM. A BLAST search identified the unique sequence as a part of the cDNA, KIAA0022 derived from KG-1 cell cDNA library (22Nomura N. Miyajima N. Sazuka T. Tanaka A. Kawarabayasi Y. Sato S. Nagase T. Seki N. Ishikawa K. Tabata S. DNA Res. 1994; 1: 27-35Crossref PubMed Scopus (272) Google Scholar). Our further analysis showed that the KIAA0022 contained a partial cDNA encoding a novel type I transmembrane C-type lectin receptor, and we termed it DCL-1 (DEC-205-associated C-type Lectin-1). The complete DCL-1 coding region encodes a signal peptide (SP), one CRD, one TM, and one CP. The KIAA0022 cDNA was recently annotated to a C-type lectin molecule (GenBank™ accession number BAA03498), and its gene was mapped to chromosome band 2q24. More details of DCL-1 will be published elsewhere. 2S. Khan, K. J. McDonald, B. P. O'Neill, N. Gonzalez, B. J. Cooper, D. N. J. Hart, and M. Kato, manuscript in preparation. The sequence analysis of the clone pB30-1 showed that fusion junction occurred within the codon G/GC ("/" indicates the junction) for Gly in the DEC-205 spacer 11, connected to the codon G/AC for Asp in the junction between the DCL-1 SP and CRD. The fusion junction was in-frame, connecting the DEC-205 CRD 10 to the DCL-1 CRD, TM, and CP, suggesting that the DEC-205/DCL-1 fusion mRNA is translated. Furthermore, analysis of the DEC-205 and DCL-1 genes indicated that for this fusion mRNA the junction is formed by splicing DEC-205 exon 35 and DCL-1 exon 1, resulting in the fusion of DEC-205 exon 34 to DCL-1 exon 2 (a variant fusion mRNA termed V34-2, Fig. 1B). An additional variant fusion mRNA termed V33-2 is described below. The DEC-205/DCL-1 Fusion mRNA Appears to Encode the Entire DEC-205 Ectodomain—We examined the L428 cDNA pool containing the DEC-205/DCL-1 junction by RT-PCR to examine whether it included the entire DEC-205 ectodomain (Fig. 2). The combination of the DEC-205 CP-specific reverse primer 085 with DEC-205-specific forward primers, nested to various parts of DEC-205 ectodomain, yielded major PCR products of the sizes predicted in accordance with the primer combinations used. We also detected slightly smaller (by ∼200 bp) minor PCR products, which were most apparent in the primer combinations of 078/085 and 088/085. When the DCL-1-specific reverse primer 086 was used in combination with the same DEC-205-specific forward primers, we detected doublet bands (∼200 bp apart), the larger band of which was the predicted size. Sequence analysis indicated that the smaller RT-PCR fragments from DEC-205 itself or the DEC-205/DCL-1 fusion mRNA were amplified from alternatively spliced RNA, lacking DEC-205 exon 34 (168 bp, described below). Thus, L428 cells express at least two variants of the DEC-205/DCL-1 fusion mRNAs, one with DEC-205 exon 34 fused to DCL-1 exon 2 (a variant termed V34-2) and one with DEC-205 exon 33 fused to DCL-1 exon 2 (a variant termed V33-2) (Fig. 2). Sequence analysis of the fusion junction of V33-2 showed that the junction is in-frame, indicating that V33-2 DEC-205/DCL-1 fusion mRNA is also likely to be translated. The V34-2 encodes the entire DEC-205 ectodomain fused to DCL-1 CRD, TM, and CP. The V33-2 lacks approximately one-third of the C-terminal portion of DEC-205 CRD 10, and the rest of DEC-205 ectodomain is fused to DCL-1. The DEC-205/DCL-1 Fusion mRNA Is Predominantly Expressed by HRS Cell Lines—To assess DEC-205/DCL-1 fusion mRNA expression, we performed Northern blot analysis in several hematopoietic cell lines (Fig. 3). The DCL-1-specific probe nested within the DCL-1 ectodomain detected a single 4.2-kb DCL-1 mRNA band in myeloid cell lines (HEL, HL60, U937, and Monomac 6), but no bands were detected in the B or T cell lines tested. We detected a single 9.5-kb DEC-205/DCL-1 mRNA band in HRS cell lines (HDLM-2, L428, and KM-H2), however, we did not detect the 4.2-kb DCL-1 mRNA band observed in the myeloid cell lines. The U937 cells appear to express a small amount of the 9.5-kb DEC-205/DCL-1 mRNA in addition to the 4.2-kb DCL-1 mRNA band. When the DEC-205-specific probe nested within the cysteine-rich domain was used to hybridize the same blot after the DCL-1 probe was stripped, a 7.5-kb DEC-205 mRNA band was detected in myeloid cell lines (HEL and U937), B cell lines (Daudi and Mann), and all HRS cell lines. In addition, we detected a 9.5-kb DEC-205/DCL-1 mRNA band in all HRS cell lines and the U937 as described previously (17Kato M. Neil T.K. Clark G.J. Morris C.M. Sorg R.V. Hart D.N. Immunogenetics. 1998; 47: 442-450Crossref PubMed Scopus (58) Google Scholar). Thus, it appears that the DEC-205/DCL-1 fusion mRNA predominates in HRS cell lines. The DEC-205 and DCL-1 Genes Are Juxtaposed in Chromosome Band 2q24 —We mapped the DEC-205 gene (LY75) previously to the chromosome band 2q24 (17Kato M. Neil T.K. Clark G.J. Morris C.M. Sorg R.V. Hart D.N. Immunogenetics. 1998; 47: 442-450Crossref PubMed Scopus (58) Google Scholar). The KIAA0022/DCL-1 gene was previously located to chromosome 2 (22Nomura N. Miyajima N. Sazuka T. Tanaka A. Kawarabayasi Y. Sato S. Nagase T. Seki N. Ishikawa K. Tabata S. DNA Res. 1994; 1: 27-35Crossref PubMed Scopus (272) Google Scholar) and further mapped recently to the identical chromosomal band in the NCBI UniGene data base. Using the NCBI Genome BLAST, we identified the human genomic contig NT 005151 containing both DEC-205 and the DCL-1 gene. Our sequence analysis showed that DEC-205 and DCL-1 genes consist of 35 and 6 exons, respectively, and the DEC-205 gene is localized ∼5.4 kb upstream of the DCL-1 gene (Fig. 4). The DCL-1 Gene Is Independently Expressed from the DEC-205 Gene—It is possible that the proposed DCL-1 gene is a part of DEC-205 gene and that the DCL-1 mRNA is generated by alternative splicing of DEC-205 mRNA driven by DEC-205 promoter. If this were the case, the DCL-1 5′-untranslated region should contain at least some DEC-205 gene sequences. To assess this possibility, we performed RNA ligase-mediated 5′-RACE using HL-60 total RNA and determined the DCL-1 transcription initiation site (Fig. 5). This procedure is designed to amplify cDNA only from full-length, capped mRNA, and suitable to determine the transcription initiation site. Two rounds of DCL-1-specific PCR amplification of the DCL-1 cDNA yielded a ∼250-bp single band regardless of primers (random decamers or DCL-1-specific primer 061) for reverse transcription (Fig. 5A). Sequencing of the 5′-RACE product indicated that DCL-1 transcription initiation site is mapped to 44 bp upstream of DCL-1 translation start codon (ATG, A at +1) located within the 5.4-kb intervening sequence between DEC-205 and DCL-1 gene. Thus, the DCL-1 gene is transcribed independently from DEC-205 gene. Therefore, the DEC-205 and DCL-1 fusion mRNA variants appear to be generated by cotranscription of both DEC-205 and DCL-1 genes followed by intergenic splicing to remove the DEC-205 exon 35 alone or exon 34–35 along with DCL-1 exon 1, resulting in DEC-205 exon 34 fused to DCL-1 exon 2 (V34-2) or DEC-205 exon 33 fused to DCL-1 exon 2 (V33-2) (see Fig. 1). The DNA sequences of DEC-205/DCL-1 fusion mRNA variants and DCL-1 mRNA were submitted to the GenBank™ and assigned the accession number AY184222 (for V34-2), AY314006 (for V33-2), and AY314007 (for DCL-1), respectively. DEC-205/DCL-1 Fusion mRNA Is Translated to the Fusion Protein—We sought to establish whether the DEC-205/DCL-1 fusion mRNA is translated into a fusion protein. We prepared cell lysates from three HRS cell