MDMX Overexpression Prevents p53 Activation by the MDM2 Inhibitor Nutlin

Name: Work Video:
Duration: 3 min 30 s
Baoli Hu; Daniele M. Gilkes; Bilal Farooqi; Saı̈d M. Sebti; Jiandong Chen
{'id': 'https://openalex.org/W2052516738', 'doi': 'https://doi.org/10.1074/jbc.c600147200', 'title': 'MDMX Overexpression Prevents p53 Activation by the MDM2 Inhibitor Nutlin', 'display_name': 'MDMX Overexpression Prevents p53 Activation by the MDM2 Inhibitor Nutlin', 'publication_year': 2006, 'publication_date': '2006-08-12', 'ids': {'openalex': 'https://openalex.org/W2052516738', 'doi': 'https://doi.org/10.1074/jbc.c600147200', 'mag': '2052516738', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/16905541'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.c600147200', 'pdf_url': 'http://www.jbc.org/article/S0021925820704850/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820704850/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5026429908', 'display_name': 'Baoli Hu', 'orcid': 'https://orcid.org/0000-0002-2737-6871'}, 'institutions': [{'id': 'https://openalex.org/I4210150208', 'display_name': 'Molecular Oncology (United States)', 'ror': 'https://ror.org/04rtkc841', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I4210150208']}, {'id': 'https://openalex.org/I3019308854', 'display_name': 'Moffitt Cancer Center', 'ror': 'https://ror.org/01xf75524', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I3019308854']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Baoli Hu', 'raw_affiliation_strings': ['Molecular Oncology Program, H. Lee Moffitt Cancer Center and Research Institute, Tampa, Florida 33612, USA.'], 'affiliations': [{'raw_affiliation_string': 'Molecular Oncology Program, H. Lee Moffitt Cancer Center and Research Institute, Tampa, Florida 33612, USA.', 'institution_ids': ['https://openalex.org/I4210150208', 'https://openalex.org/I3019308854']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5027210124', 'display_name': 'Daniele M. Gilkes', 'orcid': 'https://orcid.org/0000-0003-3984-9338'}, 'institutions': [{'id': 'https://openalex.org/I3019308854', 'display_name': 'Moffitt Cancer Center', 'ror': 'https://ror.org/01xf75524', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I3019308854']}, {'id': 'https://openalex.org/I4210150208', 'display_name': 'Molecular Oncology (United States)', 'ror': 'https://ror.org/04rtkc841', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I4210150208']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Daniele M. Gilkes', 'raw_affiliation_strings': ['Molecular Oncology Program, H. Lee Moffitt Cancer Center and Research Institute, Tampa, Florida 33612'], 'affiliations': [{'raw_affiliation_string': 'Molecular Oncology Program, H. Lee Moffitt Cancer Center and Research Institute, Tampa, Florida 33612', 'institution_ids': ['https://openalex.org/I3019308854', 'https://openalex.org/I4210150208']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5090620333', 'display_name': 'Bilal Farooqi', 'orcid': 'https://orcid.org/0000-0002-2618-7171'}, 'institutions': [{'id': 'https://openalex.org/I3019308854', 'display_name': 'Moffitt Cancer Center', 'ror': 'https://ror.org/01xf75524', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I3019308854']}, {'id': 'https://openalex.org/I4210150208', 'display_name': 'Molecular Oncology (United States)', 'ror': 'https://ror.org/04rtkc841', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I4210150208']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Bilal Farooqi', 'raw_affiliation_strings': ['Molecular Oncology Program, H. Lee Moffitt Cancer Center and Research Institute, Tampa, Florida 33612'], 'affiliations': [{'raw_affiliation_string': 'Molecular Oncology Program, H. Lee Moffitt Cancer Center and Research Institute, Tampa, Florida 33612', 'institution_ids': ['https://openalex.org/I3019308854', 'https://openalex.org/I4210150208']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5103060677', 'display_name': 'Saı̈d M. Sebti', 'orcid': 'https://orcid.org/0000-0001-5163-1038'}, 'institutions': [{'id': 'https://openalex.org/I3019308854', 'display_name': 'Moffitt Cancer Center', 'ror': 'https://ror.org/01xf75524', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I3019308854']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Said M. Sebti', 'raw_affiliation_strings': ['Drug Discovery Program, H. Lee Moffitt Cancer Center and Research Institute, Tampa, Florida 33612'], 'affiliations': [{'raw_affiliation_string': 'Drug Discovery Program, H. Lee Moffitt Cancer Center and Research Institute, Tampa, Florida 33612', 'institution_ids': ['https://openalex.org/I3019308854']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5101498583', 'display_name': 'Jiandong Chen', 'orcid': 'https://orcid.org/0000-0001-6178-8370'}, 'institutions': [{'id': 'https://openalex.org/I4210150208', 'display_name': 'Molecular Oncology (United States)', 'ror': 'https://ror.org/04rtkc841', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I4210150208']}, {'id': 'https://openalex.org/I3019308854', 'display_name': 'Moffitt Cancer Center', 'ror': 'https://ror.org/01xf75524', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I3019308854']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Jiandong Chen', 'raw_affiliation_strings': ['Molecular Oncology Program, H. Lee Moffitt Cancer Center and Research Institute, Tampa, Florida 33612'], 'affiliations': [{'raw_affiliation_string': 'Molecular Oncology Program, H. Lee Moffitt Cancer Center and Research Institute, Tampa, Florida 33612', 'institution_ids': ['https://openalex.org/I4210150208', 'https://openalex.org/I3019308854']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 2, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 9.721, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 230, 'citation_normalized_percentile': {'value': 0.999932, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 98, 'max': 99}, 'biblio': {'volume': '281', 'issue': '44', 'first_page': '33030', 'last_page': '33035'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10583', 'display_name': 'Cancer-related Molecular Pathways', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2730', 'display_name': 'Oncology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10583', 'display_name': 'Cancer-related Molecular Pathways', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2730', 'display_name': 'Oncology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T12996', 'display_name': 'Cancer Research and Treatments', 'score': 0.9746, 'subfield': {'id': 'https://openalex.org/subfields/1305', 'display_name': 'Biotechnology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11041', 'display_name': 'Ubiquitin and proteasome pathways', 'score': 0.965, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/mdmx', 'display_name': 'MDMX', 'score': 0.9983337}], 'concepts': [{'id': 'https://openalex.org/C2777221213', 'wikidata': 'https://www.wikidata.org/wiki/Q10322346', 'display_name': 'MDMX', 'level': 4, 'score': 0.9983337}, {'id': 'https://openalex.org/C2776192174', 'wikidata': 'https://www.wikidata.org/wiki/Q18028978', 'display_name': 'Mdm2', 'level': 3, 'score': 0.8554568}, {'id': 'https://openalex.org/C502942594', 'wikidata': 'https://www.wikidata.org/wiki/Q3421914', 'display_name': 'Cancer research', 'level': 1, 'score': 0.6052247}, {'id': 'https://openalex.org/C179185449', 'wikidata': 'https://www.wikidata.org/wiki/Q219699', 'display_name': 'Suppressor', 'level': 3, 'score': 0.49281457}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.38069174}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.30174068}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.28411123}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.18379241}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.16152069}], 'mesh': [{'descriptor_ui': 'D007093', 'descriptor_name': 'Imidazoles', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': True}, {'descriptor_ui': 'D010879', 'descriptor_name': 'Piperazines', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': True}, {'descriptor_ui': 'D051736', 'descriptor_name': 'Proto-Oncogene Proteins c-mdm2', 'qualifier_ui': 'Q000037', 'qualifier_name': 'antagonists & inhibitors', 'is_major_topic': True}, {'descriptor_ui': 'D051736', 'descriptor_name': 'Proto-Oncogene Proteins c-mdm2', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D016159', 'descriptor_name': 'Tumor Suppressor Protein p53', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D002460', 'descriptor_name': 'Cell Line', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D049109', 'descriptor_name': 'Cell Proliferation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D049109', 'descriptor_name': 'Cell Proliferation', 'qualifier_ui': 'Q000187', 'qualifier_name': 'drug effects', 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007093', 'descriptor_name': 'Imidazoles', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010879', 'descriptor_name': 'Piperazines', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011485', 'descriptor_name': 'Protein Binding', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051736', 'descriptor_name': 'Proto-Oncogene Proteins c-mdm2', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051736', 'descriptor_name': 'Proto-Oncogene Proteins c-mdm2', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D034741', 'descriptor_name': 'RNA, Small Interfering', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D034741', 'descriptor_name': 'RNA, Small Interfering', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D016159', 'descriptor_name': 'Tumor Suppressor Protein p53', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.c600147200', 'pdf_url': 'http://www.jbc.org/article/S0021925820704850/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/16905541', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.c600147200', 'pdf_url': 'http://www.jbc.org/article/S0021925820704850/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'display_name': 'Good health and well-being', 'id': 'https://metadata.un.org/sdg/3', 'score': 0.43}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 29, 'referenced_works': ['https://openalex.org/W1592021885', 'https://openalex.org/W1598779357', 'https://openalex.org/W1967632402', 'https://openalex.org/W1976261939', 'https://openalex.org/W1994169350', 'https://openalex.org/W1994655355', 'https://openalex.org/W1996632098', 'https://openalex.org/W2002689109', 'https://openalex.org/W2004311983', 'https://openalex.org/W2007658328', 'https://openalex.org/W2022431825', 'https://openalex.org/W2023950025', 'https://openalex.org/W2040068538', 'https://openalex.org/W2046135777', 'https://openalex.org/W2068624303', 'https://openalex.org/W2070023783', 'https://openalex.org/W2106718280', 'https://openalex.org/W2108932391', 'https://openalex.org/W2116326380', 'https://openalex.org/W2116538277', 'https://openalex.org/W2135451553', 'https://openalex.org/W2143351237', 'https://openalex.org/W2146299434', 'https://openalex.org/W2153478539', 'https://openalex.org/W2163552821', 'https://openalex.org/W2163861438', 'https://openalex.org/W2164115530', 'https://openalex.org/W2332575792', 'https://openalex.org/W65126192'], 'related_works': ['https://openalex.org/W4389547816', 'https://openalex.org/W4378417430', 'https://openalex.org/W4376114614', 'https://openalex.org/W4321605893', 'https://openalex.org/W2562317541', 'https://openalex.org/W2321730050', 'https://openalex.org/W2072238097', 'https://openalex.org/W2030430397', 'https://openalex.org/W1981979392', 'https://openalex.org/W1981067307'], 'abstract_inverted_index': {'The': [0, 71, 142, 213, 1625, 1666, 1749, 1825, 1850, 2398, 2684, 3081, 3235, 3387, 3709, 4464, 4482], 'p53': [1, 26, 62, 77, 96, 111, 138, 143, 168, 204, 219, 238, 253, 280, 284, 299, 321, 325, 340, 383, 396, 512, 580, 781, 802, 870, 1164, 1168, 1235, 1299, 1444, 1464, 1483, 1536, 1844, 2056, 2073, 2089, 2137, 2316, 2333, 2442, 2514, 2602, 2619, 2690, 2723, 2987, 3152, 3176, 3221, 3246, 3322, 3345, 3412, 3427, 3456, 3478, 3543, 3572, 3603, 3655, 3668, 3681, 3699, 3715, 3763, 3778, 3791, 3809, 3886, 3938, 3985, 4077, 4099, 4146], 'tumor': [2, 81, 114, 140, 144, 223, 256, 282, 797, 1311, 1441, 1466, 1485, 3315, 4082], 'suppressor': [3, 145], 'plays': [4, 146], 'a': [5, 107, 147, 249, 286, 329, 388, 433, 776, 791, 1177, 1304, 1489, 2146, 2227, 2230, 2366, 2403, 2471, 2631, 2663, 2830, 2873, 2977, 3008, 3206, 3238, 3284, 3651, 3736, 3759, 3787, 3811, 3875, 3967, 3974, 4006, 4079, 4132, 4203, 4283, 4412], 'key': [6, 148, 389, 2421], 'role': [7, 149, 778, 4419], 'in': [8, 80, 92, 113, 139, 150, 222, 234, 255, 281, 290, 391, 397, 741, 779, 790, 1157, 1244, 1272, 1300, 1354, 1439, 1451, 1465, 1484, 1539, 1564, 1600, 1611, 1648, 1694, 1722, 1772, 1888, 1902, 1952, 2133, 2145, 2220, 2298, 2353, 2356, 2375, 2474, 2591, 2642, 2651, 2746, 2757, 2761, 2805, 2822, 2833, 2859, 2876, 3074, 3090, 3431, 3495, 3503, 3517, 3716, 3779, 3784, 3842, 3885, 3890, 3920, 3939, 3955, 3966, 4055, 4078, 4144, 4152, 4189, 4292, 4301, 4304, 4327, 4371, 4376, 4415, 4432, 4468, 4485, 4488], 'maintaining': [9, 151], 'genomic': [10, 152], 'stability': [11, 27, 153, 169, 2878, 3604, 3817], 'and': [12, 18, 28, 55, 97, 129, 154, 160, 170, 197, 239, 271, 326, 346, 355, 508, 570, 578, 647, 874, 897, 900, 986, 1071, 1076, 1220, 1309, 1349, 1433, 1459, 1468, 1487, 1525, 1531, 1533, 1542, 1549, 1603, 1620, 1644, 1656, 1677, 1687, 1707, 1759, 1762, 1793, 1802, 1818, 1859, 1865, 1881, 1883, 1939, 1969, 1989, 2018, 2029, 2069, 2086, 2135, 2141, 2156, 2158, 2181, 2243, 2301, 2322, 2355, 2367, 2370, 2381, 2439, 2468, 2478, 2484, 2492, 2512, 2522, 2572, 2596, 2601, 2615, 2640, 2655, 2658, 2681, 2694, 2705, 2753, 2846, 2983, 3095, 3103, 3116, 3153, 3185, 3244, 3248, 3267, 3281, 3342, 3364, 3383, 3403, 3411, 3421, 3661, 3693, 3698, 3706, 3723, 3818, 3880, 3887, 3961, 3975, 3998, 4020, 4039, 4070, 4119, 4155, 4170, 4184, 4253, 4298, 4342, 4360, 4472], 'protection': [13, 155], 'against': [14, 156, 2976, 3314], 'malignant': [15, 157], 'transformation.': [16, 158], 'MDM2': [17, 34, 54, 128, 159, 176, 196, 270, 315, 335, 359, 369, 373, 386, 441, 518, 575, 746, 894, 1079, 1129, 1156, 1181, 1218, 1234, 1348, 1373, 1401, 1409, 1458, 1530, 1641, 1688, 1763, 1875, 2058, 2068, 2238, 2242, 2325, 2331, 2477, 2483, 2614, 2654, 2657, 2693, 2704, 2756, 2785, 2823, 2906, 3065, 3096, 3204, 3446, 3569, 3609, 3767, 3773, 4069, 4118, 4130, 4154, 4169, 4183, 4209, 4297, 4313, 4319, 4337], 'MDMX': [19, 50, 89, 104, 130, 161, 192, 231, 246, 272, 500, 515, 650, 732, 737, 774, 785, 866, 875, 915, 1008, 1073, 1119, 1137, 1350, 1369, 1437, 1460, 1476, 1532, 1604, 1645, 1686, 1761, 1899, 1913, 1921, 1936, 1958, 1970, 1994, 2006, 2027, 2033, 2244, 2276, 2309, 2327, 2485, 2506, 2535, 2553, 2599, 2616, 2659, 2695, 2706, 2744, 2814, 2834, 2850, 2860, 2864, 2890, 2904, 2981, 3055, 3099, 3119, 3143, 3184, 3225, 3231, 3242, 3305, 3334, 3398, 3430, 3444, 3475, 3486, 3496, 3515, 3550, 3645, 3696, 3799, 3807, 3839, 3857, 3867, 3879, 3909, 3943, 3979, 3995, 4008, 4041, 4071, 4107, 4120, 4156, 4171, 4185, 4198, 4299, 4310, 4325, 4354, 4373, 4404, 4421, 4467], 'are': [20, 121, 131, 162, 263, 273, 876, 1279, 3750, 4172, 4212], 'both': [21, 163, 877, 2241, 4068], 'p53-binding': [22, 164, 434, 1356, 1366, 4123, 4166], 'proteins': [23, 165, 2636], 'that': [24, 48, 103, 120, 166, 190, 245, 262, 773, 865, 883, 910, 1166, 1174, 1208, 1231, 1282, 1364, 1400, 1423, 1475, 2128, 2623, 2687, 2804, 2888, 2900, 3011, 3084, 3126, 3141, 3542, 3664, 3682, 3712, 3772, 3806, 4064, 4117, 4140, 4163, 4211, 4261, 4318, 4335], 'regulate': [25, 167], 'activity.': [29, 171], 'Recent': [30, 172, 907, 4332], 'development': [31, 173, 409, 1275, 4425, 4471], 'of': [32, 43, 73, 86, 95, 117, 127, 137, 174, 185, 215, 228, 237, 259, 269, 279, 292, 320, 334, 339, 351, 372, 377, 393, 400, 410, 574, 649, 731, 793, 893, 1123, 1136, 1155, 1163, 1276, 1289, 1306, 1335, 1430, 1457, 1482, 1701, 1716, 1812, 1979, 2005, 2055, 2088, 2151, 2194, 2307, 2330, 2379, 2420, 2473, 2527, 2594, 2633, 2719, 2734, 2790, 2799, 2849, 2903, 2994, 3093, 3137, 3148, 3170, 3183, 3190, 3194, 3210, 3217, 3256, 3291, 3298, 3332, 3406, 3425, 3441, 3474, 3506, 3557, 3679, 3714, 3739, 3742, 3747, 3762, 3790, 3813, 3846, 3856, 3878, 3923, 3952, 3958, 3978, 4018, 4028, 4067, 4081, 4087, 4206, 4296, 4309, 4344, 4348, 4387, 4394, 4409, 4420, 4466, 4479], 'the': [33, 58, 175, 200, 311, 337, 408, 572, 918, 1167, 1240, 1273, 1295, 1332, 1365, 1580, 1623, 1692, 1702, 1803, 1927, 1935, 1947, 1998, 2014, 2026, 2053, 2221, 2592, 2626, 2643, 2675, 2688, 2698, 2709, 2717, 2813, 2828, 2886, 3091, 3123, 3135, 3181, 3198, 3215, 3254, 3296, 3472, 3677, 3704, 3740, 3748, 3881, 3921, 3926, 3991, 4090, 4126, 4145, 4164, 4190, 4217, 4279, 4328, 4346, 4363, 4385, 4407], 'inhibitor': [35, 177, 1481], 'Nutlin': [36, 65, 74, 87, 178, 207, 216, 229, 1292, 1412, 1424, 1447, 1985, 2041, 2129, 2165, 2188, 2206, 2286, 2293, 2313, 2347, 2369, 2387, 2430, 2446, 2518, 2541, 2580, 2595, 2720, 2735, 2740, 2782, 2842, 3000, 3012, 3067, 3073, 3089, 3104, 3149, 3160, 3195, 3218, 3257, 3292, 3310, 3338, 3360, 3379, 3402, 3510, 3536, 3546, 3558, 3658, 3692, 3730, 3794, 3823, 3827, 3837, 4045, 4316, 4388, 4410], '3': [37, 179, 1293, 1425, 1448, 2042, 2063], 'has': [38, 180, 775, 787, 1225, 3563], 'greatly': [39, 181], 'facilitated': [40, 182], 'functional': [41, 183, 1333], 'analysis': [42, 184, 2866], 'MDM2-p53': [44, 186, 1336, 1346, 2077, 2131, 2389, 2448], 'binding.': [45, 187, 1347, 2078, 2455], 'We': [46, 188], 'found': [47, 189, 789, 1422, 2803], 'although': [49, 191, 3599, 4336], 'is': [51, 78, 105, 193, 220, 247, 285, 300, 316, 360, 387, 432, 1370, 1426, 1449, 1477, 2214, 2277, 2360, 2402, 2725, 2793, 3121, 3222, 3311, 3391, 3547, 3605, 3734, 4072, 4101, 4199, 4321, 4338, 4350, 4426, 4435, 4475], 'homologous': [52, 194], 'to': [53, 57, 75, 133, 195, 199, 217, 275, 307, 341, 363, 375, 382, 440, 517, 576, 645, 869, 904, 1128, 1214, 1228, 1297, 1344, 1372, 1417, 1435, 1462, 1491, 1547, 1622, 1820, 1945, 2057, 2061, 2066, 2071, 2175, 2205, 2210, 2216, 2237, 2283, 2349, 2362, 2384, 2410, 2482, 2629, 2650, 2665, 2673, 2697, 2721, 2730, 2736, 2788, 2795, 2797, 3061, 3150, 3174, 3219, 3258, 3294, 3437, 3448, 3458, 3555, 3559, 3566, 3570, 3673, 3685, 3702, 3721, 3752, 3824, 3917, 4046, 4074, 4103, 4158, 4192, 4202, 4277, 4389, 4402], 'binds': [56, 198, 516], 'same': [59, 201, 2699, 2710], 'region': [60, 202, 920, 4148], 'on': [61, 203, 1180, 1341, 1368, 1907, 2395, 2714, 2980, 2986, 2996, 3477, 3602, 3654, 3815, 4168, 4216], 'N': [63, 205], 'terminus,': [64, 206], 'does': [66, 208, 501, 509, 2080, 2451, 2503, 3013, 3161, 3828], 'not': [67, 209, 502, 510, 2081, 2160, 2452, 2504, 2817, 2871, 2880, 2990, 3014, 3107, 3122, 3162, 3307, 3727, 3829, 3915, 4322], 'disrupt': [68, 210], 'p53-MDMX': [69, 211], 'interaction.': [70, 212, 2397], 'ability': [72, 214, 338, 573, 903, 1296, 1343, 2718, 3173, 3216, 3255], 'activate': [76, 218, 884, 1221, 1298, 1463, 2072, 3175, 3220, 4076], 'compromised': [79, 221, 1450], 'cells': [82, 224, 1452, 1467, 1486, 1960, 1981, 2012, 2303, 2426, 2510, 2574, 2762, 3069, 3302, 3316, 3373, 3395, 3483, 3519, 3688, 3718, 3871, 3940, 4000, 4083], 'overexpressing': [83, 225, 1453, 2532, 3317], 'MDMX.': [84, 226, 1406, 1419, 1454, 2479, 2656, 2800, 3211, 4088, 4136, 4391], 'Combination': [85, 227], 'with': [88, 230, 436, 800, 1159, 1176, 1237, 1287, 1560, 1573, 1584, 1609, 1629, 1640, 1658, 1672, 1709, 1713, 1753, 1893, 1934, 1941, 1963, 1984, 2013, 2020, 2025, 2031, 2037, 2192, 2288, 2312, 2324, 2332, 2429, 2461, 2465, 2470, 2511, 2517, 2538, 2547, 2558, 2564, 2577, 2618, 2637, 2670, 2708, 2764, 2841, 3007, 3072, 3076, 3088, 3202, 3229, 3304, 3337, 3359, 3376, 3401, 3489, 3568, 3608, 3691, 3822, 3838, 3853, 3865, 3908, 3936, 3941, 4005, 4013, 4044, 4178, 4269, 4362], 'siRNA': [90, 232, 1967, 1971, 3840, 4009], 'resulted': [91, 233, 1271, 3502], 'synergistic': [93, 235], 'activation': [94, 112, 136, 236, 254, 278, 1445, 2789, 3247, 3323, 3346, 3413, 3479, 3544, 3669, 3845, 4100], 'growth': [98, 240, 1312, 1470, 3276, 3297, 3964, 4050], 'arrest.': [99, 241, 1471], 'These': [100, 242, 1472, 2882, 3132, 3539, 3803, 3912, 4061, 4160, 4258], 'results': [101, 243, 1473, 2685, 2883, 3082, 3236, 3540, 3710, 3804, 3841, 3992, 4062, 4259, 4483], 'suggest': [102, 244, 1474, 3134, 3805, 4162, 4260], 'also': [106, 248, 380, 643, 913, 1117, 1404, 1478, 2126, 2166, 3273, 3649, 3666, 4002, 4134, 4200], 'valid': [108, 250], 'target': [109, 251, 406, 2067, 2138, 4133], 'for': [110, 125, 252, 267, 407, 729, 1217, 1428, 1568, 1594, 1633, 1650, 1663, 1743, 1795, 1831, 1834, 1837, 1986, 2235, 2248, 2408, 2431, 2436, 2519, 2524, 2542, 2550, 2581, 2588, 2598, 2625, 2648, 2893, 3339, 3344, 3361, 3380, 3408, 3933, 4306, 4324, 4340, 4384], 'cells.': [115, 141, 257, 283, 3433], 'Development': [116, 258], 'novel': [118, 260, 411], 'compounds': [119, 261, 1610], 'MDMX-specific': [122, 264, 1493], 'or': [123, 265, 796, 2184, 2314, 2326, 2434, 2545, 2760, 3166, 3300, 3445, 3451, 3647, 4096, 4272, 4294, 4378], 'optimized': [124, 266, 2234, 2407], 'dual-inhibition': [126, 268], 'necessary': [132, 274, 4339], 'achieve': [134, 276, 4278], 'full': [135, 277], 'transcription': [287, 2861, 2891], 'factor': [288, 390, 3125], 'mutated': [289], '∼50%': [291], 'human': [293, 352, 1529, 1535, 1908, 4469], 'tumors.': [294], 'In': [295, 348, 366, 3283, 3642, 3756, 4287], 'unstressed': [296], 'normal': [297, 3891], 'cells,': [298, 3786], 'present': [301], 'at': [302, 917, 1239, 1303, 1316, 1636, 1681, 1746, 1798, 2149, 2207, 2278, 2912, 3354], 'very': [303, 3207, 4174], 'low': [304, 3208, 3355, 3950], 'levels': [305, 1410, 2306, 2526, 3209, 3232, 3331, 3889, 3957, 4086], 'due': [306, 362, 374, 2729, 2787, 3554], 'rapid': [308, 2894], 'degradation': [309, 648, 1077, 1120, 1438, 2798, 2895, 2902, 3063, 3100, 3128, 3144, 3169, 3573, 4326, 4343, 4349], 'through': [310, 519, 1121, 4282], 'ubiquitin-dependent': [312], 'proteasome': [313], 'pathway.': [314], 'an': [317, 404, 726, 1160, 1171, 1479, 2170, 2376, 2820, 3866, 3895, 4477, 4489], 'important': [318, 727, 1480], 'regulator': [319, 2016], 'turnover': [322], 'by': [323, 879, 888, 895, 921, 1078, 1446, 1545, 1654, 1670, 1679, 1757, 1766, 1816, 1915, 2009, 2023, 2075, 2285, 2336, 2364, 2441, 2556, 2561, 2585, 2739, 2755, 2853, 2867, 2896, 2905, 3064, 3129, 3145, 3158, 3180, 3224, 3265, 3324, 3347, 3369, 3385, 3417, 3428, 3455, 3480, 3520, 3535, 3545, 3549, 3657, 3670, 3695, 3729, 3776, 3793, 3798, 3810, 3862, 3905, 3949, 3987, 4011, 4106, 4315, 4492, 4506], 'binding': [324, 1012, 1127, 1219, 1236, 1286, 1432, 1546, 2132, 2177, 2191, 2236, 2297, 2352, 2359, 2383, 2390, 2409, 2649, 2680, 2696, 2724, 2732, 3165, 4157, 4281], 'acting': [327], 'as': [328, 2662, 4131, 4196, 4411, 4500, 4502], 'ubiquitin': [330], 'E3': [331, 505], 'ligase.': [332], 'Overexpression': [333, 3977], 'abrogates': [336], 'induce': [342, 1436, 2505, 3015, 3259, 4047], 'cell': [343, 798, 1301, 1442, 1522, 1867, 1949, 2142, 2320, 2807, 3200, 3227, 3260, 3271, 3327, 3351, 3365, 3781, 3851, 3892, 3897, 3924, 3929, 4093, 4329], 'cycle': [344, 2143, 3261, 4094], 'arrest': [345, 2144, 3262, 3277, 3965, 4095], 'apoptosis.': [347], 'about': [349], '30%': [350], 'osteogenic': [353], 'sarcomas': [354], 'soft': [356], 'tissue': [357, 4434], 'sarcomas,': [358], 'overexpressed': [361], 'gene': [364, 2139], 'amplification.': [365], 'tumors': [367, 795], 'without': [368, 2513, 3983], 'amplification,': [370], 'hyperactivation': [371], 'silencing': [376], 'ARF': [378, 1124, 1126, 4358], 'expression': [379, 1914, 2004, 2034, 2140, 2525, 2786, 3508, 4022], 'leads': [381], 'inactivation.': [384], 'Therefore,': [385, 2275, 2346, 2703, 3118, 3309, 3783], 'tolerance': [392], 'wild': [394], 'type': [395], 'nearly': [398], '50%': [399], 'tumors,': [401], 'making': [402], 'it': [403, 3665], 'attractive': [405], 'anti-tumor': [412], 'agents': [413], '(1Bond': [414], 'G.L.': [415], 'Hu': [416], 'W.': [417, 463, 754], 'Levine': [418, 1192], 'A.J.': [419, 469, 854, 1193, 1385, 2261], 'Curr.': [420], 'Cancer': [421, 857, 4233], 'Drug': [422], 'Targets.': [423], '2005;': [424, 490, 953, 1000, 1024, 1063, 2946, 2966, 4235], '5:': [425], '3-8Crossref': [426], 'PubMed': [427, 477, 493, 541, 565, 601, 635, 661, 689, 718, 766, 838, 956, 981, 1003, 1027, 1066, 1093, 1110, 1148, 1200, 1326, 1394, 2119, 2270, 2777, 2949, 2969, 3047, 3594, 3637, 4238, 4459], 'Scopus': [428, 478, 494, 542, 566, 602, 636, 662, 690, 719, 767, 839, 957, 982, 1004, 1028, 1067, 1094, 1111, 1149, 1201, 1327, 1395, 2120, 2271, 2778, 2950, 2970, 3048, 3595, 3638, 4239, 4460], '(270)': [429], 'Google': [430, 480, 496, 544, 568, 604, 638, 664, 692, 721, 769, 841, 862, 959, 984, 1006, 1030, 1069, 1096, 1113, 1151, 1203, 1266, 1329, 1397, 2122, 2273, 2780, 2952, 2972, 3050, 3597, 3640, 4241, 4462], 'Scholar).MDMX': [431], 'protein': [435, 2877], 'significant': [437, 2874, 2992, 3168, 3504, 3876, 3918, 4053], 'sequence': [438, 1922], 'homology': [439], '(2Shvarts': [442], 'A.': [443, 533, 584, 586, 597, 750, 823, 952, 1043, 1045, 1249, 1377, 2253, 2945, 3577, 3579, 3590, 3633, 4455], 'Steegenga': [444], 'W.T.': [445], 'Riteco': [446], 'N.': [447], 'van': [448, 455, 458, 461, 466, 851, 1382, 2258], 'Laar': [449], 'T.': [450, 2091, 3019], 'Dekker': [451], 'P.': [452, 696, 817, 821, 929, 1255, 2922, 3613], 'Bazuine': [453], 'M.': [454, 535, 590, 812, 933, 935, 1039, 2926, 2928, 3583, 3620, 4246, 4251], 'Ham': [456], 'R.C.': [457], 'der': [459, 467, 852, 1383, 2259], 'Houven': [460], 'Oordt': [462], 'Hateboer': [464], 'G.': [465, 621, 760, 3622, 4446, 4448], 'Eb': [468, 853, 1384, 2260], 'Jochemsen': [470, 484, 616, 705, 757, 828, 855, 942, 1056, 1386, 2262, 2935], 'A.G.': [471, 485, 617, 706, 758, 829, 856, 943, 1057, 1387, 2263, 2936], 'EMBO': [472, 976, 998, 1088, 2964], 'J.': [473, 554, 607, 619, 624, 654, 673, 678, 707, 748, 848, 977, 997, 999, 1020, 1087, 1089, 1103, 1141, 1191, 2108, 2770, 2963, 2965, 3036, 4231, 4254], '1996;': [474, 1197, 1263], '15:': [475], '5349-5357Crossref': [476], '(510)': [479], 'Scholar,': [481, 545, 605, 665, 693, 842, 1031, 1097, 2953], '3Marine': [482], 'J.C.': [483, 831, 1051, 3626], 'Biochem.': [486], 'Biophys.': [487], 'Res.': [488, 858], 'Commun.': [489], '331:': [491], '750-760Crossref': [492], '(154)': [495], 'Scholar).': [497, 639, 770, 1007, 1114, 1204, 1267, 2123, 2274, 2781, 2973, 3051, 3641, 4242, 4463], 'Unlike': [498], 'MDM2,': [499], 'have': [503, 2620, 4121, 4149, 4186, 4367], 'intrinsic': [504], 'ligase': [506], 'activity': [507], 'promote': [511, 3571], 'degradation.': [513, 2507, 3674, 4374], 'However,': [514, 2716, 2801, 3098, 4089, 4182, 4429], 'C-terminal': [520, 919], 'RING': [521], 'domain': [522, 2645], 'interaction': [523, 641, 2201, 4361], '(4Tanimura': [524], 'S.': [525, 527, 588, 596, 819, 937, 951, 1041, 1185, 2930, 2944, 3581, 3589, 3611, 3615, 3618, 3632, 4227, 4250, 4439, 4454], 'Ohtsuka': [526], 'Mitsui': [528], 'K.': [529, 531, 825, 1033, 1035], 'Shirouzu': [530], 'Yoshimura': [532], 'Ohtsubo': [534], 'FEBS': [536], 'Lett.': [537], '1999;': [538, 557, 1391, 2267], '447:': [539], '5-9Crossref': [540], '(266)': [543], '5Sharp': [546], 'D.A.': [547], 'Kratowicz': [548], 'S.A.': [549], 'Sank': [550], 'M.J.': [551], 'George': [552], 'D.L.': [553], 'Biol.': [555, 625, 657, 679, 708, 834, 1023, 1062, 1106, 1144, 2109, 2773, 3037], 'Chem.': [556, 626, 680, 709, 2110, 3038], '274:': [558, 1198], '38189-38196Abstract': [559], 'Full': [560, 562, 630, 632, 684, 686, 713, 715, 2114, 2116, 3042, 3044], 'Text': [561, 563, 631, 633, 685, 687, 714, 716, 2115, 2117, 3043, 3045], 'PDF': [564, 634, 688, 717, 2118, 3046], '(234)': [567], 'Scholar)': [569, 1070], 'stimulates': [571, 1010], 'ubiquitinate': [577, 905], 'degrade': [579, 1418, 4403], '(6Linares': [581, 3574], 'L.K.': [582, 3575], 'Hengstermann': [583, 3576], 'Ciechanover': [585, 3578], 'Muller': [587, 3580], 'Scheffner': [589, 3582], 'Proc.': [591, 946, 2939, 3584, 3627, 4449], 'Natl.': [592, 947, 2940, 3585, 3628, 4450], 'Acad.': [593, 948, 2941, 3586, 3629, 4451], 'Sci.': [594, 949, 2942, 3587, 3630, 4452], 'U.': [595, 950, 2943, 3588, 3631, 4453], '2003;': [598, 658, 681, 710, 1145, 2774, 3591], '100:': [599, 3592], '12009-12014Crossref': [600, 3593], '(277)': [603, 3596], '7Gu': [606], 'Kawai': [608], 'H.': [609, 613, 667, 671, 975, 2095, 3023, 4223], 'Nie': [610], 'L.': [611, 989, 1014, 1083, 1101, 2955, 4221], 'Kitao': [612, 670], 'Wiederschain': [614, 668], 'D.': [615, 669, 804, 808, 810, 926, 1047, 2097, 2919, 3025, 4245], 'Parant': [618], 'Lozano': [620, 759, 4447], 'Yuan': [622, 676], 'Z.M.': [623, 677], '2002;': [627, 1107], '277:': [628], '19251-19254Abstract': [629], '(208)': [637], 'MDMX-MDM2': [640], 'can': [642, 1232, 1283, 2294, 2749, 3873], 'lead': [644, 2796, 3916], 'ubiquitination': [646, 1135, 4341], '(8Pan': [651, 1138, 2767], 'Y.': [652, 924, 945, 963, 969, 973, 993, 1018, 1037, 1055, 1059, 1139, 2768, 2917, 2938, 2959], 'Chen': [653, 996, 1019, 1082, 1086, 1100, 1102, 1140, 2769, 2962, 4230], 'Mol.': [655, 832, 1021, 1060, 1104, 1142, 2771, 4232], 'Cell.': [656, 833, 1022, 1061, 1105, 1143, 2772], '23:': [659, 1146, 2775], '5113-5121Crossref': [660, 1147, 2776], '(195)': [663, 1150, 2779], '9Kawai': [666], 'Stuart': [672], 'Tsai': [674], 'K.K.': [675], '278:': [682, 711], '45946-45953Abstract': [683], '(141)': [691], '10de': [694], 'Graaf': [695, 816, 928, 2921], 'Little': [697, 751], 'N.A.': [698, 752], 'Ramos': [699, 1380, 2256], 'Y.F.': [700, 844, 1381, 2257], 'Meulmeester': [701, 805, 930, 2923], 'E.': [702, 806, 931, 1717, 2924, 3624], 'Letteboer': [703], 'S.J.': [704], '38315-38324Abstract': [712], '(121)': [720], 'Scholar);': [722], 'this': [723, 1903, 3724, 3780, 4486], 'may': [724, 867, 1211, 1414, 3177, 4381], 'be': [725, 1212, 1415, 2750, 3178, 4104, 4382, 4398], 'mechanism': [728], 'elimination': [730], 'during': [733, 782, 872, 3754, 4422], 'DNA': [734, 886, 911, 2083, 2908, 3016], 'damage': [735, 887, 912, 2909, 3017], 'response.': [736], 'knock-out': [738], 'mice': [739], 'die': [740], 'utero': [742], 'despite': [743, 2819], 'having': [744], 'endogenous': [745, 2308, 3333, 3429, 3525, 3901], '(11Parant': [747], 'Chavez-Reyes': [749], 'Yan': [753], 'Reinke': [755], 'V.': [756, 1187, 1247, 1375, 2251], 'Nat.': [761], 'Genet.': [762], '2001;': [763, 859], '29:': [764], '92-95Crossref': [765], '(406)': [768], 'This': [771, 1205, 3004, 3733], 'suggests': [772, 1207, 4317], 'unique': [777], 'regulating': [780], 'embryonic': [783, 4424], 'development.': [784], 'overexpression': [786, 3320, 3476, 3516, 3646, 3896], 'been': [788, 1226, 3564, 4369], 'number': [792], 'primary': [794], 'lines': [799, 1868, 2808, 3228, 3272, 3328, 3352, 3930, 4330], 'wild-type': [801], '(12Danovi': [803], 'Pasini': [807], 'Migliorini': [809, 1046], 'Capra': [811], 'Frenk': [813], 'R.': [814, 846], 'de': [815, 927, 2920], 'Francoz': [818], 'Gasparini': [820], 'Gobbi': [822], 'Helin': [824], 'Pelicci': [826], 'P.G.': [827], 'Marine': [830, 1050, 3625], '2004;': [835, 1323, 2111, 3039], '24:': [836, 1001, 2967], '5835-5843Crossref': [837], '(262)': [840], '13Ramos': [843], 'Stad': [845], 'Attema': [847], 'Peltenburg': [849], 'L.T.': [850, 1320, 2107, 3035], '61:': [860], '1839-1842PubMed': [861], 'Scholar),': [863, 960, 985, 1330, 1398, 3598], 'suggesting': [864, 1399, 3663, 3771], 'contribute': [868], 'inactivation': [871], 'tumorigenesis.MDM2': [873], 'targeted': [878], 'stress': [880, 1116, 2085], 'signaling': [881], 'pathways': [882, 4380], 'p53.': [885, 906, 1222, 2715, 3191, 3708, 3847, 4159], 'ionizing': [889, 2765], 'irradiation': [890, 2587, 2766, 3058, 3086, 3102, 3111], 'induces': [891, 914, 1118, 1469, 2136, 2784], 'phosphorylation': [892, 916, 1009, 2087, 2911, 2995, 3056, 3120], 'ATM': [896, 922, 2984], 'c-Abl': [898], 'kinases': [899], 'inhibits': [901, 2130, 4135], 'its': [902, 1342, 2217, 3172, 3600, 3816, 4430], 'studies': [908, 2898, 3193, 4333], 'showed': [909, 1165, 1294, 1351, 2686, 2856, 2899, 3083, 3274, 3541, 3650, 3711, 4334], '(14Pereg': [923, 2916], 'Shkedy': [925, 2918], 'Edelson-Averbukh': [932, 2925], 'Salek': [934, 2927], 'Biton': [936, 2929], 'Teunisse': [938, 1044, 2931], 'A.F.': [939, 2932], 'Lehmann': [940, 2933], 'W.D.': [941, 2934], 'Shiloh': [944, 1054, 2937], '102:': [954, 2947], '5056-5061Crossref': [955, 2948], '(143)': [958, 2951], 'Chk1': [961], '(15Jin': [962], 'Dai': [964], 'M.S.': [965], 'Lu': [966, 974], 'S.Z.': [967], 'Xu': [968, 2100, 3028], 'Luo': [970], 'Z.': [971], 'Zhao': [972], '2006;': [978, 1090, 3634, 4456], '25:': [979, 1025, 1064, 1091], '1207-1218Crossref': [980], '(94)': [983, 1095], 'Chk2': [987, 2978], '(16Chen': [988], 'Gilkes': [990, 1084, 2956], 'D.M.': [991, 1085, 2957], 'Pan': [992, 1017, 2958], 'Lane': [994, 1260, 1388, 2264, 2960], 'W.S.': [995, 2961], '3411-3422Crossref': [1002, 2968], '(196)': [1005, 2971], '14-3-3': [1011, 4356], '(17Chen': [1013], 'Li': [1015], 'C.': [1016, 1053, 1081, 1099, 1257, 1379, 2093, 2255, 3021], '6509-6520Crossref': [1026], '(67)': [1029, 1112], '18Okamoto': [1032], 'Kashima': [1034], 'Pereg': [1036], 'Ishida': [1038], 'Yamazaki': [1040], 'Nota': [1042], 'Kitabayashi': [1048], 'I.': [1049], 'Prives': [1052], 'Taya': [1058], '9608-9620Crossref': [1065], '(104)': [1068], 'promotes': [1072, 1134], 'nuclear': [1074], 'translocation': [1075], '(19Lebron': [1080], '1196-1206Crossref': [1092], '20Li': [1098], '22:': [1108], '7562-7571Crossref': [1109], 'Mitogenic': [1115], 'induction': [1122, 3092, 3250, 3534, 3960, 3982, 4017, 4032, 4314], 'expression.': [1125, 3097], 'selectively': [1130], 'blocks': [1131, 2447], 'p53-ubiquitination': [1132], 'but': [1133, 2059, 2391, 2450, 3205], 'Scholar).The': [1152], 'crystal': [1153], 'structure': [1154, 4293], 'complex': [1158, 4352], 'N-terminal': [1161, 2463, 4147], 'peptide': [1162, 1169, 1361, 2233, 2400, 2406, 2414, 4180], 'forms': [1170], 'amphipathic': [1172], 'α-helix': [1173], 'interacts': [1175], 'hydrophobic': [1178, 2422], 'pocket': [1179], '(21Kussie': [1182], 'P.H.': [1183], 'Gorina': [1184], 'Marechal': [1186], 'Elenbaas': [1188], 'B.': [1189, 4225, 4248], 'Moreau': [1190], 'Pavletich': [1194], 'N.P.': [1195], 'Science.': [1196], '948-953Crossref': [1199], '(1758)': [1202], 'model': [1206], 'small': [1209, 1513, 3883, 4193, 4207, 4262, 4284], 'molecules': [1210, 4194], 'able': [1213], 'specifically': [1215, 2074], 'compete': [1216], 'Phage': [1223], 'display': [1224, 4115], 'used': [1227, 1499, 1901, 1951, 2174, 3197], 'identify': [1229], 'peptides': [1230, 2372, 4111, 4127], 'inhibit': [1233, 1284, 1310, 1345, 1912, 1957, 2295, 2350, 3163, 3295, 3560, 3830], 'IC50': [1238, 1288, 2193], '100': [1241], 'nm': [1242, 1965, 2196], 'level': [1243, 2600, 2815, 2824, 2835, 2852, 3182, 3243, 3497, 3944, 4320], 'vitro': [1245, 1695, 2134, 2354, 2475, 2652], '(22Bottger': [1246], 'Bottger': [1248, 1376, 2252], 'Howard': [1250], 'S.F.': [1251], 'Picksley': [1252], 'S.M.': [1253], 'Chene': [1254], 'Garcia-Echeverria': [1256, 1378, 2254], 'Hochkeppel': [1258], 'H.K.': [1259], 'D.P.': [1261, 1389, 2265], 'Oncogene.': [1262, 1390, 2266], '13:': [1264], '2141-2147PubMed': [1265], 'High': [1268], 'throughput': [1269], 'screening': [1270], 'recent': [1274, 3009], 'Nutlins,': [1277], 'which': [1278, 2213, 2567, 2792], 'cis-imidazoline': [1280], 'analogs': [1281], 'p53-MDM2': [1285, 2190], '100–300': [1290], 'nm.': [1291], 'culture': [1302], 'concentration': [1305], '5–10': [1307], 'μm': [1308, 2153, 2540, 2579, 3378], 'when': [1313, 4176], 'given': [1314], 'orally': [1315], '200': [1317, 1964], 'mg/kg': [1318], '(23Vassilev': [1319], 'Cell': [1321, 1808], 'Cycle.': [1322], '3:': [1324], '419-421Crossref': [1325], '(7)': [1328], 'confirming': [1331], 'importance': [1334], 'interaction.Nutlin': [1337], 'was': [1338, 1814, 1852, 1924, 1995, 2007, 2035, 2043, 2064, 2173, 2202, 2317, 2334, 2341, 2486, 2554, 2836, 3005, 3059, 3106, 3263, 3683, 3719, 3726, 3764, 3795, 3860, 3903, 3945, 4033, 4057], 'identified': [1339], 'based': [1340, 1906, 4215], '∼80%': [1352], 'similarity': [1353], 'their': [1355, 4270], 'domains.': [1357], 'Previous': [1358, 3192], 'study': [1359, 1904, 4109, 4491], 'using': [1360, 1691, 1854, 1973, 1997, 3443, 3766, 3993, 4110, 4129], 'inhibitors': [1362, 1402, 4210, 4264], 'suggested': [1363, 3237, 4063], 'site': [1367, 2979, 2985], 'similar': [1371, 4122, 4175], '(24Bottger': [1374, 2250], '18:': [1392, 2268], '189-199Crossref': [1393, 2269], '(149)': [1396, 2272], 'should': [1403], 'cross-inhibit': [1405], 'Alternatively,': [1407], 'elevated': [1408], 'following': [1411, 1826, 2999, 3057, 3101], 'treatment': [1413, 2783, 2840, 3001, 3105, 3511, 4012, 4473], 'sufficient': [1416, 3060], 'Surprisingly,': [1420, 2199], 'we': [1421, 2802, 3833, 4138], 'inactive': [1427], 'inhibition': [1429, 2284], 'MDMX-p53': [1431, 2168, 2200, 2296, 2339, 2351, 2396, 2454, 3164, 3561, 3831], 'failed': [1434, 2348, 3293], 'several': [1440, 2806], 'lines.': [1443], 'Simultaneous': [1455], 'targeting': [1456, 4066], 'cooperates': [1461], 'indicate': [1488], 'need': [1490], 'develop': [1492], 'inhibitors.MATERIALS': [1494], 'AND': [1495], 'METHODSELISA': [1496], '2The': [1497], 'abbreviations': [1498], 'are:': [1500], 'ELISA,': [1501], 'enzyme-linked': [1502], 'immunosorbent': [1503], 'assay;': [1504], 'GST,': [1505], 'glutathione': [1506, 2457, 2666], 'S-transferase;': [1507], 'shRNA,': [1508, 3996], 'short': [1509], 'hairpin': [1510], 'RNA;': [1511], 'siRNA,': [1512], 'interfering;': [1514], 'IP,': [1515], 'immunoprecipitation;': [1516], 'MTT,': [1517], '3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium': [1518], 'bromide;': [1519], 'FACS,': [1520], 'fluorescence-activated': [1521], 'sorter.': [1523], 'Assay—GST-MDM2': [1524], 'GST-MDMX': [1526, 2382], 'containing': [1527], 'full-length': [1528], 'His6-tagged': [1534], 'were': [1537, 1558, 1582, 1598, 1607, 1627, 1668, 1689, 1705, 1751, 1764, 1770, 1806, 1828, 1886, 1905, 1932, 1961, 1982, 2310, 2373, 2427, 2459, 2515, 2536, 2575, 2646, 2660, 3070, 3233, 3335, 3357, 3367, 3374, 3399, 3415, 3435, 3487, 3689, 3931, 4001, 4023], 'expressed': [1538], 'Escherichia': [1540], 'coli': [1541, 1718], 'affinity': [1543, 2481, 2733, 4305], 'purified': [1544], 'glutathione-agarose': [1548, 1710], 'Ni2+-nitrilotriacetic': [1550], 'acid': [1551, 2712], 'beads': [1552, 1711, 1750, 2458, 2668], 'under': [1553, 2678, 4351], 'non-denaturing': [1554], 'conditions.': [1555, 2683], 'ELISA': [1556, 2171, 2222, 2377], 'plates': [1557, 1581, 1626, 1667], 'incubated': [1559, 1639, 1708, 2469], '2.5': [1561], 'μg/ml': [1562, 1943, 2039], 'His6-p53': [1563, 2180], 'phosphate-buffered': [1565], 'saline': [1566], '(PBS)': [1567], '16': [1569, 1987], 'h.': [1570, 1596, 1665, 2552], 'After': [1571, 1976], 'washing': [1572, 1655, 2682], 'PBS': [1574, 1585], '+': [1575, 1586, 1613, 1616], '0.1%': [1576], 'Tween': [1577, 1591], '20': [1578, 1592], '(PBST),': [1579], 'blocked': [1583, 2335, 2388, 3532], '5%': [1587], 'nonfat': [1588], 'dry': [1589], 'milk+0.1%': [1590], '(PBSMT)': [1593], '0.5': [1595], 'Compounds': [1597], 'dissolved': [1599], 'Me2SO.': [1601], 'GST-HDM2': [1602], '(5': [1605], 'μg/ml)': [1606], 'mixed': [1608, 1706], 'PBSMT': [1612, 1649], '10%': [1614, 1894], 'glycerol': [1615], '10': [1617, 2548], 'mm': [1618, 1726, 1731, 1734, 1740, 1776, 1781, 1784, 1790], 'dithiothreitol': [1619], 'added': [1621], 'wells.': [1624], 'washed': [1628, 1752], 'PBST': [1630], 'after': [1631, 2488, 2839, 3066, 3188, 3509, 4025, 4098], 'incubating': [1632], '1': [1634, 1651, 1664, 1739, 1789], 'h': [1635, 1745, 1978, 1988, 2433, 2438, 2521, 2544, 2583, 2590, 3341, 3382, 3935], 'room': [1637], 'temperature,': [1638], 'antibody': [1642, 1646, 1662, 1840, 1846, 2975, 3768], '5B10': [1643], '8C6': [1647, 1833, 2559], 'h,': [1652, 3363, 3410], 'followed': [1653, 2022, 2560, 2584, 3454, 4010], 'incubation': [1657, 1671], 'horseradish': [1659, 1855], 'peroxidase-rabbit-anti-mouse': [1660], 'Ig': [1661], 'developed': [1669, 1853, 2065, 2232], 'TMB': [1673], 'peroxidase': [1674], 'substrate': [1675], '(KPL)': [1676], 'measured': [1678], 'absorbance': [1680], '450': [1682], 'nm.GST': [1683], 'Pulldown': [1684], 'Assay—[35S]Methionine-labeled': [1685], 'generated': [1690, 1996, 3861], 'TNT': [1693], 'transcription/translation': [1696], 'kit': [1697], '(Promega).': [1698], 'Five': [1699], 'microliters': [1700], 'translation': [1703], 'products': [1704], 'loaded': [1712, 2460, 2669], '∼10': [1714], 'μg': [1715, 1811], 'produced': [1719], 'GST-p53': [1720, 2462, 2634, 2671], 'mutants': [1721, 2672], 'lysis': [1723, 1754, 1773], 'buffer': [1724, 1774], '(50': [1725, 1775], 'Tris-HCl': [1727, 1777], '(pH': [1728, 1778], '8.0),': [1729, 1779], '5': [1730, 1780, 1796, 2578, 3377], 'EDTA,': [1732, 1782], '150': [1733, 1783], 'NaCl,': [1735, 1785], '0.5%': [1736, 1786], 'Nonidet': [1737, 1787], 'P-40,': [1738, 1788], 'phenylmethylsulfonyl': [1741, 1791], 'fluoride)': [1742, 1792], '2': [1744], '4': [1747, 2437, 2551, 2582, 2589, 3968], '°C.': [1748], 'buffer,': [1755], 'fractionated': [1756, 1815], 'SDS-PAGE,': [1758], 'bound': [1760, 3684, 3720], 'detected': [1765], 'auto': [1767], 'fluorography.Western': [1768], 'Blot—Cells': [1769], 'lysed': [1771], 'centrifuged': [1794], 'min': [1797], '10,000': [1799], '×': [1800], 'g,': [1801], 'insoluble': [1804], 'debris': [1805], 'discarded.': [1807], 'lysate': [1809], '(10–50': [1810], 'protein)': [1813], 'SDS-PAGE': [1817, 2490], 'transferred': [1819], 'Immobilon': [1821], 'P': [1822], 'filters': [1823], '(Millipore).': [1824], 'antibodies': [1827, 1858, 3447], 'used:': [1829], '3G9': [1830], 'MDM2;': [1832], 'MDMX;': [1835], 'DO-1': [1836], 'p53;': [1838], 'p21': [1839, 3094, 3507, 3533, 3888, 3959, 3981, 4019], '(Oncogene': [1841], 'Research': [1842], 'Products);': [1843], 'phospho-Ser-15': [1845], '(Cell': [1847], 'Signaling': [1848], 'Technology).': [1849], 'filter': [1851], 'peroxidase-conjugated': [1856], 'secondary': [1857], 'ECL-plus': [1860], 'reagent': [1861], '(Amersham': [1862], 'Biosciences).Cell': [1863], 'Lines': [1864], 'Reagents—Tumor': [1866], 'A549': [1869], '(lung),': [1870], 'U2OS': [1871, 2531, 3301, 3394, 3482, 3518, 3849, 3870, 3928], '(bone),': [1872], 'SJSA': [1873, 3199], '(bone,': [1874], 'amplification),': [1876], 'MCF-7': [1877], '(breast),': [1878], 'JEG3': [1879, 2300, 3299, 3432, 3500, 3529, 3687, 3717, 3999], '(placenta),': [1880], 'HCT116-p53+/+': [1882], 'HCT116-p53–/–': [1884], '(colon)': [1885], 'maintained': [1887], "Dulbecco's": [1889], 'modified': [1890, 3927], "Eagle's": [1891], 'medium': [1892], 'fetal': [1895], 'bovine': [1896], 'serum.': [1897], 'All': [1898], 'constructs': [1900], 'cDNA': [1909, 3910], 'clones.': [1910], 'To': [1911, 1955, 2162, 2290, 3052, 3212, 3675, 3989], 'RNA': [1916], 'interference,': [1917], 'double-stranded': [1918], 'oligonucleotide': [1919], '(5′GATCCCGTGATGATACCGATGTAGATTCAAGAGATCTACATCGGTATCATCACTTTTTTGGAAA,': [1920], 'underlined)': [1923], 'cloned': [1925], 'into': [1926, 3800], 'pSilencer': [1928], 'vector': [1929, 1992], '(OligoEngine).': [1930], 'Cells': [1931, 3434], 'transfected': [1933, 1962, 2534, 3303, 4004], 'shRNA': [1937, 3868], 'plasmid': [1938], 'selected': [1940], '0.5–1': [1942], 'puromycin': [1944], 'obtain': [1946], 'clonal': [1948, 3850], 'line': [1950, 3201, 3852, 3898], 'Fig.': [1953], '4a.': [1954], 'transiently': [1956, 4003], 'expression,': [1959, 4359], 'control': [1966, 2371, 2413, 3142], '(AATTCTCCGAACGTGTCACGT)': [1968], '(AGATTCAGCTGGTTATTAA)': [1972], 'Oligofectamine': [1974], '(Invitrogen).': [1975, 2002], '48': [1977, 3362], 'transfection,': [1980], 'treated': [1983, 2311, 2428, 2516, 2537, 2763, 3071, 3336, 3358, 3375, 3400, 3488, 3690, 3932], 'analyzed.': [1990], 'Lentivirus': [1991], 'expressing': [1993, 2304, 3329, 3396, 3484, 4084], 'ViraPower™': [1999], 'T-REx™': [2000], 'system': [2001], 'Tetracycline-inducible': [2003], 'achieved': [2008], 'first': [2010], 'infecting': [2011], 'T-REX': [2015], 'lentivirus': [2017, 2028], 'selection': [2019, 2030], 'Blasticidin,': [2021], 'infection': [2024], 'Zeocin.': [2032], 'induced': [2036, 2910], '0.1–1': [2038], 'tetracycline.': [2040], 'purchased': [2044], 'from': [2045, 2319, 4113], 'Cayman': [2046], 'Chemical': [2047], 'Company': [2048], '(Ann': [2049], 'Arbor,': [2050], 'MI).RESULTSNutlin': [2051], 'Inhibits': [2052], 'Binding': [2054, 2480], 'Not': [2060, 2742], 'MDMX—Nutlin': [2062], 'appears': [2070], 'disrupting': [2076, 4153], 'It': [2079], 'cause': [2082, 3167], 'damage-related': [2084], '(25Thompson': [2090, 3018], 'Tovar': [2092, 3020], 'Yang': [2094, 3022], 'Carvajal': [2096, 3024], 'Vu': [2098, 3026], 'B.T.': [2099, 3027], 'Q.': [2101, 3029], 'Wahl': [2102, 3030], 'G.M.': [2103, 3031], 'Heimbrook': [2104, 3032], 'D.C.': [2105, 3033], 'Vassilev': [2106, 3034], '279:': [2112, 3040], '53015-53022Abstract': [2113, 3041], '(204)': [2121, 3049], 'Our': [2124], 'experiments': [2125, 2759], 'confirmed': [2127], 'p53-dependent': [2147], 'fashion': [2148], 'concentrations': [2150, 2208, 3405, 3951], '2–10': [2152], '(Figs.': [2154, 3659], '1a': [2155], '2a': [2157], 'data': [2159], 'shown).': [2161, 2881, 3308], 'determine': [2163, 2612, 3213, 3676], 'whether': [2164, 2292, 2613, 3054, 3214, 3835], 'disrupts': [2167], 'interaction,': [2169], 'assay': [2172, 2223, 2378, 3971], 'detect': [2176, 2991, 3449, 3459], 'between': [2178, 3240, 4092], 'immobilized': [2179, 2385], 'free': [2182, 3460, 3705], 'GST-MDM2': [2183, 2380], 'GST-MDMX.': [2185], 'As': [2186, 2226], 'expected,': [2187], 'inhibited': [2189, 2240], '∼800': [2195], '(Fig.': [2197, 2224, 2344, 2701, 2825, 2843, 3002, 3113, 3251, 3278, 3512, 3537, 3731, 3769, 3972, 4036, 4059], '1a).': [2198], 'completely': [2203, 2342, 3531], 'resistant': [2204, 2361], 'up': [2209], '30': [2211], 'μm,': [2212], 'close': [2215], 'solubility': [2218], 'limit': [2219], '1b).': [2225], 'positive': [2228], 'control,': [2229], 'previously': [2231], '(12/1)': [2239], '(∼4-fold': [2245], 'less': [2246, 2281, 3312, 4034], 'efficient': [2247, 2901, 3109, 3844, 3963, 4049], 'MDMX)': [2249], 'least': [2279], '40-fold': [2280], 'sensitive': [2282], 'compared': [2287, 3607], 'MDM2.': [2289, 2411, 3131], 'test': [2291, 3053, 3471], 'vivo,': [2299], 'MCF7': [2302, 3997], 'high': [2305, 3241, 4085], 'MG132.': [2315], 'immunoprecipitated': [2318], 'lysates': [2321], 'probed': [2323], 'antibodies.': [2328], 'Coprecipitation': [2329], 'Nutlin,': [2337, 2630, 3481, 3937, 3953], 'whereas': [2338, 4030], 'co-IP': [2340, 2449], 'unaffected': [2343], '1c).': [2345], 'vivo.FIGURE': [2357], '1MDMX-p53': [2358], 'disruption': [2363], 'Nutlin.': [2365, 3325, 3490, 3988, 4014, 4197], 'b,': [2368, 2530, 3350], 'tested': [2374, 2647, 3834], 'His6-p53.': [2386], 'had': [2392], 'no': [2393, 2857, 4052], 'effect': [2394, 3473, 3601, 3653], '12/1': [2399], '(MPRFMDYWEGLN)': [2401], 'phage': [2404, 4114], 'display-selected': [2405], 'Mutant': [2412], '(MPRAMDYAEGAN)': [2415], 'contains': [2416], 'triple': [2417], 'alanine': [2418], 'mutations': [2419, 2467, 2639, 2691, 4143], 'residues': [2423, 2713, 2915, 2998], '(underlined).': [2424], 'c,': [2425, 3372], '8': [2432, 2520, 2539, 2543, 3340, 3381, 3409], 'MG132': [2435], 'analyzed': [2440, 2523, 2555, 2597, 3264, 3343, 3384, 3416, 3694], 'IP-MDMX/MDM2': [2443], 'Western': [2444, 2562, 3348, 3418, 3700], 'blot.': [2445, 3349, 3419], 'affect': [2453], 'd,': [2456, 2573, 3393], 'fusion': [2464, 2635], 'point': [2466, 2638, 4142], 'mixture': [2472, 2664], 'translated': [2476, 2653], 'determined': [2487, 3368, 4105], 'washing,': [2489], 'fractionation,': [2491], 'autofluorography.View': [2493], 'Large': [2494, 2604, 3462], 'Image': [2495, 2605, 3463], 'Figure': [2496, 2606, 3464], 'ViewerDownload': [2497, 2607, 3465], 'Hi-res': [2498, 2608, 3466], 'image': [2499, 2609, 3467], 'Download': [2500, 2610, 3468], '(PPT)FIGURE': [2501], '2Nutlin': [2502], 'a,': [2508, 3326], 'HCT116': [2509], 'indicated': [2528], 'markers.': [2529], 'stably': [2533], 'irradiated': [2546], 'Gy': [2549, 3078], 'immunoprecipitation': [2557], 'blot': [2563, 3701], 'PS342': [2565], 'antibody,': [2566], 'detects': [2568], 'Chk2-phosphorylated': [2569], 'Ser-342.': [2570], 'c': [2571, 2845, 3115, 4038], 'pretreated': [2576], 'γ': [2586, 3079, 3085], 'presence': [2593, 3136, 3290], 'activity.View': [2603], '(PPT)To': [2611, 3469], 'interactions': [2617], 'subtle': [2621], 'differences': [2622, 4188, 4291, 4303], 'account': [2624], 'different': [2627, 2689, 3230, 3330, 3404, 4141, 4204], 'sensitivities': [2628], 'panel': [2632], 'deletions': [2641], 'transactivation': [2644], 'presented': [2661], 'agarose': [2667], 'compare': [2674], 'capture': [2676], 'efficiency': [2677, 4347], 'identical': [2679, 4150], 'reduced': [2692, 3245, 3275, 3942], 'extent': [2700], '1d).': [2702], 'interact': [2707], 'amino': [2711], 'block': [2722, 2869], 'significantly': [2726], 'different,': [2727], 'presumably': [2728], 'lower': [2731], 'MDMX.MDM2': [2737], 'Induced': [2738], 'Does': [2741], 'Cause': [2743], 'Degradation': [2745], 'Tumor': [2747], 'Cells—MDMX': [2748], 'rapidly': [2751], 'ubiquitinated': [2752], 'degraded': [2754], 'cotransfection': [2758], 'p53,': [2791, 3453, 3744], 'expected': [2794, 3751], '(JEG3,': [2809], 'MCF7,': [2810], 'HCT116,': [2811], 'U2OS)': [2812], 'did': [2816, 2870, 2989, 3914], 'decrease': [2818], 'increase': [2821, 2832, 2858, 2993, 3494, 3884, 4054], '2).': [2826], 'On': [2827], 'contrary,': [2829], 'moderate': [2831, 3606, 3652], 'often': [2837, 3196], 'observed': [2838, 4024, 4058], '2,': [2844, 3114], 'd).': [2847, 3117, 4040], 'Analysis': [2848], 'mRNA': [2851], 'semi-quantitative': [2854], 'RT-PCR': [2855], 'level.': [2862], 'Furthermore,': [2863, 3514], 'half-life': [2865], 'cycloheximide': [2868], 'reveal': [2872], 'change': [2875], '(data': [2879, 3306], 'ruled': [2884], 'out': [2885], 'possibility': [2887], 'increased': [2889], 'compensated': [2892], 'MDM2.Recent': [2897], 'requires': [2907], 'multiple': [2913], 'serine': [2914], '16Chen': [2954], 'Phosphorylation-specific': [2974], '(S342)': [2982], '(S15)': [2988], 'these': [2997, 4377, 4395], '2b).': [3003], 'consistent': [3006], 'report': [3010], 'sensitize': [3062], 'treatment,': [3068], 'combination': [3075, 3812], '1–8': [3077], 'irradiation.': [3080], 'cooperated': [3087, 4043], 'more': [3108, 3843, 3946, 3962, 4048, 4266], 'than': [3110, 3499], 'alone': [3112], 'rate-limiting': [3124, 4323], 'prevents': [3127, 3321, 3667], 'Nutlin-induced': [3130], 'observations': [3133, 4161], 'additional': [3138, 4379], 'unidentified': [3139], 'mechanisms': [3140, 3671], 'MDM2.The': [3146], 'Ability': [3147], 'Activate': [3151, 3825], 'Inhibit': [3154], 'Proliferation': [3155], 'Is': [3156], 'Compromised': [3157], 'MDMX—Because': [3159], 'MDMX,': [3171, 3686, 3722, 4029, 4345], 'affected': [3179], 'MDMX/p53': [3186], 'ratio': [3187, 3725], 'stabilization': [3189, 3656, 3986], 'amplified': [3203], 'attenuated': [3223, 3548], 'overexpression,': [3226, 3551], 'compared.': [3234], 'correlation': [3239], 'p21WAF1': [3249], '3a).': [3252], 'When': [3253], 'MTT': [3266, 3370, 3970], 'FACS': [3268], 'assays,': [3269], 'MDMX-overexpressing': [3270, 3785], '3,': [3279], 'b': [3280], 'c).': [3282], '7-day': [3285], 'colony': [3286], 'formation': [3287], 'assay,': [3288], 'continuous': [3289], 'effective': [3313], 'MDMX.FIGURE': [3318], '3MDMX': [3319], 'plated': [3353], 'density': [3356], 'proliferation': [3366], 'assay.': [3371], 'FACS.': [3386], 'S': [3388], 'phase': [3389], 'population': [3390], 'shown.': [3392], 'tetracycline-inducible': [3397, 3485], 'tetracycline': [3407], 'markers': [3414], 'e': [3420], 'f,': [3422], 'quantitative': [3423], 'sequestration': [3424], 'Nutlin-stabilized': [3426], 'subjected': [3436], 'two': [3438], 'consecutive': [3439], 'rounds': [3440], 'IP': [3442, 3457], 'MDMX-bound': [3450, 3707, 3743], 'MDM2-bound': [3452], 'p53.View': [3461], 'further': [3470], 'A': [3491, 3848], 'physiologically': [3492], 'relevant': [3493], '(lower': [3498], 'cells)': [3501], 'reduction': [3505, 3877], '3d).': [3513], 'stable': [3521, 3854, 3863, 3906, 3994], 'transfection': [3522, 3864, 3907], '(∼30-fold': [3523, 3899], 'above': [3524, 3528, 3900], 'level,': [3526], '∼5-fold': [3527], 'level)': [3530, 3902], '4a).': [3538], 'most': [3552], 'likely': [3553, 3735], 'inability': [3556, 4386, 4401], 'binding.MDMX': [3562], 'shown': [3565], 'cooperate': [3567], '(26Francoz': [3610], 'Froment': [3612], 'Bogaerts': [3614], 'De': [3616], 'Clercq': [3617], 'Maetens': [3619], 'Doumont': [3621], 'Bellefroid': [3623], '103:': [3635, 4457], '3232-3237Crossref': [3636], '(193)': [3639], 'our': [3643], 'experiments,': [3644], 'knockdown': [3648, 3855, 4027, 4042], '3d': [3660], '4a),': [3662], 'unrelated': [3672], 'amount': [3678], 'stabilized': [3680, 3792], 'immunodepletion': [3697], 'quantitate': [3703], '∼30–50%': [3713], 'altered': [3728], '3e).': [3732], 'conservative': [3737], 'estimate': [3738], 'fraction': [3741, 3761, 3789], 'since': [3745, 4125, 4400], 'some': [3746], 'complexes': [3749], 'dissociate': [3753], 'washing.': [3755], 'contrast,': [3757], 'only': [3758], 'negligible': [3760], 'depleted': [3765], '3f),': [3770], 'mainly': [3774], 'acts': [3775], 'degrading': [3777], 'line.': [3782], 'large': [3788, 4302], 'stoichiometrically': [3796], 'sequestered': [3797], 'non-functional': [3801], 'complexes.': [3802], 'inactivates': [3808], 'effects': [3814, 4151], 'activity.MDMX': [3819], 'Knockdown': [3820], 'Cooperates': [3821], 'p53—Since': [3826], 'binding,': [3832, 4357], 'combining': [3836], '(∼80%': [3858], 'reduction)': [3859], 'plasmid.': [3869, 3911], 'apparently': [3872], 'tolerate': [3874], 'consequent': [3882], 'culture.': [3893], 'Additionally,': [3894], 'created': [3904], 'modifications': [3913], 'changes': [3919, 4276], 'rates': [3922], 'proliferation.When': [3925], '24': [3934], 'efficiently': [3947], 'activated': [3948], 'resulting': [3954], 'higher': [3956], 'day': [3969], '4,': [3973, 4037], 'b).': [3976], 'abrogated': [3980], 'blocking': [3984], 'confirm': [3990], 'synthetic': [4007], 'Significantly': [4015], 'stronger': [4016], 'Bax': [4021], 'transient': [4026], 'Apaf-1': [4031], 'predictable': [4035], 'arrest;': [4051], 'apoptosis': [4056, 4097], '4e).': [4060], 'simultaneous': [4065], 'needed': [4073], 'fully': [4075], 'subset': [4080], 'decision': [4091], 'unlikely': [4102], 'alone.DISCUSSIONPrevious': [4108], 'isolated': [4112, 4128], 'concluded': [4116], 'sites,': [4124], 'Here': [4137], 'show': [4139], 'overall': [4165], 'surface': [4167], 'indeed': [4173], 'interacting': [4177], 'long': [4179], 'sequences.': [4181], 'surprising': [4187], 'sensitivity': [4191], 'such': [4195, 4288], 'insensitive': [4201], 'class': [4205], 'molecule': [4208, 4263], 'α-helical': [4213], 'mimics': [4214], 'terphenyl': [4218], 'scaffold': [4219], '(27Chen': [4220], 'Yin': [4222], 'Farooqi': [4224], 'Sebti': [4226], 'Hamilton': [4228], 'A.D.': [4229, 4515], 'Ther.': [4234], '4:': [4236], '1019-1025Crossref': [4237], '(80)': [4240], '3B.': [4243], 'Hu,': [4244], 'Gilkes,': [4247], 'Farooqi,': [4249], 'Sebti,': [4252], 'Chen,': [4255], 'unpublished': [4256], 'observations.': [4257], 'require': [4265], 'precise': [4267], 'fit': [4268], 'targets': [4271], 'demand': [4273], 'certain': [4274], 'conformational': [4275], 'tight': [4280], 'contact': [4285], 'area.': [4286], 'cases,': [4289], 'minor': [4290], 'flexibility': [4295], 'result': [4300], 'Nutlin.The': [4307], 'lack': [4308], 'down-regulation': [4311], 'upon': [4312], 'tested.': [4331], 'control.': [4353], 'phosphorylation,': [4355], 'de-ubiquitinating': [4364], 'enzyme': [4365], 'HAUSP': [4366], 'all': [4368], 'implicated': [4370], 'promoting': [4372], 'Abnormalities': [4375], 'responsible': [4383], 'down-regulate': [4390], 'Further': [4392], 'investigation': [4393], 'defects': [4396], 'will': [4397, 4405], 'critical': [4399, 4418], 'reduce': [4406], 'efficacy': [4408], 'single': [4413], 'agent': [4414], 'therapeutic': [4416], 'applications.The': [4417], 'mouse': [4423], 'well': [4427, 4501], 'established.': [4428], 'function': [4431], 'adult': [4433], 'highly': [4436], 'organ-specific': [4437], '(28Xiong': [4438], 'Van': [4440], 'Pelt': [4441], 'C.S.': [4442], 'Elizondo-Fraire': [4443], 'A.C.': [4444], 'Liu': [4445], '3226-3231Crossref': [4458], '(126)': [4461], 'significance': [4465], 'cancer': [4470], 'response': [4474], 'still': [4476], 'area': [4478], 'active': [4480], 'investigation.': [4481], 'described': [4484], 'report,': [4487], 'independent': [4490], 'Wade': [4493], 'et': [4494, 4508], 'al.,': [4495], '4G.': [4496], 'Wahl,': [4497], 'personal': [4498], 'communication.': [4499], 'those': [4503], 'recently': [4504], 'published': [4505], 'Patton': [4507], 'al.': [4509], '(29Patton': [4510], 'J.T.': [4511], 'Mayo': [4512], 'L.D.': [4513], 'Singhi': [4514], 'Gudkov': [4516], 'A.V.': [4517], 'Stark': [4518], 'G.R.': [4519], 'Jacks': [4520]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2052516738', 'counts_by_year': [{'year': 2024, 'cited_by_count': 4}, {'year': 2023, 'cited_by_count': 7}, {'year': 2022, 'cited_by_count': 4}, {'year': 2021, 'cited_by_count': 11}, {'year': 2020, 'cited_by_count': 9}, {'year': 2019, 'cited_by_count': 10}, {'year': 2018, 'cited_by_count': 11}, {'year': 2017, 'cited_by_count': 7}, {'year': 2016, 'cited_by_count': 16}, {'year': 2015, 'cited_by_count': 5}, {'year': 2014, 'cited_by_count': 11}, {'year': 2013, 'cited_by_count': 15}, {'year': 2012, 'cited_by_count': 17}], 'updated_date': '2024-12-12T22:48:43.704600', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
