Publication Information

{'id': 'https://openalex.org/W2060007614', 'doi': 'https://doi.org/10.1074/jbc.273.35.22657', 'title': 'N-linked Glycosylation of the Thyroid Na+/I− Symporter (NIS)', 'display_name': 'N-linked Glycosylation of the Thyroid Na+/I− Symporter (NIS)', 'publication_year': 1998, 'publication_date': '1998-08-01', 'ids': {'openalex': 'https://openalex.org/W2060007614', 'doi': 'https://doi.org/10.1074/jbc.273.35.22657', 'mag': '2060007614', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/9712895'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.273.35.22657', 'pdf_url': 'http://www.jbc.org/article/S0021925818487728/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925818487728/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5016957347', 'display_name': 'Orlie Levy', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I129975664', 'display_name': 'Albert Einstein College of Medicine', 'ror': 'https://ror.org/05cf8a891', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I129975664', 'https://openalex.org/I4210112371']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Orlie Levy', 'raw_affiliation_strings': ['From the ‡Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461,'], 'affiliations': [{'raw_affiliation_string': 'From the ‡Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461,', 'institution_ids': ['https://openalex.org/I129975664']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5062915879', 'display_name': 'Antonio De la Vieja', 'orcid': 'https://orcid.org/0000-0002-1187-1907'}, 'institutions': [{'id': 'https://openalex.org/I129975664', 'display_name': 'Albert Einstein College of Medicine', 'ror': 'https://ror.org/05cf8a891', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I129975664', 'https://openalex.org/I4210112371']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Antonio De la Vieja', 'raw_affiliation_strings': ['From the ‡Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461,'], 'affiliations': [{'raw_affiliation_string': 'From the ‡Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461,', 'institution_ids': ['https://openalex.org/I129975664']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5113538169', 'display_name': 'Christopher S. Ginter', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I129975664', 'display_name': 'Albert Einstein College of Medicine', 'ror': 'https://ror.org/05cf8a891', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I129975664', 'https://openalex.org/I4210112371']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Christopher S. Ginter', 'raw_affiliation_strings': ['From the ‡Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461,'], 'affiliations': [{'raw_affiliation_string': 'From the ‡Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461,', 'institution_ids': ['https://openalex.org/I129975664']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5009860045', 'display_name': 'Claudia A. Riedel', 'orcid': 'https://orcid.org/0000-0001-6168-8601'}, 'institutions': [{'id': 'https://openalex.org/I129975664', 'display_name': 'Albert Einstein College of Medicine', 'ror': 'https://ror.org/05cf8a891', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I129975664', 'https://openalex.org/I4210112371']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Claudia Riedel', 'raw_affiliation_strings': ['From the ‡Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461,'], 'affiliations': [{'raw_affiliation_string': 'From the ‡Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461,', 'institution_ids': ['https://openalex.org/I129975664']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5010495452', 'display_name': 'Ge Dai', 'orcid': 'https://orcid.org/0000-0002-6481-1705'}, 'institutions': [{'id': 'https://openalex.org/I129975664', 'display_name': 'Albert Einstein College of Medicine', 'ror': 'https://ror.org/05cf8a891', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I129975664', 'https://openalex.org/I4210112371']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Ge Dai', 'raw_affiliation_strings': ['From the ‡Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461,'], 'affiliations': [{'raw_affiliation_string': 'From the ‡Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461,', 'institution_ids': ['https://openalex.org/I129975664']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5049126875', 'display_name': 'Nancy Carrasco', 'orcid': 'https://orcid.org/0000-0001-8586-6249'}, 'institutions': [{'id': 'https://openalex.org/I129975664', 'display_name': 'Albert Einstein College of Medicine', 'ror': 'https://ror.org/05cf8a891', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I129975664', 'https://openalex.org/I4210112371']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Nancy Carrasco', 'raw_affiliation_strings': ['From the ‡Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461,'], 'affiliations': [{'raw_affiliation_string': 'From the ‡Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461,', 'institution_ids': ['https://openalex.org/I129975664']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 4.143, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 187, 'citation_normalized_percentile': {'value': 0.99997, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 98, 'max': 99}, 'biblio': {'volume': '273', 'issue': '35', 'first_page': '22657', 'last_page': '22663'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10602', 'display_name': 'Glycosylation and Glycoproteins Research', 'score': 0.9931, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10602', 'display_name': 'Glycosylation and Glycoproteins Research', 'score': 0.9931, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T12604', 'display_name': 'Glycogen Storage Diseases and Myoclonus', 'score': 0.987, 'subfield': {'id': 'https://openalex.org/subfields/2745', 'display_name': 'Rheumatology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T11642', 'display_name': 'Genomics and Rare Diseases', 'score': 0.9846, 'subfield': {'id': 'https://openalex.org/subfields/1311', 'display_name': 'Genetics'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/n-linked-glycosylation', 'display_name': 'N-linked glycosylation', 'score': 0.49101996}, {'id': 'https://openalex.org/keywords/molecular-mass', 'display_name': 'Molecular mass', 'score': 0.43776107}], 'concepts': [{'id': 'https://openalex.org/C120405084', 'wikidata': 'https://www.wikidata.org/wiki/Q285307', 'display_name': 'Symporter', 'level': 4, 'score': 0.89171827}, {'id': 'https://openalex.org/C2777313579', 'wikidata': 'https://www.wikidata.org/wiki/Q898365', 'display_name': 'Glycosylation', 'level': 2, 'score': 0.7222813}, {'id': 'https://openalex.org/C2775895851', 'wikidata': 'https://www.wikidata.org/wiki/Q185906', 'display_name': 'Asparagine', 'level': 3, 'score': 0.6223199}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.59446156}, {'id': 'https://openalex.org/C108625454', 'wikidata': 'https://www.wikidata.org/wiki/Q187126', 'display_name': 'Glycoprotein', 'level': 2, 'score': 0.5701287}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.56064475}, {'id': 'https://openalex.org/C515207424', 'wikidata': 'https://www.wikidata.org/wiki/Q8066', 'display_name': 'Amino acid', 'level': 2, 'score': 0.53488725}, {'id': 'https://openalex.org/C30324644', 'wikidata': 'https://www.wikidata.org/wiki/Q3334151', 'display_name': 'N-linked glycosylation', 'level': 4, 'score': 0.49101996}, {'id': 'https://openalex.org/C143065580', 'wikidata': 'https://www.wikidata.org/wiki/Q3285695', 'display_name': 'Mutant', 'level': 3, 'score': 0.48484147}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.44398695}, {'id': 'https://openalex.org/C58121356', 'wikidata': 'https://www.wikidata.org/wiki/Q182854', 'display_name': 'Molecular mass', 'level': 3, 'score': 0.43776107}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.31492537}, {'id': 'https://openalex.org/C181199279', 'wikidata': 'https://www.wikidata.org/wiki/Q8047', 'display_name': 'Enzyme', 'level': 2, 'score': 0.19055334}, {'id': 'https://openalex.org/C206212055', 'wikidata': 'https://www.wikidata.org/wiki/Q2553138', 'display_name': 'Glycan', 'level': 3, 'score': 0.15883008}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.09642199}, {'id': 'https://openalex.org/C149011108', 'wikidata': 'https://www.wikidata.org/wiki/Q652985', 'display_name': 'Transporter', 'level': 3, 'score': 0.07164046}], 'mesh': [{'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D027981', 'descriptor_name': 'Symporters', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D000595', 'descriptor_name': 'Amino Acid Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001483', 'descriptor_name': 'Base Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019556', 'descriptor_name': 'COS Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017931', 'descriptor_name': 'DNA Primers', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006031', 'descriptor_name': 'Glycosylation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007454', 'descriptor_name': 'Iodides', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D007454', 'descriptor_name': 'Iodides', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017136', 'descriptor_name': 'Ion Transport', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007700', 'descriptor_name': 'Kinetics', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008958', 'descriptor_name': 'Models, Molecular', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008969', 'descriptor_name': 'Molecular Sequence Data', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016297', 'descriptor_name': 'Mutagenesis, Site-Directed', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017433', 'descriptor_name': 'Protein Structure, Secondary', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.273.35.22657', 'pdf_url': 'http://www.jbc.org/article/S0021925818487728/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/9712895', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.273.35.22657', 'pdf_url': 'http://www.jbc.org/article/S0021925818487728/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 22, 'referenced_works': ['https://openalex.org/W1479888957', 'https://openalex.org/W1784665074', 'https://openalex.org/W1963645138', 'https://openalex.org/W1980832022', 'https://openalex.org/W1984794770', 'https://openalex.org/W1987014837', 'https://openalex.org/W2006714639', 'https://openalex.org/W2018613007', 'https://openalex.org/W2022310648', 'https://openalex.org/W2026316938', 'https://openalex.org/W2034083247', 'https://openalex.org/W2036493331', 'https://openalex.org/W2049344067', 'https://openalex.org/W2055169159', 'https://openalex.org/W2064039245', 'https://openalex.org/W2080372869', 'https://openalex.org/W2084810075', 'https://openalex.org/W2090937553', 'https://openalex.org/W2094533832', 'https://openalex.org/W2158554757', 'https://openalex.org/W2329260923', 'https://openalex.org/W96100949'], 'related_works': ['https://openalex.org/W4388704792', 'https://openalex.org/W4362636723', 'https://openalex.org/W2974383127', 'https://openalex.org/W2139866700', 'https://openalex.org/W2119821994', 'https://openalex.org/W2047869020', 'https://openalex.org/W2020683762', 'https://openalex.org/W2017264771', 'https://openalex.org/W1977314232', 'https://openalex.org/W1591676294'], 'abstract_inverted_index': {'The': [0, 198, 396, 489, 679, 1387, 1415, 1500, 1517, 2876, 3416, 3773, 3823, 3837, 4824, 4947, 5298, 5685], 'Na+/I−symporter': [1, 199, 419], '(NIS),': [2, 200], 'a': [3, 53, 127, 201, 251, 325, 444, 539, 688, 711, 834, 1162, 1230, 1255, 1439, 1535, 1542, 1578, 1779, 1783, 2257, 2262, 2327, 2334, 2652, 2665, 2708, 2861, 2866, 2908, 2945, 3008, 3087, 3409, 3433, 3554, 3593, 3599, 3649, 3738, 3763, 3901, 3931, 3946, 3956, 4045, 4126, 4130, 4258, 4261, 4346, 4539, 4662, 4672, 4761, 4787, 4881, 4936, 5129, 5133, 5478, 5613, 5622, 5697], '618-amino': [4, 202, 542], 'acid': [5, 164, 203, 362, 543, 1551, 4371, 4391, 4497, 4649, 5677], 'membrane': [6, 204, 804, 844, 2396, 2421, 3027, 3234, 3757, 3941, 4005, 4023, 4451, 4571, 4750, 5653], 'glycoprotein': [7, 205, 544], 'that': [8, 125, 150, 156, 160, 179, 206, 323, 348, 354, 358, 377, 449, 535, 939, 1131, 1226, 1338, 1354, 1360, 1365, 1474, 2295, 2344, 2890, 2898, 2917, 2954, 3005, 3013, 3037, 3067, 3425, 3431, 3558, 3610, 3620, 3644, 3652, 3695, 3711, 3916, 3977, 3982, 4055, 4142, 4165, 4225, 4449, 4458, 4630, 4642, 4690, 4713, 4721, 4732, 4785, 4800, 5136, 5198, 5276, 5304, 5593, 5608], 'catalyzes': [9, 207], 'the': [10, 23, 76, 92, 95, 118, 138, 157, 167, 172, 180, 208, 221, 274, 290, 293, 316, 336, 355, 365, 370, 378, 407, 418, 451, 455, 466, 494, 503, 533, 585, 751, 803, 811, 817, 821, 828, 896, 900, 1018, 1247, 1262, 1283, 1296, 1312, 1315, 1350, 1361, 1370, 1374, 1400, 1428, 1450, 1455, 1462, 1469, 1477, 1490, 1512, 1545, 1549, 1556, 1561, 1565, 1592, 1881, 1978, 1985, 2107, 2164, 2320, 2504, 2673, 2681, 2695, 2704, 2715, 2723, 2738, 2785, 2807, 2840, 2884, 2930, 3014, 3022, 3026, 3038, 3045, 3069, 3101, 3112, 3165, 3179, 3193, 3203, 3212, 3354, 3357, 3396, 3444, 3483, 3492, 3525, 3551, 3563, 3603, 3611, 3621, 3681, 3707, 3727, 3748, 3756, 3767, 3828, 3866, 3894, 3905, 3909, 3917, 3924, 3939, 3968, 4004, 4012, 4018, 4022, 4050, 4056, 4110, 4136, 4166, 4169, 4175, 4226, 4265, 4270, 4310, 4313, 4319, 4322, 4349, 4357, 4362, 4368, 4384, 4398, 4442, 4450, 4495, 4519, 4536, 4547, 4553, 4559, 4570, 4574, 4606, 4611, 4618, 4622, 4643, 4654, 4686, 4692, 4695, 4704, 4718, 4733, 4739, 4746, 4754, 4758, 4765, 4768, 4772, 4776, 4781, 4798, 4806, 4916, 4953, 4957, 4961, 4968, 4974, 5002, 5012, 5024, 5100, 5202, 5208, 5258, 5271, 5277, 5291, 5314, 5349, 5483, 5589, 5638, 5649, 5660, 5667, 5680, 5706, 5711, 5740, 5748], 'active': [11, 109, 209, 307, 446, 851, 3935, 5010], 'accumulation': [12, 210, 442, 499], 'of': [13, 56, 86, 94, 101, 113, 133, 144, 211, 254, 284, 292, 299, 311, 331, 342, 398, 409, 458, 470, 575, 587, 631, 705, 713, 753, 790, 820, 831, 843, 853, 899, 1030, 1032, 1156, 1252, 1306, 1314, 1321, 1348, 1373, 1560, 1564, 1745, 1782, 1812, 1849, 1883, 1921, 1930, 1938, 1948, 1963, 1965, 1980, 2114, 2246, 2357, 2384, 2395, 2420, 2456, 2496, 2535, 2619, 2655, 2725, 2728, 2732, 2740, 2901, 3025, 3032, 3081, 3091, 3098, 3144, 3199, 3207, 3356, 3395, 3421, 3439, 3461, 3469, 3476, 3485, 3494, 3519, 3527, 3683, 3722, 3737, 3750, 3766, 3775, 3778, 3811, 3827, 3896, 3929, 3934, 3959, 3967, 3989, 4021, 4053, 4059, 4113, 4168, 4177, 4192, 4210, 4269, 4309, 4312, 4321, 4348, 4373, 4379, 4387, 4433, 4453, 4459, 4487, 4507, 4521, 4524, 4538, 4569, 4595, 4605, 4613, 4621, 4674, 4741, 4749, 4760, 4767, 4775, 4808, 4814, 4920, 4960, 4977, 5014, 5019, 5023, 5026, 5102, 5204, 5212, 5260, 5267, 5280, 5293, 5296, 5308, 5320, 5344, 5351, 5485, 5591, 5599, 5640, 5651, 5662, 5682, 5699, 5709, 5714, 5739], 'I−': [14, 212, 399, 441, 471, 498, 697, 3779, 3804, 3812, 3841, 3920, 4151, 5715], 'into': [15, 213, 400, 1485, 1591, 3562, 5717], 'thyroid': [16, 214, 401, 410, 5718], 'cells,': [17, 215, 402, 1140, 2251, 4223], 'was': [18, 216, 634, 748, 799, 952, 1005, 1521, 1575, 1586, 1624, 1855, 1932, 1969, 1974, 1987, 2038, 2300, 2352, 2402, 2522, 2691, 2712, 2826, 2834, 2845, 2934, 3083, 3559, 3653, 3735, 3770, 3789, 3842, 4000, 4159, 4183, 4242, 4253, 4316, 4375, 4393, 4736, 4872], 'identified': [19, 217, 1027], 'and': [20, 33, 74, 90, 99, 110, 131, 218, 231, 272, 288, 297, 308, 329, 413, 647, 682, 708, 756, 807, 813, 1149, 1254, 1294, 1310, 1319, 1412, 1436, 1489, 1502, 1555, 1589, 1597, 1605, 1648, 1694, 1778, 1927, 1995, 2078, 2083, 2170, 2192, 2210, 2225, 2238, 2261, 2273, 2282, 2291, 2309, 2405, 2527, 2589, 2600, 2637, 2676, 2684, 2702, 2746, 2839, 2849, 2855, 2865, 2883, 2936, 3012, 3106, 3146, 3168, 3192, 3374, 3437, 3514, 3530, 3540, 3577, 3619, 3847, 3854, 3881, 3981, 4008, 4014, 4221, 4259, 4342, 4361, 4444, 4470, 4501, 4530, 4561, 4576, 4617, 4659, 4694, 4764, 5001, 5144, 5207, 5218, 5229, 5263, 5306, 5331, 5337, 5491, 5562, 5616, 5665, 5674, 5702, 5742], 'characterized': [21, 219], 'at': [22, 220, 1531, 1696, 1956, 1999, 2106, 2168, 2345, 2661, 2774, 3086, 3388, 3808, 4135, 5126, 5659], 'molecular': [24, 58, 222, 256, 3184, 3205, 3223, 5712], 'level': [25, 223], 'in': [26, 48, 79, 103, 137, 224, 246, 277, 301, 335, 406, 527, 584, 637, 691, 699, 892, 937, 948, 954, 1007, 1022, 1126, 1136, 1144, 1161, 1234, 1246, 1299, 1323, 1399, 1595, 1607, 1817, 1880, 1918, 1977, 2080, 2163, 2376, 2524, 2583, 2664, 2707, 2737, 2806, 2815, 2878, 2960, 3044, 3171, 3182, 3229, 3369, 3443, 3507, 3524, 3550, 3602, 3643, 3688, 3729, 3740, 3747, 3755, 3791, 3813, 3833, 3845, 3860, 3900, 3904, 3919, 3938, 3971, 4153, 4218, 4239, 4245, 4276, 4329, 4465, 4542, 4811, 4945, 5011, 5061, 5132, 5215, 5270, 5313, 5612, 5679], 'our': [27, 225, 2148, 3983, 4093, 5632], 'laboratory': [28, 226], '(Dai,': [29, 227], 'G.,': [30, 228], 'Levy,': [31, 229], 'O.,': [32, 230], 'Carrasco,': [34, 232], 'N.': [35, 233, 422, 477, 507, 550, 567, 596, 615, 662, 727, 765, 782, 870, 917, 985, 1048, 1180, 1272, 1634, 1670, 1726, 1762, 1832, 1864, 1897, 2021, 2055, 2130, 2181, 2477, 2556, 2986, 3127, 4029, 4076, 4292, 4408, 4425, 4479, 4587], '(1996)': [36, 234], 'Nature': [37, 235], '379,': [38, 236], '458–460).': [39, 237], 'Because': [40, 238, 2790, 5255], 'mature': [41, 239, 1157, 1227, 2263, 2283, 2335, 2867, 3039, 3195, 3564, 5205], 'NIS': [42, 64, 87, 102, 115, 134, 240, 262, 285, 300, 313, 332, 588, 632, 642, 798, 832, 901, 940, 950, 1002, 1023, 1132, 1159, 1165, 1228, 1307, 1322, 1401, 1487, 1566, 1853, 2151, 2207, 2223, 2234, 2253, 2298, 2364, 2391, 2429, 2463, 2506, 2542, 2588, 2590, 2601, 2767, 2843, 2869, 2902, 2948, 2958, 3033, 3041, 3059, 3082, 3169, 3190, 3208, 3361, 3376, 3386, 3401, 3414, 3440, 3463, 3477, 3504, 3547, 3586, 3596, 3637, 3642, 3658, 3675, 3704, 3718, 3741, 3752, 3787, 3800, 3850, 3880, 3936, 3943, 3952, 3962, 3990, 3999, 4060, 4114, 4127, 4158, 4178, 4182, 4199, 4215, 4350, 4374, 4454, 4469, 4631, 4832, 5142, 5206, 5213, 5226, 5283, 5309, 5327, 5609, 5729], 'is': [43, 152, 196, 241, 350, 394, 415, 443, 500, 694, 943, 1133, 1229, 1259, 1341, 1356, 1368, 1385, 1815, 2417, 2892, 2903, 2912, 2966, 3007, 3018, 3209, 3424, 3456, 3467, 3614, 3686, 3693, 3698, 3714, 3721, 3831, 3927, 3975, 4115, 4455, 4711, 4789, 4821, 4833, 4942, 5059, 5071, 5104, 5139, 5223, 5274, 5285, 5328, 5583, 5610, 5619, 5645], 'highly': [44, 242, 540, 850, 1134, 1231, 4644, 4937, 5329], 'glycosylated,': [45, 153, 243, 351, 1357, 2827, 3049], 'it': [46, 244, 3645, 3692, 3720, 3974, 4556, 4794, 5273, 5618, 5644], 'migrates': [47, 245], 'SDS-polyacrylamide': [49, 247, 3543], 'gel': [50, 248, 1434, 1646, 3544], 'electrophoresis': [51, 249, 1647, 2007], 'as': [52, 174, 185, 250, 372, 383, 493, 838, 1028, 1141, 1143, 1329, 1627, 1654, 1711, 1857, 1886, 2040, 2256, 2368, 2411, 2515, 2938, 2944, 3553, 3598, 3648, 3671, 3673, 4273, 4725, 4753, 4999], 'broad': [54, 252, 835], 'polypeptide': [55, 253, 2266, 2299, 2331, 2337, 2870, 2949, 3214, 3601, 3623, 3651], 'higher': [57, 255, 3947], 'mass': [59, 257, 3206], '(∼90–110': [60, 258], 'kDa)': [61, 259, 3219], 'than': [62, 171, 260, 369, 3220, 3950, 3954, 4552, 4820], 'nonglycosylated': [63, 120, 261, 318, 3632, 5065, 5069, 5324], '(∼50': [65, 263, 3218], 'kDa).': [66, 264], 'Using': [67, 265, 524], 'site-directed': [68, 266, 1288, 2200, 2317, 4046, 4122], 'mutagenesis,': [69, 267, 2201, 2318], 'we': [70, 268, 531, 934, 1286, 4120, 4462, 4544, 4627, 4722, 4828, 4925, 5605], 'substituted': [71, 269, 2196, 2313], 'both': [72, 270, 645, 810, 1292, 2255, 2307, 3164, 4011, 4219, 4356, 4468, 4506, 4691, 5201, 5332], 'separately': [73, 271, 1293], 'simultaneously': [75, 273, 2312], 'asparagine': [77, 275, 1297, 1397, 3072], 'residues': [78, 276, 1298, 4650, 5678], 'all': [80, 278, 1300, 3108, 3382, 3405, 3426, 4679, 5268], 'three': [81, 279, 1301, 2678, 4514], 'putativeN-linked': [82, 280, 1302], 'glycosylation': [83, 281, 1240, 1303, 1340, 1403, 2160, 2350, 2359, 2362, 2592, 2772, 2804, 2813, 2900, 2910, 2924, 2965, 3010, 3487, 3697, 3713, 3734, 3898, 4612, 4843, 5138, 5222, 5266, 5295, 5471, 5626], 'consensus': [84, 282, 1304, 1404, 2792, 2925], 'sequences': [85, 283, 1305, 1405, 1457, 2793, 2926], 'with': [88, 193, 286, 391, 641, 687, 889, 956, 1308, 1331, 1382, 1446, 1454, 1468, 1577, 1691, 1742, 1852, 1935, 1990, 2097, 2111, 2197, 2217, 2314, 2381, 2407, 2510, 2641, 2651, 2680, 2697, 2837, 2956, 3062, 3163, 3499, 3509, 3537, 3589, 3945, 4148, 4186, 4207, 4264, 4335, 4377, 4397, 4467, 4513, 4683, 4835, 4923, 4931, 4967, 5128, 5496, 5705, 5747], 'glutamine': [89, 287, 1309, 2198, 2315], 'assessed': [91, 289, 1311, 2846, 2937], 'effects': [93, 291, 1313], 'mutations': [96, 294, 1021, 1316, 3359, 3406], 'on': [97, 295, 750, 816, 1317, 1369, 2718, 2942, 3021, 3360, 3413, 3491, 3786, 4017, 4566, 4573, 4610, 4703, 4738, 4745, 4771, 4839, 4956, 5282, 5728], 'function': [98, 130, 296, 328, 1318, 3436, 5305, 5681], 'stability': [100, 132, 298, 330, 1320, 1347, 3493, 5145, 5230, 5307], 'COS': [104, 302, 1150, 1324, 1601, 1850, 1876, 2074, 2092, 2212, 2250, 2373, 2400, 2424, 2497, 2584, 2603, 3052, 3370, 3496, 3582, 3792, 3814, 4154, 4195, 4211], 'cells.': [105, 303, 1151, 1236, 5719], 'All': [106, 304, 1686], 'mutants': [107, 305, 1504, 1510, 2208, 2507, 2853, 2888, 3148, 3383, 3427], 'were': [108, 306, 1392, 1421, 1433, 1458, 1483, 1493, 1505, 1603, 1615, 1652, 1688, 1707, 1794, 1800, 1878, 1916, 1952, 1997, 2076, 2094, 2194, 2214, 2226, 2311, 2366, 2379, 2508, 2605, 2613, 2659, 2669, 3060, 3197, 3366, 3428, 3505, 3535, 3587, 3870], 'displayed': [111, 309, 3398], '50–90%': [112, 310], 'wild-type': [114, 312, 1332, 1486, 1598, 2252, 2390, 2428, 2501, 2587, 2756, 2957, 3056, 3373, 3400, 3462, 3503, 3585, 3641, 3674, 3799, 3818, 3846, 3879, 3951, 4162, 5345], 'activity,': [116, 314, 3387], 'including': [117, 315], 'completely': [119, 317, 3105, 3457], 'triple': [121, 319, 1503, 2931, 3166, 3500, 3635, 3656, 3768, 3796, 3820, 3848, 3890, 3925, 3960, 5325], 'mutant.': [122, 320, 2323], 'This': [123, 321, 1528, 1584, 2324, 3002, 3465, 3608, 5581], 'demonstrates': [124, 322, 3004], 'to': [126, 324, 464, 801, 808, 1290, 1336, 1394, 1406, 1427, 1548, 1582, 1650, 1703, 2006, 2147, 2205, 2232, 2278, 2302, 2802, 2822, 3095, 3103, 3111, 3393, 3432, 3516, 3521, 3542, 3630, 3668, 3724, 3783, 3955, 3995, 4002, 4009, 4095, 4106, 4124, 4325, 4395, 4457, 4564, 4685, 4797, 4876, 4935, 5008, 5029, 5290, 5342, 5476, 5481, 5588, 5621, 5629, 5647, 5655, 5692], 'considerable': [128, 326, 3434, 3470, 5358], 'extent,': [129, 327], 'are': [135, 333, 685, 1244, 2156, 2722, 2800, 2818, 3047, 3441, 4510, 4700, 4816, 4926, 4965, 5125, 5310, 5340, 5594], 'preserved': [136, 334, 3442, 5312], 'partial': [139, 337, 2303, 3445, 5315], 'or': [140, 338, 967, 1346, 1945, 2221, 2389, 2503, 2744, 3057, 3446, 3502, 3746, 3798, 3819, 3942, 4118, 5316], 'even': [141, 339, 3447, 5098, 5317, 5596], 'total': [142, 340, 3448, 5318], 'absence': [143, 341, 3449, 3895, 4537, 4759, 5013, 5319, 5639], 'N-linked': [145, 343, 1239, 1339, 1402, 2159, 2304, 2349, 2591, 2771, 2803, 2899, 2923, 2964, 3200, 3486, 3696, 3712, 3897, 4842, 5015, 5027, 5137, 5261, 5294, 5321, 5470], 'glycosylation.': [146, 344, 2305, 3201, 3451, 5016, 5322], 'We': [147, 177, 345, 375, 1122, 4039, 4640, 5720], 'also': [148, 346, 1352, 1708, 2325, 3660, 4795, 4873], 'found': [149, 347, 4394, 5007, 5607], 'Asn225': [151, 349, 1355, 1367, 2825, 2833, 2891, 3006, 3978, 4360, 4614, 4699], 'thus': [154, 352, 1358, 2202, 3074, 3666, 5264], 'proving': [155, 353, 1359, 3667], 'hydrophilic': [158, 356, 1363, 3016, 4696], 'loop': [159, 357, 1251, 1266, 1364, 2167, 3017, 4697], 'contains': [161, 359, 1366, 2768, 4634], 'this': [162, 360, 1383, 2781, 3761, 3996, 4143, 4675, 4812, 4914], 'amino': [163, 361, 4370, 4390, 4496, 4648, 5676], 'residue': [165, 363, 1398], 'faces': [166, 183, 364, 381, 3979, 4061, 4229], 'extracellular': [168, 366, 1250, 1371, 2166, 3023, 4575, 4619, 4705, 4958], 'milieu': [169, 367], 'rather': [170, 368, 3953, 5303], 'cytosol': [173, 371], 'previously': [175, 373, 1656, 2149, 4041, 4275, 4464, 4655], 'suggested.': [176, 374], 'demonstrated': [178, 376, 1124], 'NH2': [181, 379, 812, 4013, 4111, 4137, 4227, 4363, 4560, 4623, 4769, 4954], 'terminus': [182, 380, 830, 903, 4058, 4099, 4112, 4138, 4228, 4251, 4364, 4624, 4770, 4955], 'extracellularly': [184, 382, 2796, 3980, 4230], 'well.': [186, 384, 2720], 'A': [187, 385, 627, 744, 823, 1376, 1569], 'new': [188, 386, 1377, 4663, 4882], 'secondary': [189, 387, 745, 757, 1378, 2152, 3029, 3986, 4351, 4502, 4747, 5460, 5634, 5687, 5730], 'structure': [190, 388, 746, 758, 1379, 2153, 3030, 3987, 4352, 4503, 4748, 5635, 5642, 5688, 5731], 'model': [191, 389, 690, 747, 1380, 2154, 3031, 3988, 4353, 4549, 4720, 4735, 4827, 4885, 4915, 4951, 5689], 'consistent': [192, 390, 686, 1381, 4263, 4834, 4966], 'these': [194, 392, 2895, 2919, 3422, 4240, 4330, 4508, 4525, 5463, 5683], 'findings': [195, 393, 4837], 'proposed.': [197, 395, 1386], 'uptake': [397, 2581, 2609, 2734, 3805, 3921, 4152, 5037, 5057], 'an': [403, 700, 969, 1525, 2418, 3065, 3225, 3489, 3700, 4097], 'essential': [404, 1343, 3701, 3716, 5140, 5224], 'step': [405], 'biosynthesis': [408], 'hormones': [411], 'T3': [412], 'T4,': [414], 'mediated': [416], 'by': [417, 454, 502, 696, 840, 945, 1125, 1460, 1507, 1523, 1541, 1802, 2104, 2199, 2316, 2615, 2671, 2693, 2714, 2914, 3399, 3923, 4189, 4318, 5106, 5670, 5696], '(NIS)': [420], '(2Carrasco': [421, 476, 506], 'Biochim.': [423, 478, 508, 1087, 5112], 'Biophys.': [424, 479, 509, 1088, 5113], 'Acta.': [425, 480, 510, 5114], '1993;': [426, 481, 511], '1154:': [427, 482, 512], '65-82Crossref': [428, 483, 513], 'PubMed': [429, 484, 514, 555, 622, 674, 739, 770, 881, 928, 996, 1054, 1070, 1094, 1117, 1191, 1218, 1277, 1639, 1681, 1737, 1773, 1843, 1869, 1908, 2032, 2066, 2141, 2186, 2488, 2567, 2997, 3138, 3253, 3277, 3299, 3323, 3347, 4034, 4087, 4303, 4413, 4865, 4908, 4989, 5050, 5093, 5118, 5165, 5192, 5250, 5379, 5403, 5418, 5438, 5452, 5518, 5542, 5557, 5575], 'Scopus': [430, 485, 515, 556, 604, 623, 675, 740, 771, 882, 929, 997, 1055, 1071, 1095, 1118, 1192, 1219, 1278, 1640, 1682, 1738, 1774, 1844, 1870, 1909, 2033, 2067, 2142, 2187, 2489, 2568, 2998, 3139, 3300, 3324, 3348, 4035, 4088, 4304, 4414, 4866, 4909, 4990, 5051, 5094, 5119, 5166, 5193, 5251, 5380, 5404, 5419, 5439, 5453, 5519, 5543, 5558, 5576], '(344)': [431, 486, 516], 'Google': [432, 487, 517, 558, 606, 625, 677, 742, 773, 884, 931, 999, 1057, 1073, 1097, 1120, 1194, 1221, 1280, 1642, 1684, 1740, 1776, 1846, 1872, 1911, 2035, 2069, 2144, 2189, 2491, 2570, 3000, 3141, 3254, 3278, 3302, 3326, 3350, 4037, 4090, 4306, 4416, 4868, 4911, 4992, 5053, 5096, 5121, 5168, 5195, 5253, 5382, 5406, 5421, 5441, 5455, 5521, 5545, 5560, 5578], 'Scholar).': [433, 488, 518, 582, 626, 678, 743, 797, 885, 932, 1000, 1121, 1195, 1281, 1643, 1685, 1873, 1912, 2036, 2070, 2145, 2190, 2492, 3001, 3142, 3351, 4038, 4091, 4307, 4440, 4602, 4869, 4912, 4993, 5122, 5169, 5254], '1The': [434], 'abbreviations': [435], 'used': [436, 1287, 1437, 4121, 4254], 'are:': [437], 'NISNa+/I−': [438], 'symporterAbantibodyGABAγ-aminobutyric': [439], 'acid.NIS-catalyzed': [440], 'Na+-dependent': [445, 4382], 'transport': [447, 1622, 3364, 5716], 'process': [448], 'couples': [450], 'energy': [452], 'released': [453, 2705], 'inward': [456, 468], 'translocation': [457, 469], 'Na+': [459, 490, 2741, 2745], 'down': [460], 'its': [461, 473, 1532, 2829, 3221, 5333, 5338], 'electrochemical': [462, 474], 'gradient': [463, 475, 491], 'driving': [465, 495], 'simultaneous': [467], 'against': [472, 827, 4049], 'acting': [492], 'force': [496], 'for': [497, 1344, 1438, 1699, 1796, 2002, 2607, 2699, 2847, 3472, 3511, 3569, 3663, 3703, 3717, 3743, 3840, 3878, 3889, 3911, 3963, 4505, 4558, 4804, 4831, 4929, 4973, 5141, 5225, 5335, 5462, 5725, 5736, 5745], 'maintained': [501], 'Na+/K+': [504], 'ATPase': [505], 'Na+/I−': [519, 715], 'symporter': [520], 'antibody': [521, 826], 'γ-aminobutyric': [522], 'acid.': [523], 'expression': [525, 942, 1004, 2235, 2848], 'cloning': [526, 1498], 'Xenopus': [528], 'laevis': [529, 1147], 'oocytes,': [530], 'isolated': [532], 'cDNA': [534, 1488, 1854], 'encodes': [536], 'rat': [537, 854], 'NIS,': [538, 1253, 1328, 1349, 1599, 3099, 3454, 3495, 4054, 4163, 4522, 4543, 4930, 4995], 'hydrophobic': [541, 3232, 4645, 4938], '(1Dai': [545, 760, 1267, 1629, 1859, 2176, 4024, 4403], 'G.': [546, 561, 656, 721, 761, 776, 860, 907, 975, 1078, 1170, 1268, 1630, 1660, 1716, 1752, 1822, 1860, 1895, 2011, 2045, 2120, 2177, 2467, 2546, 2976, 3117, 3263, 4025, 4066, 4282, 4404, 4419, 4473, 4581, 5045, 5570, 5734], 'Levy': [547, 562, 657, 722, 762, 777, 1269, 1631, 1861, 1890, 2178, 4026, 4405, 4420, 4474, 4582], 'O.': [548, 563, 594, 609, 658, 723, 763, 778, 858, 905, 973, 1168, 1270, 1632, 1658, 1714, 1750, 1820, 1862, 1891, 2009, 2043, 2118, 2179, 2465, 2544, 2974, 3115, 4027, 4064, 4280, 4406, 4421, 4475, 4583, 5743], 'Carrasco': [549, 566, 595, 614, 661, 726, 764, 781, 869, 916, 984, 1179, 1271, 1633, 1669, 1725, 1761, 1831, 1863, 1896, 2020, 2054, 2129, 2180, 2476, 2555, 2985, 3126, 4028, 4075, 4291, 4407, 4424, 4478, 4586], 'Nature.': [551, 766, 1273, 1635, 1865, 2182, 4030, 4409], '1996;': [552, 767, 1274, 1636, 1866, 2183, 3315, 4031, 4410, 4857, 4900, 5085, 5371, 5449, 5534], '379:': [553, 768, 1275, 1637, 1867, 2184, 4032, 4411], '458-460Crossref': [554, 769, 1276, 1638, 1868, 2185, 4033, 4412], '(977)': [557, 772, 1279, 1641, 1871, 2188, 4036, 4415], 'Scholar,': [559, 607, 774, 1058, 1074, 1098, 3255, 3279, 3303, 3327, 4417, 5383, 5407, 5422, 5522, 5546, 5561, 5579], '3Dai': [560, 775, 4418], 'Amzel': [564, 779, 4422, 4476, 4584, 5724], 'L.M.': [565, 780, 4423, 4477, 4585], 'Konings': [568, 783, 4426, 4480, 4588], 'W.N.': [569, 784, 4427, 4481, 4589], 'Kaback': [570, 785, 3242, 4428, 4482, 4590], 'H.R.': [571, 786, 3243, 4429, 4483, 4591], 'Lolkema': [572, 787, 4430, 4484, 4592], 'J.S.': [573, 788, 4431, 4485, 4593], 'Handbook': [574, 789, 4432, 4486, 4594], 'Biological': [576, 791, 4434, 4488, 4596], 'Physics.': [577, 792, 4435, 4489, 4597], 'II.': [578, 793, 4436, 4490, 4598], 'Elsevier,': [579, 794, 4437, 4491, 4599], 'Amsterdam1996:': [580, 795, 4438, 4492, 4600], '343-367Google': [581, 796, 4439, 4493, 4601], 'Advances': [583], 'characterization': [586], 'have': [589, 809, 935, 1024, 1123, 1223, 3107, 4010, 4040, 4101, 4680, 4877, 5005, 5465, 5606], 'recently': [590, 824, 1025, 1224, 4971, 5356], 'been': [591, 1026, 4103, 4887, 5006, 5466], 'reviewed': [592, 4972], '(4Levy': [593], 'Curr.': [597], 'Opin.': [598], 'Endocrinol.': [599, 1065], 'Diabetes.': [600], '1997;': [601, 666, 731, 878, 925, 993, 1051, 1067, 1091, 1188, 1210, 1678, 1734, 1770, 1840, 2029, 2063, 2138, 2485, 2564, 2994, 3135, 3339, 4084, 4300, 4986, 5157, 5184, 5242, 5395, 5415, 5430, 5554], '4:': [602], '364-370Crossref': [603], '(12)': [605], '5Levy': [608], 'De': [610], 'la': [611], 'Vieja': [612], 'A.': [613, 877, 924, 992, 1060, 1187, 1200, 1677, 1733, 1769, 1839, 1904, 2028, 2062, 2137, 2484, 2563, 2993, 3134, 4083, 4299, 5147, 5174, 5232], 'J.': [616, 663, 728, 1063, 1076, 1100, 1111, 1207, 3244, 3268, 3288, 3312, 3336, 4854, 4897, 4983, 5082, 5111, 5154, 5181, 5239, 5368, 5392, 5412, 5427, 5446, 5501, 5512, 5531, 5551], 'Bioenerg.': [617], 'Biomembr.': [618], '1998;': [619, 1114, 5515], '30:': [620], '195-206Crossref': [621], '(69)': [624], 'thorough': [628], 'electrophysiological': [629, 681], 'analysis': [630, 755, 842, 888, 2356, 3765, 4191, 4206, 5624], 'activity': [633, 1345, 1623, 2239, 2582, 2654, 3397, 3730, 3788, 4176, 5058, 5101, 5214, 5284], 'carried': [635, 1709, 1975, 3084, 3367, 3771], 'out': [636, 1710, 1976, 3085, 3368], 'X.': [638, 1146], 'laevisoocytes': [639], 'injected': [640], 'cRNA,': [643], 'recording': [644], 'pre-steady': [646], 'steady': [648], 'state': [649], 'currents': [650, 709], '(6Eskandari': [651, 716], 'S.': [652, 717, 876, 923, 991, 1046, 1062, 1086, 1110, 1186, 1204, 1676, 1732, 1768, 1838, 1903, 2027, 2061, 2136, 2483, 2562, 2992, 3133, 3285, 4082, 4298, 5039, 5151, 5178, 5236, 5443, 5511, 5564], 'Loo': [653, 718], 'D.D.F.': [654, 719], 'Dai': [655, 720, 859, 906, 974, 1169, 1659, 1715, 1751, 1821, 1894, 2010, 2044, 2119, 2466, 2545, 2975, 3116, 4065, 4281], 'Wright': [659, 724, 3310, 4852, 4895, 4981, 5080, 5366, 5410, 5529, 5549], 'E.W.': [660, 725, 4982, 5411, 5550], 'Biol.': [664, 729, 1208, 3245, 3269, 3289, 3313, 3337, 4855, 4898, 4985, 5083, 5155, 5182, 5240, 5369, 5393, 5414, 5428, 5448, 5532, 5553], 'Chem.': [665, 730, 1209, 3246, 3270, 3290, 3314, 3338, 4856, 4899, 5084, 5156, 5183, 5241, 5370, 5394, 5429, 5533], '272:': [667, 732, 1211, 3340, 5158, 5185, 5243, 5396, 5431], '27230-27238Abstract': [668, 733], 'Full': [669, 671, 734, 736, 1213, 1215, 3250, 3274, 3294, 3296, 3318, 3320, 3342, 3344, 4860, 4862, 4903, 4905, 5088, 5090, 5160, 5162, 5187, 5189, 5245, 5247, 5374, 5376, 5398, 5400, 5433, 5435, 5537, 5539], 'Text': [670, 672, 735, 737, 1214, 1216, 3251, 3275, 3295, 3297, 3319, 3321, 3343, 3345, 4861, 4863, 4904, 4906, 5089, 5091, 5161, 5163, 5188, 5190, 5246, 5248, 5375, 5377, 5399, 5401, 5434, 5436, 5538, 5540], 'PDF': [673, 738, 1217, 3252, 3276, 3298, 3322, 3346, 4864, 4907, 5092, 5164, 5191, 5249, 5378, 5402, 5437, 5541], '(392)': [676, 741], 'obtained': [680, 1459, 1506, 1522], 'kinetic': [683, 3764], 'data': [684, 2896, 3709, 3830, 3969, 4964], 'mechanistic': [689], 'which': [692, 1010, 3161, 3455, 4941], 'Na+binding': [693], 'followed': [695, 1540, 2103], 'binding': [698], 'ordered': [701], 'fashion.': [702], 'Simultaneous': [703], 'recordings': [704], 'ion': [706], 'fluxes': [707], 'revealed': [710, 4216], 'stoichiometry': [712], '2': [714, 1743, 2228, 2290, 3377], 'proposed': [749, 2150, 3985, 4656, 4888, 5459], 'basis': [752, 4740], 'hydropathy': [754, 4445, 4499], 'algorithms': [759, 4504], 'predicted': [800, 1249, 1263, 2786, 2830, 3204, 3222, 4001, 4369, 4875], 'traverse': [802, 4003], '12': [805, 4006, 4528, 4878], 'times': [806, 2679, 4007], 'COOH': [814, 829, 902, 4015, 4051, 4057, 4250, 4271, 4562], 'termini': [815, 4016, 4563], 'intracellular': [818, 1265, 2788, 2816, 2831, 4019, 4267, 4577], 'face': [819, 1372, 4020, 4959], 'membrane.': [822, 1375, 4777, 4962], 'generated': [825, 1393, 2367, 2935], 'recognizes': [833], '∼87-kDa': [836, 1158], 'polypeptide,': [837, 3566], 'visualized': [839, 1801], 'immunoblot': [841, 2419, 4190], 'proteins': [845, 2422, 3235, 3534, 4509, 4815, 5269, 5464, 5654], 'from': [846, 964, 968, 1138, 1449, 1875, 2248, 2398, 2423, 2459, 2538, 3051, 3391, 3581, 3640, 3732, 3781, 4161, 4194], 'FRTL-5': [847, 893, 1139, 1235, 4277, 5216], 'cells': [848, 894, 1325, 1602, 1614, 1851, 1877, 2075, 2093, 2213, 2374, 2401, 2425, 2585, 2604, 2696, 3053, 3371, 3497, 3583, 3793, 3815, 4155, 4196, 4212, 4241, 4247, 4278, 4331, 5031, 5063, 5217], '(a': [849], 'line': [852], 'thyroid-derived': [855], 'cells)': [856], '(7Levy': [857, 904, 972, 1167, 1657, 1713, 1749, 2008, 2042, 2117, 2464, 2543, 2973, 3114, 4063, 4279], 'Riedel': [861, 908, 976, 1171, 1661, 1717, 1753, 1823, 2012, 2046, 2121, 2468, 2547, 2977, 3118, 4067, 4283], 'C.': [862, 909, 977, 1108, 1172, 1662, 1718, 1754, 1824, 1893, 2013, 2047, 2122, 2469, 2548, 2978, 3119, 3331, 3333, 4068, 4284, 5387, 5389, 5509], 'Ginter': [863, 910, 978, 1173, 1663, 1719, 1755, 1825, 2014, 2048, 2123, 2470, 2549, 2979, 3120, 4069, 4285], 'C.S.': [864, 911, 979, 1174, 1664, 1720, 1756, 1826, 2015, 2049, 2124, 2471, 2550, 2980, 3121, 4070, 4286], 'Paul': [865, 912, 980, 1175, 1665, 1721, 1757, 1827, 2016, 2050, 2125, 2472, 2551, 2981, 3122, 4071, 4287], 'E.M.': [866, 913, 981, 1176, 1666, 1722, 1758, 1828, 2017, 2051, 2126, 2473, 2552, 2982, 3123, 3311, 4072, 4288, 4853, 4896, 5081, 5367, 5530], 'Lebowitz': [867, 914, 982, 1177, 1667, 1723, 1759, 1829, 2018, 2052, 2127, 2474, 2553, 2983, 3124, 4073, 4289], 'A.N.': [868, 915, 983, 1178, 1668, 1724, 1760, 1830, 2019, 2053, 2128, 2475, 2554, 2984, 3125, 4074, 4290], 'Proc.': [871, 918, 986, 1181, 1671, 1727, 1763, 1833, 1898, 2022, 2056, 2131, 2478, 2557, 2987, 3128, 4077, 4293], 'Natl.': [872, 919, 987, 1182, 1672, 1728, 1764, 1834, 1899, 2023, 2057, 2132, 2479, 2558, 2988, 3129, 4078, 4294], 'Acad.': [873, 920, 988, 1183, 1673, 1729, 1765, 1835, 1900, 2024, 2058, 2133, 2480, 2559, 2989, 3130, 4079, 4295], 'Sci.': [874, 921, 989, 1184, 1674, 1730, 1766, 1836, 1901, 2025, 2059, 2134, 2481, 2560, 2990, 3131, 4080, 4296], 'U.': [875, 922, 990, 1185, 1675, 1731, 1767, 1837, 1902, 2026, 2060, 2135, 2482, 2561, 2991, 3132, 4081, 4297], '94:': [879, 926, 994, 1189, 1679, 1735, 1771, 1841, 2030, 2064, 2139, 2486, 2565, 2995, 3136, 4085, 4301], '5568-5573Crossref': [880, 927, 995, 1190, 1680, 1736, 1772, 1842, 2031, 2065, 2140, 2487, 2566, 2996, 3137, 4086, 4302], '(201)': [883, 930, 998, 1193, 1683, 1739, 1775, 1845, 2034, 2068, 2143, 2490, 2569, 2999, 3140, 4089, 4305], 'Indirect': [886], 'immunofluorescence': [887, 4205, 4217, 4238, 4328, 5749], 'anti-NIS': [890, 1747, 2115, 2409, 3538, 4249], 'Ab': [891, 1748, 2410, 3539, 4048, 4100, 4188, 4209, 4252, 4315, 4337], 'confirmed': [895, 1225, 5468], 'cytosolic': [897, 4773], 'location': [898, 4268, 4620], 'Additionally,': [933], 'shown': [936, 4042, 5603], 'rats': [938, 955], 'protein': [941, 1003, 1233, 2397, 2457, 2536, 2798, 5672], 'up-regulated': [944], 'thyroid-stimulating': [946, 958, 1014, 5209], 'hormone': [947, 959, 1015], 'vivo.': [949], 'up-regulation': [951], 'observed': [953, 3043, 3180, 3228, 5197, 5278], 'increased': [957], 'circulating': [960], 'levels': [961], 'resulting': [962, 2841, 3625, 3731], 'either': [963, 1934, 2218, 2736, 3055, 3795, 3817, 3930], '6-propyl-2-thiouracil': [965], 'treatment': [966, 1973, 3628], 'I−-deficient': [970], 'diet': [971], 'Conversely,': [1001], 'decreased': [1006, 3932], 'hypophysectomized': [1008], 'rats,': [1009], 'exhibit': [1011], 'markedly': [1012, 3639], 'lower': [1013, 3957], 'levels.': [1016], 'For': [1017], 'first': [1019, 1557, 3548, 4917], 'time,': [1020], 'causative': [1029], 'cases': [1031], 'congenital': [1033], 'hypothyroidism': [1034], '(8Fujiwara': [1035], 'H.': [1036, 3261, 3287], 'Tatsumi': [1037], 'K.': [1038, 1040, 1044], 'Miki': [1039], 'Harada': [1041], 'T.': [1042], 'Miyai': [1043], 'Takai': [1045], 'Amino': [1047], 'Nat.': [1049], 'Genet.': [1050], ':': [1052], '124-125Crossref': [1053], '(138)': [1056], '9Matsuda': [1059], 'Kosugi': [1061], 'Clin.': [1064, 1112, 5513], 'Metab.': [1066], '82:': [1068], '3966-3971Crossref': [1069], '(84)': [1072], '10Pohlenz': [1075], 'Medeiros-Neto': [1077], 'Gross': [1079], 'J.L.': [1080], 'Silveiro': [1081], 'S.P.': [1082], 'Knobel': [1083], 'M.': [1084, 3281, 5723], 'Refetoff': [1085, 1109, 5510], 'Res.': [1089], 'Commun.': [1090], '240:': [1092], '488-491Crossref': [1093], '(77)': [1096], '11Pohlenz': [1099, 5500], 'Rosenthal': [1101, 5502], 'I.M.': [1102, 5503], 'Weiss': [1103, 5504], 'R.E.': [1104, 5505], 'Jhiang': [1105, 5506], 'S.M.': [1106, 1889, 5507], 'Burant': [1107, 5508], 'Invest.': [1113, 5514], '101:': [1115, 5516], '1028-1035Crossref': [1116, 5517], '(104)': [1119, 5520], 'vitro': [1127], 'peptidylN-glycosidase': [1128], 'F': [1129, 1154, 1940, 1972, 2512, 2521, 3591, 3627], 'digestion': [1130, 1155], 'glycosylated': [1135, 1232, 2259, 2264, 2280, 2329, 2863, 3188, 3618], 'membranes': [1137, 2247, 2499, 3050, 3580, 4193], 'well': [1142], 'NIS-expressing': [1145], 'oocytes': [1148], 'Complete': [1152], 'N-glycosidase': [1153, 1939, 2511, 2520, 3063, 3590], 'results': [1160, 1351, 3423, 3914, 5124, 5299], 'deglycosylated': [1163, 2509, 5614], '∼50-kDa': [1164, 2947, 3150], 'species': [1166, 3624], 'Paire': [1196, 5170], 'et': [1197, 5171], 'al.': [1198, 5172], '(12Paire': [1199, 5146, 5173, 5231], 'Bernier-Valentin': [1201, 5148, 5175, 5233], 'F.': [1202, 3335, 5149, 5176, 5234, 5391], 'Selmi-Ruby': [1203, 5150, 5177, 5235], 'Rousset': [1205, 5152, 5179, 5237], 'B.': [1206, 5153, 5180, 5238, 5426], '18245-18249Abstract': [1212, 5159, 5186, 5244], '(92)': [1220, 5167, 5194, 5252], 'Scholar)': [1222, 1741, 1777, 5196], 'Two': [1237, 2594], 'putative': [1238, 2158, 2770], 'sites': [1241, 1594, 2161, 2814, 3109], '(Asn485and': [1242], 'Asn497)': [1243], 'present': [1245, 1284, 2523, 3754, 4243, 4782, 4944, 5633], 'last': [1248, 2165], 'third': [1256, 1264, 2787], 'site': [1257, 1538, 2351, 2773, 2782, 2911, 3011], '(Asn225),': [1258], 'located': [1260, 2162, 2794, 3020, 4116, 4652], 'within': [1261, 2784, 2795], 'In': [1282, 1334, 3864, 3965, 4344, 4518, 4603, 4913, 5637], 'report': [1285, 5134], 'mutagenesis': [1289, 4123, 4845, 5473, 5628], 'substitute,': [1291], 'simultaneously,': [1295], 'expressing': [1326, 2462, 2500, 2541, 2586, 3054, 3372, 3584, 3794, 3816, 4156, 4197, 4213, 5032, 5064], 'mutant': [1327, 1456, 1479, 1491, 1520, 2297, 2363, 2388, 2844, 2858, 2932, 3040, 3058, 3167, 3189, 3375, 3453, 3466, 3501, 3636, 3657, 3769, 3797, 3821, 3849, 3891, 3926, 3961, 5326], 'compared': [1330, 4376], 'NIS.': [1333, 1583, 3633, 3822, 3892, 4946, 5297, 5346], 'addition': [1335, 5018], 'demonstrating': [1337, 2343, 4224], 'not': [1342, 2819, 2904, 3699, 3715, 4102, 4173, 4790, 4943, 5286], 'show': [1353, 2897, 5302], 'mentioned': [1362], 'finding': [1384, 4262], 'following': [1388], 'individual': [1389, 1509, 5675], 'mutagenic': [1390], 'oligonucleotides': [1391], 'substitute': [1395], 'each': [1396, 2275, 2296, 2719], 'glutamine:': [1407], 'N225Q,': [1408], 'CTCGCTCAGCAACATTCCCGG;': [1409], 'N485Q,': [1410], 'GGCTGCACCCAAGATTCGGTC;': [1411], 'N497Q,': [1413, 2856], 'GGAGCCACCCAAGCTTCCAAC.': [1414], 'initial': [1416], 'polymerase': [1417, 1442, 1464, 1571], 'chain': [1418, 1443, 1465, 1572], 'reaction': [1419, 1444, 1466, 1573, 1986], 'extensions': [1420], 'performed': [1422, 1576, 1653, 1795, 1856, 2039], 'using': [1423, 1511, 4044, 4841], 'reverse': [1424, 1579], 'primers': [1425, 1448], 'complementary': [1426, 1447], '3′': [1429], 'end.': [1430, 1452], 'These': [1431, 1481, 3913], 'fragments': [1432, 1482], 'purified': [1435], 'second': [1440], 'round': [1441], 'extension': [1445, 1574], '5′': [1451, 1533, 1562], 'Fragments': [1453], 'digesting': [1461], 'final': [1463], 'products': [1467], 'appropriate': [1470, 1513], 'unique': [1471, 1536], 'restriction': [1472, 1515, 1537], 'enzymes': [1473, 2805], 'would': [1475], 'yield': [1476], 'smallest': [1478], 'fragments.': [1480], 'ligated': [1484, 1590], 'inserts': [1492], 'sequenced': [1494], 'past': [1495], 'their': [1496], 'respective': [1497], 'sites.': [1499, 1516], 'double': [1501, 2322, 3147, 3824], 'combining': [1508], 'endogenous': [1514], 'Flag': [1518, 1552, 4131, 4170], 'epitope': [1519, 4132], 'constructing': [1524], 'oligo:': [1526], 'GGAATTCATGGACTACAAGGACGACGATGACAAAATGGAGGGTGCGGAGGCCGG.': [1527], 'oligo': [1529], 'contains,': [1530], 'end,': [1534], '(EcoRI)': [1539], 'start': [1543], 'codon,': [1544], 'nucleotides': [1546], 'corresponding': [1547, 3604, 4934], 'eight-amino': [1550], 'sequence': [1553, 4171, 4372, 4443, 4541, 4763], '(DYKDDDDK),': [1554], '20': [1558, 2393, 2648, 2700], 'bases': [1559], 'end': [1563], 'coding': [1567], 'region.': [1568], 'single': [1570, 2206, 2852, 2857, 2887, 2909, 2946, 3145, 3417], 'primer': [1580], 'complimentary': [1581], 'fragment': [1585], 'digested': [1587], 'withEcoRI/BlpI': [1588], 'same': [1593, 3829], 'pSV.Sport': [1596], 'respectively.': [1600], 'cultured': [1604, 2077], 'transfected': [1606, 2079, 2216, 2249, 2380, 2399, 2426, 2602, 3498], '10-cm': [1608, 2081, 2377], 'dishes;': [1609], '1': [1610, 1797, 2268, 2287, 2339, 2872, 2969, 3078, 3153], 'day': [1611], 'after': [1612, 2087, 2101, 2230, 2596, 3379, 3592], 'transfection': [1613, 2088, 2102, 2231], 'seeded': [1616, 2084], 'onto': [1617, 2089], 'six-well': [1618], 'dishes': [1619, 2082, 2378], 'where': [1620, 2963], 'iodide': [1621, 2608, 2733, 3363, 3744, 5336], 'measured': [1625], 'exactly': [1626], 'reported': [1628, 1858, 4274, 4463, 4838, 5220], 'SDS-9%': [1644], 'polyacrylamide': [1645], 'electroblotting': [1649], 'nitrocellulose': [1651], 'described': [1655, 1712, 1816, 1887, 2041, 2369, 2412, 2516, 2939, 3358], 'samples': [1687, 1996], 'diluted': [1689, 1988], '1:2': [1690, 1989], 'loading': [1692, 1991], 'buffer': [1693, 1992, 2685], 'heated': [1695], '37': [1697, 1957, 2000, 2662], '°C': [1698, 1958, 2001, 2663], '30': [1700, 2003], 'min': [1701, 2004, 2701, 3513, 3877, 3888], 'prior': [1702, 2005], 'electrophoresis.': [1704, 3545], 'Immunoblot': [1705], 'analyses': [1706], 'μg': [1744, 2383, 2394, 2455, 2495, 2534], 'affinity-purified': [1746, 2408], '1:1500': [1780], 'dilution': [1781, 2113], 'horseradish': [1784], 'peroxidase-linked': [1785], 'donkey': [1786], 'anti-rabbit': [1787], 'IgG': [1788], '(Amersham': [1789, 1808], 'Pharmacia': [1790, 1809], 'Biotech).': [1791, 1810], 'Both': [1792, 4441], 'incubations': [1793], 'h.': [1798], 'Polypeptides': [1799], 'ECL': [1803], 'Western': [1804], 'blot': [1805], 'detection': [1806], 'system': [1807], 'Generation': [1811], 'anti-NIS-containing': [1813], 'sera': [1814], 'Ref.': [1818], '7Levy': [1819], 'Scholar.': [1847], 'Transfection': [1848], 'Membranes': [1874, 1913, 1951], 'prepared': [1879], 'presence': [1882, 1979, 2739, 3526, 4167], 'protease': [1884], 'inhibitors': [1885], '(13Kaminsky': [1888], 'Salvador': [1892], '1994;': [1905, 3271, 5115], '91:': [1906], '3789-3793Crossref': [1907], '(97)': [1910], '(40': [1914], 'μg)': [1915], 'resuspended': [1917], '10': [1919, 2454, 2533, 2642, 3512, 4660], 'μl': [1920, 1929, 1937, 1947, 1962, 2618], '0.5': [1922], 'm': [1923], 'Tris-HCl': [1924], '(pH': [1925, 2645], '8.0)': [1926], '18.8': [1928], 'water': [1931], 'added': [1933, 1970, 4333], '3': [1936, 2382, 3573, 3677, 3802, 3835], '(600': [1941], 'milliunits,': [1942], 'Boehringer': [1943], 'Mannheim)': [1944], '1.2': [1946], '50%': [1949], 'glycerol.': [1950], 'then': [1953, 3560], 'incubated': [1954, 1998, 2660], 'overnight': [1955, 1983], '(18': [1959], 'h).': [1960], '1.5': [1961], '2%': [1964], 'lithium': [1966, 3092], 'dodecyl': [1967, 3093], 'sulfate': [1968, 3094], 'wheneverN-glycosidase': [1971], 'detergent.': [1981], 'After': [1982], 'incubation,': [1984], '(15': [1993], 'μl),': [1994], 'Immunofluorescence': [2037], 'Forin': [2071], 'vivo': [2072, 3508], 'labeling,': [2073], '24': [2085], 'h': [2086, 2100, 3523, 3571], '6-cm': [2090], 'dishes.': [2091], 'metabolically': [2095], 'labeled': [2096, 3506], '[35S]methionine/cysteine': [2098, 3510], '48': [2099], 'immunoprecipitation': [2105], 'indicated': [2108, 2505], 'time': [2109, 2730], 'points': [2110, 2731], '1:50': [2112], 'serum': [2116], 'According': [2146, 3994], 'there': [2155], 'two': [2157, 2886, 2921, 4523], 'Asn485': [2169, 2191, 2308], 'Asn497': [2171, 2193, 2310], '(see': [2172, 2240, 2777, 3028, 3478], 'Fig.': [2173, 2242, 2778, 3834, 3972], '5': [2174, 2779, 4667, 4708], 'A)': [2175, 2237], 'individually': [2195], 'giving': [2203], 'rise': [2204, 2277], 'N485Q': [2209, 2220, 2272, 2433, 2854], 'N497Q.': [2211], 'transiently': [2215], 'wild-type,': [2219], 'N497Q': [2222, 2274, 2436], 'cDNA,': [2224], 'studied': [2227, 3790], 'days': [2229, 2595, 3378], 'analyze': [2233, 5482], '(Fig.1': [2236, 2950], 'below,': [2241], '2).': [2243, 3403], 'On': [2244], 'immunoblots': [2245, 2943, 3046], 'appeared': [2254, 3549, 3597, 3646], 'partially': [2258, 2279, 2328, 2862, 3187, 3617], '∼59-kDa': [2260], '∼108-kDa': [2265], '(Fig.': [2267, 2286, 2338, 2871, 2968, 3077, 3152, 3174, 3402, 3572, 3676, 3801, 4200, 4231, 4338, 4615, 4625, 4666, 4707], 'A,': [2269, 2288, 2340, 2873, 2951, 2970, 3574, 3678, 4668], 'lane': [2270, 2341, 2431, 2874, 2952, 2971, 3176], '1).': [2271], 'gave': [2276], '55-kDa': [2281], '∼92–95-kDa': [2284], 'polypeptides': [2285, 3042, 3151, 3191], 'lanes': [2289, 2526, 3155, 3575, 3679, 3684], '3,': [2292], 'respectively),': [2293], 'indicating': [2294, 3430, 4164], 'subjected': [2301, 3515, 3541], 'Thereafter,': [2306], 'generating': [2319], 'N485Q/N497Q': [2321, 2439], 'yielded': [2326, 2860, 3149], '∼52-kDa': [2330, 3600, 3622, 3650], 'and,': [2332], 'unexpectedly,': [2333], '∼72-kDa': [2336], '4),': [2342, 4626], 'least': [2346], 'one': [2347, 4531], 'additional': [2348], 'still': [2353], 'functional.Figure': [2354], '1Immunoblot': [2355], 'NISN-linked': [2358], 'mutants.': [2360, 2593], 'A,N-linked': [2361], 'cDNAs': [2365], 'under': [2370, 2413, 2517, 2918], '“Experimental': [2371, 2414, 2518], 'Procedures.”': [2372, 2415, 2519], 'grown': [2375], 'pSV.SPORT': [2385], 'plasmid': [2386], 'containing': [2387, 2647, 4359, 4698], 'cDNA.': [2392], 'electrophoresed,': [2403], 'electrotransferred,': [2404], 'immunoblotted': [2406], 'Shown': [2416, 2721], 'with:': [2427], '(WT-NIS;': [2430], '1);': [2432], '(lane': [2434, 2437, 2442, 2445, 2450, 3606], '2);': [2435], '3);': [2438], '(double': [2440], 'mutant)': [2441, 2449], '4);': [2443], 'N225Q': [2444, 2842, 2859, 2882], '5);': [2446], 'N225Q/N485Q/N497Q': [2447, 2933], '(triple': [2448], '6).': [2451, 2754], 'Lane': [2452, 2531], '7,': [2453], 'extract': [2458, 2537], 'E.': [2460, 2539, 3172, 3305, 4847, 4890, 4980, 5075, 5361, 5409, 5524, 5548], 'coli': [2461, 2540, 3173], 'B,': [2493, 3154], '40': [2494], 'cell': [2498], '(WT-NIS)': [2502], '(lanes': [2513], '1–12)': [2514], 'even-numbered': [2525], 'absent': [2528, 2967], 'inodd-numbered': [2529], 'lanes.': [2530], '13,': [2532], 'Scholar).View': [2571], 'Large': [2572, 2758], 'Image': [2573, 2759], 'Figure': [2574, 2760], 'ViewerDownload': [2575, 2761], 'Hi-res': [2576, 2762], 'image': [2577, 2763], 'Download': [2578, 2764], '(PPT)Figure': [2579], '2Iodide': [2580], 'transfection,': [2597], 'nontransfected': [2598], '(N.T.)': [2599], 'assayed': [2606], 'activity.': [2610, 2850, 3415, 3464], 'Uptake': [2611], 'experiments': [2612], 'initiated': [2614], 'adding': [2616], '500': [2617], '137': [2620], 'mm': [2621, 2624, 2629, 2632, 2635, 2643], 'NaCl,': [2622], '5.4': [2623], 'KCl,': [2625], '1.3': [2626], 'mmCaCl2,': [2627], '0.4': [2628, 2631], 'MgSO4,': [2630], 'Na2HPO4.7H2O,': [2633], '0.44': [2634], 'KH2PO4,': [2636], '0.55': [2638], 'mmglucose,': [2639], 'buffered': [2640], 'Hepes': [2644], '7.5)': [2646], 'μm': [2649, 2748, 3810], 'Na125I': [2650], 'specific': [2653, 5671], '100': [2656], 'Ci/mol.': [2657], 'Cells': [2658], 'humidified': [2666], 'atmosphere.': [2667], 'Reactions': [2668], 'terminated': [2670], 'aspirating': [2672], 'radioactive': [2674], 'mixture': [2675], 'washing': [2677], 'above': [2682, 3708], 'salt': [2683], 'solution': [2686], 'without': [2687, 3907], 'NaI.': [2688], 'Accumulated': [2689], '125I−': [2690], 'determined': [2692, 2713], 'permeabilizing': [2694], 'ethanol': [2698], 'quantitating': [2703], 'radioisotope': [2706], 'γ': [2709], 'counter.': [2710], 'DNA': [2711], 'diphenylamine': [2716], 'method': [2717], 'averages': [2724], 'triplicate': [2726], 'determinations': [2727], '45-min': [2729], 'conducted': [2735], '(black': [2742], 'bars)': [2743, 2751], '80': [2747], 'perchlorate': [2749], '(white': [2750], '(n': [2752], '=': [2753], 'WT-NIS,': [2755], 'NIS.View': [2757], '(PPT)': [2765], 'Although': [2766, 3202, 3706, 4870], 'another': [2769], 'position': [2775], '225': [2776], 'A),': [2780], 'lies': [2783], 'loop.': [2789], 'onlyN-linked': [2791], 'facing': [2797, 4365], 'domains': [2799, 2817, 4810, 4919, 5673], 'exposed': [2801], 'endoplasmic': [2808], 'reticulum': [2809], 'lumen': [2810], 'during': [2811], 'biosynthesis,N-linked': [2812], 'glycosylated.': [2820, 2893], 'Hence,': [2821], 'investigate': [2823], 'whether': [2824, 3482, 3726, 4109], 'notwithstanding': [2828], 'location,': [2832], 'similarly': [2835], 'replaced': [2836], 'glutamine,': [2838], 'Like': [2851, 4994], '∼53-kDa': [2864], '∼82-kDa': [2868], '5).': [2875], 'similarity': [2877], 'electrophoretic': [2879, 3226], 'mobility': [2880], 'between': [2881, 3071, 3186, 4653, 4757], 'other': [2885, 2922, 3231, 4380, 4997], 'suggests': [2889], 'Moreover,': [2894], 'dramatically': [2905], 'impeded': [2906], 'when': [2907, 4248, 4332, 5586, 5597], 'removed': [2913], 'mutation,': [2915], 'given': [2916], 'circumstances': [2920], 'remain': [2927], 'available.': [2928], 'Thus,': [2929, 3404, 3893, 4105], 'above,': [2940, 5604], 'appearing': [2941], '6)': [2953], 'comigrated': [2955, 3162], 'expressed': [2959, 3170], 'Escherichia': [2961], 'coli,': [2962], '7)': [2972], 'result': [3003, 4673], 'functionalN-linked': [3009], 'Asn225-containing': [3015], 'therefore': [3019, 5617], 'side': [3024, 4706, 4774], 'below).': [3034], 'To': [3035, 3352, 3480, 3759], 'confirm': [3036], 'indeed': [3048], 'treated': [3061, 3588], 'F,': [3064], 'enzyme': [3066, 3113], 'cleaves': [3068], 'bond': [3070], 'andN-acetyl-d-glucosamine,': [3073], 'releasingN-linked': [3075], 'oligosaccharides': [3076, 5262], 'B).': [3079, 3690, 4202, 4639, 4709], 'Deglycosylation': [3080, 3143], 'low': [3088], 'concentration': [3089], '(0.1%)': [3090], 'prevent': [3096, 4327], 'aggregation': [3097], 'allowing': [3100], 'molecule': [3102, 3557], 'unfold': [3104], 'accessible': [3110], '2,4,': [3156], '6,': [3157], '8,': [3158], '10,': [3159], 'and12),': [3160], '1B,': [3175], '13).': [3177], 'Therefore,': [3178, 3691], 'differences': [3181], 'apparent': [3183], 'masses': [3185], 'presumed': [3194], 'forms': [3196, 4661], 'because': [3198, 3736, 3928, 4555], '65.2': [3210], 'kDa,': [3211], 'unglycosylated': [3213], 'clearly': [3215, 4184], 'migrated': [3216], 'faster': [3217], 'mass,': [3224], 'behavior': [3227], 'many': [3230], 'polytopic': [3233, 5652], '(14Newman': [3236], 'M.J.': [3237], 'Foster': [3238], 'D.L.': [3239], 'Wilson': [3240], 'T.H.': [3241], '1981;': [3247], '256:': [3248], '11804-11808Abstract': [3249], '15Melikian': [3256], 'H.E.': [3257], 'McDonald': [3258], 'J.K.': [3259], 'Gu': [3260], 'Rudnick': [3262, 5044, 5569], 'Moore': [3264], 'K.R.': [3265], 'Blakely': [3266], 'R.D.': [3267], '269:': [3272], '12290-12297Abstract': [3273], '16Brüss': [3280], 'Hammermann': [3282], 'R.': [3283], 'Brimijoin': [3284], 'Bönisch': [3286], '1995;': [3291], '270:': [3292], '9197-9201Abstract': [3293], '(68)': [3301], '17Turk': [3304, 5523], 'Kerner': [3306, 4848, 4891, 5076, 5362, 5525], 'C.J.': [3307, 4849, 4892, 5077, 5363, 5526], 'Lostao': [3308, 4850, 4893, 5078, 5364, 5527], 'M.P.': [3309, 4851, 4894, 5079, 5365, 5528], '271:': [3316, 4858, 4901, 5086, 5372, 5535], '1925-1934Abstract': [3317, 4859, 4902, 5087, 5373, 5536], '(145)': [3325, 4867, 4910, 5095, 5381, 5544], '18Olivares': [3328, 5384], 'L.': [3329, 5385], 'Aragon': [3330, 5386], 'Gimenez': [3332, 5388], 'Zafra': [3334, 5390], '1211-1217Abstract': [3341, 5397], '(59)': [3349, 5405], 'examine': [3353, 3760], 'effect': [3355, 3412, 3490, 3774, 5279], 'function,': [3362, 3719], 'assays': [3365], 'transfection.': [3380], 'Remarkably,': [3381], 'exhibited': [3384, 3459], 'perchlorate-sensitive': [3385], 'values': [3389, 3869], 'ranging': [3390], '50': [3392], '90%': [3394], 'had': [3407, 4545], 'only': [3408, 3647, 4244, 4779], 'marginal': [3410], 'modulatory': [3411], 'most': [3418, 4632, 5584], 'significant': [3419, 5055], 'aspect': [3420], 'active,': [3429, 5330], 'extent': [3435], 'targeting': [3438], 'ofN-linked': [3450], 'Triple': [3452], 'nonglycosylated,': [3458], '∼50%': [3460], 'unquestionably': [3468], 'value': [3471], 'further': [3473, 5630], 'structure/function': [3474], 'study': [3475, 4783, 5590], '“Discussion”).': [3479], 'ascertain': [3481], 'lack': [3484, 5292], 'has': [3488, 4886, 5355, 5474], 'chase': [3517], 'periods': [3518], 'up': [3520], '56': [3522], 'unlabeled': [3528], 'methionine': [3529], 'cysteine.': [3531], 'Solubilized': [3532], '[35S]methionine/cysteine-labeled': [3533], 'immunoprecipitated': [3536], 'Wild-type': [3546], 'autoradiogram': [3552, 3605], '∼56-kDa': [3555, 3612], 'precursor': [3556, 3613], 'processed': [3561], '∼90–100-kDa': [3565], 'remaining': [3567], 'detectable': [3568, 3662], '39': [3570, 3664], '1–3': [3576], '5–8).': [3578], 'When': [3579, 4367], '30-min': [3594], 'chase,': [3595], '4).': [3607], 'indicates': [3609], 'itself': [3615], 'already': [3616], 'fromN-glycosidase': [3626], 'corresponds': [3629], 'fully': [3631, 5072], 'Whereas': [3634, 5017], 'differed': [3638], 'never': [3654], 'processed,': [3655], 'nevertheless': [3659], 'remained': [3661], 'h,': [3665], 'be': [3669, 3992, 4146, 4565, 4730, 5009, 5477, 5693], 'nearly': [3670], 'stable': [3672], '9–12;': [3680], 'quantitation': [3682], '5–12': [3685], 'depicted': [3687], 'Fig.3': [3689], 'clear': [3694, 3976, 5275], 'requirement': [3702], 'stability.': [3705], 'indicate': [3710], 'interest': [3723], 'determine': [3725, 5648], 'decrease': [3728, 3903], 'abolishedN-linked': [3733], 'change': [3739], 'affinity': [3742, 3958, 5334], '(Km)': [3745], 'number': [3749, 3933, 3949], 'functional': [3751, 5073, 5595, 5611], 'molecules': [3753, 3937, 3944], '(apparentVmax).': [3758], 'issue,': [3762], 'out.': [3772], 'varying': [3776], 'concentrations': [3777], '(ranging': [3780], '2.5': [3782], '160': [3784], 'μm)': [3785], 'C).': [3803], 'reached': [3806, 5131], 'saturation': [3807], '∼40': [3809], 'reciprocal': [3825], 'plot': [3826], 'presented': [3832, 3970, 4608, 5300], 'D.': [3836], 'calculated': [3838, 3867], 'Km': [3839, 3910], 'virtually': [3843], 'identical': [3844], '(∼41': [3851], '±': [3852, 3856, 3872, 3883], '1.78': [3853], '36': [3855], '1.32': [3857], 'μm,': [3858], 'respectively)': [3859, 4579], 'four': [3861], 'independent': [3862], 'experiments.': [3863, 5750], 'contrast,': [3865, 4237], 'Vmax': [3868, 3906], '210': [3871], '3.98': [3873], 'pmol': [3874, 3885], 'I−/μg': [3875, 3886], 'DNA/4': [3876, 3887], '70': [3882], '2.72': [3884], 'resulted': [3899], '∼3-fold': [3902], 'altering': [3908], 'I−.': [3912, 3964], 'demonstrate': [3915], 'reduction': [3918], 'catalyzed': [3922], 'plasma': [3940], 'turnover': [3948], 'light': [3966, 4604], '1,': [3973], 'originally': [3984, 4874], 'should': [3991, 4354], 'revised.': [3993], 'original': [3997, 4687, 4734], 'model,': [3998, 4688], 'conclusively,': [4043], 'polyclonal': [4047], 'domain': [4052, 4144, 4358, 4826, 4884, 4949], 'intracellularly': [4062, 4117], 'However,': [4092], 'attempts': [4094], 'raise': [4096], 'anti-NH2': [4098], 'successful.': [4104], 'test': [4107], 'directly': [4108], 'extracellularly,': [4119], 'engineer': [4125], 'construct': [4128], 'bearing': [4129], '(sequence': [4133], 'MDYKDDDDK)': [4134], '(N-Flag': [4139], 'NIS),': [4140], 'so': [4141, 4689], 'could': [4145], 'detected': [4147, 5060], 'anti-Flag': [4149, 4187, 4208, 4314, 4336], 'Ab.': [4150], 'N-Flag': [4157, 4181, 4198, 4214, 4323], 'indistinguishable': [4160], 'does': [4172, 4780], 'impair': [4174], '(Fig.4': [4179, 4255], 'A).': [4180], 'monitored': [4185], '4': [4201, 4232, 4339], 'Most': [4203], 'tellingly,': [4204], 'nonpermeabilized': [4220], 'permeabilized': [4222, 4246], 'C,': [4233, 4256], 'panel': [4234], 'd).': [4235], 'By': [4236], 'panels': [4257], 'b),': [4260], 'known': [4266], 'terminus,': [4272], 'Specificity': [4308], 'immunoreactivity': [4311], 'verified': [4317], 'ability': [4320], 'peptide': [4324], 'competitively': [4326], 'together': [4334], 'C,panels': [4340], 'e': [4341], 'f).': [4343], 'conclusion,': [4345], 'revision': [4347], 'depict': [4355], 'extracellularly.': [4366], 'those': [4378, 4924, 5343], 'cloned': [4381], 'cotransporters,': [4383], 'highest': [4385], 'degree': [4386], 'homology': [4388], '(24.6%': [4389], 'identity)': [4392], 'exist': [4396], 'human': [4399], 'Na+/glucose': [4400], 'cotransporter,': [4401], 'SGLT1': [4402, 4471, 4840, 4871, 4921, 4950, 4975, 5000, 5070, 5103], 'profile': [4446], 'comparisons': [4447], 'suggest': [4448], 'topology': [4452, 5350, 5484, 5623, 5650], 'similar': [4456, 5341], 'SGLT1.': [4460], 'As': [4461, 4671, 5602], 'connection': [4466], '(3Dai': [4472, 4580], 'Scholar),': [4494, 5054, 5097, 5456], 'sequence,': [4498], 'analysis,': [4500], 'actually': [4511], 'compatible': [4512], 'different': [4515], 'topological': [4516, 4969], 'models.': [4517], 'case': [4520], 'models': [4526, 5461], 'propose': [4527, 4629, 4829], 'helices,': [4529], 'proposes': [4532], '13': [4533, 4635, 4918], 'helices.': [4534], 'Given': [4535], 'signal': [4540, 4762], 'considered': [4546], '13-helix': [4548, 4719], 'less': [4550, 4726, 4818], 'likely': [4551, 4633], 'others': [4554], 'predicts': [4557], 'opposite': [4567], 'sides': [4568], '(i.e.': [4572], 'sides,': [4578], 'evidence': [4607, 4715], 'here': [4609, 4830, 5301], '1)': [4616], 'now': [4628, 4701], 'transmembrane': [4636, 4664, 4809, 4879], 'helices': [4637, 4657, 4677], '(Fig.5': [4638], 'predict': [4641], 'region': [4646], 'comprising': [4647], '389–410': [4651], '9': [4658], 'helix': [4665, 4932, 5663], 'dotted': [4669], 'line).': [4670], 'change,': [4676], '1–9': [4678], 'reversed': [4681], 'polarity': [4682, 4807], 'respect': [4684], 'NH2terminus': [4693], 'placed': [4702], 'It': [4710, 4728], 'remarkable': [4712], 'current': [4714, 5686], 'supports': [4716], 'precisely': [4717], 'initially': [4723], 'regarded': [4724], 'likely.': [4727], 'must': [4729], 'emphasized': [4731], 'favored': [4737], 'widely': [4742], 'held': [4743], 'expectations': [4744], 'transporters,': [4751, 5494], 'such': [4752, 4786, 4996], 'assumed': [4755], 'link': [4756, 4788], 'placement': [4766], 'Not': [4778], 'prove': [4784], 'always': [4791], 'required,': [4792], 'but': [4793], 'leads': [4796], 'conclusion': [4799, 5130], 'currently': [4801], 'employed': [4802], 'guidelines': [4803], 'assigning': [4805], 'class': [4813], 'probably': [4817], 'reliable': [4819], 'generally': [4822], 'believed.': [4823], '13-transmembrane': [4825], 'recent': [4836], 'scanning': [4844, 5472, 5627], '(17Turk': [4846, 4889, 5074, 5360], 'domains,': [4880], '14-transmembrane': [4883, 4948], 'coincide': [4922], 'presently': [4927], 'predicting': [4928], '14': [4933], 'carboxyl': [4939], 'tail,': [4940], 'places': [4952], 'Our': [4963, 5123], 'information': [4970], 'family': [4976], 'transporters': [4978, 4998, 5592], '(19Turk': [4979], 'Membr.': [4984, 5413, 5552], '159:': [4987, 5416, 5555], '1-20Crossref': [4988, 5417, 5556], '(192)': [4991, 5420, 5559], 'GABA': [5003, 5033, 5036, 5056, 5066, 5487], 'transporter': [5004, 5034], 'tunicamycin': [5020, 5107, 5199, 5256, 5281], '(an': [5021], 'inhibitor': [5022], 'synthesis': [5025, 5203, 5259], 'oligosaccharides)': [5028], 'HeLa': [5030, 5062], 'abolishes': [5035], '(20Keynan': [5038], 'Suh': [5040, 5565], 'Y.J.': [5041, 5566], 'Kanner': [5042, 5425, 5567], 'B.I.': [5043, 5568], 'Biochemistry.': [5046, 5571], '1992;': [5047, 5572], '31:': [5048, 5573], '1974-1979Crossref': [5049, 5574], '(122)': [5052, 5577], 'transporter.': [5067], 'Similarly,': [5068], 'though': [5099, 5348], 'inhibited': [5105], '(21Wu': [5108], 'J.-S.R.': [5109], 'Lever': [5110], '1192:': [5116], '289-292Crossref': [5117], '(6)': [5120], 'variance': [5127], 'stating': [5135], 'folding': [5143], 'prevented': [5200], 'hormone-dependent': [5210], 'reinduction': [5211], 'hence': [5219], 'thatN-linked': [5221], 'synthesis,': [5227], 'folding,': [5228], 'inhibits': [5257], 'preventsN-linked': [5265], 'cell,': [5272], 'necessarily': [5287], 'due': [5288], 'specifically': [5289], 'considerably': [5311], 'Fully': [5323], 'half-life': [5339], 'Even': [5347], 'eukaryotic': [5352], 'Na+-driven': [5353], 'symporters': [5354], 'received': [5357], 'attention': [5359], '19Turk': [5408, 5547], '22Bennett': [5423], 'E.R.': [5424], '1203-1210Abstract': [5432], '(88)': [5440], 'Scholar,23Wahle': [5442], 'Stoffel': [5444], 'W.': [5445], 'Cell': [5447], '135:': [5450], '1867-1877Crossref': [5451], '(47)': [5454], 'relatively': [5457], 'few': [5458], 'unequivocally': [5467], 'experimentally.': [5469], 'proved': [5475], 'valuable': [5479], 'technique': [5480, 5582], 'SGLT1,': [5486], '(GAT-1),': [5488], 'glycine': [5489], '(GLYT1),': [5490], 'glutamate/aspartate': [5492], '(GLAST-1)': [5493], 'albeit': [5495], 'some': [5497], 'limitations': [5498], '(Refs.': [5499], '20Keynan': [5563], 'respectively).': [5580], 'effective': [5585], 'applied': [5587], 'devoid': [5598], 'carbohydrate': [5600], 'moieties.': [5601], 'state,': [5615], 'amenable': [5620], 'byN-linked': [5625], 'probe': [5631], 'model.': [5636], 'tridimensional': [5641], 'data,': [5643], 'crucial': [5646], 'design': [5656], 'studies': [5657], 'aimed': [5658], 'elucidation': [5661], 'packing': [5664], 'understanding': [5666], 'roles': [5668], 'played': [5669], 'proteins.': [5684], 'will': [5690], 'continue': [5691], 'experimentally': [5694], 'tested': [5695], 'variety': [5698], 'biochemical,': [5700], 'biophysical,': [5701], 'immunological': [5703], 'methods': [5704], 'ultimate': [5707], 'goal': [5708], 'elucidating': [5710], 'mechanism': [5713], 'thank': [5721], 'Dr.': [5722, 5733], 'insightful': [5726], 'discussion': [5727], 'models,': [5732], 'Orr': [5735], 'critical': [5737], 'reading': [5738], 'manuscript,': [5741], 'Varlamov': [5744], 'help': [5746]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2060007614', 'counts_by_year': [{'year': 2024, 'cited_by_count': 2}, {'year': 2023, 'cited_by_count': 6}, {'year': 2022, 'cited_by_count': 6}, {'year': 2021, 'cited_by_count': 5}, {'year': 2020, 'cited_by_count': 3}, {'year': 2019, 'cited_by_count': 7}, {'year': 2018, 'cited_by_count': 8}, {'year': 2017, 'cited_by_count': 7}, {'year': 2016, 'cited_by_count': 6}, {'year': 2015, 'cited_by_count': 7}, {'year': 2014, 'cited_by_count': 5}, {'year': 2013, 'cited_by_count': 5}, {'year': 2012, 'cited_by_count': 7}], 'updated_date': '2024-12-11T11:07:17.469524', 'created_date': '2016-06-24'}