Publication Information

{'id': 'https://openalex.org/W2050274505', 'doi': 'https://doi.org/10.1074/jbc.273.1.381', 'title': 'X-gene Product of Hepatitis B Virus Induces Apoptosis in Liver Cells', 'display_name': 'X-gene Product of Hepatitis B Virus Induces Apoptosis in Liver Cells', 'publication_year': 1998, 'publication_date': '1998-01-01', 'ids': {'openalex': 'https://openalex.org/W2050274505', 'doi': 'https://doi.org/10.1074/jbc.273.1.381', 'mag': '2050274505', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/9417092'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.273.1.381', 'pdf_url': 'http://www.jbc.org/article/S0021925818385922/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925818385922/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5007382558', 'display_name': 'Hongtae Kim', 'orcid': 'https://orcid.org/0000-0001-9932-2760'}, 'institutions': [], 'countries': ['KR'], 'is_corresponding': False, 'raw_author_name': 'Hongtae Kim', 'raw_affiliation_strings': ['Signal Transduction Laboratory, Mogam Biotechnology Research Institute, 341 Pojungri, Koosungmyon, Yonginsi, Kyunggido 449-910, Korea'], 'affiliations': [{'raw_affiliation_string': 'Signal Transduction Laboratory, Mogam Biotechnology Research Institute, 341 Pojungri, Koosungmyon, Yonginsi, Kyunggido 449-910, Korea', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5052639020', 'display_name': 'Hyun‐Sook Lee', 'orcid': 'https://orcid.org/0000-0002-2251-5019'}, 'institutions': [], 'countries': ['KR'], 'is_corresponding': False, 'raw_author_name': 'Hyunsook Lee', 'raw_affiliation_strings': ['From the Signal Transduction Laboratory, Mogam Biotechnology Research Institute, 341 Pojungri, Koosungmyon, Yonginsi, Kyunggido 449-910, Korea'], 'affiliations': [{'raw_affiliation_string': 'From the Signal Transduction Laboratory, Mogam Biotechnology Research Institute, 341 Pojungri, Koosungmyon, Yonginsi, Kyunggido 449-910, Korea', 'institution_ids': []}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5013033155', 'display_name': 'Yungdae Yun', 'orcid': None}, 'institutions': [], 'countries': ['KR'], 'is_corresponding': False, 'raw_author_name': 'Yungdae Yun', 'raw_affiliation_strings': ['From the Signal Transduction Laboratory, Mogam Biotechnology Research Institute, 341 Pojungri, Koosungmyon, Yonginsi, Kyunggido 449-910, Korea'], 'affiliations': [{'raw_affiliation_string': 'From the Signal Transduction Laboratory, Mogam Biotechnology Research Institute, 341 Pojungri, Koosungmyon, Yonginsi, Kyunggido 449-910, Korea', 'institution_ids': []}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 0, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 18.407, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 194, 'citation_normalized_percentile': {'value': 0.999918, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 98, 'max': 99}, 'biblio': {'volume': '273', 'issue': '1', 'first_page': '381', 'last_page': '385'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10340', 'display_name': 'Hepatitis B Virus Studies', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2713', 'display_name': 'Epidemiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10340', 'display_name': 'Hepatitis B Virus Studies', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2713', 'display_name': 'Epidemiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T10580', 'display_name': 'Immunotherapy and Immune Responses', 'score': 0.9997, 'subfield': {'id': 'https://openalex.org/subfields/2403', 'display_name': 'Immunology'}, 'field': {'id': 'https://openalex.org/fields/24', 'display_name': 'Immunology and Microbiology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10294', 'display_name': 'Cell death mechanisms and regulation', 'score': 0.9988, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/hbx', 'display_name': 'HBx', 'score': 0.996296}], 'concepts': [{'id': 'https://openalex.org/C67567795', 'wikidata': 'https://www.wikidata.org/wiki/Q5629069', 'display_name': 'HBx', 'level': 4, 'score': 0.996296}, {'id': 'https://openalex.org/C190283241', 'wikidata': 'https://www.wikidata.org/wiki/Q14599311', 'display_name': 'Apoptosis', 'level': 2, 'score': 0.68856597}, {'id': 'https://openalex.org/C555283112', 'wikidata': 'https://www.wikidata.org/wiki/Q1637543', 'display_name': 'Carcinogenesis', 'level': 3, 'score': 0.65421957}, {'id': 'https://openalex.org/C2780593183', 'wikidata': 'https://www.wikidata.org/wiki/Q6844', 'display_name': 'Hepatitis B virus', 'level': 3, 'score': 0.60906076}, {'id': 'https://openalex.org/C54009773', 'wikidata': 'https://www.wikidata.org/wiki/Q1429031', 'display_name': 'Transfection', 'level': 3, 'score': 0.53477055}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.5275352}, {'id': 'https://openalex.org/C502942594', 'wikidata': 'https://www.wikidata.org/wiki/Q3421914', 'display_name': 'Cancer research', 'level': 1, 'score': 0.52193785}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.4817062}, {'id': 'https://openalex.org/C43759708', 'wikidata': 'https://www.wikidata.org/wiki/Q3749256', 'display_name': 'DNA fragmentation', 'level': 4, 'score': 0.4512807}, {'id': 'https://openalex.org/C2778019345', 'wikidata': 'https://www.wikidata.org/wiki/Q1148337', 'display_name': 'Hepatocellular carcinoma', 'level': 2, 'score': 0.45079616}, {'id': 'https://openalex.org/C81885089', 'wikidata': 'https://www.wikidata.org/wiki/Q189082', 'display_name': 'Cell culture', 'level': 2, 'score': 0.41938576}, {'id': 'https://openalex.org/C2522874641', 'wikidata': 'https://www.wikidata.org/wiki/Q808', 'display_name': 'Virus', 'level': 2, 'score': 0.40841156}, {'id': 'https://openalex.org/C31573885', 'wikidata': 'https://www.wikidata.org/wiki/Q304484', 'display_name': 'Programmed cell death', 'level': 3, 'score': 0.33386266}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.3304423}, {'id': 'https://openalex.org/C159047783', 'wikidata': 'https://www.wikidata.org/wiki/Q7215', 'display_name': 'Virology', 'level': 1, 'score': 0.31050897}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.2515443}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.068633795}], 'mesh': [{'descriptor_ui': 'D017209', 'descriptor_name': 'Apoptosis', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D008099', 'descriptor_name': 'Liver', 'qualifier_ui': 'Q000473', 'qualifier_name': 'pathology', 'is_major_topic': True}, {'descriptor_ui': 'D015534', 'descriptor_name': 'Trans-Activators', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D016475', 'descriptor_name': '3T3 Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017209', 'descriptor_name': 'Apoptosis', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002460', 'descriptor_name': 'Cell Line', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002467', 'descriptor_name': 'Cell Nucleus', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002467', 'descriptor_name': 'Cell Nucleus', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D053938', 'descriptor_name': 'DNA Fragmentation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011905', 'descriptor_name': 'Genes, ras', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008099', 'descriptor_name': 'Liver', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051379', 'descriptor_name': 'Mice', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019253', 'descriptor_name': 'Proto-Oncogene Proteins c-bcl-2', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019253', 'descriptor_name': 'Proto-Oncogene Proteins c-bcl-2', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D013752', 'descriptor_name': 'Tetracycline', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013752', 'descriptor_name': 'Tetracycline', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D015534', 'descriptor_name': 'Trans-Activators', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016159', 'descriptor_name': 'Tumor Suppressor Protein p53', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016159', 'descriptor_name': 'Tumor Suppressor Protein p53', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D054334', 'descriptor_name': 'Viral Regulatory and Accessory Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.273.1.381', 'pdf_url': 'http://www.jbc.org/article/S0021925818385922/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/9417092', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.273.1.381', 'pdf_url': 'http://www.jbc.org/article/S0021925818385922/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'score': 0.8, 'display_name': 'Good health and well-being', 'id': 'https://metadata.un.org/sdg/3'}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 45, 'referenced_works': ['https://openalex.org/W1480852720', 'https://openalex.org/W1502806819', 'https://openalex.org/W1525178335', 'https://openalex.org/W1591152328', 'https://openalex.org/W1597419589', 'https://openalex.org/W1623819487', 'https://openalex.org/W1651425720', 'https://openalex.org/W1834945569', 'https://openalex.org/W1916360605', 'https://openalex.org/W1970848975', 'https://openalex.org/W1976038917', 'https://openalex.org/W1976385326', 'https://openalex.org/W1979520405', 'https://openalex.org/W1986150533', 'https://openalex.org/W1987536971', 'https://openalex.org/W1999614623', 'https://openalex.org/W2002420878', 'https://openalex.org/W2005275397', 'https://openalex.org/W2011607753', 'https://openalex.org/W2015702695', 'https://openalex.org/W2032781689', 'https://openalex.org/W2034116029', 'https://openalex.org/W2044014221', 'https://openalex.org/W2052169714', 'https://openalex.org/W2072454412', 'https://openalex.org/W2074192294', 'https://openalex.org/W2076962190', 'https://openalex.org/W2083549154', 'https://openalex.org/W2091685075', 'https://openalex.org/W2096653553', 'https://openalex.org/W2096808350', 'https://openalex.org/W2099053209', 'https://openalex.org/W2107404790', 'https://openalex.org/W2111918191', 'https://openalex.org/W2123449896', 'https://openalex.org/W2127163321', 'https://openalex.org/W2128366838', 'https://openalex.org/W2129905922', 'https://openalex.org/W2140576094', 'https://openalex.org/W2150001528', 'https://openalex.org/W2152175101', 'https://openalex.org/W2253951324', 'https://openalex.org/W2409498455', 'https://openalex.org/W26593026', 'https://openalex.org/W90002144'], 'related_works': ['https://openalex.org/W4285268539', 'https://openalex.org/W2372432334', 'https://openalex.org/W2193072995', 'https://openalex.org/W2160255518', 'https://openalex.org/W2138293101', 'https://openalex.org/W2093274492', 'https://openalex.org/W2043861742', 'https://openalex.org/W2030325265', 'https://openalex.org/W2005426489', 'https://openalex.org/W1968971574'], 'abstract_inverted_index': {'Hepatitis': [0, 192, 384], 'B': [1, 176, 193, 368, 385, 429, 483, 1295, 1467, 4625], 'virus': [2, 177, 194, 369, 386, 391, 430, 484, 598, 1164, 1190, 1434], 'is': [3, 20, 102, 195, 212, 294, 387, 400, 573, 695, 779, 900, 2579, 3054, 3316, 3362, 3708, 3854, 3892, 3944, 4038, 4050, 4059, 4097, 4200, 4326, 4458, 4498, 4573, 4583, 4600], 'a': [4, 132, 196, 324, 388, 393, 401, 498, 574, 663, 786, 1462, 1680, 1685, 1690, 1732, 1768, 1817, 1828, 1852, 1950, 1985, 2081, 2266, 2296, 2376, 2416, 2540, 2580, 2656, 2714, 2754, 2833, 3105, 3128, 3209, 3214, 3355, 3375, 3505, 3698, 3751, 3768, 3855, 4061, 4098, 4185, 4230, 4459], 'causative': [5, 197, 402], 'agent': [6, 198, 403, 2413], 'of': [7, 14, 32, 64, 71, 80, 89, 97, 106, 131, 136, 144, 183, 189, 199, 206, 224, 256, 263, 272, 281, 289, 298, 323, 328, 336, 375, 381, 404, 439, 503, 520, 538, 579, 595, 703, 712, 746, 776, 782, 905, 923, 1040, 1066, 1121, 1129, 1160, 1187, 1220, 1267, 1308, 1338, 1384, 1444, 1465, 1478, 1636, 1703, 1749, 1770, 1789, 1791, 1800, 1805, 1836, 1881, 1914, 1958, 1976, 1992, 2018, 2166, 2205, 2208, 2214, 2240, 2402, 2418, 2441, 2471, 2483, 2488, 2496, 2509, 2523, 2565, 2573, 2583, 2590, 2600, 2627, 2665, 2710, 2717, 2722, 2728, 2743, 2748, 2757, 2760, 2763, 2772, 2790, 2909, 2919, 2994, 3009, 3019, 3035, 3042, 3051, 3060, 3063, 3071, 3075, 3177, 3183, 3240, 3247, 3267, 3277, 3293, 3310, 3323, 3359, 3391, 3467, 3500, 3512, 3538, 3551, 3595, 3626, 3668, 3835, 3839, 3902, 3911, 3942, 3949, 3991, 3997, 3999, 4047, 4055, 4068, 4079, 4088, 4094, 4101, 4107, 4126, 4163, 4175, 4198, 4206, 4212, 4223, 4233, 4294, 4298, 4329, 4363, 4372, 4377, 4408, 4443, 4578, 4594, 4608, 4672, 4680, 4690, 4695, 4709, 4745, 4758], 'hepatocellular': [8, 190, 200, 382, 440, 448, 704, 1472], 'carcinoma,': [9, 201], 'and': [10, 59, 159, 185, 202, 251, 351, 377, 399, 406, 522, 535, 799, 992, 1185, 1263, 1265, 1470, 1480, 1486, 1591, 1603, 1606, 1641, 1682, 1705, 1831, 1858, 1866, 1878, 1891, 1907, 1932, 1936, 1953, 2023, 2048, 2153, 2176, 2181, 2211, 2248, 2253, 2278, 2343, 2373, 2404, 2431, 2490, 2526, 2556, 2561, 2696, 2704, 2719, 2738, 2786, 2987, 3187, 3213, 3283, 3331, 3388, 3403, 3421, 3457, 3485, 3489, 3528, 3589, 3607, 3646, 3712, 3811, 3820, 3923, 4002, 4070, 4209, 4279, 4496, 4542, 4656, 4665, 4693, 4701, 4767, 4773, 4789, 4801, 4812], 'in': [11, 39, 116, 138, 141, 149, 203, 231, 308, 330, 333, 341, 531, 581, 599, 608, 662, 750, 891, 1455, 1761, 1833, 1844, 1851, 1889, 1926, 1955, 1965, 2112, 2118, 2163, 2237, 2270, 2289, 2295, 2335, 2362, 2387, 2493, 2655, 2725, 2832, 3016, 3104, 3127, 3271, 3290, 3296, 3325, 3374, 3504, 3597, 3616, 3623, 3670, 3685, 3696, 3714, 3761, 3802, 3828, 3858, 3888, 3904, 3908, 3915, 3936, 3946, 4005, 4103, 4112, 4116, 4128, 4177, 4189, 4300, 4306, 4505, 4617, 4662, 4687, 4698, 4747], 'the': [12, 16, 29, 46, 62, 68, 78, 86, 94, 104, 129, 142, 181, 186, 204, 208, 221, 238, 254, 260, 270, 278, 286, 296, 321, 334, 373, 378, 436, 476, 481, 486, 504, 518, 536, 577, 584, 593, 607, 701, 744, 780, 794, 903, 921, 1037, 1041, 1057, 1064, 1103, 1122, 1211, 1287, 1302, 1306, 1432, 1442, 1445, 1594, 1634, 1637, 1696, 1701, 1706, 1709, 1716, 1728, 1742, 1747, 1754, 1778, 1783, 1792, 1812, 1823, 1834, 1841, 1847, 1879, 1918, 1939, 1956, 1974, 2019, 2024, 2095, 2103, 2149, 2200, 2203, 2222, 2353, 2406, 2411, 2424, 2427, 2438, 2443, 2457, 2475, 2486, 2494, 2506, 2544, 2571, 2574, 2663, 2673, 2720, 2726, 2741, 2761, 2848, 2906, 2917, 2926, 2991, 3007, 3017, 3036, 3048, 3058, 3068, 3111, 3143, 3175, 3181, 3184, 3194, 3241, 3244, 3255, 3259, 3275, 3291, 3308, 3311, 3317, 3320, 3352, 3371, 3379, 3416, 3454, 3496, 3510, 3524, 3582, 3624, 3637, 3666, 3682, 3715, 3753, 3805, 3822, 3833, 3837, 3895, 3900, 3909, 3933, 3947, 3989, 3995, 4013, 4036, 4045, 4053, 4066, 4071, 4077, 4083, 4105, 4117, 4123, 4161, 4169, 4173, 4181, 4191, 4196, 4203, 4210, 4213, 4219, 4281, 4291, 4295, 4311, 4323, 4327, 4370, 4378, 4405, 4441, 4579, 4591, 4618, 4688, 4759, 4809], 'course': [13, 205], 'tumorigenesis,': [15, 207], 'X-gene': [17, 209, 487, 585], 'product': [18, 210, 488, 586, 1720], '(HBx)': [19, 211, 489], 'known': [21, 213, 3709, 4361], 'to': [22, 109, 172, 180, 214, 301, 364, 372, 435, 509, 589, 605, 700, 709, 907, 920, 1030, 1047, 1055, 1096, 1285, 1289, 1300, 1989, 1998, 2028, 2132, 2312, 2433, 2531, 2672, 2680, 2745, 2752, 2843, 3109, 3118, 3263, 3368, 3443, 3495, 3584, 3710, 3718, 3818, 3873, 3951, 3994, 4122, 4130, 4277, 4319, 4413, 4415, 4538, 4543, 4547, 4575, 4668, 4798, 4808], 'play': [23, 215], 'important': [24, 216], 'roles.': [25, 217], 'Here,': [26, 218], 'we': [27, 119, 165, 219, 311, 357, 1449, 2542, 2660, 2903, 2924, 2989, 3121, 3134, 3577, 3865], 'investigated': [28, 220], 'transforming': [30, 222, 2439, 2507, 4444, 4452, 4501], 'potential': [31, 223, 2440, 2508], 'HBx': [33, 47, 65, 101, 113, 127, 137, 168, 225, 239, 257, 293, 305, 319, 329, 360, 526, 580, 698, 706, 751, 798, 906, 913, 1045, 1051, 1297, 1452, 1479, 1977, 1993, 2444, 2472, 2489, 2502, 2524, 2578, 2669, 2723, 2744, 2758, 2913, 2986, 3012, 3114, 3126, 3137, 3178, 3188, 3248, 3294, 3324, 3335, 3360, 3397, 3409, 3445, 3513, 3580, 3596, 3869, 3881, 3903, 3950, 3992, 4017, 4048, 4102, 4165, 4275, 4284, 4314, 4364, 4437, 4450, 4497, 4535, 4746], 'by': [34, 100, 226, 292, 660, 1033, 1305, 1336, 1645, 1673, 1746, 2202, 2345, 2577, 2668, 2731, 2912, 3146, 3251, 3340, 3885, 3894, 4030, 4076, 4172, 4202, 4289, 4550], 'conventional': [35, 227], 'focus': [36, 90, 98, 228, 282, 290, 2477, 2498, 2533, 2666, 2729, 2749, 2910, 2995, 3052, 3072, 3883, 4023, 4028, 4095, 4114], 'formation': [37, 99, 229, 291, 2478, 2534, 2586, 2667, 2730, 2750, 2768, 2911, 2996, 3053, 3884, 4004, 4029, 4067, 4096, 4115], 'assay': [38, 230, 666, 2587, 2769, 3412, 4014, 4811], 'NIH3T3': [40, 232, 713, 1757, 2451, 2591, 2773, 3889, 3953], 'cells.': [41, 233, 1457, 3861, 3954], 'Cells': [42, 234, 2106], 'were': [43, 235, 1028, 1283, 1488, 1643, 1759, 1780, 1825, 1849, 1887, 1898, 1910, 1924, 1947, 1971, 2110, 2151, 2161, 2224, 2235, 2263, 2287, 2330, 2355, 2385, 2408, 2429, 2467, 2528, 2567, 2841, 3038, 3304, 3384, 3406, 3426, 3481, 3493, 3517, 3526, 3541, 3614, 3639], 'cotransfected': [44, 236, 1933, 2543, 2684], 'with': [45, 51, 237, 243, 392, 1687, 1786, 1797, 1868, 1934, 2138, 2156, 2318, 2332, 2357, 2371, 2390, 2410, 2456, 2505, 2553, 2593, 2605, 2651, 2687, 2775, 2795, 2828, 2929, 2985, 3003, 3011, 3023, 3080, 3100, 3191, 3205, 3285, 3351, 3386, 3431, 3472, 3483, 3530, 3543, 3554, 3569, 3619, 3641, 3650, 3654, 3814, 4109, 4500, 4610], 'expression': [48, 240, 1476, 1613, 1794, 2445, 2459, 2470, 2482, 2549, 2597, 2690, 3138, 3176, 3246, 3321, 3336, 3361, 3990, 4046, 4166], 'plasmid': [49, 241, 1477, 1614, 1729, 1743, 1814, 2446, 2460, 2550, 3139, 4167], 'along': [50, 242, 1796, 2552, 2686, 3204], 'other': [52, 244, 897, 1212, 1214, 2681, 3886, 4031, 4080, 4312, 4360, 4756], 'oncogenes': [53, 245, 2712, 2735, 2765, 2780, 3887, 4081], 'including': [54, 246, 2781], 'Ha-ras,': [55, 247, 1600, 2705, 2782, 2988], 'v-src,': [56, 248, 1604, 2702, 2784], 'v-myc,': [57, 249, 1601, 2700, 2785], 'v-fos,': [58, 250, 1602, 2701, 2783], 'E1a.': [60, 252], 'Unexpectedly,': [61, 253, 2485], 'introduction': [63, 255], 'completely': [66, 258], 'abrogated': [67, 259, 4027], 'focus-forming': [69, 261], 'ability': [70, 262, 904, 1288, 2742, 3117, 3583, 3872, 3948, 4087, 4318], 'all': [72, 264, 1908, 2732], 'five': [73, 265, 2688, 2733, 2778], 'tested': [74, 266, 2734, 2904], 'oncogenes.': [75, 267, 2682, 4032], 'In': [76, 268, 971, 1049, 3173, 3428, 3862, 4008, 4533], 'addition,': [77, 269, 972, 4534], 'cotransfection': [79, 271], 'Bcl-2,': [81, 273], 'an': [82, 274, 1750, 2143, 2323, 2562, 2930, 3116, 3136, 3460, 3871, 4164, 4226, 4317, 4706], 'apoptosis': [83, 115, 151, 173, 275, 307, 343, 365, 1100, 1126, 1303, 1454, 2845, 3312, 3382, 3695, 3875, 3917, 4170, 4192, 4199, 4236, 4288, 4321, 4416, 4462, 4596, 4609, 4616, 4671, 4710], 'inhibitor,': [84, 276], 'reversed': [85, 277], 'HBx-mediated': [87, 279, 777, 1446, 3069, 4375, 4586, 4595], 'inhibition': [88, 280, 2908, 3070], 'formation,': [91, 283, 2499, 4024], 'suggesting': [92, 284, 2500], 'that': [93, 167, 285, 359, 697, 1089, 1451, 1994, 2501, 2570, 3047, 3113, 3319, 3349, 3579, 3852, 3868, 3988, 4104, 4160, 4218, 4274, 4365], 'observed': [95, 287, 749, 2468, 2512, 2907, 2990, 3471, 3542, 3568, 3592, 3843, 3945, 4305, 4622, 4686], 'repression': [96, 288], 'through': [103, 295, 1036, 1063, 2265, 2916, 3057, 4440], 'induction': [105, 297, 2401, 2918, 3059, 3292, 3594, 3838, 3901, 4197, 4442], 'apoptosis.': [107, 299, 1291, 1440, 2920, 4373, 4587], 'Next,': [108, 300, 2659, 3108, 3509], 'test': [110, 302, 3395], 'unequivocally': [111, 303], 'whether': [112, 304, 2662, 2905, 3396], 'induces': [114, 306, 3399, 4235, 4451], 'liver': [117, 123, 170, 309, 315, 362, 753, 1456, 1896, 1922, 2277, 2282, 2381, 3202, 3419, 3475, 3546, 3600, 3603, 3687, 3860, 3906, 4302, 4465, 4507, 4545, 4619], 'cells,': [118, 310, 3476, 3890], 'established': [120, 312, 528, 2931, 3122, 3279, 4461], 'stable': [121, 313, 2280, 3424, 3598, 3609], 'Chang': [122, 314, 1895, 1921, 2276, 2281, 2380, 3201, 3418, 3474, 3545, 3599, 3602, 3686, 3859, 3905, 4301], 'cell': [124, 316, 506, 893, 1058, 2159, 3123, 3280, 3302, 3327, 3755, 3763, 3830, 4056, 4072, 4548, 4703, 4715], 'lines': [125, 317, 3124, 3281, 3303, 3328], 'expressing': [126, 318, 3125], 'under': [128, 320, 2375, 3180], 'control': [130, 322, 3182, 3473, 3544], 'tetracycline-inducible': [133, 325, 1638, 3129, 3185, 3353], 'promoter.': [134, 326], 'Induction': [135, 327], 'these': [139, 163, 331, 355, 524, 2711, 3300, 3326, 3575, 4748], 'cells': [140, 171, 332, 363, 714, 1758, 1779, 1824, 1848, 1897, 1913, 1923, 1946, 2150, 2283, 2329, 2384, 2407, 2428, 2452, 2592, 2774, 3203, 3373, 3390, 3420, 3456, 3525, 3547, 3604, 3610, 3638, 3652, 3688, 3907, 4303, 4466, 4546, 4675], 'presence': [143, 335, 1835, 1957, 3625, 3910], '1%': [145, 337, 2139, 2319, 3432, 3620, 3912], 'calf': [146, 338, 1765, 1930, 2116, 2140, 2293, 2320, 2392, 3433, 3621], 'serum': [147, 339, 1766, 1931, 2117, 2294, 2393, 3622, 3913], 'resulted': [148, 340, 2492, 2724, 3015, 3289, 3914, 4111], 'typical': [150, 342, 3478, 3916], 'phenomena': [152, 344, 3918, 4750], 'such': [153, 345, 1217, 3919], 'as': [154, 346, 497, 529, 785, 1218, 1334, 1679, 1684, 1689, 1816, 2519, 2559, 2837, 3690, 3767, 3920, 4304, 4331, 4369, 4449, 4682, 4711, 4713], 'DNA': [155, 347, 390, 397, 1807, 1815, 2196, 3401, 3414, 3450, 3468, 3479, 3502, 3719, 3921, 4541], 'fragmentation,': [156, 348, 3415], 'nuclear': [157, 349, 3404, 3515, 3539, 3556, 3924], 'condensation,': [158, 350], 'fragmentation.': [160, 352], 'Based': [161, 353], 'on': [162, 354, 902, 1102, 1864, 2102, 2186, 2341, 2847, 3067, 3459, 3514, 4310], 'results,': [164, 356, 3576], 'propose': [166, 358], 'sensitizes': [169, 361], 'upon': [174, 366, 2469, 2481, 3040, 3408, 3593, 3812, 3844], 'hepatitis': [175, 184, 367, 376, 408, 428, 482, 597, 1294, 1466, 1469, 4611, 4624, 4664], 'infection,': [178, 370], 'contributing': [179, 371], 'development': [182, 374, 745], 'subsequent': [187, 379, 1471], 'generation': [188, 380, 458, 702], 'carcinoma.': [191, 383, 705], 'small': [389], '3.2-kilobase': [394], 'partially': [395], 'double-stranded': [396], 'genome': [398], 'acute': [405], 'chronic': [407, 427], '(1Ganem': [409], 'D.': [410, 1243, 2961], 'Varmus': [411], 'H.E.': [412, 1134, 1343, 1535, 2853], 'Annu.': [413], 'Rev.': [414], 'Biochem.': [415, 4559, 4731], '1987;': [416], '56:': [417], '651-693Crossref': [418], 'PubMed': [419, 551, 566, 638, 652, 688, 738, 768, 822, 862, 882, 941, 966, 989, 1003, 1025, 1082, 1115, 1140, 1154, 1182, 1205, 1231, 1258, 1280, 1349, 1363, 1379, 1402, 1423, 1512, 1542, 1556, 1573, 1588, 1665, 2011, 2073, 2859, 2881, 2898, 2951, 2976, 3166, 3233, 3745, 3795, 3982, 4250, 4268, 4398, 4431, 4491, 4528, 4566, 4639, 4737], 'Scopus': [420, 471, 552, 567, 689, 739, 769, 823, 863, 942, 967, 1083, 1141, 1155, 1206, 1232, 1259, 1350, 1364, 1403, 1424, 1513, 1543, 1557, 1666, 2012, 2074, 2860, 2899, 2977, 3167, 3234, 3746, 3796, 3983, 4251, 4269, 4432, 4492, 4529, 4567, 4640, 4738], '(821)': [421], 'Google': [422, 473, 554, 569, 639, 653, 691, 741, 771, 825, 838, 865, 883, 944, 969, 990, 1004, 1026, 1085, 1116, 1143, 1157, 1183, 1208, 1234, 1261, 1281, 1331, 1352, 1366, 1380, 1405, 1426, 1515, 1545, 1559, 1574, 1589, 1628, 1668, 2014, 2076, 2862, 2882, 2901, 2952, 2979, 3169, 3236, 3748, 3798, 3985, 4157, 4253, 4271, 4355, 4399, 4434, 4494, 4531, 4569, 4642, 4652, 4740], 'Scholar).': [423, 474, 570, 654, 692, 742, 772, 884, 970, 1086, 1117, 1209, 1332, 1516, 1629, 1669, 2015, 2077, 2980, 3237, 3749, 3799, 4272, 4356, 4435, 4532, 4570, 4653, 4741], 'Through': [424], 'epidemiological': [425], 'studies,': [426, 525, 601], 'infection': [431, 4599, 4627], 'has': [432, 490, 1052, 1615, 2049, 4620], 'been': [433, 515, 1053, 1608, 1616, 2050, 4621], 'linked': [434], 'high': [437, 4231], 'incidence': [438], 'carcinoma': [441, 1473], '(HCC)': [442], '1The': [443], 'abbreviations': [444], 'used': [445], 'are:': [446], 'HCC,': [447, 534], 'carcinoma;': [449], 'DMEM,': [450], "Dulbecco's": [451], 'modified': [452], "Eagle's": [453], 'medium;': [454], 'PBS,': [455, 2333, 2372], 'phosphate-buffered': [456], 'saline.': [457], '(2Beasly': [459], 'R.P.': [460], 'Lin': [461], 'C.-C.': [462], 'Hwang': [463], 'L.Y.': [464], 'Chen': [465], 'C.-S.': [466], 'Lancet.': [467], '1981;': [468], 'ii:': [469], '1129-1133Abstract': [470], '(417)': [472], 'Among': [475], 'four': [477], 'proteins': [478], 'translated': [479], 'from': [480, 523, 1431, 1735, 1900, 1917, 2045, 2199, 3453, 3932, 4184, 4670], 'genome,': [485], 'drawn': [491, 659], 'much': [492], 'attention': [493], 'for': [494, 501, 592, 1293, 1520, 1633, 1700, 1861, 1872, 2032, 2146, 2183, 2193, 2229, 2255, 2326, 2338, 2367, 2516, 3307, 3413, 4035, 4052, 4065, 4464, 4585, 4771, 4792, 4804], 'its': [495], 'role': [496, 578, 4593], 'transacting': [499], 'factor': [500, 4446, 4454, 4503], 'exploitation': [502], 'host': [505], 'machinery.': [507], 'Up': [508], 'now,': [510], 'several': [511, 791, 4359], 'significant': [512], 'discoveries': [513], 'have': [514, 1093, 1286, 1607, 3866, 4286, 4316], 'made': [516], 'regarding': [517], 'functions': [519, 4362], 'HBx,': [521, 2442, 2518], 'was': [527, 587, 658, 707, 748, 1298, 1671, 1722, 1737, 1808, 1883, 1982, 1995, 2021, 2026, 2038, 2087, 2092, 2130, 2197, 2310, 2448, 2479, 2514, 2670, 2914, 2983, 3028, 3179, 3189, 3198, 3249, 3337, 3441, 3451, 3470, 3558, 3567, 3757, 3765, 3809, 3842, 4015, 4193, 4411, 4536], 'essential': [530], 'viral': [532, 582, 1123, 1215, 1428, 2839, 3691, 4626, 4663], 'replication,': [533, 583], 'activation': [537, 922, 926, 1065, 4376], 'certain': [539], 'signal': [540, 910], 'transduction': [541, 911], 'pathways': [542], '(3Rossner': [543], 'M.T.': [544], 'J.': [545, 633, 644, 647, 677, 732, 811, 870, 872, 877, 928, 977, 984, 998, 1020, 1069, 1110, 1177, 1275, 1374, 1501, 1531, 1565, 1568, 1583, 2062, 2876, 2946, 3724, 3774, 3976, 4242, 4246, 4386, 4393, 4422, 4522, 4630, 4781, 4787], 'Med.': [546], 'Virol.': [547, 634, 648, 878, 985, 999, 1021, 1111, 1178, 1276, 1375, 1569, 1584, 2877, 2947, 4394], '1992;': [548, 1255, 1625, 2973, 4488], '36:': [549], '101-117Crossref': [550], '(192)': [553], 'Scholar,': [555, 640, 839, 866, 945, 1005, 1144, 1235, 1353, 1367, 1406, 2863, 2883, 2953, 4254, 4643], '4Cromlish': [556], 'J.A.': [557, 876], 'Trends': [558], 'Microbiol.': [559], '1996;': [560, 986, 1000, 1022, 4247, 4265, 4395, 4525], '4:': [561], '270-274Abstract': [562], 'Full': [563, 683, 685, 817, 819, 1507, 1509, 2068, 2070, 4636], 'Text': [564, 684, 686, 818, 820, 1508, 1510, 2069, 2071, 4637], 'PDF': [565, 687, 821, 1511, 2072, 4638], '(46)': [568], 'Although': [571], 'there': [572, 4604], 'controversy': [575], 'about': [576], 'shown': [588, 1029, 1054, 1284, 1299, 1997, 3270, 3801, 3867, 4412, 4537], 'be': [590, 1031, 1999, 2678, 2753, 4402], 'required': [591, 4574], 'replication': [594, 665], 'woodchuck': [596], 'animal': [600, 1091], 'which': [602, 3207, 3364, 3891, 4190, 4457, 4577], 'are': [603, 790, 3591, 3648, 4358, 4605, 4659, 4666, 4684, 4796], 'considered': [604], 'reflect': [606], 'vivo': [609], 'phenomenon': [610], 'more': [611, 3032], 'precisely': [612], '(5Chen': [613], 'H.S.': [614, 1410], 'Kaneko': [615], 'S.': [616, 857, 936, 1077, 1168, 1245, 1253, 1418, 1652, 2867, 2937, 2963, 2971, 3153, 3220, 3740, 3790, 4472, 4486, 4556], 'Girones': [617], 'R.': [618, 868, 4474, 4730], 'Anderson': [619], 'R.W.': [620, 1551], 'Hornbuckle': [621], 'W.E.': [622], 'Tennant': [623], 'B.C.': [624], 'Cote': [625], 'P.J.': [626], 'Gerin': [627], 'J.L.': [628], 'Purcell': [629], 'R.H.': [630, 632], 'Miller': [631], '1993;': [635, 835, 1137, 1151, 1228, 1346, 1360, 2856], '67:': [636], '1218-1226Crossref': [637], '6Zoulim': [641], 'F.': [642, 979, 995, 4388], 'Saputelli': [643], 'Seeger': [645], 'C.': [646, 874, 957, 1015, 1196, 2889, 3726, 3776, 4262, 4764], '1994;': [649, 859, 938, 963, 1179, 1399, 1420, 2878, 2948, 4734], '68:': [650, 1180, 2879, 2949], '2026-2030Crossref': [651], 'A': [655, 773, 1802, 2250], 'similar': [656], 'conclusion': [657], 'us': [661, 4807], 'transfection-based': [664], '(7Lee': [667, 801, 1491, 2052], 'H.': [668, 674, 722, 802, 808, 845, 1270, 1317, 1369, 1492, 1498, 1660, 2004, 2053, 2059, 3161, 3228, 3966, 4143, 4341, 4511, 4726, 4785, 4790], 'Lee': [669, 803, 1493, 2054, 4516], 'Y.-H.': [670, 804, 1494, 2055, 4762], 'Huh': [671, 805, 1495, 2056], 'Y.-S.': [672, 806, 1496, 2057], 'Moon': [673, 807, 1497, 2058], 'Yun': [675, 809, 1499, 2060], 'Y.': [676, 716, 720, 810, 1174, 1272, 1371, 1500, 1623, 2061, 2873, 2943, 3728, 3778, 3960, 3964, 4779], 'Biol.': [678, 812, 962, 1398, 1502, 1538, 2063, 4733], 'Chem.': [679, 813, 1503, 2064], '1995;': [680, 814, 879, 1079, 1202, 1277, 1328, 1376, 1504, 1662, 2065, 2895, 3163, 3230, 3742, 3792, 4154, 4352, 4428, 4649], '270:': [681, 815, 1505, 2066, 4429], '31405-31412Abstract': [682, 816, 1506, 2067], '(39)': [690, 824, 1514, 2075], 'Generally,': [693], 'it': [694], 'believed': [696], 'contributes': [699, 1046], 'reported': [708, 2842, 3766, 3929, 3987, 4332, 4606], 'induce': [710, 1099, 1439, 2844, 3119, 3444, 3585, 3694, 3874, 4021], 'transformation': [711, 1447, 1521, 4810], '(8Shirakata': [715, 3959], 'Kawada': [717, 3961], 'M.': [718, 724, 728, 829, 955, 959, 981, 1009, 1013, 1017, 1146, 1172, 1176, 1223, 1239, 1355, 1650, 2871, 2875, 2941, 2945, 2957, 3151, 3218, 3734, 3784, 3962, 3968, 3972, 4240, 4390, 4420, 4470, 4769], 'Fujiki': [719, 3963], 'Sano': [721, 3965], 'Oda': [723, 3967], 'Yaginuma': [725, 3969], 'K.': [726, 730, 757, 843, 1319, 1391, 1529, 1621, 3732, 3782, 3970, 3974, 4145, 4343, 4513, 4765], 'Kobayashi': [727, 3971], 'Koike': [729, 756, 3973], 'Jpn.': [731, 3975], 'Cancer': [733, 1326, 3977, 4152, 4350], 'Res.': [734, 1327, 3978, 4153, 4351, 4561], '1989;': [735, 3979], '80:': [736, 3980], '617-621Crossref': [737, 3981], '(168)': [740, 3984], 'Furthermore,': [743, 4697], 'HCC': [747, 778], 'transgenic': [752, 4506], '(9Kim': [754], 'C.-M.': [755], 'Saito': [758], 'I.': [759], 'Miyamura': [760], 'T.': [761, 1166, 1170, 1274, 1373, 1533, 1582, 2865, 2869, 2935, 2939, 3730, 3780, 4645, 4802], 'Jay': [762, 4518], 'G.': [763, 947, 1019, 1654, 1656, 3155, 3157, 3222, 3224, 4519], 'Nature.': [764, 1552], '1991;': [765], '351:': [766], '317-320Crossref': [767], '(1056)': [770], 'possible': [774, 898, 4743], 'mechanism': [775, 899, 1464, 4371], 'disruption': [781, 2664, 2747, 4093], 'p53': [783, 800, 889, 1309, 2403, 3683, 3707, 3760, 3807, 3816, 3853, 4176, 4224, 4234, 4278, 4282, 4299], 'function': [784, 890, 4293], 'tumor': [787, 4003], 'suppressor.': [788], 'There': [789, 4357], 'reports': [792, 4216], 'describing': [793], 'direct': [795], 'association': [796], 'between': [797], 'Scholar,10Feitelson': [826], 'M.A.': [827, 847], 'Zhu': [828], 'Duan': [830], 'L.-X.': [831], 'London': [832], 'W.T.': [833], 'Oncogene.': [834, 1624], '8:': [836], '1109-1117PubMed': [837], '11Wang': [840], 'X.W.': [841, 1311, 4137, 4335], 'Forrester': [842, 1318, 4144, 4342], 'Yeh': [844, 1316, 4142, 4340], 'Feitelson': [846], 'Gu': [848], 'J.-R.': [849], 'Harris': [850, 1324, 4150, 4348], 'C.C.': [851, 1325, 4151, 4349], 'Proc.': [852, 931, 1072, 1248, 1413, 2966, 3735, 3785, 4481], 'Natl.': [853, 932, 1073, 1249, 1414, 2967, 3736, 3786, 4482], 'Acad.': [854, 933, 1074, 1250, 1415, 2968, 3737, 3787, 4483], 'Sci.': [855, 934, 1075, 1251, 1416, 2969, 3738, 3788, 4484], 'U.': [856, 935, 1076, 1252, 1417, 2970, 3739, 3789, 4244, 4485], 'A.': [858, 937, 953, 1078, 1254, 1419, 2972, 3722, 3741, 3772, 3791, 4487, 4554, 4722], '91:': [860, 939, 1421], '2230-2234Crossref': [861], '(637)': [864], '12Truant': [867], 'Antunovic': [869], 'Greenblatt': [871], 'Prives': [873, 4261], 'Cromlish': [875], '69:': [880, 1278, 1377], '1851-1859Crossref': [881], 'Such': [885], 'interaction': [886], 'presumably': [887], 'suppresses': [888], 'G1': [892], 'cycle': [894, 1059, 4073], 'arrest.': [895], 'The': [896, 1118, 1475, 1517, 1610, 1630, 1692, 1885, 2016, 2034, 2158, 2232, 2261, 2511, 3498, 3564, 3663, 3926, 3939, 4033, 4374, 4742], 'based': [901, 2101], 'activate': [908], 'cellular': [909, 1104, 3716, 4187], 'pathways.': [912], 'stimulates': [914], 'theras/raf/mitogen-activated': [915], 'protein': [916, 2043, 2928, 3897, 4380], 'kinase': [917, 975, 4383], 'cascade,': [918], 'leading': [919], 'AP-1-dependent': [924], 'transcriptional': [925], '(13Benn': [927], 'Schneider': [929, 982, 996, 1070, 4391], 'R.J.': [930, 983, 997, 1071, 4392, 4424], '10350-10354Crossref': [940], '(404)': [943], '14Natoli': [946], 'Avantaggiati': [948], 'M.L.': [949, 1563], 'Chirillo': [950], 'P.': [951, 1007, 1241, 2959, 4238, 4558], 'Costanzo': [952], 'Artini': [954, 1012], 'Balsano': [956, 1014], 'Levrero': [958, 1016], 'Mol.': [960, 1396, 1536], 'Cell.': [961, 1397, 1537], '14:': [964, 1400], '989-998Crossref': [965], '(125)': [968], 'c-Jun': [973], 'N-terminal': [974, 4382], '(15Benn': [976, 4385], 'Su': [978, 4387], 'Doria': [980, 4389], '70:': [987, 1001, 1023, 4396], '4978-4985Crossref': [988, 4397], 'Scholar)': [991, 1027, 1262, 1282, 1381, 3170, 3986, 4158, 4400], 'NF-κB': [993], '(16Su': [994], '4558-4566Crossref': [1002], '17Chirillo': [1006], 'Falco': [1008], 'Puri': [1010], 'P.L.': [1011], 'Natoli': [1018], '641-646Crossref': [1024], 'activated': [1032], 'HBx.': [1034, 3268, 4089], 'Probably,': [1035], 'combined': [1038, 4204], 'actions': [1039], 'mechanisms': [1042, 4580], 'listed': [1043, 4581], 'above,': [1044], 'tumorigenesis.': [1048], 'fact,': [1050], 'deregulate': [1056], 'check': [1060], 'point': [1061, 3941, 4125], 'controls': [1062], 'ras': [1067], '(18Benn': [1068], '92:': [1080, 3743, 3793], '11215-11219Crossref': [1081], '(266)': [1084], 'It': [1087], 'seems': [1088, 2751], 'most': [1090], 'viruses': [1092], 'evolved': [1094], 'strategies': [1095], 'block': [1097, 1290, 1301, 1437, 4320], 'and/or': [1098], 'depending': [1101, 2846], 'environment': [1105, 2849, 4188], '(19Teodoro': [1106], 'J.G.': [1107], 'Branton': [1108], 'P.E.': [1109], '1997;': [1112, 4563, 4633], '71:': [1113], '1739-1746Crossref': [1114], 'representative': [1119], 'examples': [1120], 'transactivators': [1124, 1216, 2840, 3692], 'inducing': [1125], 'include': [1127], 'E1a': [1128, 1595, 2546, 2555, 2621, 2813, 4108], 'adenovirus': [1130, 1221, 1339, 2545], '(20Lowe': [1131, 1340, 2850], 'S.W.': [1132, 1341, 2851], 'Ruley': [1133, 1342, 1534, 2852], 'Genes': [1135, 1149, 1226, 1344, 1358, 2854, 4263], 'Dev.': [1136, 1150, 1227, 1345, 1359, 2855, 4264], '7:': [1138, 1152, 1229, 1347, 1361, 1626, 2857], '535-545Crossref': [1139, 1348, 2858], '(613)': [1142, 1351, 2861], '21Debbas': [1145, 1354], 'White': [1147, 1224, 1246, 1356, 2964], 'E.': [1148, 1225, 1247, 1357, 2965, 4768], '546-554Crossref': [1153, 1230, 1362], '(836)': [1156, 1233, 1365], 'Scholar),': [1158, 1184, 1427, 1546, 1560, 1575, 1590, 2902, 4495], 'Tax': [1159], 'human': [1161, 1188, 1611], 'T-cell': [1162], 'leukemia': [1163], '(22Yamada': [1165, 2934], 'Yamaoka': [1167, 2866, 2936], 'Goto': [1169, 2868, 2938], 'Nakai': [1171, 2870, 2940], 'Tsujimoto': [1173, 1622, 2872, 2942], 'Hatanaka': [1175, 2874, 2944], '3374-3379Crossref': [1181, 2880, 2950], 'Tat': [1186], 'immunodeficiency': [1189], '(23Li': [1191], 'C.J.': [1192, 2885], 'Friedman': [1193, 2886], 'D.J.': [1194, 2887], 'Wang': [1195, 2888, 4133], 'Metelew': [1197, 2890], 'V.': [1198, 2891], 'Pardel': [1199, 2892], 'A.B.': [1200, 2893], 'Science.': [1201, 1661, 2007, 2894, 3162, 3229, 4427], '268:': [1203, 1663, 2896, 3164, 3231], '429-431Crossref': [1204, 2897], '(549)': [1207, 2900], 'On': [1210], 'hand,': [1213, 4313], 'E1b': [1219], '(21Debbas': [1222], '24Rao': [1236, 2954], 'L.': [1237, 1387, 2955, 4260, 4724, 4728], 'Debbas': [1238, 2956], 'Sabbatini': [1240, 2958], 'Hockenbery': [1242, 2960], 'Korsmeyer': [1244, 2962], '89:': [1256, 2974, 4489], '7742-7746Crossref': [1257, 2975], '(659)': [1260, 2978], 'IE1': [1264], 'IE2': [1266], 'cytomegalovirus': [1268], '(25Zhu': [1269], 'Shen': [1271, 1370], 'Shenk': [1273, 1372], '7960-7970Crossref': [1279, 1378], 'As': [1292, 2539, 3269, 3750, 3800], 'virus,': [1296], 'induced': [1304, 2713, 4171, 4287], 'overexpression': [1307, 4174, 4328], '(26Wang': [1310, 4136, 4334], 'Gibson': [1312, 4138, 4336], 'M.K.': [1313, 4139, 4337], 'Vermeulen': [1314, 4140, 4338], 'W.': [1315, 1389, 1658, 3159, 3226, 4141, 4339, 4478, 4718, 4783, 4799], 'Stüzbecher': [1320, 4146, 4344], 'H.-W.': [1321, 4147, 4345], 'Hoeijmakers': [1322, 4148, 4346], 'J.H.J.': [1323, 4149, 4347], '55:': [1329, 1586, 4155, 4353], '6012-6016PubMed': [1330, 4156, 4354], 'Notably,': [1333], 'exemplified': [1335], 'E1a/E1b': [1337], '25Zhu': [1368], 'or': [1382, 1438, 2126, 2306, 2382, 2394, 2420, 2454, 2676, 3437, 3630, 3657, 3700, 4612], 'T-antigen': [1383], 'SV40': [1385], '(27Fromm': [1386], 'Shawlot': [1388], 'Gunning': [1390], 'Butel': [1392], 'J.S.': [1393], 'Overbeek': [1394], 'P.A.': [1395], '6743-6754Crossref': [1401], '(96)': [1404], '28McCarthy': [1407], 'S.A.': [1408], 'Symonds': [1409], 'Dyke': [1411], 'T.V.': [1412], '3979-3983Crossref': [1422], '(112)': [1425], 'gene': [1429, 1598, 2788], 'products': [1430], 'same': [1433, 3565, 4118], 'may': [1435, 1460, 3693, 4285, 4315, 4366, 4401, 4438], 'either': [1436, 3697], 'During': [1441], 'study': [1443, 4572], 'process,': [1448], 'found': [1450], 'sensitizes/induces': [1453], 'This': [1458, 3346], 'observation': [1459, 3347], 'provide': [1461], 'pathogenic': [1463], 'virus-related': [1468], 'generation.': [1474], 'internal': [1481], 'deletion': [1482, 2521], 'mutants': [1483, 2522], 'pcDNA-X,': [1484], 'Xdel-1,': [1485], 'Xdel-2': [1487], 'described': [1489, 1617, 2051, 3381], 'previously': [1490, 1996, 4333], 'plasmids': [1518, 1795], 'employed': [1519, 2925, 3306, 3758], 'assay,': [1522], 'pMT13S': [1523], '(29Zerler': [1524], 'B.': [1525, 1527, 4720], 'Moran': [1526], 'Maruyama': [1528], 'Moomaw': [1530], 'Grodzicker': [1532], '1986;': [1539, 1570], '6:': [1540], '887-899Crossref': [1541], '(90)': [1544], 'pEJ': [1547, 2461], '(30Newbold': [1548], 'R.F.': [1549], 'Overell': [1550], '1983;': [1553], '304:': [1554], '648-651Crossref': [1555], '(323)': [1558], 'pMC29': [1561], '(31Heaney': [1562], 'Pierce': [1564], 'Parsons': [1566], 'J.T.': [1567], '60:': [1571], '167-176Crossref': [1572], 'pFBJ/R': [1576], '(32Miller': [1577], 'A.D.': [1578], 'Verma': [1579], 'I.M.': [1580], 'Curran': [1581], '1985;': [1585, 2008], '521-526Crossref': [1587], 'pcDNAv-src,': [1592, 2694], 'encode': [1593], '13': [1596, 2547, 2999], 'S': [1597, 2548], 'product,': [1599], 'respectively,': [1605], 'described.': [1609], 'Bcl-2': [1612, 2927, 2982, 3010, 3064], '(33Borzillo': [1618], 'G.V.': [1619], 'Endo': [1620], '869-876PubMed': [1627], 'parental': [1631, 3417], 'plamids': [1632], 'construction': [1635], 'cassette,': [1639], 'pUHD10-3': [1640, 1755], 'pUHD172-1,': [1642, 3206], 'developed': [1644, 3145], 'Gossen': [1646, 3147], 'et': [1647, 3148, 3957, 4134], 'al.': [1648, 3149, 3958, 4135], '(34Gossen': [1649, 3150, 3217], 'Freundlieb': [1651, 3152, 3219], 'Bender': [1653, 3154, 3221], 'Müler': [1655, 3156, 3223], 'Hillen': [1657, 3158, 3225], 'Bujard': [1659, 3160, 3227], '1766-1769Crossref': [1664, 3165, 3232], '(2051)': [1667, 3168, 3235], 'pTet-X': [1670, 1935, 3141, 3197], 'obtained': [1672, 1721, 1899], 'polymerase': [1674, 1717], 'chain': [1675, 1718], 'reaction': [1676, 1719], 'using': [1677, 1782, 1811, 1912, 1938, 2094, 3254, 3876], 'TAATACGACTCACTATAGGG': [1678], '5′-primer': [1681], 'GCTCAGAATTCTTAGCTAGCGTAATCTGGAACATCGTATGGGTATTCGGCAGAGGTGAAAAAGTTG': [1683], '3′-primer': [1686], 'pcDNA-X': [1688, 2447, 2685], 'template.': [1691], 'underlined': [1693], 'sequences': [1694], 'denote': [1695], 'EcoRI': [1697, 1751], 'site': [1698], 'introduced': [1699], 'facilitation': [1702], 'subcloning': [1704], 'sequence': [1707, 2017], 'encoding': [1708, 2699], 'hemagglutinin': [1710, 3192], 'tag,': [1711], 'respectively.': [1712, 2399], 'After': [1713, 1840, 1962, 2142, 2188, 2322, 2423, 3238], 'HindIII/EcoRI': [1714], 'digestion,': [1715], 'inserted': [1723], 'into': [1724, 1739, 1753, 2450, 3200], 'pcDNA1': [1725], '(Invitrogen),': [1726], 'yielding': [1727, 1741], 'pcDNA-HBx-HA.': [1730], 'Subsequently,': [1731, 2352], 'KpnI/XbaI': [1733], 'fragment': [1734, 1752], 'pcDNA-HBx-HA': [1736], 'subcloned': [1738], 'pUC18,': [1740], 'pUC18-HBx-HA,': [1744], 'followed': [1745], 'transfer': [1748], 'plasmid.': [1756], 'plated': [1760, 2111, 2288], 'DMEM': [1762, 1927, 2113, 2136, 2290, 2316, 2388, 3429, 3617], 'containing': [1763, 1855, 1928, 2114, 2135, 2243, 2291, 2315], '10%': [1764, 1929, 2115, 2292, 2391, 2395], 'at': [1767, 1827, 1875, 1892, 1949, 2190, 2219, 2226, 2258, 2349, 2364, 2415, 3193, 3548, 3560, 4041], 'density': [1769], '3': [1771], '×': [1772, 2108, 2272, 2285], '105cells/35-mm': [1773], 'plate.': [1774], 'Sixteen': [1775], 'h': [1776, 1821, 1944, 2122, 2301, 3448, 3520, 3635, 3827], 'later,': [1777, 2123, 2302, 3449, 3636], 'transfected': [1781, 1806, 2449, 3199], 'lipofection': [1784, 1940], 'technique': [1785], '1': [1787, 2174, 2368, 2737], 'μg': [1788, 1799], 'each': [1790, 2133, 2313, 2698], 'indicated': [1793, 1842, 2425], '0.4': [1798, 2419], 'pSV2neo.': [1801], 'total': [1803], 'amount': [1804, 3499], 'kept': [1809], 'constant': [1810], 'pUC19': [1813], 'carrier.': [1818], 'At': [1819, 1942, 4090, 4588], '48': [1820, 1943, 2327], 'post-transfection,': [1822, 1945], 'split': [1826, 1948], '2:1': [1829], 'ratio': [1830, 1952], 'cultured': [1832, 1925, 1954], '400': [1837, 1959], 'μg/ml': [1838, 1960, 2128, 2308, 2359, 3287, 3439, 3491, 3562, 3632, 3659], 'G418.': [1839, 1961, 2652, 2829, 3101], 'days': [1843, 1964, 3000], 'selective': [1845, 1966], 'medium,': [1846, 1967], 'fixed': [1850, 2334, 3527], 'PBS': [1853, 2363], 'solution': [1854], '0.2%': [1856, 1869, 2177], 'glutaraldehyde': [1857], '0.5%': [1859, 2336], 'formaldehyde': [1860, 2337], '10': [1862, 1873, 2194, 2230, 2339], 'min': [1863, 1874, 2185, 2257, 2340], 'ice': [1865], 'stained': [1867, 2356, 3529, 3640], 'crystal': [1870], 'violet': [1871], 'room': [1876, 2350], 'temperature,': [1877], 'number': [1880, 2564, 2716], 'foci': [1882, 2466, 2566, 2576, 3025, 3037], 'counted.': [1884], 'experiments': [1886, 1909], 'performed': [1888, 1911, 2093, 3385], 'duplicate': [1890], 'least': [1893], 'twice.': [1894], 'American': [1901], 'Type': [1902], 'Culture': [1903], 'Collection': [1904], '(passage': [1905], '259),': [1906], '<15': [1915], 'passages': [1916], 'original': [1919], 'stock.': [1920], 'pUHD172-1': [1937], 'technique.': [1941], '10:1': [1951], '21': [1963], 'individual': [1968, 4673], 'G418-resistant': [1969, 3215, 3242], 'colonies': [1970, 4001], 'isolated.': [1972], 'For': [1973, 2078, 2400, 2921, 3131, 4614], 'detection': [1975], 'protein,': [1978], 'polyclonal': [1979, 2035], 'rabbit': [1980], 'antiserum': [1981, 2037, 3256], 'raised': [1983, 2039, 3257], 'against': [1984, 2040, 3258], 'synthetic': [1986, 3260], 'peptide': [1987, 2020, 2025, 3261], 'corresponding': [1988, 3262], 'residues': [1990], '144–154': [1991, 3266], 'immunogenic': [2000], '(35Morianity': [2001], 'A.M.': [2002], 'Alexander': [2003], 'Lerner': [2005], 'R.A.': [2006], '227:': [2009], '429-433Crossref': [2010], '(123)': [2013], 'SPAPCNFFTSA,': [2022], 'conjugated': [2027], 'keyhole': [2029], 'limpet': [2030], 'hemocyanin': [2031], 'immunization.': [2033], 'anti-p53': [2036], 'glutathione': [2041], 'S-transferase-p53': [2042], 'purified': [2044], 'Escherichia': [2046], 'coli': [2047], 'p21': [2079, 3840], 'wafI/cipI,': [2080], 'monoclonal': [2082], 'antibody': [2083], '(Upstate': [2084], 'Biotechnology,': [2085], 'Inc.)': [2086], 'employed.': [2088, 3427], 'Western': [2089, 2434, 3252, 3297, 3341], 'blot': [2090], 'analysis': [2091, 3253, 3342], 'enhanced': [2096, 4714], 'chemiluminescence': [2097], 'system': [2098, 3144], '(Amersham': [2099], 'Corp.)': [2100], "manufacturer's": [2104], 'protocol.': [2105], '(3': [2107, 2284], '104)': [2109], '35-mm': [2119], 'dishes.': [2120], 'Twenty-four': [2121, 2300], '0,': [2124, 2303, 3435, 3627], '2,': [2125, 2304, 3436, 3628, 3655], '5': [2127, 3286, 3438, 3490], 'doxycycline': [2129, 2309, 3288, 3440, 3492, 3506, 3522, 3669], 'added': [2131, 2311, 3442, 3494], 'dish': [2134], 'supplemented': [2137, 2317, 2389, 3430, 3618], 'serum.': [2141, 2321], 'additional': [2144, 2324], 'incubation': [2145, 2325], '72': [2147], 'h,': [2148, 2328, 2369], 'harvested': [2152, 2430, 3455], 'washed': [2154, 2331, 2370], 'once': [2155], 'PBS.': [2157], 'pellets': [2160, 2234], 'resuspended': [2162, 2236], '0.1': [2164, 2206], 'ml': [2165], 'lysis': [2167, 4679], 'buffer': [2168, 2242], '(10': [2169], 'mm': [2170], 'Tris-HCl,': [2171], 'pH': [2172], '7.5,': [2173], 'mmEDTA,': [2175], 'Triton': [2178], 'X-100),': [2179], 'vortexed,': [2180], 'incubated': [2182, 2254, 3615], '20': [2184], 'ice.': [2187], 'centrifugation': [2189], '12,000': [2191, 2227], 'rpm': [2192, 2228], 'min,': [2195], 'precipitated': [2198], 'supernatants': [2201], 'addition': [2204], 'volume': [2207, 2213], '5.0m': [2209], 'NaCl': [2210], '0.5': [2212, 2271], 'isopropyl': [2215], 'alcohol.': [2216], 'Following': [2217], 'storage': [2218], '−20': [2220], '°C,': [2221], 'samples': [2223, 2262], 'centrifuged': [2225], 'min.': [2231], 'resulting': [2233], '50': [2238, 2259], 'μl': [2239], 'Tris/EDTA': [2241], 'proteinase': [2244], 'K': [2245], '(300': [2246], 'μg/ml)': [2247, 2252], 'RNase': [2249], '(100': [2251], '30': [2256], '°C.': [2260], 'electrophoresed': [2264], '1.5%': [2267], 'agarose': [2268, 3461], 'gel': [2269, 3462], 'Tris': [2273], 'borate/EDTA': [2274], 'buffer.': [2275], 'HBx-expressing': [2279, 3372, 3423, 3608], '102)': [2286], '7-mm': [2297], 'chamber': [2298, 2314], 'slide.': [2299], '5,': [2305, 3629, 3656], '7': [2307, 3631, 3658], 'ice,': [2342], 'permeated': [2344], '100%': [2346], 'methanol': [2347], 'treatment': [2348, 3276, 3813, 3846], 'temperature.': [2351], 'slides': [2354], '2': [2358, 3273, 3488, 3561], 'Hoechst': [2360, 3531, 3642], '33258': [2361, 3532], '37': [2365], '°C': [2366], 'visualized': [2374], 'fluorescent': [2377], 'UV': [2378], 'microscope.': [2379], 'HepG2': [2383, 3754], 'maintained': [2386], 'fetal': [2396], 'bovine': [2397], 'serum,': [2398, 3434], 'p21,': [2405], 'treated': [2409, 3653], 'chemotherapeutic': [2412], 'doxorubicin': [2414, 3704, 3845], 'concentration': [2417, 3550, 3667], '1.0': [2421], 'μg/ml.': [2422], 'times,': [2426], 'subjected': [2432], 'analysis.': [2435, 3298], 'To': [2436, 3394, 3411], 'investigate': [2437], 'alone': [2453, 4018, 4049], 'together': [2455], 'Ha-ras': [2458, 2491, 2596, 2614, 2619, 2623, 2632, 2637, 2641, 2646, 2674, 2808, 3014, 3027, 3086, 3089, 3094, 4110], '(TableI,': [2462], 'part': [2463, 2537], 'A).': [2464, 3172], 'No': [2465, 3465], 'alone,': [2473], 'whereas': [2474, 3477, 3553, 4229], 'expected': [2476], 'detected': [2480, 3482, 4661], 'Ha-ras.': [2484, 2510], 'coexpression': [2487, 2721, 3008, 3041, 4078, 4106], 'abrogation': [2495, 2572, 2727, 3050], 'Ha-ras-induced': [2497, 2575], 'somehow': [2503], 'interfered': [2504], 'effect': [2513], 'specific': [2515, 2581], 'wild-type': [2517, 3706], 'two': [2520, 3278, 3301, 3422, 3877, 3937], '(Xdel-1': [2525], 'Xdel-2)': [2527], 'not': [2529, 3344, 3572, 4020, 4039, 4060, 4601], 'able': [2530], 'disrupt': [2532], '(Table': [2535], 'I,': [2536], 'B).': [2538, 3848], 'control,': [2541, 3752], '(pMT13S)': [2551], 'pEJ.': [2554], 'Ha-rasacted': [2557], 'cooperatively': [2558], 'expected,': [2560], 'increased': [2563, 3503, 4707], 'observed,': [2568], 'confirming': [2569], 'nature': [2582], 'HBx.Table': [2584], 'IFocus': [2585], 'after': [2588, 2603, 2649, 2770, 2793, 2826, 3001, 3078, 3098, 3332, 3521, 3825], 'transfection': [2589, 2771], 'hbx': [2594, 2611, 2617, 2635, 2776], '±': [2595], 'plasmidsTransfected': [2598], 'genesNumber': [2599, 2626, 3074], 'foci9': [2601], 'days1-aDays': [2602], 'selection': [2604, 2650, 2794, 2827, 3002, 3079, 3099, 3239], 'G418.12': [2606], 'days16': [2607], 'days19': [2608], 'daysA.': [2609], 'neo0014': [2610], '+': [2612, 2615, 2618, 2622, 2624, 2633, 2636, 2640, 2642, 2645, 2799, 2803, 2807, 2810, 2812, 2814, 2816, 2818, 2820, 2822, 3085, 3088, 3091, 3093, 3095], 'neo0013': [2613], 'neo442030': [2616], '+neo0037': [2620], 'neo9304751Transfected': [2625], 'foci11': [2628, 2791, 3076], 'days14': [2629], 'daysB.': [2630], 'neo00': [2631], 'neo1925': [2634], '+neo13': [2638], 'Xdel1': [2639], 'neo713': [2643], 'Xdel2': [2644], '+neo19211-a': [2647], 'Days': [2648, 2825, 3097], 'Open': [2653, 2830, 3102], 'table': [2654, 2831, 3103], 'new': [2657, 2834, 3106], 'tab': [2658, 2835, 3107], 'examined': [2661], 'restricted': [2671], 'case': [2675], 'could': [2677], 'extended': [2679, 4797], 'We': [2683, 3680, 4754, 4776], 'different': [2689, 2779, 3878, 4186], 'plasmids,': [2691], 'pMC29,': [2692], 'pFBJ/R,': [2693], 'pMT13S,': [2695], 'pEJ,': [2697], 'E1a,': [2703], 'respectively': [2706], '(Fig.': [2707, 2736, 3463, 3533], '1).': [2708], 'Each': [2709], 'fair': [2715], 'foci,': [2718, 3021, 4069], 'TableII).': [2739], 'Therefore,': [2740, 3031, 3299, 3378], 'mediate': [2746], 'general': [2755], 'property': [2756, 2933, 4100], 'regardless': [2759], 'type': [2762, 3770, 3857], 'partner': [2764], 'tested.Table': [2766], 'IIFocus': [2767], 'plus': [2777, 3013], 'E1aTransfected': [2787], 'selectionNumber': [2789], 'days2-aDays': [2792], 'G418.13': [2796, 3081], 'daysneo00v-fos': [2797], '+neo1632hbx': [2798], 'v-fos': [2800], '+neo04v-src': [2801], '+neo712hbx': [2802], 'v-src': [2804], '+neo02Ha-ras': [2805], '+neo2636hbx': [2806], '+neo01E1a': [2809], 'neo918hbx': [2811], 'neo14v-myc': [2815], 'neo48hbx': [2817], 'v-myc': [2819], 'neo02E1a': [2821], 'Ha-ras+': [2823], 'neo36632-a': [2824], 'Insomuch': [2836], 'many': [2838], '22Yamada': [2864], '23Li': [2884], 'mediated': [2915, 3056], 'this': [2922, 3132, 3762, 3863, 4042, 4409, 4589], 'purpose,': [2923, 3133], 'anti-apoptotic': [2932, 3896, 4227, 4292], 'When': [2981], 'coexpressed': [2984], 'partial': [2992], 'rescue': [2993, 3018], '(TableIII).': [2997], 'Specifically,': [2998], 'G418': [3004], '(400': [3005], 'μg/ml),': [3006], '12': [3020], 'compared': [3022], '22': [3024], 'when': [3026, 3487, 4322], 'expressed': [3029], 'alone.': [3030], 'than': [3033, 4677], 'half': [3034], 'rescued': [3039], 'Bcl-2.': [3043, 3898], 'These': [3044, 3849], 'results': [3045, 3850, 3928], 'suggest': [3046, 3851, 4217], 'HBx-induced': [3049], 'probably': [3055], 'apoptosis.Table': [3061], 'IIIEffect': [3062], '(anti-apoptotic': [3065], 'protein)': [3066], 'formationTransfected': [3073], 'days3-aDays': [3077], 'daysneo00Ha-ras': [3082], '+neo1822bcl-2': [3083], '+neo11hbx': [3084], '+neo23hbx': [3087], '+bcl-2': [3090], 'neo512E1a': [3092], 'neo21323-a': [3096], 'confirm': [3110], 'possibility': [3112], 'possesses': [3115, 3581, 3870], 'apoptosis,': [3120, 3400], 'manner.': [3130, 3508, 3702], 'constructed': [3135], 'named': [3140], 'employing': [3142], '(Fig.2': [3171], 'pTet-X,': [3174], 'promoter,': [3186, 3354], 'tagged': [3190], 'carboxyl': [3195], 'terminus.': [3196], 'encodes': [3208], 'mutated': [3210], 'tetracycline': [3211], 'repressor': [3212], 'marker': [3216], 'colonies,': [3243], 'inducible': [3245], 'confirmed': [3250], 'amino': [3264], 'acids': [3265], 'Fig.': [3272], 'B,': [3274], '(CLX1': [3282], 'CLX2)': [3284], 'bands': [3295], 'routinely': [3305], 'rest': [3309], 'experiments.': [3313], 'Of': [3314], 'note': [3315], 'fact': [3318], 'level': [3322, 3358, 3808, 3824, 4222, 4297], 'decreased': [3329], 'rapidly,': [3330], 'passage': [3333], '15,': [3334], 'barely': [3338], 'detectable': [3339], '(data': [3343, 3571], 'shown).': [3345, 3573], 'suggests': [3348], 'even': [3350, 4011], 'leaky': [3356], 'low': [3357], 'sustained,': [3363], 'imparts': [3365], 'enough': [3366, 4063], 'toxicity': [3367], 'select': [3369], 'out': [3370], 'long-term': [3376], 'culture.': [3377], 'subsequently': [3380], 'assays': [3383], 'CLX1': [3387, 3484, 3651], 'CLX2': [3389, 3486, 3570], '<10': [3392], 'passages.': [3393], 'really': [3398], 'fragmentation': [3402, 3469, 3590, 3647, 3922], 'condensation': [3405, 3516, 3540, 3557, 3588, 3645], 'assayed': [3407, 4194], 'expression.': [3410, 3446], 'clones': [3425], 'Seventy-two': [3447], 'extracted': [3452], 'run': [3458], '3).': [3464], 'sign': [3466], 'ladders': [3480], 'medium.': [3497], 'fragmented': [3501], 'dose-dependent': [3507], 'effects': [3511, 4205], 'assayed.': [3518], 'Forty-eight': [3519, 3634], 'treatment,': [3523, 3705], '4).': [3534], 'Again,': [3535], 'no': [3536], 'signs': [3537], 'any': [3549, 4022, 4091], 'doxycycline,': [3552], 'CLX1,': [3555], 'evident': [3559, 3649], 'doxycycline.': [3563, 3633, 3660, 3662], 'result': [3566], 'From': [3574], 'conclude': [3578], 'apoptosis.Figure': [3586], '4Nuclear': [3587], 'cells.Control': [3601], '(left': [3605], 'panels)': [3606, 3613], '(CLX1)': [3611], '(right': [3612], '33258.': [3643], 'Nuclear': [3644], 'Dox,': [3661], 'numbers': [3664], 'represent': [3665], 'μg/ml.View': [3671], 'Large': [3672], 'Image': [3673], 'Figure': [3674], 'ViewerDownload': [3675], 'Hi-res': [3676], 'image': [3677], 'Download': [3678], '(PPT)': [3679], 'studied': [3681], 'status': [3684], 'insomuch': [3689, 4448], 'p53-dependent': [3699], 'p53-independent': [3701], 'Upon': [3703], 'accumulate': [3711, 3819], 'participate': [3713], 'response': [3717], 'damage': [3720], '(36Puisieux': [3721, 3771], 'Ji': [3723, 3773], 'Guillot': [3725, 3775], 'Legros': [3727, 3777], 'Soussi': [3729, 3779], 'Isselbacher': [3731, 3781], 'Ozturk': [3733, 3783], '1342-1346Crossref': [3744, 3794], '(49)': [3747, 3797], 'line': [3756, 3764], 'since': [3759, 4195, 4404], 'wild': [3769, 3856], 'Fig.5': [3803], 'A,': [3804], 'basal': [3806], 'low,': [3810], 'doxorubicin,': [3815], 'began': [3817], 'reached': [3821], 'maximal': [3823], '24': [3826], 'both': [3829], 'lines.': [3831], 'Accompanying': [3832], 'accumulation': [3834], 'p53,': [3836, 4330], 'wafI/cipI': [3841], '(Fig.5': [3847], 'report,': [3864], 'criteria.': [3879], 'First,': [3880], 'disrupted': [3882], 'blocked': [3893], 'Second,': [3899], 'condensation.': [3925], 'experimental': [3927], 'here': [3930], 'differ': [3931], 'previous': [3934], 'ones': [3935], 'aspects.': [3938], 'first': [3940], 'discrepancy': [3943, 4182], 'transform': [3952], 'Previously,': [3955], 'Shirakata': [3956], 'led': [3993], 'stimulation': [3996, 4054], 'growth': [3998, 4445, 4453, 4502], 'drug-resistant': [4000], 'nude': [4006], 'mice.': [4007], 'our': [4009, 4131, 4307], 'case,': [4010, 4308], 'though': [4012], 'different,': [4016], 'did': [4019], 'but': [4025, 4058, 4603], 'rather': [4026, 4676], 'reason': [4034], 'difference': [4037], 'clear': [4040], 'stage.': [4043], 'Perhaps,': [4044], 'sufficient': [4051], 'growth,': [4057], 'strong': [4062], 'stimulus': [4064, 4208, 4325, 4463], 'perturbation': [4074], 'caused': [4075], 'revealed': [4082], 'otherwise': [4084], 'latent': [4085], 'apoptosis-inducing': [4086, 4324], 'rate,': [4092], 'unique': [4099], 'cooperative': [4113], 'experiment.': [4119], 'With': [4120], 'regard': [4121], 'second': [4124], 'discrepancy,': [4127], 'contrast': [4129], 'finding,': [4132], 'showed': [4159], 'microinjection': [4162], 'blocks': [4168, 4280], 'primary': [4178], 'fibroblasts.': [4179], 'Possibly,': [4180], 'originated': [4183], 'determined': [4201], 'external': [4207], 'physiology': [4211], 'cell.': [4214], 'Recent': [4215], 'normal': [4220, 4296], 'physiological': [4221], 'displays': [4225], 'activity,': [4228], 'dose': [4232], '(37Lassus': [4237], 'Ferlin': [4239], 'Piette': [4241], 'Hibner': [4243], 'EMBO': [4245], '15:': [4248], '4566-4573Crossref': [4249], '(102)': [4252], '38Chen': [4255], 'X.': [4256], 'Ko': [4257], 'L.J.': [4258], 'Jayaraman': [4259], '10:': [4266], '2438-2451Crossref': [4267], '(660)': [4270], 'Considering': [4273], 'binds': [4276], 'function,': [4283], 'antagonizing': [4290], 'but,': [4309], 'also': [4367, 4777], 'serve': [4368], 'mitogen-activated': [4379], 'kinase/c-Jun': [4381], 'pathway': [4384, 4410], 'responsible': [4403, 4584], 'abnormal': [4406], 'regulation': [4407], 'lead': [4414], '(39Xia': [4417], 'Z.': [4418], 'Dickens': [4419], 'Raingeaud': [4421], 'Davis': [4423], 'Greenberg': [4425], 'M.E.': [4426], '1326-1331Crossref': [4430], '(5045)': [4433], 'Alternatively,': [4436], 'work': [4439], 'β': [4447, 4455, 4504], 'expression,': [4456], 'well': [4460, 4712], '(40Oberhammer': [4467], 'F.A.': [4468], 'Pavelka': [4469], 'Sharma': [4471], 'Tiefenbacher': [4473], 'Purchio': [4475], 'A.F.': [4476], 'Bursch': [4477], 'Hermann': [4479], 'R.S.': [4480], '5408-5412Crossref': [4490], '(680)': [4493], 'colocalized': [4499], '(41Yoo': [4508], 'Y.D.': [4509], 'Ueda': [4510], 'Park': [4512, 4800], 'Flanders': [4514], 'K.C.': [4515], 'Y.I.': [4517], 'Kim': [4520, 4803], 'S.-J.': [4521], 'Clin': [4523], 'Invest.': [4524], '97:': [4526], '388-395Crossref': [4527], '(154)': [4530], 'bind': [4539], 'damaged': [4540], 'sensitize': [4544], 'death': [4549], 'ultraviolet': [4551], 'irradiation': [4552], '(42Capovilla': [4553], 'Carmona': [4555], 'Arbuthnot': [4557], 'Biophys.': [4560], 'Commun.': [4562], '232:': [4564], '255-260Crossref': [4565], '(47)': [4568], 'Further': [4571], 'clarify': [4576], 'above': [4582], 'stage,': [4590], 'precise': [4592], 'during': [4597, 4623], 'natural': [4598], 'clear,': [4602], 'correlations': [4607], 'HCC.': [4613], 'example,': [4615], '(43Galle': [4628], 'P.R.': [4629], 'Hepatol.': [4631], '(Amst.).': [4632], '27:': [4634], '405-412Abstract': [4635], '(83)': [4641], '44Patel': [4644], 'Gores': [4646], 'G.J.': [4647], 'Hepatology.': [4648], '21:': [4650], '1725-1741PubMed': [4651], 'Apoptotic': [4654], 'bodies': [4655], '"piecemeal': [4657], 'necrosis"': [4658], 'frequently': [4660], 'likely': [4667], 'occur': [4669], 'infected': [4674], 'focal': [4678], 'hepatocytes,': [4681], 'they': [4683], 'often': [4685], 'absence': [4689], 'adjacent': [4691], 'inflammation': [4692], 'features': [4694], 'necrosis.': [4696], 'hepatocarcinogenesis,': [4699], 'preneoplastic': [4700], 'neoplastic': [4702], 'populations': [4704], 'show': [4705], 'rate': [4708], 'proliferation': [4716], '(45Bursch': [4717], 'Grasl-Kraupp': [4719], 'Ellinger': [4721], 'Torok': [4723], 'Kienzl': [4725], 'Mullauer': [4727], 'Schulte-Hermann': [4729], 'Cell': [4732], '72:': [4735], '669-675Crossref': [4736], '(29)': [4739], 'involvement': [4744], 'pathological': [4749], 'needs': [4751], 'further': [4752], 'investigation.': [4753], 'thank': [4755, 4778], 'members': [4757], 'laboratory,': [4760], 'especially': [4761], 'Lee,': [4763], 'Kim,': [4766], 'Hong,': [4770], 'materials': [4772], 'helpful': [4774], 'discussions.': [4775], 'Sung,': [4780], 'Suh,': [4782], 'Park,': [4784], 'Ji,': [4786], 'Shin,': [4788], 'Shin': [4791], 'various': [4793], 'materials.': [4794], 'Thanks': [4795], 'kindly': [4805], 'introducing': [4806], 'histochemistry.': [4813]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2050274505', 'counts_by_year': [{'year': 2024, 'cited_by_count': 1}, {'year': 2023, 'cited_by_count': 2}, {'year': 2022, 'cited_by_count': 1}, {'year': 2021, 'cited_by_count': 1}, {'year': 2020, 'cited_by_count': 1}, {'year': 2019, 'cited_by_count': 2}, {'year': 2018, 'cited_by_count': 2}, {'year': 2017, 'cited_by_count': 3}, {'year': 2016, 'cited_by_count': 6}, {'year': 2015, 'cited_by_count': 1}, {'year': 2014, 'cited_by_count': 2}, {'year': 2013, 'cited_by_count': 3}, {'year': 2012, 'cited_by_count': 7}], 'updated_date': '2024-12-09T02:26:13.805687', 'created_date': '2016-06-24'}