Structural Features of Galectin-9 and Galectin-1 That Determine Distinct T Cell Death Pathways

Name: Work Video:
Duration: 3 min 30 s
Shuguang Bi; Lesley A. Earl; Linsey Jacobs; Linda G. Baum
{'id': 'https://openalex.org/W2049652679', 'doi': 'https://doi.org/10.1074/jbc.m800523200', 'title': 'Structural Features of Galectin-9 and Galectin-1 That Determine Distinct T Cell Death Pathways', 'display_name': 'Structural Features of Galectin-9 and Galectin-1 That Determine Distinct T Cell Death Pathways', 'publication_year': 2008, 'publication_date': '2008-02-08', 'ids': {'openalex': 'https://openalex.org/W2049652679', 'doi': 'https://doi.org/10.1074/jbc.m800523200', 'mag': '2049652679', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/18258591', 'pmcid': 'https://www.ncbi.nlm.nih.gov/pmc/articles/2431002'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m800523200', 'pdf_url': 'http://www.jbc.org/article/S0021925820493275/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820493275/pdf', 'any_repository_has_fulltext': True}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5111131143', 'display_name': 'Shuguang Bi', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I161318765', 'display_name': 'University of California, Los Angeles', 'ror': 'https://ror.org/046rm7j60', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I161318765']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Shuguang Bi', 'raw_affiliation_strings': ['Department of Pathology and Laboratory Medicine, UCLA School of Medicine, Los Angeles, California 90095, USA.'], 'affiliations': [{'raw_affiliation_string': 'Department of Pathology and Laboratory Medicine, UCLA School of Medicine, Los Angeles, California 90095, USA.', 'institution_ids': ['https://openalex.org/I161318765']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5016825268', 'display_name': 'Lesley A. Earl', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I161318765', 'display_name': 'University of California, Los Angeles', 'ror': 'https://ror.org/046rm7j60', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I161318765']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Lesley A. Earl', 'raw_affiliation_strings': ['Department of Pathology and Laboratory Medicine, UCLA School of Medicine, Los Angeles, California, 90095'], 'affiliations': [{'raw_affiliation_string': 'Department of Pathology and Laboratory Medicine, UCLA School of Medicine, Los Angeles, California, 90095', 'institution_ids': ['https://openalex.org/I161318765']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5113851261', 'display_name': 'Linsey Jacobs', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I161318765', 'display_name': 'University of California, Los Angeles', 'ror': 'https://ror.org/046rm7j60', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I161318765']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Linsey Jacobs', 'raw_affiliation_strings': ['Department of Pathology and Laboratory Medicine, UCLA School of Medicine, Los Angeles, California, 90095'], 'affiliations': [{'raw_affiliation_string': 'Department of Pathology and Laboratory Medicine, UCLA School of Medicine, Los Angeles, California, 90095', 'institution_ids': ['https://openalex.org/I161318765']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5110060760', 'display_name': 'Linda G. Baum', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I161318765', 'display_name': 'University of California, Los Angeles', 'ror': 'https://ror.org/046rm7j60', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I161318765']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Linda G. Baum', 'raw_affiliation_strings': ['Department of Pathology and Laboratory Medicine, UCLA School of Medicine, Los Angeles, California, 90095'], 'affiliations': [{'raw_affiliation_string': 'Department of Pathology and Laboratory Medicine, UCLA School of Medicine, Los Angeles, California, 90095', 'institution_ids': ['https://openalex.org/I161318765']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 4.546, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 137, 'citation_normalized_percentile': {'value': 0.999911, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 97, 'max': 98}, 'biblio': {'volume': '283', 'issue': '18', 'first_page': '12248', 'last_page': '12258'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T12387', 'display_name': 'Galectins and Cancer Biology', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2403', 'display_name': 'Immunology'}, 'field': {'id': 'https://openalex.org/fields/24', 'display_name': 'Immunology and Microbiology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T12387', 'display_name': 'Galectins and Cancer Biology', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2403', 'display_name': 'Immunology'}, 'field': {'id': 'https://openalex.org/fields/24', 'display_name': 'Immunology and Microbiology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10717', 'display_name': 'Aluminum Alloys Composites Properties', 'score': 0.9049, 'subfield': {'id': 'https://openalex.org/subfields/2210', 'display_name': 'Mechanical Engineering'}, 'field': {'id': 'https://openalex.org/fields/22', 'display_name': 'Engineering'}, 'domain': {'id': 'https://openalex.org/domains/3', 'display_name': 'Physical Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/galectin', 'display_name': 'Galectin', 'score': 0.9313751}, {'id': 'https://openalex.org/keywords/galectin-3', 'display_name': 'Galectin-3', 'score': 0.56240654}, {'id': 'https://openalex.org/keywords/galectin-1', 'display_name': 'Galectin-1', 'score': 0.5066317}], 'concepts': [{'id': 'https://openalex.org/C156293190', 'wikidata': 'https://www.wikidata.org/wiki/Q83138026', 'display_name': 'Galectin', 'level': 2, 'score': 0.9313751}, {'id': 'https://openalex.org/C31573885', 'wikidata': 'https://www.wikidata.org/wiki/Q304484', 'display_name': 'Programmed cell death', 'level': 3, 'score': 0.58170575}, {'id': 'https://openalex.org/C79879829', 'wikidata': 'https://www.wikidata.org/wiki/Q5571762', 'display_name': 'Intracellular', 'level': 2, 'score': 0.57446027}, {'id': 'https://openalex.org/C2776336362', 'wikidata': 'https://www.wikidata.org/wiki/Q18028529', 'display_name': 'Galectin-3', 'level': 2, 'score': 0.56240654}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.5363855}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.52397364}, {'id': 'https://openalex.org/C2778735756', 'wikidata': 'https://www.wikidata.org/wiki/Q18028523', 'display_name': 'Galectin-1', 'level': 2, 'score': 0.5066317}, {'id': 'https://openalex.org/C170493617', 'wikidata': 'https://www.wikidata.org/wiki/Q208467', 'display_name': 'Receptor', 'level': 2, 'score': 0.4381092}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.2586618}, {'id': 'https://openalex.org/C203014093', 'wikidata': 'https://www.wikidata.org/wiki/Q101929', 'display_name': 'Immunology', 'level': 1, 'score': 0.18959859}, {'id': 'https://openalex.org/C190283241', 'wikidata': 'https://www.wikidata.org/wiki/Q14599311', 'display_name': 'Apoptosis', 'level': 2, 'score': 0.13914543}], 'mesh': [{'descriptor_ui': 'D037483', 'descriptor_name': 'Galectin 1', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': True}, {'descriptor_ui': 'D037483', 'descriptor_name': 'Galectin 1', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D037161', 'descriptor_name': 'Galectins', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': True}, {'descriptor_ui': 'D037161', 'descriptor_name': 'Galectins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D013601', 'descriptor_name': 'T-Lymphocytes', 'qualifier_ui': 'Q000166', 'qualifier_name': 'cytology', 'is_major_topic': True}, {'descriptor_ui': 'D016923', 'descriptor_name': 'Cell Death', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002460', 'descriptor_name': 'Cell Line', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D037483', 'descriptor_name': 'Galectin 1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D037161', 'descriptor_name': 'Galectins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006023', 'descriptor_name': 'Glycoproteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006023', 'descriptor_name': 'Glycoproteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D042541', 'descriptor_name': 'Intracellular Space', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D042541', 'descriptor_name': 'Intracellular Space', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D008024', 'descriptor_name': 'Ligands', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016131', 'descriptor_name': 'Lymphocyte Subsets', 'qualifier_ui': 'Q000166', 'qualifier_name': 'cytology', 'is_major_topic': False}, {'descriptor_ui': 'D016131', 'descriptor_name': 'Lymphocyte Subsets', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011134', 'descriptor_name': 'Polysaccharides', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D011134', 'descriptor_name': 'Polysaccharides', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017434', 'descriptor_name': 'Protein Structure, Tertiary', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011956', 'descriptor_name': 'Receptors, Cell Surface', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D011956', 'descriptor_name': 'Receptors, Cell Surface', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D020449', 'descriptor_name': 'Repetitive Sequences, Amino Acid', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017154', 'descriptor_name': 'Stromal Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017154', 'descriptor_name': 'Stromal Cells', 'qualifier_ui': 'Q000166', 'qualifier_name': 'cytology', 'is_major_topic': False}, {'descriptor_ui': 'D017154', 'descriptor_name': 'Stromal Cells', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D013329', 'descriptor_name': 'Structure-Activity Relationship', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013601', 'descriptor_name': 'T-Lymphocytes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013950', 'descriptor_name': 'Thymus Gland', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013950', 'descriptor_name': 'Thymus Gland', 'qualifier_ui': 'Q000166', 'qualifier_name': 'cytology', 'is_major_topic': False}], 'locations_count': 4, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m800523200', 'pdf_url': 'http://www.jbc.org/article/S0021925820493275/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': True, 'landing_page_url': 'https://europepmc.org/articles/pmc2431002', 'pdf_url': 'https://europepmc.org/articles/pmc2431002?pdf=render', 'source': {'id': 'https://openalex.org/S4306400806', 'display_name': 'Europe PMC (PubMed Central)', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1303153112', 'host_organization_name': 'European Bioinformatics Institute', 'host_organization_lineage': ['https://openalex.org/I1303153112'], 'host_organization_lineage_names': ['European Bioinformatics Institute'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': True, 'landing_page_url': 'https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2431002', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S2764455111', 'display_name': 'PubMed Central', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/18258591', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m800523200', 'pdf_url': 'http://www.jbc.org/article/S0021925820493275/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'id': 'https://metadata.un.org/sdg/3', 'score': 0.83, 'display_name': 'Good health and well-being'}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 61, 'referenced_works': ['https://openalex.org/W1489515336', 'https://openalex.org/W1503857509', 'https://openalex.org/W1516996919', 'https://openalex.org/W1541574343', 'https://openalex.org/W1567285907', 'https://openalex.org/W1585589080', 'https://openalex.org/W1596091734', 'https://openalex.org/W1763310158', 'https://openalex.org/W1820309072', 'https://openalex.org/W1874098526', 'https://openalex.org/W1876412445', 'https://openalex.org/W1964004995', 'https://openalex.org/W1965330885', 'https://openalex.org/W1968091639', 'https://openalex.org/W1969925688', 'https://openalex.org/W1971231511', 'https://openalex.org/W1974053860', 'https://openalex.org/W1980069375', 'https://openalex.org/W1980631793', 'https://openalex.org/W1982095943', 'https://openalex.org/W1985998548', 'https://openalex.org/W2007671824', 'https://openalex.org/W2008803062', 'https://openalex.org/W2012285230', 'https://openalex.org/W2029330083', 'https://openalex.org/W2031798405', 'https://openalex.org/W2041659209', 'https://openalex.org/W2046148841', 'https://openalex.org/W2046361773', 'https://openalex.org/W2050983302', 'https://openalex.org/W2053289663', 'https://openalex.org/W2053480920', 'https://openalex.org/W2053959071', 'https://openalex.org/W2058591356', 'https://openalex.org/W2060490044', 'https://openalex.org/W2061460842', 'https://openalex.org/W2066251525', 'https://openalex.org/W2067868934', 'https://openalex.org/W2070631889', 'https://openalex.org/W2072772016', 'https://openalex.org/W2088585449', 'https://openalex.org/W2094920104', 'https://openalex.org/W2107812434', 'https://openalex.org/W2113132053', 'https://openalex.org/W2114569569', 'https://openalex.org/W2124614586', 'https://openalex.org/W2129345841', 'https://openalex.org/W2132054009', 'https://openalex.org/W2133492486', 'https://openalex.org/W2133737923', 'https://openalex.org/W2135631468', 'https://openalex.org/W2144218935', 'https://openalex.org/W2146421447', 'https://openalex.org/W2146796201', 'https://openalex.org/W2155658028', 'https://openalex.org/W2157274127', 'https://openalex.org/W2157672076', 'https://openalex.org/W2164055911', 'https://openalex.org/W2169841941', 'https://openalex.org/W2171872740', 'https://openalex.org/W2188713841'], 'related_works': ['https://openalex.org/W4313381252', 'https://openalex.org/W4300349701', 'https://openalex.org/W4281285546', 'https://openalex.org/W2506475006', 'https://openalex.org/W2382233096', 'https://openalex.org/W2119342878', 'https://openalex.org/W2115230055', 'https://openalex.org/W1999561602', 'https://openalex.org/W1965920153', 'https://openalex.org/W1836000002'], 'abstract_inverted_index': {'The': [0, 90, 243, 333, 1406, 1436, 1659, 2411, 2942, 3149, 3205, 3219, 3274, 3287, 3355, 3388, 3417, 3438, 3546, 4146], 'galectin': [1, 244, 572, 1349, 1368, 2516, 2536, 3770], 'family': [2, 245, 573, 626, 2577], 'of': [3, 19, 141, 152, 164, 194, 210, 235, 246, 262, 384, 395, 407, 437, 453, 478, 499, 512, 556, 570, 574, 632, 663, 902, 1070, 1076, 1415, 1503, 1610, 1623, 1630, 1677, 1687, 1696, 1706, 1731, 1855, 1913, 2035, 2319, 2328, 2332, 2370, 2414, 2421, 2467, 2482, 2490, 2498, 2526, 2540, 2560, 2578, 2793, 2798, 2937, 3152, 3222, 3290, 3358, 3380, 3391, 3442, 3464, 3483, 3584, 3715, 3768, 4025, 4103, 4110, 4143, 4149, 4162, 4171, 4240, 4339], 'lectins': [4, 247, 576], 'regulates': [5, 248, 497, 2581], 'multiple': [6, 249], 'biologic': [7, 250, 2426], 'functions,': [8, 251], 'such': [9, 252], 'as': [10, 99, 134, 253, 342, 377, 508, 510, 1373, 1949, 2142, 3131, 3161, 3184, 3198, 3231, 3255, 3267, 3299, 3325, 3596, 3827, 3882, 4176], 'development,': [11, 254, 495], 'inflammation,': [12, 255], 'immunity,': [13, 256], 'and': [14, 48, 58, 66, 76, 82, 136, 157, 169, 187, 216, 226, 257, 291, 301, 309, 319, 325, 379, 400, 412, 430, 459, 469, 635, 640, 660, 665, 675, 906, 915, 1050, 1065, 1072, 1079, 1121, 1135, 1150, 1259, 1358, 1512, 1607, 1626, 1664, 1668, 1703, 1717, 1737, 1745, 1853, 1858, 1927, 2037, 2042, 2125, 2137, 2225, 2379, 2424, 2437, 2449, 2455, 2469, 2480, 2500, 2511, 2555, 2586, 2758, 2788, 2826, 2965, 3014, 3062, 3081, 3099, 3108, 3115, 3134, 3145, 3157, 3193, 3215, 3227, 3243, 3262, 3284, 3295, 3310, 3384, 3400, 3433, 3445, 3453, 3471, 3487, 3498, 3528, 3533, 3566, 3572, 3580, 3592, 3681, 3695, 3754, 3780, 3794, 3811, 3824, 3852, 3943, 3953, 4005, 4010, 4023, 4093, 4116, 4141, 4167, 4276, 4292, 4313, 4321, 4332], 'cancer.': [15, 258], 'One': [16, 259], 'common': [17, 260], 'function': [18, 261], 'several': [20, 263, 2215], 'galectins': [21, 39, 92, 237, 264, 282, 335, 480, 894, 1116, 1353, 2416, 2554, 2561, 3640, 3718, 3922], 'is': [22, 265, 488, 647, 1042, 1371, 1439, 1933, 1947, 1963, 2029, 2380, 2537, 2569], 'the': [23, 33, 131, 153, 182, 192, 201, 207, 232, 266, 276, 374, 396, 425, 435, 444, 450, 475, 506, 571, 624, 641, 648, 1045, 1262, 1348, 1351, 1366, 1445, 1484, 1600, 1605, 1614, 1662, 1674, 1685, 1694, 1697, 1701, 1721, 1724, 1728, 1732, 1905, 1911, 1925, 2464, 2523, 2527, 2538, 2541, 2545, 2557, 2789, 2899, 2951, 3051, 3077, 3135, 3189, 3202, 3256, 3259, 3268, 3271, 3352, 3376, 3381, 3407, 3413, 3477, 3481, 3512, 3523, 3541, 3560, 3573, 3712, 3716, 3765, 3769, 3792, 3795, 3924, 4097, 4160, 4337], 'ability': [24, 267], 'to': [25, 42, 85, 191, 231, 268, 285, 328, 434, 474, 522, 629, 651, 680, 899, 1082, 1360, 1365, 1410, 1483, 1712, 1863, 2031, 2128, 2214, 2444, 2473, 2515, 2563, 3076, 3159, 3187, 3229, 3297, 3375, 3406, 3535, 3558, 3627, 3763, 3790, 4096, 4107, 4120, 4159, 4326], 'trigger': [26, 86, 269, 329, 681, 900, 2564], 'T': [27, 64, 67, 87, 104, 117, 240, 270, 307, 310, 330, 347, 360, 483, 493, 501, 514, 558, 638, 643, 903, 908, 1084, 1129, 1304, 1343, 1416, 1743, 1746, 1915, 1941, 2039, 2045, 2131, 2216, 2321, 2372, 2439, 2528, 2547, 2582, 2743, 2960, 3068, 3702, 4306, 4328, 4334], 'cell': [28, 50, 68, 88, 105, 118, 126, 218, 241, 271, 293, 311, 331, 348, 361, 369, 461, 484, 494, 559, 644, 904, 909, 1130, 1417, 1513, 1691, 1747, 1916, 1942, 1961, 2132, 2217, 2440, 2457, 2484, 2520, 2529, 2548, 2583, 2744, 2961, 3725, 3731, 3854, 3989, 4080, 4329], 'death.': [29, 89, 242, 272, 332, 485, 1133, 1692], 'However,': [30, 197, 273, 440, 1058, 1904, 4336], 'differences': [31, 274, 1660, 1923, 2474], 'among': [32, 275], 'death': [34, 46, 97, 106, 119, 213, 277, 289, 340, 349, 362, 456, 487, 560, 631, 645, 659, 671, 685, 901, 1052, 1418, 1917, 1929, 1962, 2318, 2369, 2441, 2453, 2479, 2530, 2549, 2567, 3804, 3855, 3990, 4081], 'pathways': [35, 278, 561, 1053, 2550, 2568], 'triggered': [36, 279, 567, 2532], 'by': [37, 109, 122, 175, 280, 352, 365, 418, 568, 1055, 1492, 2533, 2552, 3327, 3428, 3511, 3540, 3576, 3653, 3807, 4015, 4157], 'various': [38, 281, 907, 2495, 3717], 'with': [40, 167, 283, 410, 1376, 1444, 1488, 1500, 1727, 2442, 2809, 2834, 2840, 2903, 2911, 2917, 2955, 3000, 3055, 3351, 3396, 3430, 3485, 3526, 3631, 3688, 3711, 3799, 3921, 3939, 3945, 3982, 4007, 4228, 4264, 4274, 4278, 4286, 4317], 'regard': [41, 284, 2443], 'glycoprotein': [43, 83, 286, 326, 654, 1046, 1077, 2134, 2143, 2450], 'receptors,': [44, 287, 1047, 2451], 'intracellular': [45, 96, 110, 123, 288, 339, 353, 366, 684, 1051, 2452], 'pathways,': [47, 98, 290, 341], 'target': [49, 217, 292, 460, 1127, 2422, 2456, 2483], 'specificity': [51, 294, 2510, 2539], 'are': [52, 295, 1137, 1603, 1612, 1921], 'not': [53, 102, 115, 296, 345, 358, 2324], 'well': [54, 297, 509, 4118], 'understood.': [55, 298], 'Specifically,': [56, 299], 'galectin-9': [57, 75, 135, 156, 168, 300, 318, 378, 399, 411, 916, 1136, 1260, 1481, 1498, 1611, 1678, 1698, 1707, 1738, 1859, 1914, 1928, 1932, 2028, 2124, 2146, 2470, 2704, 3180, 3263, 3593, 3696, 3781, 4249], 'galectin-1': [59, 77, 137, 170, 302, 320, 380, 413, 642, 658, 670, 676, 1064, 1258, 1370, 1437, 1733, 1736, 1857, 1926, 1938, 1946, 2126, 2212, 2468, 2499, 2672, 3082, 3127, 3194, 3251, 3320, 3359, 3392, 3414, 4244, 4320], 'both': [60, 303, 1856, 2508, 3153, 3223, 3291], 'kill': [61, 304, 1067, 1083, 1740, 4327], 'thymocytes,': [62, 305, 1071, 1741, 2041, 4331], 'peripheral': [63, 306, 637, 1742, 2043, 4333], 'cells,': [65, 308, 639, 1744, 2040], 'lines;': [69, 312], 'however,': [70, 313, 2522], 'we': [71, 160, 198, 314, 403, 441, 2433, 2486, 2505], 'have': [72, 315, 562, 672, 895, 1261, 1354, 1506, 1713, 1860, 1909, 2139, 3624], 'found': [73, 180, 199, 316, 423, 442, 1062], 'that': [74, 181, 200, 317, 424, 443, 1063, 1346, 1379, 1673, 1908, 1919, 2417, 2471, 2493, 2507, 3616, 3623], 'require': [78, 321], 'different': [79, 95, 139, 176, 236, 322, 338, 382, 419, 479, 1068, 1115, 1119, 1123, 1361, 1504, 1510, 1681, 2130, 2415, 2546, 2553], 'glycan': [80, 323, 1048, 1080, 2447], 'ligands': [81, 324, 667, 1081, 1632, 2448], 'receptors': [84, 327, 655, 1078, 2144], 'two': [91, 132, 334, 375, 1352, 1446, 1489, 1601, 1615, 1675, 1729, 3514, 3543], 'also': [93, 128, 336, 371, 896, 1709], 'utilize': [94, 337], 'galectin-9,': [100, 116, 343, 359, 1688, 3093, 3468], 'but': [101, 114, 344, 357], 'galectin-1,': [103, 113, 159, 346, 356, 402, 1598, 3103, 3586, 3678, 3751], 'was': [107, 120, 206, 350, 363, 449, 623, 3048, 3070, 3129, 3182, 3196, 3253, 3265, 3349, 3361, 3394, 3456, 3474, 3496, 3520, 3756, 3782, 3788, 3805, 3913, 3966, 4133, 4155], 'blocked': [108, 121, 351, 364, 4227], 'Bcl-2,': [111, 354], 'whereas': [112, 355, 2211, 3692], 'galectin-3.': [124, 367], 'Target': [125, 368], 'susceptibility': [127, 370, 2458, 2481], 'differed': [129, 372], 'between': [130, 373, 1723, 1924], 'galectins,': [133, 376], 'killed': [138, 381], 'subsets': [140, 383, 1069, 1131], 'murine': [142, 385, 1868, 2460], 'thymocytes.': [143, 386, 2461], 'To': [144, 387, 2462, 3122, 3175, 3246, 3313, 3986, 4077], 'define': [145, 388, 1347], 'structural': [146, 389, 1356, 2412, 2465, 2496, 2558], 'features': [147, 390, 1357, 2413, 2466, 2497, 2559], 'responsible': [148, 391], 'for': [149, 392, 669, 1132, 1413, 2145, 2446, 2478, 3165, 3201, 3235, 3258, 3270, 3302, 3424, 3435, 3634, 3722, 3750, 3777, 3930, 3962, 3971, 4017, 4235], 'distinct': [150, 229, 393, 472, 557, 1074, 1355, 1628, 2425, 2566], 'activities': [151, 394], 'tandem': [154, 397, 1485], 'repeat': [155, 398, 1486], 'dimeric': [158, 401, 1367, 1407], 'created': [161, 404], 'a': [162, 405, 682, 1374, 1440, 1493, 1867, 1950, 1955, 2488, 2534, 2570, 3087, 3162, 3185, 3199, 3232, 3364, 3644, 3657, 3815, 4001, 4301], 'series': [163, 406, 2489], 'bivalent': [165, 408, 1956, 3319], 'constructs': [166, 409], 'carbohydrate': [171, 184, 203, 221, 414, 427, 446, 464, 1264, 1273, 1312], 'recognition': [172, 185, 204, 222, 415, 428, 447, 465, 1265, 1274, 1313, 2420], 'domains': [173, 416, 1266], 'connected': [174, 417], 'peptide': [177, 189, 420, 432, 1495, 1501], 'linkers.': [178, 421], 'We': [179, 422], 'N-terminal': [183, 426, 1606, 3190, 3260], 'domain': [186, 205, 223, 429, 448, 466, 3357, 3390], 'linker': [188, 431, 1699], 'contributed': [190, 433], 'potency': [193, 436, 2517], 'these': [195, 438, 1056, 2503, 2565], 'constructs.': [196, 439], 'C-terminal': [202, 445, 1608, 1665, 1704, 2542, 3203, 3272], 'primary': [208, 451, 2524, 4260], 'determinant': [209, 452, 2525], 'receptor': [211, 454, 2476], 'recognition,': [212, 455], 'pathway': [214, 457, 646, 686, 2531], 'signaling,': [215, 458], 'susceptibility.': [219, 462], 'Thus,': [220, 463], 'specificity,': [224, 467], 'presentation,': [225, 468], 'valency': [227, 470], 'make': [228, 471], 'contributions': [230, 473], 'specific': [233, 476, 661, 1128, 2535], 'effects': [234, 477, 2427], 'in': [238, 481, 492, 505, 657, 1113, 1122, 1140, 1450, 1509, 1661, 1683, 1720, 1866, 1939, 1965, 2326, 2375, 2475, 2518, 2573, 2804, 2898, 2950, 2994, 3050, 3733, 3745, 3760, 3772, 3979, 3991, 4082, 4152, 4232, 4255], 'initiating': [239, 482], 'Cell': [486, 526, 833, 2355, 2741, 2864, 2926, 3703, 3803, 3911, 4307], 'an': [489, 1451, 1618], 'essential': [490, 2664], 'factor': [491], 'which': [496, 3373, 3404], 'selection': [498], 'functional': [500], 'cells': [502, 515, 1085, 2046, 2322, 2373, 2423, 2832, 2909, 3069, 3621, 3708, 3793, 3796, 3918, 3976, 4012, 4151], 'during': [503], 'development': [504], 'thymus,': [507], 'elimination': [511], 'activated': [513, 636], 'after': [516, 3412], 'microbial': [517], 'infection': [518], 'or': [519, 1954, 2330, 2839, 2916, 3172, 3241, 3308, 3719, 3727, 3927, 4251, 4268], 'other': [520], 'exposure': [521], 'antigen': [523], '(1Opferman': [524], 'J.T.': [525, 709, 730, 1157, 1771, 1841, 2234, 4184], 'Death': [527, 834, 2356, 2865, 3704, 3870, 4308], 'Differ.': [528, 835, 2357, 2866], '2008;': [529], '15:': [530], '234-242Crossref': [531], 'PubMed': [532, 549, 589, 604, 617, 699, 718, 738, 762, 786, 810, 839, 865, 888, 938, 962, 983, 1006, 1035, 1105, 1166, 1187, 1204, 1220, 1252, 1401, 1431, 1474, 1531, 1557, 1592, 1654, 1761, 1780, 1801, 1827, 1901, 1984, 2019, 2071, 2092, 2118, 2170, 2206, 2242, 2266, 2292, 2311, 2361, 2406, 2696, 2781, 2870, 2891, 2931, 2987, 3043, 3344, 3610, 3671, 3841, 3906, 4048, 4072, 4193, 4220], 'Scopus': [533, 550, 590, 605, 618, 700, 719, 739, 763, 787, 811, 840, 866, 889, 939, 963, 984, 1007, 1036, 1106, 1167, 1188, 1205, 1221, 1253, 1402, 1432, 1475, 1532, 1558, 1593, 1655, 1762, 1781, 1802, 1828, 1985, 2020, 2072, 2093, 2119, 2171, 2207, 2243, 2267, 2293, 2312, 2362, 2407, 2697, 2782, 2871, 2892, 2932, 2988, 3044, 3345, 3611, 3672, 3842, 3907, 4049, 4073, 4194, 4221], '(87)': [534, 2021], 'Google': [535, 552, 592, 607, 620, 702, 721, 741, 765, 789, 813, 842, 868, 891, 941, 965, 986, 1009, 1038, 1108, 1169, 1190, 1207, 1223, 1255, 1404, 1434, 1477, 1534, 1560, 1595, 1657, 1764, 1783, 1804, 1830, 1851, 1902, 1987, 2022, 2074, 2095, 2121, 2173, 2209, 2245, 2269, 2295, 2314, 2364, 2409, 2699, 2784, 2873, 2894, 2934, 2990, 3046, 3347, 3613, 3674, 3844, 3909, 4051, 4075, 4196, 4223], 'Scholar,': [536, 593, 608, 703, 722, 742, 766, 790, 814, 843, 869, 942, 966, 987, 1010, 1170, 1191, 1208, 1224, 1535, 1561, 1765, 1784, 1805, 1831, 1988, 2075, 2096, 2174, 2246, 2270, 2296, 2874, 4052, 4197], '2Starr': [537], 'T.K.': [538], 'Jameson': [539], 'S.C.': [540], 'Hogquist': [541], 'K.A.': [542], 'Annu.': [543], 'Rev.': [544, 599], 'Immunol.': [545, 734, 782, 861, 934, 958, 1101, 1823, 1847, 1980, 2015, 2114, 2166, 2238, 2262, 2288, 2402, 2777, 3340, 3902, 4044, 4068], '2003;': [546, 802, 1824, 2115, 2403, 3035, 3607, 3668], '21:': [547], '139-176Crossref': [548], '(1181)': [551], 'Scholar).': [553, 621, 892, 1039, 1256, 1405, 1435, 1478, 1596, 1658, 1903, 2023, 2122, 2315, 2365, 2410, 3675, 3845, 3910, 4076, 4224], 'A': [554], 'number': [555, 4148, 4161], 'been': [563, 673, 678, 897, 1507, 1861, 2140, 4324], 'described,': [564], 'including': [565, 911, 1144, 2220], 'those': [566], 'members': [569], 'vertebrate': [575], '(3Camby': [577], 'I.': [578], 'LeMercier': [579], 'M.': [580, 728, 744, 748, 772, 792, 794, 818, 857, 883, 920, 948, 1024, 1091, 1230, 1232, 1240, 1387, 1543, 1573, 1579, 1640, 1813, 1821, 1839, 1886, 2060, 2104, 2112, 2196, 2232, 2252, 2284, 2300, 2340, 2392, 2400, 2677, 2687, 2773, 2849, 2969, 2973, 3025, 3027, 3898, 4040, 4058, 4201, 4211], 'Lefranc': [581], 'F.': [582, 995, 1210, 1583], 'Kiss': [583], 'R.': [584, 1014, 1226, 1389, 2007, 2050, 2186], 'Glycobiology.': [585, 613, 884, 1002, 2307], '2006;': [586, 862, 885, 959, 1102, 2289, 2778, 3903, 4045, 4069], '16:': [587, 886], '137R-157RCrossref': [588], '(678)': [591], '4Liu': [594], 'F.T.': [595, 830, 954, 972, 1097, 2352, 2861, 2880, 4064], 'Rabinovich': [596], 'G.A.': [597], 'Nat.': [598, 2165], 'Cancer.': [600], '2005;': [601, 2167], '5:': [602], '29-41Crossref': [603], '(1159)': [606], '5Hernandez': [609], 'J.D.': [610, 822, 845, 2272, 2344, 2761, 2853, 3886, 4028], 'Baum': [611, 693, 710, 731, 749, 779, 797, 831, 858, 955, 1098, 1158, 1196, 1425, 1755, 1772, 1842, 2235, 2259, 2285, 2353, 2774, 2862, 2974, 3030, 3603, 3664, 3835, 3899, 4041, 4065, 4185], 'L.G.': [612, 694, 711, 732, 750, 780, 798, 832, 859, 956, 1099, 1159, 1197, 1426, 1756, 1773, 1843, 2236, 2260, 2286, 2354, 2675, 2775, 2863, 2975, 3031, 3604, 3665, 3836, 3900, 4042, 4066, 4186, 4199], '2002;': [614, 1589], '12:': [615], '127R-136RCrossref': [616], '(186)': [619], 'Galectin-1': [622, 1134, 1363], 'first': [625, 3356], 'member': [627], 'described': [628, 1508, 3326, 3598, 3828, 3884, 4178], 'induce': [630, 2032], 'developing': [633], 'thymocytes': [634, 4111], 'best': [649], 'characterized': [650], 'date.': [652], 'Specific': [653], 'involved': [656], 'types': [662], 'O-': [664], 'N-glycan': [666], 'required': [668, 1412, 2562], 'identified,': [674], 'has': [677, 1061, 4323], 'shown': [679, 1862], 'novel': [683], '(6Perillo': [687, 1419, 1749, 3829], 'N.L.': [688, 705, 1153, 1193, 1420, 1750, 1767, 2679, 3830, 4180, 4203], 'Pace': [689, 773, 1421, 1751, 2253, 3831], 'K.E.': [690, 724, 774, 1422, 1752, 2228, 2254, 3600, 3661, 3832], 'Seilhamer': [691, 1423, 1753, 2688, 3833, 4212], 'J.J.': [692, 1424, 1754, 2689, 3834, 4213], 'Nature.': [695, 1427, 1757, 3837], '1995;': [696, 1393, 1428, 1758, 2693, 3838, 4217], '378:': [697, 1429, 1759, 3839], '736-739Crossref': [698, 1430, 1760, 3840], '(940)': [701, 1433, 1763, 3843], '7Perillo': [704, 1766], 'Uittenbogaart': [706, 1154, 1768, 2684, 4181, 4208], 'C.H.': [707, 1155, 1769, 2685, 4182, 4209], 'Nguyen': [708, 729, 846, 1156, 1770, 1840, 2233, 2273, 2762, 3887, 4029, 4183], 'J.': [712, 733, 751, 768, 781, 796, 799, 820, 847, 849, 860, 881, 933, 957, 991, 1029, 1100, 1160, 1172, 1181, 1198, 1212, 1241, 1390, 1516, 1525, 1546, 1563, 1643, 1774, 1786, 1795, 1822, 1846, 1874, 1992, 2065, 2077, 2086, 2113, 2156, 2198, 2237, 2248, 2261, 2274, 2276, 2287, 2302, 2306, 2342, 2401, 2690, 2763, 2765, 2776, 2851, 2925, 2939, 2976, 3029, 3032, 3888, 3890, 3901, 4030, 4032, 4043, 4067, 4187, 4214], 'Exp.': [713, 1161, 1775, 2691, 4188, 4215], 'Med.': [714, 1162, 1200, 1776, 2202, 2692, 4189, 4216], '1997;': [715, 1163, 1184, 1528, 1549, 1646, 1777, 1798, 2089, 4190], '185:': [716, 1164, 1778, 4191], '1851-1858Crossref': [717, 1165, 1779, 4192], '(266)': [720, 1168, 1782, 4195], '8Pace': [723], 'Hahn': [725, 2229, 3601, 3662], 'H.P.': [726, 816, 2230, 2338, 2847, 3602, 3663], 'Pang': [727, 817, 947, 1090, 2231, 2339, 2676, 2848, 4057, 4200], '2000;': [735, 754, 1893, 2239, 2308, 2979], '165:': [736, 2240], '2331-2334Crossref': [737, 2241], '(199)': [740, 2244], '9Galvan': [743], 'Tsuboi': [745, 2970], 'S.': [746, 922, 928, 978, 1236, 1469, 2011, 2176, 2184, 2886, 2971], 'Fukuda': [747, 856, 2283, 2686, 2772, 2972, 3897, 4039, 4210], 'Biol.': [752, 800, 1242, 1391, 1547, 1644, 2927, 2977, 3033], 'Chem.': [753, 801, 1243, 1392, 1548, 1645, 2978, 3034], '275:': [755, 2980], '16730-16737Abstract': [756, 2981], 'Full': [757, 759, 805, 807, 1247, 1249, 1396, 1398, 1552, 1554, 1649, 1651, 1896, 1898, 2982, 2984, 3038, 3040], 'Text': [758, 760, 806, 808, 1248, 1250, 1397, 1399, 1553, 1555, 1650, 1652, 1897, 1899, 2983, 2985, 3039, 3041], 'PDF': [761, 809, 1251, 1400, 1556, 1653, 1900, 2986, 3042], '(119)': [764, 2989], '10Nguyen': [767, 2247], 'Evans': [769, 2249], 'D.P.': [770, 2250], 'Galvan': [771, 793, 2251, 3026], 'Leitenberg': [775, 2255], 'D.': [776, 2256], 'Bui': [777, 2257], 'T.N.': [778, 2258], '2001;': [783, 1217, 2263], '167:': [784, 2264], '5697-5707Crossref': [785, 2265], '(172)': [788, 2268], '11Amano': [791], 'He': [795, 819, 848, 2275, 2341, 2764, 2850, 3028, 3889, 4031], '278:': [803, 3036], '7469-7475Abstract': [804, 3037], '(188)': [812, 3045], '12Hahn': [815], 'Hernandez': [821, 2343, 2852], 'Yang': [823, 2345, 2854], 'R.Y.': [824, 968, 2346, 2855, 2876], 'Li': [825, 2347, 2856], 'L.Y.': [826, 2348, 2857], 'Wang': [827, 850, 2277, 2349, 2766, 2858, 3891, 4033], 'X.': [828, 2350, 2859], 'Liu': [829, 953, 971, 1096, 2351, 2860, 2879, 4063], '2004;': [836, 935, 1981, 2358, 2867, 3341], '11:': [837, 2359, 2868], '1277-1286Crossref': [838, 2360, 2869], '(122)': [841, 2363, 2872], '13Hernandez': [844, 2271], 'W.': [851, 2278, 2767, 3892, 4034], 'Ardman': [852, 2279, 2768, 3893, 4035], 'B.': [853, 926, 2280, 2769, 3894, 4036], 'Green': [854, 2281, 2770, 3895, 4037], 'J.M.': [855, 2282, 2771, 3896, 4038], '177:': [863, 2290, 2779, 3904, 4046], '5328-5336Crossref': [864, 2291, 2780, 3905, 4047], '(99)': [867, 2294, 2783, 3908, 4050], '14Walzel': [870], 'H.': [871, 924, 1020, 1228, 1459, 1539, 1636, 1876, 1890, 2000, 2002, 2009, 2056, 2154, 2298], 'Fahmi': [872], 'A.A.': [873], 'Eldesouky': [874], 'M.A.': [875], 'Abou-Eladab': [876], 'E.F.': [877], 'Waitz': [878], 'G.': [879, 1457, 1998], 'Brock': [880, 2305], 'Tiedge': [882], '1262-1271Crossref': [887], '(24)': [890], 'Other': [893], 'reported': [898, 4325], 'lines': [905, 1514, 1748, 2745, 2962], 'subsets,': [910], 'galectin-2,': [912], 'galectin-3,': [913, 4322], 'galectin-8,': [914], '(15Sturm': [917], 'A.': [918, 979, 1018, 1026, 1176, 1470, 1520, 1790, 1996, 2054, 2062, 2081, 2152, 2180, 2192, 2194, 2683, 2887, 4207], 'Lensch': [919], 'Andre': [921], 'Kaltner': [923], 'Wiedenmann': [925], 'Rosewicz': [927], 'Dignass': [929], 'A.U.': [930], 'Gabius': [931], 'H.J.': [932], '173:': [936], '3825-3837Crossref': [937], '(184)': [940], '16Stillman': [943, 4053], 'B.N.': [944, 1087, 4054], 'Hsu': [945, 969, 1088, 2877, 4055], 'D.K.': [946, 970, 1089, 2878, 4056], 'Brewer': [949, 1092, 4059], 'C.F.': [950, 1093, 4060], 'Johnson': [951, 1094, 4061], 'P.': [952, 1095, 1972, 1974, 2004, 3332, 3334, 4062], '176:': [960, 1103, 2204, 4070], '778-789Crossref': [961, 1104, 4071], '(383)': [964, 1107, 4074], '17Yang': [967, 2875], 'Proc.': [973, 1464, 2881], 'Natl.': [974, 1465, 2882], 'Acad.': [975, 1466, 2883], 'Sci.': [976, 1467, 2884], 'U.': [977, 1468, 1545, 1642, 2885], '1996;': [980, 2888], '93:': [981, 2889], '6737-6742Crossref': [982, 2890], '(671)': [985, 2893], '18Tribulatti': [988], 'M.V.': [989], 'Mucci': [990], 'Cattaneo': [992], 'V.': [993], 'Agüero': [994], 'Gilmartin': [996], 'T.': [997, 1028, 1565, 1571, 1575, 1577, 1819, 1976, 2064, 2110, 2188, 2398, 2681, 3336, 4205], 'Head': [998], 'S.R.': [999], 'Campetella': [1000], 'O.': [1001, 1463, 1537, 1634], '2007;': [1003, 1032, 2016, 2068, 2203], '17:': [1004], '1404-1412Crossref': [1005], '(67)': [1008], '19Lu': [1011], 'L.H.': [1012, 2048], 'Nakagawa': [1013, 2049], 'Kashio': [1015, 2051], 'Y.': [1016, 1234, 1567, 1807, 1872, 1878, 1888, 2052, 2098, 2386], 'Ito': [1017, 2053], 'Shoji': [1019, 2055], 'Nishi': [1021, 1568, 1814, 2057, 2105, 2189, 2393], 'N.': [1022, 1541, 1569, 1638, 1815, 1817, 2058, 2106, 2108, 2178, 2190, 2394, 2396], 'Hirashima': [1023, 1239, 1572, 1820, 2059, 2111, 2195, 2399], 'Yamauchi': [1025, 2061, 2193], 'Nakamura': [1027, 1570, 1808, 1818, 2063, 2099, 2109, 2387, 2397], 'Biochem.': [1030, 2066], '(Tokyo).': [1031, 2067], '141:': [1033, 2069], '157-172Crossref': [1034, 2070], '(65)': [1037, 2073], 'Relatively': [1040], 'little': [1041], 'known': [1043], 'about': [1044], 'ligands,': [1049], 'used': [1054, 1270, 1309, 2551, 3130, 3183, 3197, 3254, 3266, 3350, 4092], 'galectins.': [1057], 'our': [1059], 'laboratory': [1060], 'galectin-3': [1066, 2843], 'use': [1073, 3160, 3230, 3298], 'sets': [1075, 1629], '(16Stillman': [1086], 'Scholar);': [1109, 2700], 'this': [1110, 2431, 2576], 'suggests': [1111], 'that,': [1112], 'vivo,': [1114], 'expressed': [1117, 1139], 'at': [1118, 1967, 3742, 3923, 3933, 3955, 3968], 'times': [1120], 'anatomic': [1124], 'sites': [1125], 'may': [1126, 1679], 'highly': [1138], 'many': [1141], 'immune': [1142], 'organs,': [1143], 'bone': [1145], 'marrow,': [1146], 'lymph': [1147], 'nodes,': [1148], 'spleen,': [1149], 'thymus': [1151, 4173], '(7Perillo': [1152, 4179], '20Wada': [1171, 1785, 2076], 'Ota': [1173, 1517, 1787, 2078], 'K.': [1174, 1518, 1585, 1788, 1809, 1880, 1882, 1884, 2079, 2100, 2182, 2388], 'Kumar': [1175, 1519, 1789, 2080], 'Wallner': [1177, 1521, 1791, 2082], 'E.I.': [1178, 1522, 1792, 2083], 'Kanwar': [1179, 1523, 1793, 1887, 2084], 'Y.S.': [1180, 1524, 1794, 2085], 'Clin.': [1182, 1526, 1796, 2087], 'Investig.': [1183, 1527, 1797, 2088], '99:': [1185, 1529, 1799, 2090], '2452-2461Crossref': [1186, 1530, 1800, 2091], '(255)': [1189, 1533, 1803, 2094], '21Perillo': [1192], 'Marcus': [1194], 'M.E.': [1195], 'Mol.': [1199, 1979, 2014, 3339], '1998;': [1201, 1244], '76:': [1202], '402-412Crossref': [1203], '(580)': [1206], '22Spitzenberger': [1209], 'Graessler': [1211], 'Schroeder': [1213], 'H.E.': [1214], 'Biochimie': [1215], '(Paris).': [1216], '83:': [1218], '851-862Crossref': [1219], '(42)': [1222], '23Matsumoto': [1225], 'Matsumoto': [1227], 'Seki': [1229, 1812, 2103, 2391], 'Hata': [1231], 'Asano': [1233], 'Kanegasaki': [1235], 'Stevens': [1237], 'R.L.': [1238], '273:': [1245], '16976-16984Abstract': [1246], '(269)': [1254], 'Whereas': [1257], 'canonical': [1263], '(CRDs)': [1267], '2The': [1268, 1307], 'abbreviations': [1269, 1308], 'are:': [1271, 1310], 'CRD,': [1272, 1311, 3261], 'domain;': [1275, 1314], '7-AAD,': [1276, 1315], '7-aminoactinomycin': [1277, 1316, 2614], 'D;': [1278, 1317], 'C2GnT,': [1279, 1318], 'core': [1280, 1319], '2': [1281, 1320, 2820, 3005], 'β-1,6-N-acetylglucosaminyltransferase;': [1282, 1321], 'DMNJ,': [1283, 1322], 'deoxymannojirimycin;': [1284, 1323], 'DN,': [1285, 1324], 'double': [1286, 1289, 1325, 1328], 'negative;': [1287, 1326], 'DP,': [1288, 1327], 'positive;': [1290, 1329], 'FITC,': [1291, 1330], 'fluorescein': [1292, 1331], 'isothiocyanate;': [1293, 1332], 'PI,': [1294, 1333], 'propidium': [1295, 1334], 'iodide;': [1296, 1335], 'RT,': [1297, 1336], 'reverse': [1298, 1337], 'transcript;': [1299, 1338], 'PBS,': [1300, 1339, 2662, 3762], 'phosphate-buffered': [1301, 1340], 'saline;': [1302, 1341], 'Th1,': [1303, 1342], 'helper': [1305, 1344], '1.': [1306, 1345], 'family,': [1350], 'belong': [1359], 'subfamilies.': [1362], 'belongs': [1364, 1482], 'subfamily;': [1369], 'synthesized': [1372], 'monomer': [1375], 'one': [1377], 'CRD': [1378, 1666, 2509, 2512, 3191], 'non-covalently': [1380], 'homodimerizes': [1381], '(Kd': [1382], '∼': [1383], '7': [1384], 'μm)': [1385], '(24Cho': [1386], 'Cummings': [1388], '270:': [1394], '5198-5206Abstract': [1395], '(171)': [1403], 'form': [1408], 'appears': [1409], 'be': [1411, 1710, 1864], 'induction': [1414], 'homodimer': [1438], 'relatively': [1441], 'rigid': [1442], 'structure,': [1443], 'identical': [1447], 'CRDs': [1448, 1490, 1602, 1609, 1616, 1676, 1705, 1730], 'oriented': [1449], 'anti-parallel': [1452], 'orientation': [1453], '(25Liao': [1454], 'D.I.': [1455], 'Kapadia': [1456], 'Ahmed': [1458], 'Vasta': [1460], 'G.R.': [1461], 'Herzberg': [1462], '1994;': [1471, 2928], '91:': [1472], '1428-1432Crossref': [1473], '(272)': [1476], 'In': [1479, 2024, 2366, 2430], 'contrast,': [1480, 2025, 2367], 'subfamily,': [1487], 'joined': [1491], 'flexible': [1494], 'linker.': [1496], 'Three': [1497], 'isoforms': [1499], 'linkers': [1502], 'lengths': [1505], 'tissues': [1511, 3872], '(20Wada': [1515], '26Tureci': [1536], 'Schmitt': [1538, 1635], 'Fadle': [1540, 1637], 'Pfreundschuh': [1542, 1639], 'Sahin': [1544, 1641], '272:': [1550, 1647], '6416-6422Abstract': [1551, 1648], '(201)': [1559, 1656], '27Hirabayashi': [1562], 'Hashidate': [1564], 'Arata': [1566], 'Urashima': [1574], 'Oka': [1576], 'Futai': [1578], 'Muller': [1580], 'W.E.': [1581], 'Yagi': [1582], 'Kasai': [1584, 2303], 'Biochim.': [1586], 'Biophys.': [1587], 'Acta.': [1588], '1572:': [1590], '232-254Crossref': [1591], '(817)': [1594], 'Unlike': [1597], 'where': [1599], 'identical,': [1604], 'different;': [1613], 'share': [1617], 'amino': [1619], 'acid': [1620], 'sequence': [1621, 3482], 'homology': [1622], 'only': [1624], '39%,': [1625], 'bind': [1627], 'saccharide': [1631], '(26Tureci': [1633], 'N-': [1663, 1702], 'sequences': [1667, 3095], 'respective': [1669], 'ligand': [1670], 'specificities': [1671], 'suggest': [1672, 1918], 'play': [1680], 'roles': [1682], 'mediating': [1684], 'functions': [1686], 'e.g.': [1689], 'triggering': [1690, 2519], 'Given': [1693], 'length': [1695], 'peptide,': [1700], 'would': [1708], 'predicted': [1711], 'greater': [1714, 1718], 'rotational': [1715], 'flexibility': [1716, 1719], 'spacing': [1722], 'CRDs,': [1725], 'compared': [1726, 2435], 'dimer.': [1734], 'Both': [1735], 'can': [1739], '28Kashio': [1806, 2097], 'Abedin': [1810, 2101, 2389], 'M.J.': [1811, 2102, 2390], 'Yoshida': [1816, 2107, 2395], '170:': [1825, 2116, 2404], '3631-3636Crossref': [1826, 2117, 2405], '(247)': [1829, 2120, 2408], '29Vespa': [1832], 'G.N.': [1833], 'Lewis': [1834], 'L.A.': [1835], 'Kozak': [1836], 'K.R.': [1837], 'Moran': [1838], 'Miceli': [1844], 'M.C.': [1845], '1999;': [1848], '162:': [1849], '799-806PubMed': [1850], 'Scholar),': [1852, 2210, 2785, 3614], 'administration': [1854], 'therapeutic': [1865], 'nephritis': [1869], 'model': [1870], '(30Tsuchiyama': [1871], 'Wada': [1873], 'Zhang': [1875], 'Morita': [1877], 'Hiragushi': [1879], 'Hida': [1881], 'Shikata': [1883], 'Yamamura': [1885], 'Makino': [1889], 'Kidney': [1891], 'Int.': [1892], '58:': [1894], '1941-1952Abstract': [1895], 'few': [1906], 'studies': [1907], 'examined': [1910], 'mechanism': [1912, 4338], 'there': [1920], 'significant': [1922, 2033], 'pathways.': [1930], 'First,': [1931], 'much': [1934], 'more': [1935], 'potent': [1936], 'than': [1937], 'inducing': [1940], 'death;': [1943, 2521], 'even': [1944], 'when': [1945], 'made': [1948], 'leucine': [1951], 'zipper': [1952], 'dimer': [1953], 'single': [1957, 3317], 'chain': [1958, 3318], 'molecule,': [1959], 'minimal': [1960, 2663], 'observed': [1964], 'vitro': [1966], 'concentrations': [1968, 3926], '<1': [1969], 'μm': [1970, 2027], '(31Battig': [1971, 3331], 'Saudan': [1973, 3333], 'Gunde': [1975, 3335], 'Bachmann': [1977, 3337], 'M.F.': [1978, 3338], '41:': [1982, 3342], '9-18Crossref': [1983, 3343], '(35)': [1986, 3346], '32van': [1989], 'der': [1990], 'Leij': [1991], 'van': [1993, 2005], 'den': [1994], 'Berg': [1995], 'Harms': [1997], 'Eschbach': [1999], 'Vos': [2001], 'Zwiers': [2003], 'Weeghel': [2006], 'Groen': [2008], 'Poppema': [2010], 'Visser': [2012], 'L.': [2013], '44:': [2017], '506-513Crossref': [2018], '0.1': [2026, 3011], 'sufficient': [2030], 'apoptosis': [2034], 'MOLT-4': [2036, 2320, 2371], 'Jurkat': [2038, 2749, 2786, 2830, 2907, 3066], 'blood': [2044], '(19Lu': [2047], 'Second,': [2123], 'appear': [2127], 'recognize': [2129], 'surface': [2133, 2218], 'receptors;': [2135], 'Tim-3': [2136, 2734], 'CD44': [2138], 'identified': [2141], '(33Zhu': [2147], 'C.': [2148, 2940], 'Anderson': [2149], 'A.C.': [2150], 'Schubart': [2151], 'Xiong': [2153], 'Imitola': [2155], 'Khoury': [2157], 'S.J.': [2158], 'Zheng': [2159], 'X.X.': [2160], 'Strom': [2161], 'T.B.': [2162], 'Kuchroo': [2163], 'V.K.': [2164], '6:': [2168], '1245-1252Crossref': [2169], '(1428)': [2172], '34Katoh': [2175], 'Ishii': [2177], 'Nobumoto': [2179], 'Takeshita': [2181], 'Dai': [2183], 'Shinonaga': [2185], 'Niki': [2187], 'Tominaga': [2191], 'Am.': [2197], 'Respir.': [2199], 'Crit.': [2200], 'Care': [2201], '27-35Crossref': [2205], '(138)': [2208], 'binds': [2213], 'glycoproteins': [2219], 'CD2,': [2221], 'CD3,': [2222], 'CD7,': [2223], 'CD43,': [2224], 'CD45': [2226], '(8Pace': [2227], '35Walzel': [2297], 'Blach': [2299], 'Hirabayashi': [2301], 'K.I.': [2304], '10:': [2309], '131-140Crossref': [2310], '(94)': [2313], 'Finally,': [2316], 'galectin-1-induced': [2317], 'does': [2323], 'result': [2325], 'activation': [2327, 2384], 'caspases': [2329], 'release': [2331, 2378], 'cytochrome': [2333, 2376], 'c': [2334, 2377], 'from': [2335, 2590, 3065, 3363, 3461, 3476, 3522, 3643, 3875], 'mitochondria': [2336], '(12Hahn': [2337, 2846], 'galectin-9-induced': [2368, 2438], 'results': [2374], 'dependent': [2381], 'on': [2382, 3656, 4000, 4136, 4300], 'caspase': [2383], '(28Kashio': [2385], 'determine': [2418], 'differential': [2419], 'remain': [2428], 'unknown.': [2429], 'study,': [2432], 'directly': [2434], 'galectin-1-': [2436], 'requirements': [2445, 2477], 'mediators,': [2454], 'using': [2459, 3072, 3086, 3168, 3238, 3305, 3369, 3648, 3814, 3951], 'understand': [2463], 'contribute': [2472, 2514], 'populations,': [2485], 'designed': [2487], 'hybrid': [2491], 'proteins': [2492, 3630], 'combine': [2494], 'galectin-9.': [2501], 'Using': [2502], 'constructs,': [2504], 'determined': [2506, 3806, 3856, 4014], 'presentation': [2513], 'CRD.': [2543, 3204, 3273], 'Elucidating': [2544], 'determining': [2556], 'critical': [2571], 'step': [2572], 'understanding': [2574], 'how': [2575], 'molecules': [2579], 'coordinately': [2580], 'survival.': [2584], 'Chemicals': [2585], 'Reagents—Reagents': [2587], 'were': [2588, 2802, 2896, 2948, 2992, 3084, 3117, 3155, 3225, 3293, 3421, 3447, 3549, 3570, 3594, 3637, 3641, 3683, 3697, 3709, 3797, 3848, 3873, 3880, 3919, 3937, 3960, 3977, 3998, 4013, 4091, 4105, 4127, 4174, 4226, 4262, 4284, 4298], 'purchased': [2589], 'indicated': [2591, 3713, 3925], 'suppliers:': [2592], 'TRIzol': [2593, 3073], 'reagent,': [2594], 'one-step': [2595, 3088], 'RT-PCR': [2596, 3089], 'kit,': [2597], 'annexin': [2598, 3808, 3861, 3864], 'V-fluorescein': [2599], 'isothiocyanate': [2600], '(FITC)/propidium': [2601], 'iodide': [2602], '(PI),': [2603], "Dulbecco's": [2604, 2995], 'modified': [2605, 2996, 3365, 3536, 3567], "Eagle's": [2606, 2997], 'medium,': [2607, 2610, 2998], 'RPMI': [2608, 2805], '1640': [2609, 2806], 'HEPES,': [2611, 2825], 'Glutamax,': [2612, 2822, 3007], 'penicillin-streptomycin,': [2613], 'D': [2615, 2737], '(7-AAD),': [2616], 'phycoerythrin-conjugated': [2617], 'monoclonal': [2618, 2623, 2731], 'rat': [2619, 2624, 2732], 'anti-mouse': [2620, 2625, 2635, 4270, 4295], 'CD4,': [2621], 'FITC-conjugated': [2622, 2633, 2637], 'CD8': [2626], 'antibodies,': [2627], 'Texas': [2628], 'Red-conjugated': [2629], 'goat': [2630, 2634, 2638, 2709, 4230, 4257, 4266, 4269, 4288, 4294], 'anti-rabbit': [2631, 2711, 4267, 4289], 'IgG,': [2632, 2636, 2640], 'anti-rat': [2639], 'CountBright': [2641, 4086], 'absolute': [2642, 4079, 4087, 4147], 'counting': [2643, 4088], 'beads': [2644, 4089, 4104, 4163], '(Invitrogen);': [2645], 'fetal': [2646, 2811, 3002], 'bovine': [2647, 2812, 3003], 'serum': [2648, 4231, 4253], '(Hyclone,': [2649], 'Logan,': [2650], 'UT);': [2651], 'dithiothreitol': [2652, 3759], '(Fisher': [2653], 'Scientific,': [2654], 'Chino,': [2655], 'CA);': [2656, 2724, 2730], 'ampicillin,': [2657], 'geneticin,': [2658], 'G418,': [2659], 'β-lactose,': [2660], '10×': [2661], 'medium/sodium': [2665], 'pyruvate': [2666, 3018], 'solution': [2667], '(Sigma);': [2668], 'polyclonal': [2669, 2701], 'rabbit': [2670, 4242], 'anti-human': [2671, 2703, 2733, 4243, 4248], 'antibody': [2673], '(36Baum': [2674], 'Perillo': [2678, 4202], 'Wu': [2680, 4204], 'Delegeane': [2682, 4206], '181:': [2694, 4218], '877-887Crossref': [2695, 4219], '(256)': [2698, 4222], 'mouse': [2702, 4247], '(Abnova,': [2705], 'Taiwan);': [2706], 'horseradish': [2707], 'peroxidase-conjugated': [2708], 'anti-mouse,': [2710], 'IgG': [2712], '(Bio-Rad);': [2713], 'Ficoll-Paque': [2714], '(GE': [2715], 'Healthcare);': [2716], 'deoxymannojirimycin': [2717], '(DMNJ),': [2718], 'aquacide': [2719], 'II': [2720], '(Calbiochem,': [2721], 'San': [2722, 3507, 3821], 'Diego,': [2723, 3508, 3822], '3-amino-9-ethylcarbazole,': [2725, 4275], 'hematoxylin': [2726], '(Biomedia,': [2727], 'Foster': [2728], 'City,': [2729], '(R': [2735], '&': [2736], 'Systems,': [2738], 'Minneapolis,': [2739, 2800], 'MN).': [2740], 'Lines—Human': [2742], 'CEM,': [2746], 'HUT78,': [2747], 'HH,': [2748], 'E6-1,': [2750], 'J45.01': [2751], '(American': [2752], 'Type': [2753], 'Culture': [2754], 'Collection,': [2755], 'Manassas,': [2756], 'VA),': [2757], 'CEM.DKO': [2759], '(13Hernandez': [2760, 3885, 4027], 'A11,': [2787], 'CD29-deficient': [2790], 'derivative': [2791], '(gift': [2792, 2936], 'Dr.': [2794, 2938], 'Yoji': [2795], 'Shimizu,': [2796], 'University': [2797], 'Minnesota,': [2799], 'MN)': [2801], 'maintained': [2803, 2897, 2949, 2993, 3049], 'medium': [2807, 2901, 2953, 3053], 'supplemented': [2808, 2902, 2954, 2999, 3054], '10%': [2810, 3001, 4256], 'serum,': [2813, 3004, 4258], '0.25%': [2814], 'glucose,': [2815], '1': [2816, 3015, 3915], 'mm': [2817, 2821, 2824, 3006, 3016, 3650, 3690, 3758, 3786, 3941], 'sodium': [2818, 3017], 'pyruvate,': [2819], '10': [2823, 2904], '50': [2827], 'units/ml': [2828, 3009], 'penicillin/streptomycin.': [2829], 'E6-1': [2831, 2908, 3067], 'transfected': [2833, 2910], 'vector': [2835, 2912, 3367, 3383, 3409, 3451, 3460, 3502, 3525, 3538], 'alone': [2836, 2913], '(E6': [2837, 2844, 2914, 2921], 'Neo)': [2838], 'cDNA': [2841, 2918, 3083, 3124, 3128, 3177, 3181, 3195, 3248, 3252, 3264, 3315, 3360, 3393, 3473, 3495, 3519], 'encoding': [2842, 2919, 3112, 3125, 3178, 3249, 3316], 'Gal3)': [2845], 'Scholar)': [2895, 2935, 2991, 3047, 3348], 'same': [2900, 2952, 3052, 3513, 3542], 'μg/ml': [2905, 3984], 'geneticin.': [2906, 3058], 'Mock),': [2915], 'Bcl-2': [2920], 'Bcl-2)': [2922], '(37Reed': [2923], 'J.C.': [2924], '124:': [2929], '1-6Crossref': [2930], '(2390)': [2933], 'Reed,': [2941], 'Burnham': [2943], 'Institute,': [2944], 'La': [2945], 'Jolla,': [2946], 'CA)': [2947, 3509, 3823], '0.9': [2956], 'mg/ml': [2957, 3012, 3057], 'G418.': [2958], 'Murine': [2959], 'BW5147.3': [2963], '(BW5147)': [2964], 'BW5147PhaR2.1': [2966], '(PhaR2.1)': [2967], '(9Galvan': [2968], '100': [3008, 3785, 3940, 4108], 'penicillin,': [3010], 'streptomycin,': [3013], 'solution.': [3019], 'PhaR2.1': [3020], 'ST6Gal': [3021], 'I': [3022], '(PhaRST6)': [3023], '(11Amano': [3024], '0.8': [3056], 'Messenger': [3059], 'RNA': [3060, 3064], 'Isolation': [3061], 'RT-PCR—Total': [3063], 'isolated': [3071, 3571], 'reagent': [3074], 'according': [3075, 4095], "manufacturer's": [3078, 4098], 'protocol.': [3079, 4099], 'Galectin-9': [3080], 'obtained': [3085, 3118, 4156], 'kit': [3090], '(Invitrogen).': [3091], 'For': [3092, 3102, 4280], 'primer': [3094, 3370, 3385, 3397, 3401], 'were:': [3096, 3105, 3137, 3207, 3276], 'Gal-9FNde,': [3097], '5′-tgcaatccatatggccttcagcagttcccag-3′,': [3098], 'Gal-9RXho,': [3100], '5′-cccctcgagctatgtctgcacatgggt-3′.': [3101, 3286], 'primers': [3104, 3136, 3169, 3206, 3275, 3431], 'Gal1FNde,': [3106, 3170, 3306], '5′-ggagatatagatatggcttgtggtctggtcgcc-3′,': [3107], 'Gal1RXho,': [3109], '5′-cccctcgagtcagtcaaaggccacacattt-3′.': [3110], 'cDNAs': [3111], 'gal-1-9-1,': [3113, 3126, 3167, 3444, 3469, 3589], 'gal-9-9-1,': [3114, 3179, 3237, 3470, 3590, 3693, 3779], 'gal-1-9-9': [3116, 3446], 'via': [3119], 'overlapping': [3120, 3323], 'PCR.': [3121], 'construct': [3123, 3176, 3247, 3314], 'PCR': [3132, 3150, 3163, 3220, 3233, 3288, 3300, 3324, 3419, 3440], 'template': [3133, 3164, 3186, 3200, 3234, 3257, 3269, 3301], 'Gal1FNde': [3138, 3277], '(described': [3139, 3147, 3209, 3217, 3278], 'above);': [3140], 'Gal1RDR3,': [3141, 3173], '5′-ctgcactgtgtggatgactgtctgggtgtcaaaggccacacatttgat-3′;': [3142], 'Gal1FDR3,': [3143], '5′-atccacacagtgcagagcgcccctggacaggcttgtggtctggtcgcc-3′;': [3144], 'Gal1RXho': [3146, 3216, 3311], 'above).': [3148, 3218], 'products': [3151, 3221, 3289, 3420, 3441, 3548], 'reactions': [3154, 3224, 3292], 'purified': [3156, 3226, 3294, 3497, 3595], 'mixed': [3158, 3228, 3296, 4117], 'generating': [3166, 3236, 3303], 'Gal1FDR3': [3171], 'Gal1RXho.': [3174], 'obtain': [3188], 'sequence,': [3192], 'Gal9FNde': [3208], 'above),': [3210, 3279], 'Gal9NCRDLNKR,': [3211], '5′-ggcgctctgcactgtgtggatgactgtctgggtctggaagctgatgtaggacag;': [3212], 'Gal1LNK9F,': [3213, 3242], '5′-cacacagtgcagagcgcccctggacaggcttgtggtctggtcgccagc;': [3214], 'Gal9FNde,': [3239], 'Gal9NCRDLNKR': [3240], 'Gal1Rxho': [3244], 'primers.': [3245, 3312], 'gal-1-9-9,': [3250, 3304, 3472, 3591, 3694, 3778], 'Gal1–9R,': [3280], '5′-tgtctgggtgtcaaaggccacaca-3′;': [3281], 'Gal9SF,': [3282, 3309], '5′-acccagacagtcatccacaca-3′;': [3283], 'Gal9RXho,': [3285], 'Gal1–9R': [3307], '(gal-1': [3321], 'GG),': [3322], 'Battig': [3328], 'et': [3329], 'al.': [3330], 'following': [3353], 'modification.': [3354], 'amplified': [3362, 3395, 3422], 'pGEMEX-1': [3366, 3537], '(Promega)': [3368], 'F1': [3371, 3432], '(5′-ggagaccacaacggtttcc-3′),': [3372], 'anneals': [3374, 3405], 'T7': [3377], 'promoter': [3378], 'region': [3379], 'pGEMEX': [3382, 3408], 'R2': [3386, 3434], '(5′-accacaagccataccgccgtcaaaggccacacatttg-3′).': [3387], 'second': [3389], 'F2': [3398], '(5′-gtggcctttgacggcggtatggcttgtggtctggtc-3′)': [3399], 'R1': [3402], '(5′-actcaagcttatgcatgcggcc),': [3403], '20': [3410], 'bp': [3411], 'stop': [3415], 'codon.': [3416], 'resulting': [3418], 'together': [3423], '5': [3425, 3728], 'cycles': [3426], 'followed': [3427, 3652], 'amplification': [3429], '18': [3436], 'cycles.': [3437], 'final': [3439, 3766], 'gal-9,': [3443], 'cloned': [3448, 3457], 'into': [3449, 3458, 3500, 3551], 'TOPO-TA-PCR': [3450, 3478], '(Invitrogen),': [3452], 'gal-1': [3454, 3587, 3679, 3752], 'GG': [3455, 3518], 'TOPO-XL-PCR': [3459, 3524], 'Invitrogen.': [3462], 'Construction': [3463], 'Galectin': [3465], 'Expression': [3466, 3583], 'Vectors—For': [3467], 'cut': [3475, 3521], 'vectors': [3479, 3565], 'containing': [3480], 'interest': [3484], 'NdeI': [3486], 'XhoI': [3488], '(New': [3489, 3530], 'England': [3490, 3531], 'Biolabs,': [3491], 'Ipswich,': [3492], 'MA).': [3493], 'Digested': [3494], 'ligated': [3499, 3534, 3547], 'pET': [3501], '3.1': [3503], '(Novagen,': [3504], 'EMD': [3505], 'Biosciences,': [3506, 3820], 'linearized': [3510, 3539], 'restriction': [3515, 3544, 3577], 'enzymes.': [3516, 3545], 'Gal-1': [3517], 'XbaI': [3527], 'BamHI': [3529], 'Biolabs)': [3532], 'transformed': [3550], 'chemically': [3552], 'competent': [3553], 'Escherichia': [3554], 'coli': [3555, 3618], 'DH5α': [3556], '(Novagen)': [3557], 'amplify': [3559], 'expression': [3561], 'vectors.': [3562], 'Plasmids': [3563], '(pET/galectin': [3564], 'PGEMEX-1/gal-1': [3568], 'GG)': [3569], 'inserts': [3574], 'verified': [3575], 'enzyme': [3578], 'analysis': [3579, 3950], 'DNA': [3581], 'sequencing.': [3582], 'Galectins—Recombinant': [3585], 'GG,': [3588, 3680, 3753], 'previously': [3597, 3883, 4177], '(38Pace': [3599, 3660], 'Methods': [3605, 3666], 'Enzymol.': [3606, 3667], '363:': [3608, 3669], '499-518Crossref': [3609, 3670], '(61)': [3612, 3673], 'except': [3615], 'E.': [3617, 3635], 'Rossetta': [3619], '(DE3)/pLysS': [3620], '(Novagen),': [3622], 'enhanced': [3625], 'capability': [3626], 'express': [3628], 'mammalian': [3629], 'rare': [3632], 'codons': [3633], 'coli,': [3636], 'used.': [3638], 'All': [3639], 'eluted': [3642], 'lactose-agarose': [3645], 'affinity': [3646], 'column': [3647, 3659], '200': [3649], 'lactose,': [3651], 'further': [3654], 'purification': [3655], 'sizing': [3658], 'After': [3676, 3974], 'concentration,': [3677], 'gal-1-9-1': [3682, 3755], 'dialyzed': [3684, 3698], 'against': [3685, 3699], '1×': [3686, 3700, 3761, 3773, 3783, 3801, 3946, 4233], 'PBS': [3687, 3947, 4234], '8': [3689], 'dithiothreitol,': [3691], 'PBS.': [3701, 3774, 3784, 3802], 'Assays—1': [3705], '×': [3706, 3867, 3916, 4113], '106': [3707, 3917, 4114], 'incubated': [3710, 3920], 'concentration': [3714], 'buffer': [3720, 3928, 3981], 'control': [3721, 3749, 3776, 3929, 4254], '6': [3723], '(mouse': [3724], 'lines)': [3726], 'h': [3729, 3932], '(human': [3730], 'lines),': [3732], '24-well': [3734], 'tissue': [3735], 'culture': [3736], 'plates': [3737], '(Sarstedt': [3738], 'Inc.,': [3739], 'Newton,': [3740], 'NC)': [3741], '37': [3743, 3934], '°C': [3744, 3970], '5%': [3746], 'CO2.': [3747], 'Buffer': [3748, 3775], '0.2': [3757, 3956, 3983], 'match': [3764], 'dilution': [3767], 'stock': [3771], 'β-Lactose': [3787], 'added': [3789, 4106], 'dissociate': [3791], 'washed': [3798, 3944], 'ice-cold': [3800], 'V-FITC': [3809], 'binding': [3810], 'PI': [3812], 'uptake': [3813], 'Becton': [3816], 'Dickinson': [3817], 'FACScan': [3818, 4002], '(BD': [3819], 'CellQuest': [3825, 4008], 'software': [3826], '10,000': [3846, 3995], 'events': [3847, 3997, 4126], 'acquired': [3849], 'per': [3850, 4129, 4164], 'sample,': [3851], 'percent': [3853, 3988], 'as:': [3857], '(1': [3858, 4112], '-': [3859], '(viable': [3860], 'V-': [3862, 3865], '(galectin)/viable': [3863], '(control)))': [3866], '100.': [3868], 'Thymocyte': [3869, 4131], 'Assays—Thymus': [3871], 'harvested': [3874, 3881], '6-week-old': [3876], 'C57BL/6': [3877], 'mice.': [3878], 'Thymocytes': [3879], 'viability': [3912, 4132], '>95%.': [3914], '4': [3931, 3969], '°C.': [3935], 'Cells': [3936], 'dissociated': [3938], 'lactose': [3942], 'before': [3948, 4238], 'phenotypic': [3949], 'CD4-phycoerythrin': [3952], 'CD8-FITC': [3954], 'μg/ml.': [3957], 'Isotype-matched': [3958], 'controls': [3959], 'included': [3961], 'all': [3963], 'reagents.': [3964], 'Staining': [3965], 'performed': [3967], '30': [3972, 4236], 'min.': [3973], 'washing,': [3975], 'resuspended': [3978], 'HEPES': [3980], '7-AAD.': [3985], 'quantitate': [3987, 4078], 'each': [3992, 4083, 4153], 'thymocyte': [3993, 4084], 'subset,': [3994, 4085], 'total': [3996], 'collected': [3999, 4128, 4299], 'flow': [4003, 4121], 'cytometer': [4004], 'analyzed': [4006, 4094], 'software,': [4009], 'live': [4011], 'gating': [4016], 'forward': [4018, 4137], 'versus': [4019, 4138], 'side': [4020, 4139], 'scatter': [4021, 4140], 'profiles': [4022], 'absence': [4024, 4142], '7-AAD': [4026, 4144], '(Invitrogen)': [4090], 'Briefly,': [4100], '25': [4101], 'μl': [4102, 4109], 'cells)': [4115], 'prior': [4119], 'cytometry': [4122], 'analysis;': [4123], '3,000': [4124], 'bead': [4125], 'sample.': [4130, 4165], 'assessed': [4134], 'based': [4135], 'uptake.': [4145], 'viable': [4150], 'subset': [4154], 'reference': [4158], 'Immunochemistry': [4166], 'Immunofluorescence—Consecutive': [4168], '0.5-μm': [4169], 'sections': [4170], 'human': [4172], 'prepared': [4175], '36Baum': [4198], 'Slides': [4225], '20%': [4229], 'min': [4237], 'addition': [4239], '1:1000': [4241, 4265, 4287], 'antibody,': [4245, 4250], '1:200': [4246], 'non-immune': [4252], 'bound': [4259, 4282], 'antibodies': [4261, 4283], 'detected': [4263, 4285], 'IgG-horseradish': [4271], 'peroxidase,': [4272], 'developed': [4273], 'counterstained': [4277], 'hematoxylin.': [4279], 'immunofluorescence,': [4281], 'IgG-Texas': [4290], 'Red': [4291], '1:500': [4293], 'IgG-FITC.': [4296], 'Images': [4297], 'Zeiss': [4302], 'Axioimager': [4303], 'microscope.': [4304], 'Galectin-9-induced': [4305], 'Requires': [4309], 'Different': [4310], 'Glycan': [4311], 'Ligands': [4312], 'Glycoprotein': [4314], 'Receptors,': [4315], 'Compared': [4316], 'Galectin-1—Galectin-9,': [4318], 'like': [4319], 'lines,': [4330], 'cells.': [4335], 'g': [4340]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2049652679', 'counts_by_year': [{'year': 2024, 'cited_by_count': 7}, {'year': 2023, 'cited_by_count': 8}, {'year': 2022, 'cited_by_count': 6}, {'year': 2021, 'cited_by_count': 11}, {'year': 2020, 'cited_by_count': 7}, {'year': 2019, 'cited_by_count': 7}, {'year': 2018, 'cited_by_count': 6}, {'year': 2017, 'cited_by_count': 6}, {'year': 2016, 'cited_by_count': 8}, {'year': 2015, 'cited_by_count': 10}, {'year': 2014, 'cited_by_count': 6}, {'year': 2013, 'cited_by_count': 11}, {'year': 2012, 'cited_by_count': 9}], 'updated_date': '2024-12-13T11:56:58.682005', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
