Title: Stimulation of Type I Collagen Transcription in Human Skin Fibroblasts by TGF-β: Involvement of Smad 3
Abstract: Transforming growth factor-β (TGF-β) stimulates the transcription of the α2(I) procollagen gene (COL1A2). The intracellular mediators involved in this response remain poorly understood. In this study, we demonstrate that primary human skin fibroblasts express Smads, a novel family of signaling molecules, in vitro in the absence of TGF-β. The levels of Smad 7 mRNA was rapidly and transiently increased by TGF-β. Transient overexpression of Smad 3 and Smad 4, but not Smad 1 or Smad 2, caused trans-activation of a CAT reporter gene driven by a 772 bp segment of the human COL1A2 promoter containing putative TGF-β response elements. Smad stimulation of promoter activity was ligand independent, but was further enhanced by TGF-β. Overexpression of a phosphorylation-deficient Smad 3 mutant or wild-type Smad 7, which lacks the carboxy-terminal phosphorylation motif, specifically inhibited TGF-β-induced activation of COL1A2 promoter. A CAGACA sequence shown to be a functional Smad-binding element in the plasminogen activator inhibitor-1 gene promoter was found within the TGF-β-response region of the proximal COL1A2 promoter. Gel mobility shift assays showed protein phosphorylation-dependent binding activity in fibroblast nuclear extracts specific for this sequence; TGF-β treatment strongly stimulated the formation of this DNA-protein complex. Smad was identified as a component of the CAGACA-binding transcription complex in TGF-β-treated fibroblasts by antibody supershifting. These results demonstrate that (i) Smad 3 transmits TGF-β signals from the receptor to the COL1A2 promoter in human fibroblasts, and is likely to play an important role in stimulation of COL1A2 promoter activity elicited by TGF-β; (ii) in fibroblasts, Smads appear to function as inducible DNA-binding transcription factors; and (iii) Smad 7 may be involved in autocrine negative feedback in the regulation of COL1A2 promoter activity by TGF-β. Transforming growth factor-β (TGF-β) stimulates the transcription of the α2(I) procollagen gene (COL1A2). The intracellular mediators involved in this response remain poorly understood. In this study, we demonstrate that primary human skin fibroblasts express Smads, a novel family of signaling molecules, in vitro in the absence of TGF-β. The levels of Smad 7 mRNA was rapidly and transiently increased by TGF-β. Transient overexpression of Smad 3 and Smad 4, but not Smad 1 or Smad 2, caused trans-activation of a CAT reporter gene driven by a 772 bp segment of the human COL1A2 promoter containing putative TGF-β response elements. Smad stimulation of promoter activity was ligand independent, but was further enhanced by TGF-β. Overexpression of a phosphorylation-deficient Smad 3 mutant or wild-type Smad 7, which lacks the carboxy-terminal phosphorylation motif, specifically inhibited TGF-β-induced activation of COL1A2 promoter. A CAGACA sequence shown to be a functional Smad-binding element in the plasminogen activator inhibitor-1 gene promoter was found within the TGF-β-response region of the proximal COL1A2 promoter. Gel mobility shift assays showed protein phosphorylation-dependent binding activity in fibroblast nuclear extracts specific for this sequence; TGF-β treatment strongly stimulated the formation of this DNA-protein complex. Smad was identified as a component of the CAGACA-binding transcription complex in TGF-β-treated fibroblasts by antibody supershifting. These results demonstrate that (i) Smad 3 transmits TGF-β signals from the receptor to the COL1A2 promoter in human fibroblasts, and is likely to play an important role in stimulation of COL1A2 promoter activity elicited by TGF-β; (ii) in fibroblasts, Smads appear to function as inducible DNA-binding transcription factors; and (iii) Smad 7 may be involved in autocrine negative feedback in the regulation of COL1A2 promoter activity by TGF-β. glutathione-S-transferase plasminogen activator inhibitor-1 Smad binding element Type I collagen is the major structural component of the extracellular matrix. Transforming growth factor-β (TGF-β) stimulates type I collagen transcription (Penttinen et al., 1988Penttinen R.P. Kobayashi S. Bornstein P. Transforming growth factor β increases mRNA for matrix proteins both in the presence and in the absence of changes in mRNA stability.Proc Natl Acad Sci USA. 1988; 85: 1105-1108Crossref PubMed Scopus (344) Google Scholar;Inagaki et al., 1994Inagaki Y. Truter S. Ramirez F. Transforming growth factor-β stimulates α2 (I) collagen gene expression through a cis-acting element that contains an Sp1-binding site.J Biol Chem. 1994; 269: 14828-14834Abstract Full Text PDF PubMed Google Scholar;Jimenez et al., 1994Jimenez S.A. Varga J. Olsen A. Li L. Diaz A. Herhal J. Koch J. Functional analysis of human α1 (I) procollagen gene promoter: differential activity in collagen-producing and nonproducing cells and response to transforming growth factor-β1.J Biol Chem. 1994; 269: 12684-12691Abstract Full Text PDF PubMed Google Scholar;Chung et al., 1996Chung K.-Y. Agarwal A. Uitto J. Mauviel A. An AP-1 binding sequence is essential for regulation of the human α1 (I) collagen (COL1A2) promoter activity by transforming growth factor-β.J Biol Chem. 1996; 271: 3272-3278Crossref PubMed Scopus (302) Google Scholar). Transient transfection studies with α2(I) procollagen gene (COL1A2) promoter constructs have localized a complex TGF-β response element called TbRE to a region between –330 bp and –255 bp (Inagaki et al., 1994Inagaki Y. Truter S. Ramirez F. Transforming growth factor-β stimulates α2 (I) collagen gene expression through a cis-acting element that contains an Sp1-binding site.J Biol Chem. 1994; 269: 14828-14834Abstract Full Text PDF PubMed Google Scholar). The functional TbRE consists of a GC-rich 5′ portion and Box B. In contrast to the detailed structural analysis of TGF-β-responsive elements in the COL1A2 promoter, little is currently known about the intracellular signaling mechanisms that enable TGF-β to stimulate collagen transcription in vivo and in vitro. TGF-β signaling in mammalian cells is mediated through interactions with type I and type II TGF-β receptors. These transmembrane serine-threonine kinase receptors exist as independent homodimers in the absence of ligand (Massagué, 1996Massagué J. TGFβ signaling: receptors, transducers, and Mad proteins.Cell. 1996; 85: 947-950Abstract Full Text Full Text PDF PubMed Scopus (804) Google Scholar). Binding of TGF-β to the high-affinity type II receptor results in recruitment of the type I receptor into a ternary signaling complex. The type I receptor then becomes phosphorylated, enabling it to propagate the signal to intracellular targets. Genetic screens in Drosophila, Xenopus, and C. elegans have identified a novel class of genes whose products function downstream from receptors for TGF-β-like ligands, and regulate architectural patterns of development (Sekelsky et al., 1995Sekelsky J.J. Newfeld S.J. Raftery L.A. Chratoff E.H. Gelbart W.M. Genetic characterization and cloning of mothers against dpp, a gene required for decapentaplegic function in Drosophila melanogaster.Genetics. 1995; 139: 1347-1358Crossref PubMed Google Scholar;Graff et al., 1996Graff J.M. Bansal A. Melton D.A. Xenopus Mad proteins transduce distinct subsets of signals for the TGFβ superfamily.Cell. 1996; 85: 479-487Abstract Full Text Full Text PDF PubMed Scopus (390) Google Scholar;Savage et al., 1996Savage C. Das P. Finelli A.L. Townsend S.R. Sun C.-Y. Baird S.E. Padgett R.W. Caenorhabditis elegans genes sma-2, sma-3, and sma-4 define a conserved family of transforming growth factor β pathway components.Proc Natl Acad Sci USA. 1996; 93: 790-794Crossref PubMed Scopus (416) Google Scholar). Nine distinct vertebrate homologs of these proteins, called Smads, have been cloned to date (Hoodless et al., 1996Hoodless P.A. Haerry S. Abdollah M. Stapleton M. O’connor M.B. Attisano L. Wrana J.L. MADR1, a MAD-related protein that functions in BMP2 signaling pathways.Cell. 1996; 85: 489-500Abstract Full Text Full Text PDF PubMed Scopus (612) Google Scholar;Chen et al., 1997aChen Y. Bhushan A. Vale W. SMAD 8 mediates the signaling of the receptor serine kinase.Proc Natl Acad Sci USA. 1997; 94: 12938-12943Crossref PubMed Scopus (135) Google Scholar;Liu et al., 1996Liu F. Hata A. Baker J.C. Doody J. Cárcamo J. Harland R.M. Massagué J. A human Mad protein acting as a BMP-regulated transcriptional activator.Nature. 1996; 381: 620-623Crossref PubMed Scopus (571) Google Scholar;Zhang et al., 1996Zhang Y. Feng X.-H. Wu R.-Y. Derynck R. Receptor-associated Mad homologues synergize as effectors of the TGF-β response.Nature. 1996; 383: 168-171Crossref PubMed Scopus (736) Google Scholar;Topper et al., 1997Topper J.N. Cai J. Qiu Y. et al.Vascular MADs: Two novel MAD-related genes selectively inducible by flow in human vascular endothelium.Proc Natl Acad Sci USA. 1997; 94: 9314-9319Crossref PubMed Scopus (284) Google Scholar). The identification of Smad mutations in human cancers suggests a role for these genes as tumor suppressors (Hahn et al., 1996Hahn S.A. Schutte M. Shamsul Hoque A.T.M. et al.DPC4, a candidate tumor suppressor gene at human chromosome 18q21.1.Science. 1996; 271: 350-353Crossref PubMed Scopus (2096) Google Scholar;Eppert et al., 1996Eppert K. Scherer S.W. Ozcelik H. et al.MADR2 maps to 18q21 and encodes a TGFβ-regulated MAD-related protein that is functionally mutated in colorectal carcinoma.Cell. 1996; 86: 543-552Abstract Full Text Full Text PDF PubMed Scopus (762) Google Scholar). The Smads share conserved amino- and carboxy-terminal domains separated by a more divergent proline-rich linker region. Smad 1 and Smad 5 signal downstream of bone morphogenetic protein, whereas Smad 2 and its close homolog Smad 3 are thought to be activated primarily by TGF-β and activin (Chen et al., 1996Chen Y. Lebrun J.J. Vale W. Regulation of transforming growth factor β- and activin-induced transcription by mammalian Mad proteins.Proc Natl Acad Sci USA. 1996; 93: 12992-12997Crossref PubMed Scopus (139) Google Scholar;Hoodless et al., 1996Hoodless P.A. Haerry S. Abdollah M. Stapleton M. O’connor M.B. Attisano L. Wrana J.L. MADR1, a MAD-related protein that functions in BMP2 signaling pathways.Cell. 1996; 85: 489-500Abstract Full Text Full Text PDF PubMed Scopus (612) Google Scholar;Liu et al., 1996Liu F. Hata A. Baker J.C. Doody J. Cárcamo J. Harland R.M. Massagué J. A human Mad protein acting as a BMP-regulated transcriptional activator.Nature. 1996; 381: 620-623Crossref PubMed Scopus (571) Google Scholar;Macías-Silva et al., 1996Macías-Silva M. Abdollah S. Hoodless P.A. Pirone R. Attisano L. Wrana J.L. MADR2 is a substrate of the TGFβ receptor and its phosphorylation is required for nuclear accumulation and signaling.Cell. 1996; 87: 1215-1224Abstract Full Text Full Text PDF PubMed Scopus (643) Google Scholar;Yingling et al., 1996Yingling J.M. Das P. Savage C. Zhang M. Padgett R.W. Wang X.F. Mammalian dwarfins are phosphorylated in response to TGF-β and are implicated in control of cell growth.Proc Natl Acad Sci USA. 1996; 93: 8940-8944Crossref PubMed Scopus (129) Google Scholar;Nakao et al., 1997bNakao A. Imamura T. Souchelnytskyi S. et al.TGF-β receptor-mediated signaling through Smad 2, Smad 3, and Smad 4.Embo J. 1997; 16: 5353-5362Crossref PubMed Scopus (873) Google Scholar). It is likely that Smads are also involved in signaling by agonists not related to the TGF-β superfamily (Mucsi and Goldberg, 1997Mucsi I. Goldberg H.J. Dominant-negative SMAD-3 interferes with transcriptional activation by multiple agonists.Biochem Biophys Res Commun. 1997; 232: 517-521Crossref PubMed Scopus (14) Google Scholar). After stimulation of cells with TGF-β, cytoplasmic Smad 2 and Smad 3 interact transiently with the activated type I TGF-β receptor, become phosphorylated at carboxy-terminal serine residues, and associate with Smad 4 (Lagna et al., 1996Lagna G. Hata A. Hemmati-Brivanou A. Massagué J. Partnership between DPC4 and SMAD proteins in TGF-β signaling pathways.Nature. 1996; 383: 832-836Crossref PubMed Scopus (791) Google Scholar;Macías-Silva et al., 1996Macías-Silva M. Abdollah S. Hoodless P.A. Pirone R. Attisano L. Wrana J.L. MADR2 is a substrate of the TGFβ receptor and its phosphorylation is required for nuclear accumulation and signaling.Cell. 1996; 87: 1215-1224Abstract Full Text Full Text PDF PubMed Scopus (643) Google Scholar;Zhang et al., 1996Zhang Y. Feng X.-H. Wu R.-Y. Derynck R. Receptor-associated Mad homologues synergize as effectors of the TGF-β response.Nature. 1996; 383: 168-171Crossref PubMed Scopus (736) Google Scholar;Liu et al., 1997Liu X. Sun Y. Constantinescu S.N. Karam E. Weinberg R.A. Lodish H.F. Transforming growth factor β-induced phosphorylation of Smad 3 is required for growth inhibition and transcriptional induction in epithelial cells.Proc Natl Acad Sci USA. 1997; 94: 10669-10674Crossref PubMed Scopus (323) Google Scholar;Nakao et al., 1997aNakao A. Afrakhte M. Morén A. et al.Identification of Smad 7, a TGF-β-inducible antagonist of TGF-β signaling.Nature. 1997; 389: 631-634Crossref PubMed Scopus (1489) Google Scholar;Wu et al., 1997Wu R.-Y. Zhang Y. Feng X.-H. Derynck R. Heteromeric and homomeric interactions correlate with signaling activity and functional cooperativity of Smad 3 and Smad 4/DPC4.Mol Cell Biol. 1997; 17: 2521-2528Crossref PubMed Scopus (183) Google Scholar). The hetero-oligomeric Smad 2/3–Smad 4 complex translocates into the nucleus, where it regulates the transcription of target genes through as-yet poorly understood mechanisms. Recently, Smad 6, Smad 7, and Smad 9 have been identified in endothelial and epithelial cells. These closely related proteins form a structurally and functionally distinct class of Smads, and act as negative effectors of TGF-β signaling in vitro (Topper et al., 1997Topper J.N. Cai J. Qiu Y. et al.Vascular MADs: Two novel MAD-related genes selectively inducible by flow in human vascular endothelium.Proc Natl Acad Sci USA. 1997; 94: 9314-9319Crossref PubMed Scopus (284) Google Scholar;Imamura et al., 1997Imamura T. Takase M. Nishihara A. Oeda E. Hanai J.-I. Kawabata M. Miyazano K. Smad 6 inhibits signaling by the TGF-β superfamily.Nature. 1997; 389: 622-625Crossref PubMed Scopus (841) Google Scholar;Nakao et al., 1997aNakao A. Afrakhte M. Morén A. et al.Identification of Smad 7, a TGF-β-inducible antagonist of TGF-β signaling.Nature. 1997; 389: 631-634Crossref PubMed Scopus (1489) Google Scholar). In this study, we investigated the role of Smad signaling in mediating the effects of TGF-β on the transcription of the type I collagen gene. The results indicate that Smad 3 and Smad 4 are expressed in primary human fibroblasts, trans-activate the COL1A2 promoter in vitro, and show inducible DNA-binding activity specific for a TGF-β-response element of the COL1A2 promoter. Smad 7, whose expression in fibroblasts is rapidly induced by TGF-β, abrogates ligand-induced stimulation of collagen promoter activity, and may play a role in an intracellular negative feedback loop for TGF-β signaling. Primary cell cultures were established from neonatal foreskin biopsies by previously described explant techniques (Varga et al., 1987Varga J. Rosenbloom J. Jimenez S.A. Transforming growth factor β (TGFβ) causes a persistent increase in steady-state amounts of type I and type III collagen and fibronectin mRNAs in normal human dermal fibroblasts.Biochem J. 1987; 247: 597-604Crossref PubMed Scopus (455) Google Scholar), and COS cells were from ATCC. Media were obtained from Biowhittaker (Walkersville, MD); all other tissue culture reagents were from Gibco BRL (Grand Island, NY). Cells were grown at 37°C in a 5% CO2 atmosphere in Dulbecco’s (COS cells) or modified Eagle’s medium supplemented with 10% fetal calf serum, 1% vitamins, 1% penicillin/streptomycin, and 2 mM L-glutamine, and studied between passages 4–8. When the cells reached confluence, fresh medium with varying concentrations of fetal calf serum with or without TGF-β2 (from Celtrix, Santa Clara, CA), or TGF-β1 (from Amgen, Thousand Oaks, CA) was added, and cultures were harvested following a further 24–48 h incubation. At the end of each experiment, total RNA was isolated from fibroblasts maintained in medium with 1% fetal calf serum using TRIZOL Reagent (Gibco BRL). Relative levels of mRNA were examined by northern analysis with [α-32P]dCTP-labeled cDNA probes. Following washing of the nylon membranes, the cDNA-mRNA hybrids were visualized by autoradiography on Kodak X-AR5 films exposed for 24–72 h with intensifying screens. The following cDNA probes were used: glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a 1.4 kb restriction fragment including the entire coding region of Smad 3, and a 1.6 kb restriction fragment including the entire coding region of Smad 4 (Zhang et al., 1996Zhang Y. Feng X.-H. Wu R.-Y. Derynck R. Receptor-associated Mad homologues synergize as effectors of the TGF-β response.Nature. 1996; 383: 168-171Crossref PubMed Scopus (736) Google Scholar). To examine the expression of Smad 2, Smad 6, and Smad 7 mRNA in fibroblasts, a coupled RT-PCR assay was employed. At the end of the indicated periods of incubation with or without TGF-β1, total RNA was extracted from confluent fibroblasts, as described for northern analysis. Samples were treated with RNase-free DNase according to the manufacturer’s instructions (Promega, Madison, WI) to remove potentially contaminating DNA. One microgram of RNA was then copied into cDNA in 12 μl reaction mixture using the SuperScript Preamplification System for first-strand cDNA synthesis kit (Gibco BRL). Aliquots of the resulting cDNA were then subjected to PCR amplification in the presence of 1 unit of AmpliTaq polymerase (Perkin-Elmer, Norwalk, CT), 15 μM of each primer, 200 μM dNTP, 1.5 mM MgCl2, 10 Ci [α-32P] dCTP, and 2.5 μl PCR Buffer (Perkin-Elmer) in a total volume of 25 μl. Oligonucleotide primers specific for Smad 2, Smad 6, and Smad 7 cDNA shown in Table 1 were designed using “Primer Design” software (Scientific and Educational Software, Durham, NC). The reaction was incubated at 94°C for 30 s and at 72°C for 30 s, stopped at 72°C for 5 min, and cooled on ice. At the end of the amplification, the size of the PCR products was determined by comparison with standard DNA markers, using 8% polyacrylamide gel electrophoresis and ethidium bromide staining. In other experiments, 9 μl of each reaction was taken at different amplification cycles, and analyzed by electrophoresis. The gels were then dried and exposed to Kodak X-ray film for 5 min. The segments of the gel corresponding to the bands detected by autoradiography were excised, and the amount of radioactivity was determined by liquid scintillation counting. As positive controls, duplicate samples of cDNA were amplified in parallel with GAPDH-specific primers, and analyzed as described above. As negative control, cDNA synthesis without RT was performed to exclude PCR contamination. Experiments were repeated three times.Table 1Sequences and positions of primers used in RT-PCR assaysmRNAPrimer sequence (5′–3′)aS, sense orientation; AS, antisense orientation.GenBank accessionPosition (5′–3′)Size of amplified product (bp)Smad 2SASGGAGCAGAATACCGAAGGCA CTTGAGCAACGCACTGAAGGAF 680181322 1449128Smad 6SASCAAGCCACTGGATCTGTCCGA TTGCTGAGCAGGATGCCGAAGAF0355281800 2120321Smad 7SASATGCTGTGCCTTCCTCCGCT CGTCCACGGCTGCTGCATAAAF015261680 1173494GAPDHSASTGACCACAGTCCATGCCATC TACATGGCAACTGTGAGGAGG584 1192609a S, sense orientation; AS, antisense orientation. Open table in a new tab For transient transfection experiments, the p3TP-lux, plasminogen activator inhibitor-1 (PAI-1)-CAT, COL1A2-CAT, and pSV0CAT constructs were used as reporters. The p3TP construct contains three concatamerized repeats of the AP-1 site of the collagenase promoter, and the TGF-β response element of the PAI-1 promoter; the PAI-1-CAT chimeric construct contains sequences from –1237 to +20 bp of the rat PAI-1 promoter fused to the CAT reporter gene (Bruzdzinski et al., 1993Bruzdzinski C.J. Johnson M.R. Goble C.A. Winograd S.S. Gelehrter T.D. Mechanism of glucocorticoid induction of the rat plasminogen activator inhibitor-1 gene in HTC rat hepatoma cells: identification of cis-acting regulatory elements.Mol Endocrinol. 1993; 7: 1169-1177Crossref PubMed Scopus (33) Google Scholar); the COL1A2-CAT construct contains sequences from –772 to +58 bp of the human COL1A2 promoter fused to the CAT reporter gene (Ihn et al., 1997Ihn H. LeRoy E.C. Trojanowska M. Oncostatin M stimulates transcription of the human α2 (I) collagen gene via the Sp1/Sp3-binding site.J Biol Chem. 1997; 272: 24666-24672Crossref PubMed Scopus (133) Google Scholar); and pSV0CAT is a negative control plasmid. Fibroblasts were grown to 70% confluence in 60 mm dishes. The media were changed, and 4 h later cultures were transfected with the reporter plasmids (20 μg), along with the indicated wild-type or mutant expression plasmids or corresponding empty constructs (1 μg), employing the calcium-phosphate/DNA coprecipitation method. Expression vectors for human Smad 1 and Smad 2 (gifts from L. Attisano, University of Toronto, Toronto) contain in-frame amino-terminal FLAG epitope tag (Eppert et al., 1996Eppert K. Scherer S.W. Ozcelik H. et al.MADR2 maps to 18q21 and encodes a TGFβ-regulated MAD-related protein that is functionally mutated in colorectal carcinoma.Cell. 1996; 86: 543-552Abstract Full Text Full Text PDF PubMed Scopus (762) Google Scholar;Hoodless et al., 1996Hoodless P.A. Haerry S. Abdollah M. Stapleton M. O’connor M.B. Attisano L. Wrana J.L. MADR1, a MAD-related protein that functions in BMP2 signaling pathways.Cell. 1996; 85: 489-500Abstract Full Text Full Text PDF PubMed Scopus (612) Google Scholar). Expression vectors for Smad 4 (from R. Derynck, University of California, San Francisco), and Smad 3 and Smad 3A, which carries three carboxy-terminal serine-to-alanine substitutions (from H. Lodish, Whitehead Institute), contain the FLAG epitope tag at the amino-terminal domain (Zhang et al., 1996Zhang Y. Feng X.-H. Wu R.-Y. Derynck R. Receptor-associated Mad homologues synergize as effectors of the TGF-β response.Nature. 1996; 383: 168-171Crossref PubMed Scopus (736) Google Scholar;Liu et al., 1997Liu X. Sun Y. Constantinescu S.N. Karam E. Weinberg R.A. Lodish H.F. Transforming growth factor β-induced phosphorylation of Smad 3 is required for growth inhibition and transcriptional induction in epithelial cells.Proc Natl Acad Sci USA. 1997; 94: 10669-10674Crossref PubMed Scopus (323) Google Scholar). Expression vector for Smad 7 (from P. ten Dijke, Ludwig Institute for Cancer Research) was constructed by subcloning a Smad 7 cDNA in the pcDNA3 expression vector (Nakao et al., 1997aNakao A. Afrakhte M. Morén A. et al.Identification of Smad 7, a TGF-β-inducible antagonist of TGF-β signaling.Nature. 1997; 389: 631-634Crossref PubMed Scopus (1489) Google Scholar). Expression vector for Smad 6 (from M. Kawabata, Japanese Foundation for Cancer Research) contains a FLAG epitope in the amino terminal domain in pcDNA3 (Imamura et al., 1997Imamura T. Takase M. Nishihara A. Oeda E. Hanai J.-I. Kawabata M. Miyazano K. Smad 6 inhibits signaling by the TGF-β superfamily.Nature. 1997; 389: 622-625Crossref PubMed Scopus (841) Google Scholar). Expression vector for Smad 9 (from T. Watanabe, Otsuka Pharmaceuticals) was constructed by subcloning a Smad 9 cDNA in the pT7Blue expression vector (Watanabe et al., 1997Watanabe T.K. Suzuki M. Omori Y. et al.Cloning and characterization of a novel member of the human Mad gene family (MADH6).Genomics. 1997; 42: 446-451Crossref PubMed Scopus (48) Google Scholar). A Smad 2 mutant expression vector (from H. Goldberg, Hospital for Sick Children) was constructed by subcloning a Smad 2 cDNA with a premature stop codon in the pcDNA3 expression vector (Mucsi and Goldberg, 1997Mucsi I. Goldberg H.J. Dominant-negative SMAD-3 interferes with transcriptional activation by multiple agonists.Biochem Biophys Res Commun. 1997; 232: 517-521Crossref PubMed Scopus (14) Google Scholar). In order to control for minor variations in transfection efficiency, 50 ng renilla luciferase DNA (Promega), which expresses luciferase under the control of the cytomegalovirus promoter, was included in all transfections. Fresh media containing 0.1% fetal calf serum and TGF-β1 or TGF-β2 (12.5 ng per ml) were then added, and the cells were harvested 48 h after transfection. The total protein content of the extracts was quantitated by the Bradford Coomassie Blue G binding assay (Bradford, 1976Bradford M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye-binding.Anal Biochem. 1976; 72: 248-254Crossref PubMed Scopus (205469) Google Scholar) (Bio-Rad Laboratories, Richmond, CA). Identical amounts of protein from each cell extract (30 μg per assay) were used for parallel determination of CAT activity. CAT activity was determined by an organic solvent extraction assay using [14C] chloramphenicol and butyryl-CoA at assay conditions predetermined to be within the linear range for CAT activities of the samples. Radioactive acetylated chloramphenicol was quantitated by liquid scintillation counting. Luciferase activity was determined using the Dual-Luciferase Reporter Assay System (Promega). Fresh media with or without TGF-β1 (12.5 ng per ml) were added to confluent fibroblasts. At the end of the indicated incubation periods, nuclear extracts were prepared as described (Andrews and Faller, 1991Andrews N.C. Faller D.V. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells.Nucleic Acids Res. 1991; 19: 2499Crossref PubMed Scopus (2192) Google Scholar), and protein concentrations were determined by the Bio-Rad assay. Glutathione-S-transferase (GST)-Smad 3 MH1-domain fusion protein vectors (Zawel et al., 1998Zawel L. Dai J.L. Buckhaults P. Zhou S. Kinzler K.W. Vogelstein B. Kern S.E. Human Smad 3 and Smad 4 are sequence-specific transcription activators.Mol Cell. 1998; 1: 611-617Abstract Full Text Full Text PDF PubMed Scopus (874) Google Scholar) were expressed in Escherichia coli and partially purified by chromatography on glutathione-Sepharose 4B columns (Pharmacia, Piscataway, NJ). Double-stranded oligonucleotides corresponding to a 24 bp sequence spanning –272 to –249 bp of the COL1A2 promoter (COL1A2-CAGA, 5′-GGAGGTATGCAGACAACGAGT-CAG-3′) harboring the CAGACA motif, a 24 bp sequence spanning –386 to –363 bp of the COL1A2 promoter (COL1A2–386/–363, 5′-CTAGCGGCCTCTAGACGTTTAAGA-3′) harboring a CAGA motif, or a 26 bp sequence [Smad binding element (SBE), 5′-GGAGTATGTCTAGACTGA-CAATGTAC-3′] harboring a consensus palindromic Smad-binding element (Zawel et al., 1998Zawel L. Dai J.L. Buckhaults P. Zhou S. Kinzler K.W. Vogelstein B. Kern S.E. Human Smad 3 and Smad 4 are sequence-specific transcription activators.Mol Cell. 1998; 1: 611-617Abstract Full Text Full Text PDF PubMed Scopus (874) Google Scholar) were generated. Additional probes were prepared by introducing subsitution mutations (underlined) in the –272 to –249 COL1A2 sequence: COL1A2-CAGA-m2, 5′-GGAGGTATGACTACAACGAGTCAG-3′; COL1A2-CAGA-m3, 5′-GGAGGTAT-GCAGCACACGAGTCAG-3′; COL1A2-CAGA-m4, 5′-GGAGGTATGCAGACACAT-AGTCAG-3′; and COL1A2-CAGA-m5, 5′-GGAGGTATGACTCACACGAGTCAG-3′. The probes were end-labeled with [γ-32P[ATP using T4 polynucleotide kinase, or with [α-32P[dATP using Klenow fragment of DNA polymerase I for the phosphatase studies. Electrophoretic gel mobility shift assays were performed in binding reactions (total volume 20 μl) containing 2 μg of double-stranded poly[d(I-C)], 3–10 μg nuclear extract or 1 μg of recombinant Smad 3, and 100,000 cpm of radiolabeled probes (≈0.2–0.5 ng). In order to establish the specificity of the protein-DNA complexes, unlabeled oligonucleotide competitors in 2–50-fold molar excess were added in the binding reactions 5 min before the labeled probes. Polyclonal SED antibodies (1–10 μl, as indicated) to Smad 2/3 (Nakao et al., 1997aNakao A. Afrakhte M. Morén A. et al.Identification of Smad 7, a TGF-β-inducible antagonist of TGF-β signaling.Nature. 1997; 389: 631-634Crossref PubMed Scopus (1489) Google Scholar), or pan-FOS antibodies, which react with all members of the FOS family (Santa Cruz Biotechnology, SC-235X), or preimmune serum were added to the binding reactions 15 min prior to the probes. Following incubation of the reaction mixtures on ice for 30 min, protein-DNA complexes were resolved from free probes in nondenaturing 5.5% polyacrylamide gels using low ionic strength buffers. The gels were then dried under vacuum and exposed to X-ray film at –70°C. To examine the effect of in vitro dephosphorylation on DNA-binding activity, nuclear extracts were incubated with 0.8 units per g protein calf intestinal alkaline phosphatase (MBI Fermentas, Amherst, NY) at room temperature for 30 min, followed by the phophatase inhibitor sodium orthovanadate (Sigma, St. Louis, MO), and then examined by gel shift assays with Klenow-labeled DNA probes, as described above. In order to detect endogenous Smad proteins, nuclear extracts from confluent fibroblasts incubated with TGF-β1 or left untreated for 48 h were prepared, and boiled at 90°C with sample buffer for 5 min. Extracts (15–30 μg) were subjected to electrophoresis in 7% SDS polyacrylamide gels in a minigel apparatus for 1 h. The proteins were then trans-blotted onto nitrocellulose membranes for 30 min at 15 V. After blocking with 5% milk, the membranes were incubated with primary antibodies or preimmune serum for 1 h, followed by biotinylated goat anti-rabbit IgG secondary antibodies for 1 h, and washed with Tris-saline buffer. The SED anti-Smad antibody recognizes Smad 2 and Smad 3. Secondary antibodies were detected by inc