Title: Transcription Factor YB-1 Mediates DNA Polymerase α Gene Expression
Abstract: Y-box protein-1 involvement in cyclin A and B1 gene regulation has recently been demonstrated. A more generalized role of this protein for cell replication is hypothesized as numerous regulatory sequences of cell cycle-related genes contain putative binding sites. In the present study the DNA polymerase α (DPA) gene is identified as another YB-1-responsive gene with a Y-box and 3′ inverted repeat sequence, designated DPA RE-1, in the serum-responsive promoter region. Overexpressed YB-1 concentration-dependently trans-activated DPA gene expression in reporter assays and Southwestern blotting as well as DNA binding analyses revealed binding of distinct endogenous proteins to the RE-1 with molecular sizes of 26, 32 and 52 kDa. Among these, YB-1 binding was confirmed using recombinant as well as endogenous proteins, with preferential single-stranded DNA binding. Early serum growth response in mesangial cells was accompanied by a nuclear YB-1 shift and nucleocomplex formation at the RE-1. Fine mapping of the DPA RE-1 sequence unraveled a dependence on co-factors for trans-regulation with gene activation in the context of a heterologous SV40 promoter but suppression in the context of the abbreviated homologous promoter sequence. A YB-1 knock down resulted in decreased DPA transcription rates and abrogated the serum-dependent induction of DPA transcription. These results link YB-1 with serum responsiveness of DPA gene expression and provide insight into the required sequence and protein binding context. Y-box protein-1 involvement in cyclin A and B1 gene regulation has recently been demonstrated. A more generalized role of this protein for cell replication is hypothesized as numerous regulatory sequences of cell cycle-related genes contain putative binding sites. In the present study the DNA polymerase α (DPA) gene is identified as another YB-1-responsive gene with a Y-box and 3′ inverted repeat sequence, designated DPA RE-1, in the serum-responsive promoter region. Overexpressed YB-1 concentration-dependently trans-activated DPA gene expression in reporter assays and Southwestern blotting as well as DNA binding analyses revealed binding of distinct endogenous proteins to the RE-1 with molecular sizes of 26, 32 and 52 kDa. Among these, YB-1 binding was confirmed using recombinant as well as endogenous proteins, with preferential single-stranded DNA binding. Early serum growth response in mesangial cells was accompanied by a nuclear YB-1 shift and nucleocomplex formation at the RE-1. Fine mapping of the DPA RE-1 sequence unraveled a dependence on co-factors for trans-regulation with gene activation in the context of a heterologous SV40 promoter but suppression in the context of the abbreviated homologous promoter sequence. A YB-1 knock down resulted in decreased DPA transcription rates and abrogated the serum-dependent induction of DPA transcription. These results link YB-1 with serum responsiveness of DPA gene expression and provide insight into the required sequence and protein binding context. As eukaryotic cells progress through the cell cycle, multiple genes involved in DNA replication and nucleotide metabolism are coordinately up-regulated shortly before or at the onset of DNA synthesis. These genes among others encompass histones, dihydrofolate reductase, thymidine kinase and synthase, proliferating cell nuclear antigen, topoisomerase IIα, and DNA polymerase α (DPA) 1The abbreviations used are: DPA, DNA polymerase α; YB-1, Y-box-binding protein-1; rYB-1, recombinant YB-1 protein; MC, mesangial cell; AS, antisense; BrdUrd, bromodeoxyuridine; RE-1, response element-1; MBN, mung bean nuclease; IR, inverted repeat./primase (1Ayusawa D. Shimizu K. Koyama H. Kaneda S. Takeishi K. Seno T. J. Mol. Biol. 1986; 190: 559-567Crossref PubMed Scopus (102) Google Scholar, 2Farnham P.J. Schimke R.T. J. Biol. Chem. 1985; 260: 7675-7680Abstract Full Text PDF PubMed Google Scholar, 3Sherley J.L. Kelly T.J. J. Biol. Chem. 1988; 263: 8350-8358Abstract Full Text PDF PubMed Google Scholar). A concordant up-regulation of the transcription factor Y-box protein 1 (YB-1) with topoisomerase IIα and proliferating cell nuclear antigen has been previously reported (4Gu C. Oyama T. Osaki T. Kohno K. Yasumoto K. Anticancer Res. 2001; 21: 2357-2362PubMed Google Scholar); however, a direct involvement of YB-1 in the transcriptional control of the aforementioned genes has not been investigated. DPA is a key component of the chromosomal replication apparatus and is regarded as the principal polymerase involved in eukaryotic DNA replication (5Campbell J.L. Annu. Rev. Biochem. 1986; 55: 733-771Crossref PubMed Google Scholar). A role for DPA primase has been found in the checkpoint that couples S phase to mitosis (6D'Urso G. Grallert B. Nurse P. J. Cell Sci. 1995; 108: 3109-3118Crossref PubMed Google Scholar). Furthermore, Wahl et al. (7Wahl A.F. Geis A.M. Spain B.H. Wong S.W. Korn D. Wang T.S. Mol. Cell. Biol. 1988; 8: 5016-5025Crossref PubMed Scopus (101) Google Scholar) demonstrated a significant up-regulation of DPA gene transcription during the activation of quiescent (G0 phase) to proliferating cells (G1/S phases). Steady state DPA mRNA levels, synthesis rates of nascent polymerase protein, and enzymatic activity all exhibit a substantial increase before the peak of in vivo DNA synthesis. The concerted increase of these three parameters is consistent with the regulation of this key DNA replication enzyme to a considerable extent at the transcriptional level. Studies performed by Wang and co-workers (7Wahl A.F. Geis A.M. Spain B.H. Wong S.W. Korn D. Wang T.S. Mol. Cell. Biol. 1988; 8: 5016-5025Crossref PubMed Scopus (101) Google Scholar, 8Pearson B.E. Nasheuer H.P. Wang T.S. Mol. Cell. Biol. 1991; 11: 2081-2095Crossref PubMed Google Scholar) demonstrated that in serum-deprived cells, DPA mRNA, protein, and in vitro activity levels are low, whereas serum addition leads to a coordinate increase in parallel with the onset of DNA synthesis. Prior analyses of the GC-rich TATA-less DPA promoter sequence for cis-acting elements identified a serum response element that is activated in NIH 3T3 cells (8Pearson B.E. Nasheuer H.P. Wang T.S. Mol. Cell. Biol. 1991; 11: 2081-2095Crossref PubMed Google Scholar). This element was mapped to sequences –65/–17 relative to the transcriptional start site. The 28-bp sequence –45/–17 includes an inverted CCAAT box and enhances transcription 10-fold in cycling cells when compared with the minimal activity construct –17/+45 (8Pearson B.E. Nasheuer H.P. Wang T.S. Mol. Cell. Biol. 1991; 11: 2081-2095Crossref PubMed Google Scholar). Specific binding activities that trans-activate DPA gene transcription via this element include CTF1 (9Hayhurst G.P. Bryant L.A. Caswell R.C. Walker S.M. Sinclair J.H. J. Virol. 1995; 69: 182-188Crossref PubMed Google Scholar) and CTF/NF-I (10Jones K.A. Kadonaga J.T. Rosenfeld P.J. Kelly T.J. Tjian R. Cell. 1987; 48: 79-89Abstract Full Text PDF PubMed Scopus (574) Google Scholar). The importance of this sequence for DPA gene expression has also been demonstrated in the course of human cytomegalovirus infection. Human cytomegalovirus immediate-early protein 1 directly interacts with CTF1 and synergistically trans-activates DPA gene transcription via the inverted CCAAT box (9Hayhurst G.P. Bryant L.A. Caswell R.C. Walker S.M. Sinclair J.H. J. Virol. 1995; 69: 182-188Crossref PubMed Google Scholar). Inverted CCAAT boxes also constitute binding sites for Y-box-binding proteins (11Kohno K. Izumi H. Uchiumi T. Ashizuka M. Kuwano M. BioEssays. 2003; 25: 691-698Crossref PubMed Scopus (435) Google Scholar). YB-1 binds to DNA as well as RNA in a sequence-specific fashion and is implicated in the transcriptional regulation of a variety of genes (12Swamynathan S.K. Nambiar A. Guntaka R.V. FASEB J. 1998; 12: 515-522Crossref PubMed Scopus (87) Google Scholar). Depending on the cellular context, YB-1 may act either as a transcriptional activator or repressor, even of the same gene (13Mertens P.R. Harendza S. Pollock A.S. Lovett D.H. J. Biol. Chem. 1997; 272: 22905-22912Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar). Close inspection of the DPA gene sequences –45/–17 revealed the presence of an inverted CCAAT box on the opposite strand with an inverse repeat sequence extending from –37 to –10 bps relative to the transcription start site (see Fig. 3). These motifs exhibit striking similarities to a previously identified enhancer element (denoted RE-1 and R1, respectively) in the rat and human matrix metalloproteinase-2 promoters, which is a well characterized binding site for YB-1 (14Mertens P.R. Alfonso-Jaume M.A. Steinmann K. Lovett D.H. J. Biol. Chem. 1998; 273: 32957-32965Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar). The current study examined the potential YB-1 interaction with the inverted CCAAT-box and demonstrates that YB-1 functions as a positive trans-activator of DPA gene expression, underscoring the pivotal role of YB-1 in the regulation of cellular proliferation. Rat mesangial cells (MCs) were established and characterized as described previously (15Mertens P.R. Espenkott V. Venjakob B. Heintz B. Handt S. Sieberth H.G. Hypertension. 1998; 32: 945-952Crossref PubMed Scopus (16) Google Scholar, 16Reisdorff J. En-Nia A. Stefanidis I. Floege J. Lovett D.H. Mertens P.R. J. Am. Soc. Nephrol. 2002; 13: 1568-1578Crossref PubMed Scopus (31) Google Scholar) and were grown in RPMI 1640 medium supplemented with 10% fetal calf serum, 2 mm l-glutamine, 100 μg/ml streptomycin, and 100 units/ml penicillin at 37 °C in humidified 5% CO2 in air. HK-2 cells were maintained as described previously (17Norman J.T. Lindahl G.E. Shakib K. En-Nia A. Yilmaz E. Mertens P.R. J. Biol. Chem. 2001; 276: 29880-29890Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar). pSG5-YB-1—The eukaryotic YB-1 expression vector (pSG5-YB-1) containing the complete human YB-1 open reading frame cloned into the expression vector pSG5 (Stratagene) was kindly provided by J. P.-Y. Ting (University of North Carolina) (18MacDonald G.H. Itoh-Lindstrom Y. Ting J.P. J. Biol. Chem. 1995; 270: 3527-3533Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar). DNA Polymerase α Promoter Constructs—DNA polymerase α promoter/luciferase reporter plasmids were kindly donated by T. S.-F. Wang (8Pearson B.E. Nasheuer H.P. Wang T.S. Mol. Cell. Biol. 1991; 11: 2081-2095Crossref PubMed Google Scholar). Designations pDPALΔ5(–1571) and pDPASLΔ5(–248) refer to plasmids that contain 1571 and 248 bps of the DPA upstream sequence, respectively, which is subcloned in pSV0A. PSV0ALΔ5 is a negative control plasmid also subcloned in pSV0A. DPA sequences –65/+45, –46/+45, and –9/+45 were subcloned into the multiple cloning restriction sites BglII and KpnI of reporter constructs pGL3-Basic and -Promoter (Promega). Transient transfection of MCs was performed with liposome preparation Tfx-50 (Promega) as described (19En-Nia A. Reisdorff J. Stefanidis I. Floege J. Heinrich P.C. Mertens P.R. Biochem. J. 2002; 362: 693-700Crossref PubMed Google Scholar). Purified plasmid DNA was diluted in 1000 μl of RPMI 1640 medium, mixed with sterile Tfx-50 preparation (4.5 μl/μg of DNA), and incubated at room temperature for 15 min. MCs were grown to 60–70% confluency in 6-well culture plates and washed twice with phosphate-buffered saline. To each well 1 ml DNA/liposome mixture was added and incubated for 2.5 h at 37 °C with subsequent addition of complete 10% fetal calf serum/RPMI medium. In co-transfection experiments 1 μg of luciferase reporter plasmid was combined with 1 μg of pSG5-YB-1 plasmid DNA/well. The total DNA content was equalized by inclusion of pSG5 plasmid. As control for transfection efficiency, pSV40-βGal plasmid (1 μg/well; Promega), was included. Cell lysis, β-galactosidase, and luciferase assays were performed after 48 h. Luciferase assays were performed with 100 μl of the lysates as described previously (20Mertens P.R. Alfonso-Jaume M.A. Steinmann K. Lovett D.H. J. Am. Soc. Nephrol. 1999; 10: 2480-2487Crossref PubMed Google Scholar). β-Galactosidase activity was measured using a commercial chemiluminescence assay (Promega). All transfections were performed in triplicate to quadruplicate and were repeated at least three times. Transfection results were averaged and are expressed as the mean ± 1 S.D. Cells were grown to 80% confluency in tissue culture flasks, washed twice with ice-cold phosphate-buffered saline without calcium and magnesium, and scraped in 10 ml of cold phosphate-buffered saline. Nuclear and cytoplasmic cell extracts were prepared as described previously (13Mertens P.R. Harendza S. Pollock A.S. Lovett D.H. J. Biol. Chem. 1997; 272: 22905-22912Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar). Protein concentrations were determined by the Bio-Rad protein assay using bovine serum albumin as standard. Extracts were stored at –80 °C until performance of electrophoretic mobility shift analysis, Western, or Southwestern blotting. Double-stranded probes (–65GCCGGAAGTCCGCAGCCTCCCGGAGCCGCTGATTGGCTTTCAGGCTGGCGCCTGTCTCGGCCCCC) were generated by heating complementary synthetic oligonucleotides for 10 min at 95 °C in Tris-EDTA with subsequent cooling to room temperature over 6 h. All probes were radiolabeled by means of T4-polynucleotide kinase using [γ-32P]ATP and were purified on 14% polyacrylamide gels and eluted, and 6 × 104 cpm of labeled probe was included per binding reaction. Binding reactions were performed at 22 °C for 30 min in binding buffer (20 mm HEPES (pH 7.9), 20% glycerol, 0.1 m NaCl, 0.2 mm EDTA) containing 0.2 mm phenylmethylsulfonyl fluoride, 0.5 mm dithiothreitol, 300 μg/ml acetylated bovine serum albumin, and 2 μg of poly(dI-dC) in a total volume of 25 μl upon the addition of nuclear or cytoplasmic extracts. Samples were electrophoresed on non-denaturing 4% polyacrylamide, 7.5% glycerol gels in a buffer containing 1× Tris borate/EDTA followed by autoradiography. Recombinant YB-1 was prepared from a pRSET vector (Invitrogen) containing an insert coding for a hexahistidine T7 epitope-YB-1 fusion protein as described by Mertens et al. (14Mertens P.R. Alfonso-Jaume M.A. Steinmann K. Lovett D.H. J. Biol. Chem. 1998; 273: 32957-32965Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar). For competition experiments, unlabeled oligonucleotides or nonspecific DNA (500-fold molar excess) were added to the binding reaction 15 min before the addition of labeled oligonucleotides followed by a 30-min incubation period and subsequent separation on polyacrylamide gels. Relative binding affinities were determined by quantitation of shifted bands using a PhosphorImager system (Bio-Rad). For supershift assays, affinity-purified rabbit anti-YB-1 antibody raised against a C-terminal epitope (20Mertens P.R. Alfonso-Jaume M.A. Steinmann K. Lovett D.H. J. Am. Soc. Nephrol. 1999; 10: 2480-2487Crossref PubMed Google Scholar) was added to the nuclear extracts 12 h before the addition of labeled oligonucleotides, and the binding reaction was incubated for 30 min at 20 °C. Nuclear proteins (5 μg) were separated by SDS-10% PAGE before transfer to nitrocellulose membranes (Schleicher and Schuell) and blocked in TTBS (10 mm Tris-HCl (pH 8.0), 150 mm NaCl, 0.05% Tween 20) containing 2% BSA for 2 h at room temperature. Filters were incubated with primary polyclonal rabbit anti-YB-1 antibody (1:1000) followed by 3 washes with TTBS for 5 min each and incubation with secondary goat anti-rabbit IgG in TTBS. For DNA polymerase α protein detection, a polyclonal antibody raised in goat (N19, Santa Cruz) was used at 1:1000 dilution with bovine anti-goat IgG (Santa Cruz; 1:5000) serving as secondary antibody. The filters were washed 3 times with TTBS and developed with an ECL detection kit (Amersham Biosciences). Southwestern blot analysis was performed as described (13Mertens P.R. Harendza S. Pollock A.S. Lovett D.H. J. Biol. Chem. 1997; 272: 22905-22912Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar) using MC nuclear proteins (50 μg) and radiolabeled DPA RE-1 oligonucleotide probes (106 cpm/ml). Confluent human kidney cells (HK-2) were grown to 80% confluence and serum-starved for 24 h. Subsequently cells were incubated with 10% fetal bovine serum for 3 and 6 h and subjected to chromatin immunoprecipitation, as described by the manufacturer of the chromatin immunoprecipitation assay kit (Upstate Biotechnology Inc.). Briefly, 106 cells were treated with 1% formaldehyde solution for 10 min at 37 °C to cross-link proteins and were resuspended in lysis buffer containing 1% SDS, 10 mm EDTA, 50 mm Tris-HCl (pH 8.1). Extracts were sonicated until sheared DNA had an average size of 1 kilobase. DNA-protein complexes were used for immunoprecipitation reactions that included polyclonal anti-YB-1 antibodies (20Mertens P.R. Alfonso-Jaume M.A. Steinmann K. Lovett D.H. J. Am. Soc. Nephrol. 1999; 10: 2480-2487Crossref PubMed Google Scholar). Control reactions were set up without antibody and with a salmon sperm DNA/protein A-agarose slurry (Upstate Biotechnology). Protein-DNA cross-links were reversed by adding 5 m NaCl and heating to 65 °C for 4 h. DNA was recovered and used for PCR reactions with primers that amplify the DNA polymerase α proximal promoter (forward, 5′-CGC CCA AAT CTT TTC CCA TC-3′; reverse, 5′-CA CGG CGA CGA CTG TGA GAT-3′). Conditions of PCR were as follows: 1 cycle of 95 °C for 5 min followed by 40 cycles of 95 °C for 30 s, 51 °C for 30 s and 72 °C for 30 s. Mung bean nuclease treatment was performed as described by Norman et al. (17Norman J.T. Lindahl G.E. Shakib K. En-Nia A. Yilmaz E. Mertens P.R. J. Biol. Chem. 2001; 276: 29880-29890Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar). The strictly double-stranded, asymmetrically end-labeled probe was prepared by digesting pT4-Luc-DPA RE-1 with BglII or KpnI; the resultant overhanging 5′ ends were dephosphorylated with calf intestinal alkaline phosphatase (Roche Applied Science) and end-labeled with [γ-32P]ATP by means of T4 polynucleotide kinase (Roche Applied Science). The DNA fragment was released by BglII/KpnI digestion and gel-purified. About 105 cpm of probe was incubated in the presence of 1 μg of poly(dI-dC) with either rYB-1 (10 ng) or nuclear proteins (10 μg) in binding buffer A (without EDTA, supplemented with 4 mm MgCl2) in a total volume of 15 μl at 25 °C for 20 min. The reaction volume was diluted 5-fold, and 1 volume of mung bean nuclease buffer was added. Mung bean nuclease reactions were performed at saturating concentrations of enzyme, as previously determined by titration. 50 units of mung bean nuclease (100 units/μl; Promega) were added to each reaction and incubated for 20 min at 37 °C, followed by termination with 240 μl of stop buffer (100 mm Tris-HCl (pH 8.0), 100 mm NaCl, 20 mm EDTA, 0.1% SDS, 100 μg/ml proteinase K). After incubation in stop buffer at 37 °C for 15 min, reactions were phenol/chloroformextracted once and precipitated. Samples were subjected to electrophoresis on 12.5% polyacrylamide urea gels with parallel lanes containing chemical sequencing reactions. Cycling MCs grown in complete medium with 10% fetal calf serum were incubated with phosphothiorated antisense (AS) or scrambled control oligonucleotides (Stanford University), as described previously by Duh et al. (21Duh J.L. Zhu H. Shertzer H.G. Nebert D.W. Puga A. J. Biol. Chem. 1995; 270: 30499-30507Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar) at concentrations ranging from 10 to 50 μm. Medium containing oligonucleotides was replaced every 24 h. Direct cell counting was performed with trypan blue staining for assessment of viable cells. Three independent experiments were performed in quadruplicate. Results were averaged and are expressed as the mean ± 1 S.D. MCs were grown to 50% confluency on 10-cm plates in RPMI 1640 with 10% fetal calf serum, 100 μg/ml streptomycin, 100 units/ml penicillin. Cells were transfected with the empty vector pSuperDuper (Oligo-Engine, Seattle, WA) or the pSuperDuper vector harboring the sequence 5′-GGTCATCGCAACGAAGGTTTT-3′ as a tail to tail tandem repeat of bp 285–305 of the human YB-1-coding sequence (accession number J03827). Stable transfections with liposomal preparation FuGENE were performed in conjunction with G418 resistance plasmid pUHD15–1neo (BD-Clontech, Heidelberg, Germany). Five μg total plasmid DNA and 15 μl of FuGENE solution were mixed in 500 μl of serum-free medium, incubated for 15 min at room temperature, and added dropwise to culture medium (10 ml/plate). After 24 h the medium was exchanged, and selection with G418 at a concentration of 400 μg/ml was started. Within 2 weeks single cell clones were apparent and selectively picked. Screening for the presence of pSuperDuper plasmid DNA was performed, and changes of YB-1 mRNA and protein levels were performed by real-time PCR and immunoblotting using a polyclonal anti-YB-1 antibody. Proliferation of YB-1 knock down and control cells was measured by BrdUrd incorporation using the BrdUrd colorimetric enzyme-linked immunosorbent assay kit (Roche Applied Science). Cells were plated on 96-well plates for 24 h. During the last 16 h the cells were grown in the presence of BrdUrd, and the incorporation thereof was measured by ELISA using an anti-BrdUrd-peroxidase monoclonal antibody. Statistical significance was determined for paired comparisons using Student's t test or by analysis of variance for multiple comparisons where appropriate. Reduction of Endogenous YB-1 Inhibits Cell Proliferation—We have hypothesized of a key role for YB-1 in cell proliferation in non-transformed cells. As a first step, an oligonucleotide antisense approach was chosen to reduce endogenous YB-1 concentrations in rat MCs. The efficacy of YB-1 transcript reduction was assessed at the protein level by Western blotting (Fig. 1A). An approximate 60% reduction of YB-1 protein was detected in the antisense-treated cells, whereas there was no change of the YB-1 protein concentration in cells incubated with scrambled control oligonucleotides. Direct cell counting revealed a concentration-dependent inhibitory effect of the YB-1 antisense oligonucleotide on cell proliferation of up to 50%, whereas proliferation was unaffected by control oligonucleotide (Fig. 1B). Because sequence-independent effects have been described for phosphothiorated antisense oligonucleotides, a second approach utilizing interfering double-stranded RNA was performed. Here, a 80% reduction of endogenous YB-1 mRNA and protein levels was achieved in MC and led to a 90% inhibition of endogenous YB-1 protein levels (Fig. 1C, left and middle panel). Under these conditions cell proliferation, assessed by BrdUrd incorporation, was reduced by ∼50% (Fig. 1C, right panel). YB-1 Stimulates DNA Polymerase α Promoter Activity— Given the influence of YB-1 on the expression of other proliferation-associated genes, we next tested whether YB-1 also influences transcription of the DPA gene. A reporter assay was established using hybrid luciferase constructs harboring the 5′ regulatory sequence of the human DPA gene transfected into mesangial cells. Transfections were performed with reporter constructs pDPALΔ5 (–1571/+45) and pDPASLΔ5 (–248/+45). After co-transfection with YB-1 expression vector, pSG5-YB-1, a 2-fold increase in luciferase activity was observed with both constructs, pDPALΔ5 and pDPASLΔ5 (Fig. 2A), whereas cotransfection of pSG-5-YB-1 did not affect the activity of control luciferase vector pSV0ALΔ5. There was a 2-fold higher transcriptional activity of construct pDPALΔ5 compared with pDPASLΔ5, indicating additional elements within the extended promoter sequence. The increase of reporter gene activity with overexpressed YB-1 was concentration-dependent, as shown for construct pDPASLΔ5 in Fig. 2B. Identification of Putative YB-1 Binding Sites in the Human DNA Polymerase α Gene Promoter—Inspection of the DPA promoter sequence revealed a putative YB-1 binding site at –45/–17 bps. This sequence harbors an inverted CCAAT-box (ATTGG) and is homologous to previously described incomplete Y-box elements (22Wolffe A.P. BioEssays. 1994; 16: 245-251Crossref PubMed Scopus (329) Google Scholar). Furthermore, there is a 3′ inverse repeat motif located between –27 and –11 that may constitute a template for extended YB-1/DNA binding. A comparison of the DPA Y-box element with the YB-1 binding element in the rat MMP-2 gene, designated response element-1 (MMP-2 RE-1), is shown in Fig. 3A. There is an extensive degree of similarity between both elements with seven consecutive matching bases within the Y-box, and in addition, the 3′ sequence of the Y-box contains an inverted repeat motif with 6 of 10 bases matching in both elements. To determine whether the DPA sequence, designated DPA response element 1 (DPA RE-1), also bound YB-1, Southwestern blotting and EMSA were performed. DPA RE-1 Binding Activities—The molecular masses of potential DPA RE-1-binding proteins were assessed by Southwestern blotting with nuclear proteins from MC and single-stranded as well as double-stranded probes. Single-stranded sense (SS1) oligonucleotides bound to several proteins with estimated molecular masses of 26, 32, and 52 kDa (Fig. 3B). Specificity of the binding reaction was confirmed by inclusion of homologous (lane 2) and heterologous (lane 3) competitor DNA at 1000-fold molar excess. The 52-kDa band exhibited the same mobility as endogenous YB-1 protein that is detected by Western blotting using an anti-YB-1 antibody (lane 4), supporting the notion of YB-1 binding to this element. A similar banding pattern was observed with the antisense DNA strand (data not shown). Recombinant YB-1 Binds to the DPA RE-1—DNA binding studies were performed with recombinant YB-1 protein (rYB-1) and sense (SS1), antisense (SS2), and double (DS)-stranded DPA RE-1 probes. Two closely migrating complexes were detected by electrophoretic mobility shift analysis with all probes (Fig. 4A, lanes 2, 6, and 10). Quantitative densitometry of bands revealed a 5-fold higher affinity of rYB-1 for both single-stranded templates compared with the double-stranded probe. Specificity of binding reactions was confirmed by inclusion of homologous competitor DNA at 500-fold molar excess, leading to diminished bands (lanes 3, 7, and 11), whereas heterologous competitor DNA had only a minor effect on complex formation (lanes 4, 8, and 12). Endogenous YB-1 Binds to the DPA RE-1—Similar DNA binding studies were performed with MC nuclear proteins. Nuclear proteins formed several distinct complexes with SS1, SS2, and DS probes (Fig. 4B). To test for YB-1 participation in these complexes, supershift studies were performed using a specific anti-YB-1 antibody directed against epitopes in the protein C terminus (20Mertens P.R. Alfonso-Jaume M.A. Steinmann K. Lovett D.H. J. Am. Soc. Nephrol. 1999; 10: 2480-2487Crossref PubMed Google Scholar). This domain is known to participate in protein-protein interactions and also determines DNA binding specificity. With inclusion of the anti-YB-1 antibody, supershifts were apparent with the DS (lane 3) and SS2 probes (lane 9, indicated by an asterisk). At the same time complexes 10> and 11> appeared diminished. For the sense strand, a disruption of complex 5> was detected (indicated by <#), and at the same time a novel high mobility complex appeared (lane 6, indicated by "**"). Here, the antibody most likely prevented binding of YB-1 to the probe and no supershift appeared. These experiments indicate that endogenous YB-1 is a component of the nucleoprotein complexes formed with DPA RE-1 in all conformations tested and that it interacts with other DPA RE-1 binding factors. Serum-dependent Changes of Complex Formation at the DPA RE-1—Because the sequence element –45/–17 of DPA is responsive to serum growth factor, DNA binding studies were performed with nuclear (NE) and cytoplasmic (CE) extracts from serum-starved and serum-stimulated MCs. MCs were serum-starved for 24 h and subsequently incubated for different periods with 10% bovine fetal serum before extracts were prepared. Formation of nucleocomplexes was tested with radiolabeled double (DS) and sense-strand (SS1) DPA RE-1 probes (Fig. 5A and B). Under these conditions three distinct bands were detected with DS DPA RE-1 that exhibited only minor changes in intensities after serum stimulation (Fig. 5A). Again, inclusion of anti-YB-1 antibody led to the formation of a supershift (indicated by an asterisk in lanes 5 and 10) and diminished bands 2> and 3> (Fig. 5A). With cytoplasmic and double strand probe a minor decrease of complex >6 was detected after 2 h of serum stimulation. In contrast to these minor changes with the DS probe, major changes in complex formation were detected with the sense strand of DPA RE-1. The intensities of bands designated 1>, 2>, 4>, and 5> (Fig. 5B, compare lanes 1–4) were increased within 30 min of serum incubation. This increase was transient and lasted for less than 2 h. Reciprocal changes were observed with cytoplasmic extracts; that is, band intensities indicated by 8> (Fig. 5B, compare lanes 6–9) decreased within 30 min and increased again 24 h after serum stimulation. Involvement of YB-1 in complex formation was demonstrated by inclusion of polyclonal anti-YB-1 antibody (Fig. 5B, lanes 5 and 10). Here diminished bands (indicated by #) and supershifts (indicated by *) were present. These finding are in accord with a transient serum growth factor-induced shift of cytoplasmic YB-1 protein to the nuclear compartment and predominant binding of YB-1-containing complexes to the single-stranded DPA RE-1 element. YB-1 Promotes Single-stranded DNA Conformation in the DPA Promoter—Previous studies suggest that YB-1 promotes strand se