Title: The Upstream Region of the Rpe65 Gene Confers Retinal Pigment Epithelium-specific Expression in Vivo and in Vitro and Contains Critical Octamer and E-box Binding Sites
Abstract: RPE65 is essential for all-trans- to 11-cis-retinoid isomerization, the hallmark reaction of the retinal pigment epithelium (RPE). Here, we identify regulatory elements in the Rpe65 gene and demonstrate their functional relevance to Rpe65 gene expression. We show that the 5′ flanking region of the mouse Rpe65 gene, like the human gene, lacks a canonical TATA box and consensus GC and CAAT boxes. The mouse and human genes do share several cis-acting elements, including an octamer, a nuclear factor one (NFI) site, and two E-box sites, suggesting a conserved mode of regulation. A mouseRpe65 promoter/β-galactosidase transgene containing bases –655 to +52 (TR4) of the mouse 5′ flanking region was sufficient to direct high RPE-specific expression in transgenic mice, whereas shorter fragments (–297 to +52 or –188 to +52) generated only background activity. Furthermore, transient transfection of analogous TR4/luciferase constructs also directed high reporter activity in the human RPE cell line D407 but weak activity in the non-RPE cell lines HeLa, HepG2, and HS27. Functional binding of potential transcription factors to the octamer sequence, AP-4, and NFI sites was demonstrated by directed mutagenesis, electrophoretic mobility shift assay, and cross-linking. Mutations of these sites abolished binding and corresponding transcriptional activity and indicated that octamer and E-box transcription factors synergistically regulate the RPE65 promoter function. Thus, we have identified the regulatory region in theRpe65 gene that accounts for tissue-specific expression in the RPE and found that octamer and E-box transcription factors play a critical role in the transcriptional regulation of theRpe65 gene. RPE65 is essential for all-trans- to 11-cis-retinoid isomerization, the hallmark reaction of the retinal pigment epithelium (RPE). Here, we identify regulatory elements in the Rpe65 gene and demonstrate their functional relevance to Rpe65 gene expression. We show that the 5′ flanking region of the mouse Rpe65 gene, like the human gene, lacks a canonical TATA box and consensus GC and CAAT boxes. The mouse and human genes do share several cis-acting elements, including an octamer, a nuclear factor one (NFI) site, and two E-box sites, suggesting a conserved mode of regulation. A mouseRpe65 promoter/β-galactosidase transgene containing bases –655 to +52 (TR4) of the mouse 5′ flanking region was sufficient to direct high RPE-specific expression in transgenic mice, whereas shorter fragments (–297 to +52 or –188 to +52) generated only background activity. Furthermore, transient transfection of analogous TR4/luciferase constructs also directed high reporter activity in the human RPE cell line D407 but weak activity in the non-RPE cell lines HeLa, HepG2, and HS27. Functional binding of potential transcription factors to the octamer sequence, AP-4, and NFI sites was demonstrated by directed mutagenesis, electrophoretic mobility shift assay, and cross-linking. Mutations of these sites abolished binding and corresponding transcriptional activity and indicated that octamer and E-box transcription factors synergistically regulate the RPE65 promoter function. Thus, we have identified the regulatory region in theRpe65 gene that accounts for tissue-specific expression in the RPE and found that octamer and E-box transcription factors play a critical role in the transcriptional regulation of theRpe65 gene. retinal pigment epithelium nuclear factor one cellular 11-cis-retinaldehyde-binding protein polymerase chain reaction base pair(s) 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside β-galactosidase electrophoretic mobility shift assay CCAAT-box binding transcription factor/nuclear factor one helix-loop-helix All-trans- to 11-cis-isomerization of vitamin A is an obligate and tissue-specific enzymatic step in the renewal of 11-cis-retinal, the universal chromophore of rhodopsin and other visual pigment proteins, in the visual cycle (1Saari J.C. Invest. Ophthalmol. Visual Sci. 2000; 41: 337-348PubMed Google Scholar) of the retinal pigment epithelium (RPE).1 Several components, including 11-cis-retinol dehydrogenase (2Simon A. Hellman U. Wernstedt C. Eriksson U. J. Biol. Chem. 1995; 270: 1107-1112Abstract Full Text Full Text PDF PubMed Scopus (216) Google Scholar), cellular 11-cis-retinaldehyde-binding protein (CRALBP) (3Saari J.C. Bredberg D.L. Exp. Eye Res. 1988; 46: 569-578Crossref PubMed Scopus (32) Google Scholar, 4Saari J.C. Bredberg D.L. Noy N. Biochemistry. 1994; 33: 3106-3112Crossref PubMed Scopus (80) Google Scholar) and lecithin:retinol acyltransferase (5Saari J.C. Bredberg D.L. J. Biol. Chem. 1988; 263: 8084-8090Abstract Full Text PDF PubMed Google Scholar, 6Ruiz A. Winston A. Lim Y.H. Gilbert B.A. Rando R.R. Bok D. J. Biol. Chem. 1999; 274: 3834-3841Abstract Full Text Full Text PDF PubMed Scopus (212) Google Scholar), all essential to the visual cycle activity, are found highly expressed, but not exclusively expressed, in the RPE. However, the retinol isomerase activity (7Bernstein P.S. Rando R.R. Biochemistry. 1986; 25: 6473-6478Crossref PubMed Scopus (54) Google Scholar, 8Deigner P.S. Law W.C. Canada F.J. Rando R.R. Science. 1989; 244: 968-971Crossref PubMed Scopus (155) Google Scholar, 9Winston A. Rando R.R. Biochemistry. 1998; 37: 2044-2050Crossref PubMed Scopus (80) Google Scholar), central to 11-cis-chromophore synthesis, is expected, mechanistically, to be highly tissue-specific. A tissue-specific component of the RPE, RPE65 (10Hamel C.P. Tsilou E. Pfeffer B.A. Hooks J.J. Detrick B. Redmond T.M. J. Biol. Chem. 1993; 268: 15751-15757Abstract Full Text PDF PubMed Google Scholar, 11Hamel C.P. Tsilou E. Harris E. Pfeffer B.A. Hooks J.J. Detrick B. Redmond T.M. J. Neurosci. Res. 1993; 34: 414-425Crossref PubMed Scopus (104) Google Scholar, 12Hamel C.P. Jenkins N.A. Gilbert D.J. Copeland N.G. Redmond T.M. Genomics. 1994; 20: 509-512Crossref PubMed Scopus (56) Google Scholar), which copurifies with 11-cis-retinol dehydrogenase (2Simon A. Hellman U. Wernstedt C. Eriksson U. J. Biol. Chem. 1995; 270: 1107-1112Abstract Full Text Full Text PDF PubMed Scopus (216) Google Scholar), appears to play a crucial role in retinoid isomerization. Thus, in the Rpe65-deficient mouse (13Redmond T.M., Yu, S. Lee E. Bok D. Hamasaki D. Chen N. Goletz P. Ma J.X. Crouch R.K. Pfeifer K. Nat. Genet. 1998; 20: 344-351Crossref PubMed Scopus (779) Google Scholar), rod photoreceptor function is abolished due to lack of the 11-cis-retinal chromophore. Furthermore, mutations in the human RPE65 gene cause several forms of severe early onset blindness (14Morimura H. Fishman G.A. Grover S.A. Fulton A.B. Berson E.L. Dryja T.P. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3088-3093Crossref PubMed Scopus (393) Google Scholar, 15Marlhens F. Bareil C. Griffoin J.M. Zrenner E. Amalric P. Eliaou C. Liu S.Y. Harris E. Redmond T.M. Arnaud B. Claustres M. Hamel C.P. Nat. Genet. 1997; 17: 139-141Crossref PubMed Scopus (507) Google Scholar, 16Marlhens F. Griffoin J.M. Bareil C. Arnaud B. Claustres M. Hamel C.P. Eur. J. Hum. Genet. 1998; 6: 527-531Crossref PubMed Scopus (56) Google Scholar, 17Gu S.M. Thompson D.A. Srikumari C.R. Lorenz B. Finckh U. Nicoletti A. Murthy K.R. Rathmann M. Kumaramanickavel G. Denton M.J. Gal A. Nat. Genet. 1997; 17: 194-197Crossref PubMed Scopus (525) Google Scholar). Clearly, RPE65 is essential to the visual cycle in general and to all-trans- to 11-cis-retinoid isomerization in particular. RPE65 is the major protein of the RPE microsomal membrane fraction. The bovine (10Hamel C.P. Tsilou E. Pfeffer B.A. Hooks J.J. Detrick B. Redmond T.M. J. Biol. Chem. 1993; 268: 15751-15757Abstract Full Text PDF PubMed Google Scholar), human (18Nicoletti A. Wong D.J. Kawase K. Gibson L.H. Yang-Feng T.L. Richards J.E. Thompson D.A. Hum. Mol. Genet. 1995; 4: 641-649Crossref PubMed Scopus (105) Google Scholar), dog (19Aguirre G.D. Baldwin V. Pearce-Kelling S. Narfstrom K. Ray K. Acland G.M. Mol. Vis. 1998; 4: 23PubMed Google Scholar), rat (20Manes G. Leducq R. Kucharczak J. Pages A. Schmitt-Bernard C.F. Hamel C.P. FEBS Lett. 1998; 423: 133-137Crossref PubMed Scopus (22) Google Scholar), and salamander (21Ma J. Xu L. Othersen D.K. Redmond T.M. Crouch R.K. Biochim. Biophys. Acta. 1998; 1443: 255-261Crossref PubMed Scopus (43) Google Scholar) cDNAs have been cloned, as have the human (18Nicoletti A. Wong D.J. Kawase K. Gibson L.H. Yang-Feng T.L. Richards J.E. Thompson D.A. Hum. Mol. Genet. 1995; 4: 641-649Crossref PubMed Scopus (105) Google Scholar) and mouse genes. 2S. Liu, A. Boulanger, J. Kammer, E. Harris, S. Yu, and T. M. Redmond, manuscript in preparation. 2S. Liu, A. Boulanger, J. Kammer, E. Harris, S. Yu, and T. M. Redmond, manuscript in preparation. RPE65 is specific to the vertebrate RPE and is also highly conserved at the level of protein sequence. Previous data suggest a complex transcriptional and translational regulation of RPE65. At the transcriptional level, our knowledge is limited (22Nicoletti A. Kawase K. Thompson D.A. Invest. Ophthalmol. Visual Sci. 1998; 39: 637-644PubMed Google Scholar), and we lack functional evidence concerning the transcriptional elements involved in the activation of the gene and in its specific expression in the RPE. Transcription ofRpe65 appears to be developmentally regulated, with the protein first appearing at about postnatal day 4 in the rat (11Hamel C.P. Tsilou E. Harris E. Pfeffer B.A. Hooks J.J. Detrick B. Redmond T.M. J. Neurosci. Res. 1993; 34: 414-425Crossref PubMed Scopus (104) Google Scholar), coincident with the first appearance of the photoreceptor outer segments. Reverse transcription-polymerase chain reaction (reverse transcription-PCR) analysis of RPE65 in embryonic and newborn rat suggests a biphasic induction of RPE65 mRNA expression (20Manes G. Leducq R. Kucharczak J. Pages A. Schmitt-Bernard C.F. Hamel C.P. FEBS Lett. 1998; 423: 133-137Crossref PubMed Scopus (22) Google Scholar). At the level of translation, we have found that a 170-nucleotide region of the RPE65 3′ untranslated region acts as a translational inhibition element (23Liu S.Y. Redmond T.M. Arch. Biochem. Biophys. 1998; 357: 37-44Crossref PubMed Scopus (21) Google Scholar). Also, when RPE cells are explanted into culture, they lose expression of RPE65 protein within 2 weeks, although the expression of RPE65 mRNA can continue (10Hamel C.P. Tsilou E. Pfeffer B.A. Hooks J.J. Detrick B. Redmond T.M. J. Biol. Chem. 1993; 268: 15751-15757Abstract Full Text PDF PubMed Google Scholar, 11Hamel C.P. Tsilou E. Harris E. Pfeffer B.A. Hooks J.J. Detrick B. Redmond T.M. J. Neurosci. Res. 1993; 34: 414-425Crossref PubMed Scopus (104) Google Scholar). Here, we present the sequence of the 5′ flanking region of the mouseRpe65 gene and indicate its similarity to the corresponding human gene region. We have generated transgenic mice containingRpe65 promoter-reporter constructs and show that theRpe65 5′flanking region –655 to +52 can drivelacZ reporter gene expression specifically in the RPE. In addition, we show that this fragment also displays a high transcriptional activity in D407 RPE cells in vitro. Furthermore, by directed mutagenesis, electrophoretic mobility shift assay (EMSA), and cross-linking, we demonstrate functional binding of transcription factors to an octamer sequence and AP-4 and NFI sites and show their importance to the transcriptional regulation of the mouseRpe65 gene. A P1 clone containing the complete mouse Rpe65 gene was isolated (Genomic Systems, St. Louis, MO). Restriction fragments containing the 5′ region of the mouseRpe65 gene were identified by Southern blot hybridization to a random-primed 32P-labeled bovine cDNA 5′ end probe (10Hamel C.P. Tsilou E. Pfeffer B.A. Hooks J.J. Detrick B. Redmond T.M. J. Biol. Chem. 1993; 268: 15751-15757Abstract Full Text PDF PubMed Google Scholar). pBluescript subclones containing the 5′ region of theRpe65 gene were sequenced. One such clone, E1–12, was found to contain the first three exons of mouse Rpe65, as well as 2.8 kilobase pairs of 5′ flanking region. This was compared with the sequence of the 5′ flanking region of the human RPE65 gene, obtained in the same way (15Marlhens F. Bareil C. Griffoin J.M. Zrenner E. Amalric P. Eliaou C. Liu S.Y. Harris E. Redmond T.M. Arnaud B. Claustres M. Hamel C.P. Nat. Genet. 1997; 17: 139-141Crossref PubMed Scopus (507) Google Scholar), using the GeneWorks 2.5 and MacVector 6.5 sequence analysis programs (Oxford Molecular, Beaverton, OR). For transgenic mice, three constructs, TR2, TR3, and TR4, containing sequences included in the mouse 5′ flanking region, were amplified. For amplification, oligonucleotide primer pairs containing HindIII restriction sites at their 5′ ends were used. The forward oligonucleotide primers used were (restriction sites underlined) as follows: TR4, 5′-CCCAAGCTTGCAATGGTGAAGACAGTGA-3′; TR3, 5′-CCCAAGCTTTACAGTGAGGATAACAGCA-3′; and TR2, 5′CCCAAGCTTGATCCAAGTCTGGAAAATA-3′. The common reverse primer used was 5′-CCCAAGCTTCTTCCAGTGAAGATTAGAG-3′. These fragments were digested with HindIII and subcloned into HindIII-digested pCH126A2 plasmid (24Goring D.R. Rossant J. Clapoff S. Breitman M.L. Tsui L.C. Science. 1987; 235: 456-458Crossref PubMed Scopus (95) Google Scholar) containing an E. coli lacZ gene and simian virus 40 polyadenylation signal sequences. For transient transfection luciferase assay, constructs TR3 and TR4 were inserted into the plasmid pGL3-Basic (Promega, Madison, WI). The forward primers were the same as those used to amplify TR3 and TR4 fragments during the production of transgenic mice. The common reverse primer also overlapped with the primer used before, but it lacked four bases at the 3′ end. Mutations were introduced by DNA amplification using QuickChangeTM site-directed mutagenesis kit (Stratagene, La Jolla, CA). A total of four site-directed mutants using the pTR4luc plasmid as a template were generated. These were named m1AP4, mNFI, m2AP4, and mOct. 11 additional constructs, as well, containing combinatorial mutations in two, three, or all of the cited elements were created using single, double, or triple mutants as a template, respectively. Mutated oligonucleotides used for DNA amplification are shown in Table II. The introduction of mutations was verified by DNA sequencing.Table IIOligonucleotides used for EMSA and directed mutagenesisNamePositionSequence (5′-3′)Oct-1−515 to −475GATAGCAGGGTTAAAACATGCAAAGACAGCACCTCATATACOct-1m−515 to −475–––––––––––––––––CCA––CCA––––––––––––––––2AP-4−271 to −237GATGACTGAGGTCAGCTCAGGACTGCATGGCAGGC2AP-4m−271 to −237––––––––––––––AT–A–TT––––––––––––––NFI−187 to −155ATCCAAGTCTGGAAAATAGCCAAAACACTGTTANFIm−187 to −155––––––––––––––––––TAA––––––––––––EBNA-1AATTGAGCTCGGTACCCGGGGATCCTATCTGGGTAGCATATGCTATCCTAATGGATCCTCTAGAGTCGACCTGGAGGCATGC1AP-4−102 to −64CTTTTGTTACCTTCCATCAGCTGAGGGGTGGAGAGGGTTC1AP-4m−102 to −64––––––––––––––––––CATC––A–––––––––––––––1AP-4–5Br−64 to −102GAACCC5C5CCACCCC5CAGC5GA5GGAAGG5AACAAAAGRespective binding sequences are in boldface. Base substitutions are noted in all the mutated oligonucleotides (m). 5Br, 5-bromodeoxyuridine (5Saari J.C. Bredberg D.L. J. Biol. Chem. 1988; 263: 8084-8090Abstract Full Text PDF PubMed Google Scholar). Open table in a new tab Respective binding sequences are in boldface. Base substitutions are noted in all the mutated oligonucleotides (m). 5Br, 5-bromodeoxyuridine (5Saari J.C. Bredberg D.L. J. Biol. Chem. 1988; 263: 8084-8090Abstract Full Text PDF PubMed Google Scholar). DNA constructs were microinjected into the male pronuclei of single cell FVB/N mouse embryos, which were implanted into pseudopregnant CD1 foster mothers, using standard techniques. Transgenic founder mice and their progeny were identified by PCR of a region common to all of the transgenes. For some founders, copy number was estimated by Southern blot analysis ofPstI-digested genomic DNA hybridized with a lacZgene probe. Transgenic founders were bred to CD1 mice to generate F1 progeny. β-Galactosidase (β-gal) reporter gene activity was assayed using the chemiluminescent Galacto-Light Plus assay (Tropix/PE Applied Biosystems, Bedford, MA). Eyes were dissected into three parts: the anterior segment, comprising the cornea, iris, and ciliary body; the posterior segment, comprising the retina, RPE, choroid, and sclera; and the lens. Noneye tissues assayed were brain, liver, lung, heart, kidney, and spleen. For histochemistry, tissues were fixed for 1 h in 4% paraformaldehyde in phosphate-buffered saline and washed three times in 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (X-gal) rinse buffer (100 mm sodium phosphate, pH 7.3, 2 mm MgCl2, 0.01% sodium deoxycholate, 0.02% Nonidet P-40). The eyes were stained overnight in a solution of 2 mg/ml X-gal in X-gal rinse buffer containing 5 mm each potassium ferrocyanide and potassium ferricyanide. After staining, tissues were postfixed in 4% paraformaldehyde and embedded in methacrylate. Sections were cut at a thickness of 5 μm, counterstained with neutral red, and evaluated for presence of blue product. In addition, stained eyes were postfixed in 4% paraformaldehyde and dissected to remove anterior segment, lens, and retina. The resultant eyecup was quartered and flat-mounted in 50% glycerol for an en face preparation of the RPE/choroid/sclera complex. The human retinal pigment epithelium cell line D407 was obtained from Richard C. Hunt (25Davis A.A. Bernstein P.S. Bok D. Turner J. Nachtigal M. Hunt R.C. Invest. Ophthalmol. Visual Sci. 1995; 36: 955-964PubMed Google Scholar) and grown in high glucose Dulbecco's modified Eagle's medium (Life Technologies, Inc.) supplemented with 3% fetal bovine serum, 100 units/ml penicillin, 100 μg/ml streptomycin, and 2 mm glutamine. HeLa, HepG2, and HS27 cells were obtained from American Type Culture Collection (Manassas, VA) and grown in the same medium as used for D407 except that the concentration of fetal bovine serum was 10%. Approximately 2.5 × 105 cells were plated onto six-well tissue culture dishes and allowed to grow for 48–72 h (until 80–90% confluent). To correct for differences in transfection efficiency, 2 μg of each luciferase plasmid and 90 ng of pSV40/β-gal were added to the cells in a solution containing Superfect transfectant (Qiagen, Chatsworth, CA). Luciferase and β-gal reporter gene activities were assayed using the Dual-Light reporter gene assay (Tropix/PE Applied Biosystems, Bedford, MA). The ratio of luciferase activity to β-gal activity in each sample served as a measure of normalized luciferase activity. Experiments were performed in triplicate at least four times. Nuclear extracts from D407 and freshly dissected RPE bovine cells were prepared by the method of Dignam et al.(26Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9149) Google Scholar). For EMSA, double-stranded oligonucleotides (Table II) were labeled with polynucleotide kinase and [γ-32P]dATP (6000 Ci/mmol). Approximately 15 μg of nuclear extract were added to binding buffer (33 mm Tris-HCl, pH 7.5, 166 mmNaCl, 1.6 mm dithiothreitol), 4 μg of poly(dI-dC), 0.04% Nonidet P-40, 8% glycerol, and 32P-labeled probe (30,000–50,000 cpm) and incubated at room temperature 30 min. For the competition assay, a 50–2000-fold molar excess of unlabeled wild type, mutant, or nonspecific competitor oligonucleotide was used along with the labeled probe. The DNA-protein complexes were resolved on 5% polyacrylamide gels in 0.5× Tris borate-EDTA buffer and visualized by autoradiography. For antibody supershifts, nuclear extracts were incubated with 1 μl of CTF/NFI polyclonal antibody (provided by Naoko Tanese) or 4 μl of α-Oct-1 monoclonal antibody (provided by Winship Herr, isotype IgG1, κ) for 1 h at room temperature prior to addition of labeled probe. Corresponding preimmune serum was used as a control in the NFI supershift assay. Medium containing Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and antibiotics and an Oct-2 antibody (provided by Winship Herr) with the same isotype as the α-Oct-1 antibody were used as controls in the supershift assays. For cross-linking experiments, thymidines were substituted by 5-bromo-deoxyuridine in one oligonucleotide strand. After incubation with the probe in the same conditions described above, samples were cross-linked for 10 min under UV radiation in a Strata-linker. For molecular weight determinations, samples were electrophoresed on a 12% polyacrylamide-Tris-HCl gel (Bio-Rad) in 1× Tris-glycine-SDS buffer. We have sequenced approximately 2.8 kilobase pairs of 5′ flanking region upstream of the putative transcription start site of the mouse Rpe65 gene (Fig.1 A; numbered +1 based on homology with the human gene (22Nicoletti A. Kawase K. Thompson D.A. Invest. Ophthalmol. Visual Sci. 1998; 39: 637-644PubMed Google Scholar)) and searched for sequences evolutionarily conserved between the mouse and humanRpe65/RPE65 genes 5′ flanking regions. When 2.8 kilobase pairs of the 5′ flanking region of the mouse and humanRpe65/RPE65 genes were compared by dot matrix analysis, a diagonal of similarity was seen distally to approximately –1200 with a short region of similarity closer to the 5′ end of each segment (data not shown). The proximal 628 and 581 nucleotides of the human and mouse 5′ flanking regions, respectively, and 5′ untranslated regions were compared by ClustalW alignment (Fig. 1 B). Many conserved blocks of sequence were noted between the two, including NFI (at –178 to –165), octamer (at –498 to –491), and two E-box consensus (at –84 to –79 and –257 to –252) binding sites. The overall homology is over 70%. A possible site homologous to the human CRALBP gene (27Kennedy B.N. Goldflam S. Chang M.A. Campochiaro P. Davis A.A. Zack D.J. Crabb J.W. J. Biol. Chem. 1998; 273: 5591-5598Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar) element, noted by Nicoletti et al. (22Nicoletti A. Kawase K. Thompson D.A. Invest. Ophthalmol. Visual Sci. 1998; 39: 637-644PubMed Google Scholar) in the humanRPE65 5′ flanking region is present at –72 to –63 in the mouse Rpe65 5′ flanking region. This element, however, is not represented in the mouse CRALBP gene promoter. The NFI site in both genes has a similar intervening nonconsensus sequence (AAA(T/C)A) only seen previously in the human RPE65 gene (22Nicoletti A. Kawase K. Thompson D.A. Invest. Ophthalmol. Visual Sci. 1998; 39: 637-644PubMed Google Scholar), but the consensus binding half-sites (TGGA-N5-GCCA) match perfectly with the CTF/NFI family consensus. The two E-box sites are consensus basic helix-loop-helix (HLH) protein binding sites, although Nicolettiet al. (22Nicoletti A. Kawase K. Thompson D.A. Invest. Ophthalmol. Visual Sci. 1998; 39: 637-644PubMed Google Scholar) specifically ascribed them to AP-4. An octamer sequence was also identified in both promoters; they differed by only one nucleotide from the consensus octamer sequence ATGCAAAT. Both human and mouse genes lack consensus GC and CAAT boxes. A possible TATA box was identified at –27 to –20 in the human gene (22Nicoletti A. Kawase K. Thompson D.A. Invest. Ophthalmol. Visual Sci. 1998; 39: 637-644PubMed Google Scholar), although, as in the mouse gene, it is somewhat deviated from consensus (28Wobbe C.R. Struhl K. Mol. Cell. Biol. 1990; 10: 3859-3867Crossref PubMed Scopus (238) Google Scholar, 29Singer V.L. Wobbe C.R. Struhl K. Genes Dev. 1990; 4: 636-645Crossref PubMed Scopus (154) Google Scholar). In addition, sequences similar to motifs found in other retina-specific genes, including interphotoreceptor retinoid-binding protein (IRBP) (30Bobola N. Hirsch E. Albini A. Altruda F. Noonan D. Ravazzolo R. J. Biol. Chem. 1995; 270: 1289-1294Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar) and CRALBP (27Kennedy B.N. Goldflam S. Chang M.A. Campochiaro P. Davis A.A. Zack D.J. Crabb J.W. J. Biol. Chem. 1998; 273: 5591-5598Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar), were identified. Although similar sequences were found in the human RPE65 gene proximal promoter (22Nicoletti A. Kawase K. Thompson D.A. Invest. Ophthalmol. Visual Sci. 1998; 39: 637-644PubMed Google Scholar), it is not yet clear what role, if any, these play in the overall activity of the Rpe65 gene. To identify sequence elements and transcriptional factors responsible of Rpe65 expression, we first determined the minimal Rpe65 promoter sequence necessary for the in vivo specific expression of the Rpe65 gene in the RPE. We made three constructs containing the upstream sequence of theRpe65 gene coupled to the lacZ gene/SV40 poly(A) signal sequence, and we analyzed their corresponding β-gal activity in transgenic mice. These contained the following sequence positions (construct name in parentheses): –188 to +52 (TR2), –297 to +52 (TR3), and –655 to +52 (TR4). Microinjection of these constructs into fertilized oocytes resulted in the generation of several founder lines for each construct. Copy number was estimated by comparing the hybridization signal of probe with genomic DNA from transgenic mice to serial dilutions of a known quantity of the relevant linearized construct. The number of founders analyzed and the number of copies and β-gal expression levels of each construct are presented in Table I.Table Iβ-Gal activity in transgenic mouse linesConstructFoundern 1-aNumber of mice analyzed.Copy no. 1-bNumber of transgene copies integrated.PS-βgal 1-cβ-Gal expression in the posterior segment (PS) of the eye. +++, +, and − represent comparison of β-gal activity. +++, high expression; +, low expression; −, no expression.Ectopic 1-dEctopic β-gal expression in non-RPE tissues.TR246ND 1-eND, value not determined.−−TR38121−−12101−Retina94ND−−TR4362+++−6302+++Cerebellum1843ND+++−1901ND+−1-a Number of mice analyzed.1-b Number of transgene copies integrated.1-c β-Gal expression in the posterior segment (PS) of the eye. +++, +, and − represent comparison of β-gal activity. +++, high expression; +, low expression; −, no expression.1-d Ectopic β-gal expression in non-RPE tissues.1-e ND, value not determined. Open table in a new tab Although RPE65 has been shown to be expressed specifically in the RPE of the eye and is not found in nonocular tissues (11Hamel C.P. Tsilou E. Harris E. Pfeffer B.A. Hooks J.J. Detrick B. Redmond T.M. J. Neurosci. Res. 1993; 34: 414-425Crossref PubMed Scopus (104) Google Scholar), we surveyed expression of RPE65 promoter-lacZ gene constructs in a variety of tissues. We assayed eye tissues (the anterior segment, comprising the cornea, iris and ciliary body; the posterior segment, comprising the retina, RPE, choroid, and sclera; and the lens) and noneye tissues (brain, heart, lung, liver, kidney, and spleen) from transgenic and nontransgenic F1 or F2 littermates for β-gal activity. We found that the constructs pTR2lacZ (–188/+52, not shown) and pTR3lacZ (–297/+52) produced only background β-gal activity in control or transgenic animals in all tissues assayed (Fig.2 A). However, the longest construct pTR4lacZ (–655/+52) exhibited an average of about 15-fold higher β-gal activity than the control in the posterior segment, but no significant difference in other ocular and nonocular tissues (Fig. 2 B). The values obtained for TR3 (progeny of founder 12) are shown in Fig. 2 A, and those obtained for TR4 (progeny of founder 3) are shown in Fig. 2 B. Concerning TR4, very similar values were obtained for F1 progeny of founder 6 and 184, but founder 190 had values 75% lower than these. Discernible staining was seen only in the eyes of pTR4lacZ (–655/+52) transgenic animals (founders 3, 6, and 184). At the gross level, staining of the whole eyes revealed a punctate pattern (Fig.3 A). In sections of these eyes examined by light microscopy, the blue X-gal product was seen to be restricted in its distribution to the RPE cells of transgenic mice (Fig. 3 C), whereas none was present in nontransgenic littermates (Fig. 3, B and D). No staining of lens, anterior segment, or neural retina was observed in transgenic and nontransgenic animals (data not shown). Staining of the RPE was patchy, however, and this was best appreciated by en face light microscopy of transgenic RPE/choroid/sclera flat mount (Fig.3 E). Again, no staining was present in nontransgenic littermate controls (Fig. 3 F). Although most, if not all, cells of the RPE demonstrated some level of X-gal staining in the cytoplasm, about 15% of cells were much more highly stained and filled with blue product. Analyses of fixed TR4 noneye tissues stained with X-gal did not reveal any detectable staining except for the founder 6 progeny, which showed an ectopic β-gal expression in the cerebellum. RPE65 is not expressed in brain (11Hamel C.P. Tsilou E. Harris E. Pfeffer B.A. Hooks J.J. Detrick B. Redmond T.M. J. Neurosci. Res. 1993; 34: 414-425Crossref PubMed Scopus (104) Google Scholar) or cerebellum. 3T. M. Redmond, unpublished data. To better understand the transcriptional regulation of theRpe65 gene, we searched for a cellular model capable of activation of the mouse Rpe65 promoter. Although only traces of RPE65 mRNA are detected by PCR in nonconfluent cultures of the human RPE cell D407 (data not shown), it has been demonstrated that these cells are able to activate a human RPE65 promoter (22Nicoletti A. Kawase K. Thompson D.A. Invest. Ophthalmol. Visual Sci. 1998; 39: 637-644PubMed Google Scholar). Thus, to test its activity and specificity in vitro, the promoter fragment TR4 (–655 to + 52) was cloned into the luciferase reporter vector pGL3-Basic and transfected into D407 cells. To show the cellular specificity of the vector, it was also transfected into the non-RPE cell lines HeLa, HepG2, and HS27. None of these latter cell lines or the tissues from which the