Localization and Function of the Yeast Multidrug Transporter Tpo1p

Name: Work Video:
Duration: 3 min 30 s
Markus Albertsen; Inga Bellahn; Reinhard Krämer; Sabine Waffenschmidt
{'id': 'https://openalex.org/W2047065718', 'doi': 'https://doi.org/10.1074/jbc.m210715200', 'title': 'Localization and Function of the Yeast Multidrug Transporter Tpo1p', 'display_name': 'Localization and Function of the Yeast Multidrug Transporter Tpo1p', 'publication_year': 2003, 'publication_date': '2003-04-01', 'ids': {'openalex': 'https://openalex.org/W2047065718', 'doi': 'https://doi.org/10.1074/jbc.m210715200', 'mag': '2047065718', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/12562762'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m210715200', 'pdf_url': 'http://www.jbc.org/article/S0021925819646521/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819646521/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5014517490', 'display_name': 'Markus Albertsen', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I180923762', 'display_name': 'University of Cologne', 'ror': 'https://ror.org/00rcxh774', 'country_code': 'DE', 'type': 'education', 'lineage': ['https://openalex.org/I180923762']}], 'countries': ['DE'], 'is_corresponding': False, 'raw_author_name': 'Markus Albertsen', 'raw_affiliation_strings': ['Institut für Biochemie, Universität zu Köln, Zülpicher Strasse 47, 50674 Köln, Germany'], 'affiliations': [{'raw_affiliation_string': 'Institut für Biochemie, Universität zu Köln, Zülpicher Strasse 47, 50674 Köln, Germany', 'institution_ids': ['https://openalex.org/I180923762']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5074489417', 'display_name': 'Inga Bellahn', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I180923762', 'display_name': 'University of Cologne', 'ror': 'https://ror.org/00rcxh774', 'country_code': 'DE', 'type': 'education', 'lineage': ['https://openalex.org/I180923762']}], 'countries': ['DE'], 'is_corresponding': False, 'raw_author_name': 'Inga Bellahn', 'raw_affiliation_strings': ['From the Institut für Biochemie, Universität zu Köln, Zülpicher Strasse 47, 50674 Köln, Germany'], 'affiliations': [{'raw_affiliation_string': 'From the Institut für Biochemie, Universität zu Köln, Zülpicher Strasse 47, 50674 Köln, Germany', 'institution_ids': ['https://openalex.org/I180923762']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5111928847', 'display_name': 'Reinhard Krämer', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I180923762', 'display_name': 'University of Cologne', 'ror': 'https://ror.org/00rcxh774', 'country_code': 'DE', 'type': 'education', 'lineage': ['https://openalex.org/I180923762']}], 'countries': ['DE'], 'is_corresponding': False, 'raw_author_name': 'Reinhard Krämer', 'raw_affiliation_strings': ['From the Institut für Biochemie, Universität zu Köln, Zülpicher Strasse 47, 50674 Köln, Germany'], 'affiliations': [{'raw_affiliation_string': 'From the Institut für Biochemie, Universität zu Köln, Zülpicher Strasse 47, 50674 Köln, Germany', 'institution_ids': ['https://openalex.org/I180923762']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5089055543', 'display_name': 'Sabine Waffenschmidt', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I180923762', 'display_name': 'University of Cologne', 'ror': 'https://ror.org/00rcxh774', 'country_code': 'DE', 'type': 'education', 'lineage': ['https://openalex.org/I180923762']}], 'countries': ['DE'], 'is_corresponding': False, 'raw_author_name': 'Sabine Waffenschmidt', 'raw_affiliation_strings': ['From the Institut für Biochemie, Universität zu Köln, Zülpicher Strasse 47, 50674 Köln, Germany'], 'affiliations': [{'raw_affiliation_string': 'From the Institut für Biochemie, Universität zu Köln, Zülpicher Strasse 47, 50674 Köln, Germany', 'institution_ids': ['https://openalex.org/I180923762']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 2.949, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 78, 'citation_normalized_percentile': {'value': 0.933894, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 94, 'max': 95}, 'biblio': {'volume': '278', 'issue': '15', 'first_page': '12820', 'last_page': '12825'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T11924', 'display_name': 'Polyamine Metabolism and Applications', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T11924', 'display_name': 'Polyamine Metabolism and Applications', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10497', 'display_name': 'Fungal and yeast genetics research', 'score': 0.9997, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T12770', 'display_name': 'Amino Acid Enzymes and Metabolism', 'score': 0.9948, 'subfield': {'id': 'https://openalex.org/subfields/1303', 'display_name': 'Biochemistry'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/electrochemical-gradient', 'display_name': 'Electrochemical gradient', 'score': 0.6137207}, {'id': 'https://openalex.org/keywords/major-facilitator-superfamily', 'display_name': 'Major facilitator superfamily', 'score': 0.5713266}, {'id': 'https://openalex.org/keywords/wild-type', 'display_name': 'Wild type', 'score': 0.4937409}, {'id': 'https://openalex.org/keywords/gene-knockout', 'display_name': 'Gene knockout', 'score': 0.43159753}], 'concepts': [{'id': 'https://openalex.org/C2777576037', 'wikidata': 'https://www.wikidata.org/wiki/Q719725', 'display_name': 'Saccharomyces cerevisiae', 'level': 3, 'score': 0.68104005}, {'id': 'https://openalex.org/C2777497464', 'wikidata': 'https://www.wikidata.org/wiki/Q418834', 'display_name': 'Spermidine', 'level': 3, 'score': 0.67360234}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.6251686}, {'id': 'https://openalex.org/C90424259', 'wikidata': 'https://www.wikidata.org/wiki/Q211026', 'display_name': 'Electrochemical gradient', 'level': 3, 'score': 0.6137207}, {'id': 'https://openalex.org/C62465871', 'wikidata': 'https://www.wikidata.org/wiki/Q1886097', 'display_name': 'Major facilitator superfamily', 'level': 4, 'score': 0.5713266}, {'id': 'https://openalex.org/C2779222958', 'wikidata': 'https://www.wikidata.org/wiki/Q45422', 'display_name': 'Yeast', 'level': 2, 'score': 0.5520638}, {'id': 'https://openalex.org/C207583985', 'wikidata': 'https://www.wikidata.org/wiki/Q128723', 'display_name': 'Wild type', 'level': 4, 'score': 0.4937409}, {'id': 'https://openalex.org/C23265538', 'wikidata': 'https://www.wikidata.org/wiki/Q300033', 'display_name': 'ATPase', 'level': 3, 'score': 0.45181516}, {'id': 'https://openalex.org/C77957584', 'wikidata': 'https://www.wikidata.org/wiki/Q1133550', 'display_name': 'Gene knockout', 'level': 3, 'score': 0.43159753}, {'id': 'https://openalex.org/C57181701', 'wikidata': 'https://www.wikidata.org/wiki/Q2853339', 'display_name': 'Antiporter', 'level': 3, 'score': 0.41874892}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.40390158}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.40273914}, {'id': 'https://openalex.org/C149011108', 'wikidata': 'https://www.wikidata.org/wiki/Q652985', 'display_name': 'Transporter', 'level': 3, 'score': 0.37098464}, {'id': 'https://openalex.org/C41625074', 'wikidata': 'https://www.wikidata.org/wiki/Q176088', 'display_name': 'Membrane', 'level': 2, 'score': 0.36223346}, {'id': 'https://openalex.org/C143065580', 'wikidata': 'https://www.wikidata.org/wiki/Q3285695', 'display_name': 'Mutant', 'level': 3, 'score': 0.31177688}, {'id': 'https://openalex.org/C181199279', 'wikidata': 'https://www.wikidata.org/wiki/Q8047', 'display_name': 'Enzyme', 'level': 2, 'score': 0.18344858}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.08103496}], 'mesh': [{'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D026901', 'descriptor_name': 'Membrane Transport Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D011073', 'descriptor_name': 'Polyamines', 'qualifier_ui': 'Q000493', 'qualifier_name': 'pharmacokinetics', 'is_major_topic': True}, {'descriptor_ui': 'D012441', 'descriptor_name': 'Saccharomyces cerevisiae', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D029701', 'descriptor_name': 'Saccharomyces cerevisiae Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D017920', 'descriptor_name': 'Antiporters', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001692', 'descriptor_name': 'Biological Transport', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': 'Q000032', 'qualifier_name': 'analysis', 'is_major_topic': False}, {'descriptor_ui': 'D002462', 'descriptor_name': 'Cell Membrane', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002462', 'descriptor_name': 'Cell Membrane', 'qualifier_ui': 'Q000648', 'qualifier_name': 'ultrastructure', 'is_major_topic': False}, {'descriptor_ui': 'D002462', 'descriptor_name': 'Cell Membrane', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D017931', 'descriptor_name': 'DNA Primers', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018432', 'descriptor_name': 'Drug Resistance, Multiple', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007700', 'descriptor_name': 'Kinetics', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D026901', 'descriptor_name': 'Membrane Transport Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D026901', 'descriptor_name': 'Membrane Transport Proteins', 'qualifier_ui': 'Q000032', 'qualifier_name': 'analysis', 'is_major_topic': False}, {'descriptor_ui': 'D026901', 'descriptor_name': 'Membrane Transport Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D027701', 'descriptor_name': 'Organic Cation Transport Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011073', 'descriptor_name': 'Polyamines', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016133', 'descriptor_name': 'Polymerase Chain Reaction', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012441', 'descriptor_name': 'Saccharomyces cerevisiae', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012441', 'descriptor_name': 'Saccharomyces cerevisiae', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D029701', 'descriptor_name': 'Saccharomyces cerevisiae Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D029701', 'descriptor_name': 'Saccharomyces cerevisiae Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D029701', 'descriptor_name': 'Saccharomyces cerevisiae Proteins', 'qualifier_ui': 'Q000032', 'qualifier_name': 'analysis', 'is_major_topic': False}, {'descriptor_ui': 'D013095', 'descriptor_name': 'Spermidine', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013095', 'descriptor_name': 'Spermidine', 'qualifier_ui': 'Q000493', 'qualifier_name': 'pharmacokinetics', 'is_major_topic': False}, {'descriptor_ui': 'D014617', 'descriptor_name': 'Vacuoles', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014617', 'descriptor_name': 'Vacuoles', 'qualifier_ui': 'Q000648', 'qualifier_name': 'ultrastructure', 'is_major_topic': False}, {'descriptor_ui': 'D014617', 'descriptor_name': 'Vacuoles', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m210715200', 'pdf_url': 'http://www.jbc.org/article/S0021925819646521/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/12562762', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m210715200', 'pdf_url': 'http://www.jbc.org/article/S0021925819646521/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'score': 0.4, 'id': 'https://metadata.un.org/sdg/15', 'display_name': 'Life on land'}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 31, 'referenced_works': ['https://openalex.org/W1522510671', 'https://openalex.org/W1546910338', 'https://openalex.org/W1575457051', 'https://openalex.org/W1747506719', 'https://openalex.org/W1850569493', 'https://openalex.org/W1967390330', 'https://openalex.org/W1968518936', 'https://openalex.org/W1972704395', 'https://openalex.org/W1979630986', 'https://openalex.org/W1987272829', 'https://openalex.org/W1998467122', 'https://openalex.org/W2002740689', 'https://openalex.org/W2006472880', 'https://openalex.org/W2007045213', 'https://openalex.org/W2007075817', 'https://openalex.org/W2017938846', 'https://openalex.org/W2028638629', 'https://openalex.org/W2032679514', 'https://openalex.org/W2032758517', 'https://openalex.org/W2036244319', 'https://openalex.org/W2037240543', 'https://openalex.org/W2045785885', 'https://openalex.org/W2047439787', 'https://openalex.org/W2047492250', 'https://openalex.org/W2056079473', 'https://openalex.org/W2072577257', 'https://openalex.org/W2101442503', 'https://openalex.org/W2121586065', 'https://openalex.org/W2124859343', 'https://openalex.org/W4233242819', 'https://openalex.org/W4238270754'], 'related_works': ['https://openalex.org/W4387670505', 'https://openalex.org/W3216668821', 'https://openalex.org/W2892394354', 'https://openalex.org/W2809972353', 'https://openalex.org/W2317772263', 'https://openalex.org/W2093796467', 'https://openalex.org/W2061946782', 'https://openalex.org/W1999988084', 'https://openalex.org/W1971618060', 'https://openalex.org/W1614543652'], 'abstract_inverted_index': {'In': [0, 166, 398, 668, 730, 2606, 3144, 4823, 5391], 'Saccharomyces': [1, 167, 401], 'cerevisiae': [2, 157, 168, 323, 402, 1318, 4553, 5094, 5820], 'four': [3, 169, 515, 1132, 4543], 'transporters,': [4, 170, 2616, 4545], 'Tpo1p–Tpo4p,': [5, 171, 444], 'all': [6, 172, 346, 518, 620, 741, 792, 4372, 4542], 'members': [7, 173, 519], 'of': [8, 35, 90, 94, 108, 118, 139, 148, 174, 201, 256, 260, 274, 284, 305, 314, 395, 456, 520, 523, 582, 590, 619, 628, 671, 683, 694, 714, 733, 776, 793, 837, 950, 998, 1027, 1082, 1112, 1119, 1130, 1136, 1176, 1191, 1204, 1216, 1229, 1233, 1258, 1281, 1293, 1304, 1377, 1427, 1435, 1448, 1509, 1515, 1546, 1583, 1592, 1625, 1630, 1661, 1690, 1722, 1749, 1771, 1802, 1851, 1878, 1973, 2009, 2051, 2061, 2103, 2110, 2131, 2134, 2154, 2226, 2246, 2289, 2320, 2444, 2548, 2609, 2622, 2640, 2719, 2753, 2760, 2779, 2782, 2809, 2813, 2816, 2823, 2865, 2869, 2884, 2910, 2943, 2956, 2960, 2991, 3132, 3142, 3146, 3185, 3207, 3257, 3283, 3290, 3297, 3307, 3319, 3335, 3420, 3504, 3520, 3540, 3550, 3568, 3583, 3629, 3796, 3849, 3875, 3885, 3928, 3977, 4004, 4031, 4035, 4053, 4063, 4074, 4094, 4114, 4124, 4131, 4137, 4145, 4159, 4170, 4181, 4198, 4293, 4346, 4366, 4373, 4398, 4406, 4429, 4445, 4458, 4477, 4489, 4541, 4572, 4595, 4627, 4653, 4735, 4764, 4771, 4819, 4857, 4889, 4899, 4902, 4979, 5037, 5074, 5080, 5102, 5203, 5208, 5211, 5228, 5231, 5248, 5266, 5313, 5340, 5351, 5386, 5401, 5523, 5559, 5571, 5589, 5593, 5605, 5612, 5625, 5802, 5816, 5824], 'the': [9, 33, 36, 40, 45, 71, 97, 115, 137, 162, 175, 199, 202, 206, 211, 237, 263, 281, 303, 328, 396, 399, 403, 418, 452, 457, 528, 588, 626, 642, 650, 669, 681, 698, 719, 748, 777, 794, 911, 948, 996, 1028, 1040, 1066, 1074, 1113, 1117, 1120, 1131, 1137, 1146, 1202, 1205, 1221, 1230, 1234, 1245, 1250, 1253, 1259, 1278, 1282, 1294, 1305, 1428, 1432, 1436, 1477, 1501, 1507, 1510, 1516, 1522, 1537, 1547, 1590, 1641, 1743, 1824, 1943, 1970, 1990, 2040, 2219, 2244, 2321, 2442, 2476, 2501, 2507, 2607, 2619, 2643, 2727, 2732, 2750, 2757, 2761, 2765, 2770, 2777, 2788, 2798, 2807, 2810, 2824, 2866, 2870, 2903, 2908, 2925, 2934, 2944, 2954, 2957, 2972, 2978, 2989, 2994, 3000, 3140, 3183, 3200, 3255, 3273, 3278, 3281, 3298, 3305, 3308, 3333, 3395, 3407, 3417, 3477, 3485, 3492, 3495, 3501, 3511, 3518, 3527, 3581, 3625, 3630, 3633, 3642, 3648, 3674, 3743, 3756, 3763, 3785, 3797, 3814, 3865, 3873, 3883, 3909, 3921, 3923, 3932, 3956, 3986, 4021, 4027, 4049, 4054, 4105, 4121, 4132, 4135, 4146, 4171, 4182, 4207, 4213, 4218, 4223, 4226, 4231, 4237, 4261, 4284, 4288, 4291, 4294, 4311, 4353, 4374, 4380, 4399, 4410, 4422, 4442, 4462, 4470, 4478, 4487, 4493, 4558, 4563, 4649, 4740, 4747, 4750, 4820, 4846, 4878, 4905, 4987, 5015, 5035, 5072, 5145, 5165, 5188, 5194, 5206, 5229, 5242, 5246, 5262, 5311, 5344, 5352, 5365, 5373, 5376, 5384, 5392, 5418, 5462, 5469, 5521, 5528, 5537, 5603, 5610, 5756, 5810, 5813, 5822, 5842, 5852, 5859, 5877], 'major': [10, 176, 529], 'facilitator': [11, 177, 530], 'superfamily,': [12, 178], 'have': [13, 179, 445, 2628, 4548, 4877], 'been': [14, 180, 446, 2629, 2892, 3215, 3680, 4498, 4549, 4599, 4632, 4640, 4912, 5089, 5477, 5617], 'shown': [15, 181, 4047, 4499, 5273, 5478, 5750], 'to': [16, 19, 77, 83, 101, 182, 185, 243, 249, 267, 448, 510, 539, 593, 634, 641, 654, 674, 680, 702, 718, 728, 755, 916, 919, 1013, 1201, 1220, 1236, 1244, 1248, 1270, 1560, 1628, 1638, 1651, 1756, 1798, 1939, 2005, 2108, 2127, 2151, 2237, 2271, 2281, 2357, 2385, 2528, 2554, 2612, 2632, 2656, 2785, 2794, 2797, 2819, 2948, 2967, 2985, 2999, 3035, 3157, 3199, 3245, 3271, 3288, 3331, 3393, 3401, 3517, 3731, 3905, 3941, 4000, 4059, 4086, 4142, 4259, 4267, 4414, 4435, 4505, 4576, 4817, 4986, 5010, 5043, 5098, 5119, 5135, 5144, 5157, 5191, 5217, 5219, 5275, 5278, 5417, 5433, 5487, 5533, 5552, 5619, 5622, 5751, 5871], 'confer': [17, 183, 5620], 'resistance': [18, 82, 184, 248, 525, 1269, 4480, 4504, 5621, 5716], 'polyamines.': [20, 186, 655, 4858], 'It': [21, 187, 1373, 4044, 4496], 'was': [22, 112, 188, 278, 533, 623, 665, 786, 820, 914, 980, 1005, 1033, 1142, 1188, 1285, 1366, 1404, 1441, 1487, 1519, 1529, 1549, 1587, 1635, 1643, 1745, 1949, 2042, 2054, 2221, 2235, 2269, 2410, 2482, 2520, 2551, 2646, 2712, 2905, 2997, 3072, 3301, 3413, 3507, 3800, 3959, 3980, 3997, 4127, 4175, 4186, 4220, 4250, 4257, 4281, 4384, 5142, 5272, 5317, 5329, 5347, 5371, 5413, 5424, 5748], 'suggested': [23, 189], 'that': [24, 53, 128, 155, 190, 219, 294, 321, 740, 767, 2025, 2265, 2627, 2941, 3025, 3124, 3136, 3316, 3412, 3475, 3526, 3769, 3803, 4048, 4279, 4371, 4453, 4500, 4547, 4565, 4749, 4756, 4801, 4829, 4862, 4872, 4989, 5007, 5067, 5129, 5178, 5224, 5343, 5379, 5431, 5479, 5812], 'they': [25, 191, 3783, 4998], 'act': [26, 192], 'by': [27, 44, 193, 210, 380, 387, 420, 535, 823, 958, 1031, 1045, 1073, 1085, 1144, 1181, 1197, 1240, 1299, 1533, 1551, 1653, 1719, 1732, 1828, 1886, 1912, 1924, 2002, 2172, 2223, 2453, 2509, 2596, 2714, 2740, 2745, 2863, 2894, 3017, 3304, 3406, 3622, 3653, 3869, 4177, 4850, 5071, 5240, 5321, 5335, 5567], 'pumping': [28, 194], 'their': [29, 195, 374, 511, 658, 734, 4636, 5183], 'respective': [30, 116, 196, 282, 647, 1206, 1283, 1935, 2728], 'substrate': [31, 197, 5709], 'into': [32, 198, 389, 417, 1263, 1531, 1557, 2886, 3013, 3536, 3624, 3673, 3742, 4166, 4492, 4766, 5065, 5268], 'lumen': [34, 200], 'vacuole': [37, 203, 419, 3626], 'depending': [38, 204], 'on': [39, 205, 587, 760, 880, 1274, 1645, 1747, 1844, 2039, 2318, 2902, 3211, 3533, 4290, 4746, 4887, 5310, 5405, 5609], 'proton': [41, 207], 'gradient': [42, 49, 208, 215, 1752, 2717, 4360, 4467, 4891], 'generated': [43, 209, 1309, 1405, 2171, 2647, 4340], 'V-ATPase.': [46, 212], 'Using': [47, 213, 4357], 'sucrose': [48, 214, 1759, 2715, 4358, 4466, 4890], 'ultracentrifugation': [50, 216, 1829], 'we': [51, 152, 217, 318, 686, 722, 738, 2617, 2653, 2805, 2965, 3007, 3155, 3169, 3388, 3473, 3646, 3665, 3844, 3863, 4096, 4151, 4264, 4362, 4451, 4574, 4826, 5107, 5132, 5308, 5380, 5395, 5465, 5548], 'found': [52, 154, 218, 320, 586, 739, 2940, 3474, 3768, 3962, 4258, 4370, 4452, 5381], 'an': [54, 220, 635, 731, 1462, 2272, 2610, 2658, 3160, 4143, 4808, 5061, 5398, 5578, 5707], 'hemagglutinin': [55, 221, 332], '(HA)-tagged': [56, 222], 'Tpo1p': [57, 73, 91, 129, 223, 239, 257, 295, 532, 594, 712, 761, 770, 2641, 2783, 2946, 2961, 2992, 3125, 3150, 3579, 3804, 4075, 4139, 4266, 4280, 4647, 4736, 4863, 5103, 5124, 5149, 5271, 5572, 5590, 5817], 'as': [58, 60, 224, 226, 704, 788, 1451, 1498, 1505, 1931, 2603, 2648, 2731, 3151, 3678, 3752, 3983, 4008, 4210, 4234, 4314, 4352, 4386, 4469, 4597, 4904, 4955, 4957], 'well': [59, 225, 691, 4315, 4956], 'its': [61, 227, 536, 715, 4501], 'HA-tagged': [62, 72, 228, 238, 1585, 2945, 4456, 4539, 4751], 'Tpo2p–4p': [63, 229], 'homologues': [64, 230], 'co-localize': [65, 231], 'with': [66, 114, 232, 280, 800, 1007, 1016, 1491, 1521, 1705, 2089, 2097, 2174, 2242, 2276, 2286, 2487, 2642, 2756, 2769, 2924, 2933, 3463, 3762, 3985, 4006, 4082, 4222, 4461, 4557, 4646, 5258, 5364, 5409, 5484, 5527, 5564], 'plasma': [67, 98, 132, 233, 264, 298, 2771, 2799, 2979, 2995, 3320, 3634, 4270, 4285, 4312, 4387, 4411, 4559, 4585, 4741, 4866], 'membrane': [68, 99, 234, 265, 460, 701, 2720, 2772, 2996, 3321, 4286, 4313, 4364, 4388, 4412, 4560, 4586], 'markers.': [69, 235], 'Because': [70, 236, 366, 2953, 2988, 3375, 3655, 4255], 'carrier': [74, 240, 693, 3391, 4868], 'protein': [75, 241, 512, 2974, 4652, 4752], 'proved': [76, 242], 'be': [78, 102, 244, 268, 449, 1237, 2657, 2861, 2963, 3268, 3470, 3619, 3671, 3750, 4010, 4046, 4268, 4415, 4419, 4436, 5083, 5126, 5238, 5333, 5752], 'functional': [79, 245, 4754], 'in': [80, 85, 92, 136, 142, 246, 251, 258, 302, 308, 344, 371, 548, 660, 697, 726, 747, 772, 909, 995, 1310, 1315, 1321, 1357, 1402, 1622, 1658, 1664, 1687, 1760, 1787, 1811, 1848, 1875, 1958, 1969, 1989, 2028, 2044, 2085, 2118, 2158, 2194, 2198, 2327, 2437, 2441, 2462, 2475, 2583, 2889, 2922, 2977, 2993, 3003, 3102, 3129, 3162, 3182, 3254, 3379, 3384, 3416, 3562, 3580, 3616, 3662, 3734, 3755, 3775, 3808, 3818, 3872, 3882, 3889, 3931, 3953, 3994, 4012, 4024, 4076, 4091, 4112, 4187, 4206, 4230, 4252, 4274, 4283, 4299, 4310, 4379, 4404, 4421, 4440, 4486, 4551, 4567, 4583, 4592, 4737, 4762, 4833, 4839, 4844, 4852, 4908, 5003, 5091, 5104, 5128, 5154, 5187, 5205, 5236, 5318, 5326, 5482, 5493, 5531, 5536, 5573, 5591, 5602, 5818], 'conferring': [81, 247], 'polyamines': [84, 95, 250, 261, 404, 639, 2465, 2550, 3210, 3584, 3669, 4596, 4765, 4991, 5259], 'TPO1': [86, 120, 252, 286, 1029, 2817, 3018, 3027, 3212, 3459, 3528, 4055, 4133, 4156, 4238, 4256, 4834, 5166, 5322, 5354, 5489, 5747], 'knockouts,': [87, 253], 'a': [88, 119, 131, 254, 285, 297, 421, 521, 646, 672, 690, 705, 757, 886, 953, 1080, 1177, 1185, 1192, 1358, 1375, 1425, 1659, 1706, 1723, 1750, 1788, 1895, 1901, 1907, 1919, 2006, 2045, 2057, 2129, 2227, 2238, 2315, 2633, 2880, 2887, 2895, 3026, 3066, 3204, 3246, 3410, 3448, 3458, 3563, 3576, 3753, 3963, 4001, 4017, 4072, 4092, 4100, 4129, 4153, 4269, 4437, 4454, 4475, 4733, 4830, 4836, 4865, 5041, 5077, 5100, 5158, 5213, 5337, 5348, 5406, 5429, 5560, 5587, 5623, 5753], 'function': [89, 255, 618, 3002, 3577, 4073, 5101, 5588, 5815], 'transport': [93, 106, 147, 259, 272, 313, 388, 442, 454, 720, 2380, 2625, 3623, 4405, 4594, 4738], 'across': [96, 262, 3632, 4409, 4739], 'seemed': [100, 266], 'likely.': [103, 269], 'The': [104, 123, 270, 289, 579, 617, 763, 779, 828, 1002, 1063, 1110, 1208, 1361, 1422, 1439, 1465, 1473, 1483, 1513, 1526, 1553, 1618, 1647, 1683, 1775, 1839, 1882, 1934, 1953, 2036, 2049, 2081, 2112, 2138, 2168, 2189, 2232, 2261, 2351, 2432, 2455, 2479, 2709, 2899, 2913, 3240, 3294, 3327, 3566, 3636, 3793, 3878, 3991, 4193, 4245, 4277, 4424, 4769, 4870, 4976, 5324, 5356, 5569, 5581], 'polyamine': [105, 146, 271, 312, 453, 662, 773, 921, 943, 2821, 2986, 3005, 3011, 3130, 3153, 3164, 3241, 3250, 3573, 3650, 3660, 3817, 3906, 4025, 4179, 4297, 4402, 4544, 4909, 5105, 5232, 5377, 5435, 5480, 5596], 'activity': [107, 117, 273, 283, 3105, 3296, 3392, 3452, 4117, 4812, 5244, 5247, 5328], 'wild': [109, 149, 275, 315, 2926, 3036, 3110, 3174, 3464, 3770, 3898, 3967, 3987, 4036, 4064, 4106, 4214, 5162, 5366, 5410, 5836], 'type': [110, 150, 276, 316, 696, 2927, 3037, 3111, 3175, 3721, 3771, 3899, 3968, 3988, 4037, 4065, 4107, 4215, 5163, 5367, 5837], 'cells': [111, 277, 350, 651, 829, 1619, 1648, 1729, 1954, 2082, 2113, 2139, 2433, 2502, 2580, 2725, 2916, 3014, 3038, 3134, 3176, 3724, 3774, 3820, 3859, 3871, 3879, 3930, 3979, 4005, 4081, 4847, 4961, 5008, 5198, 5257, 5267, 5470], 'compared': [113, 279, 3462, 3984, 5408], 'knockout': [121, 287, 3141, 4758], 'strain.': [122, 288, 4168], 'results': [124, 290, 764, 3637, 4888], 'obtained': [125, 291, 765, 1367], 'strongly': [126, 292], 'suggest': [127, 293, 766], 'is': [130, 158, 296, 324, 377, 546, 798, 1079, 1313, 1374, 2791, 2875, 3015, 3126, 3657, 3805, 3813, 4474, 4744, 4753, 4759, 4813, 4864, 4982, 5039, 5069, 5150, 5600, 5712, 5821], 'membrane-bound': [133, 299, 4271], 'exporter,': [134, 300], 'involved': [135, 301, 547, 3128, 3807, 4273, 4591, 5127, 5153], 'detoxification': [138, 304, 3582, 4488, 5214, 5592, 5823], 'excess': [140, 306, 5829], 'spermidine': [141, 307, 549, 2105, 2447, 2499, 2519, 2920, 2951, 3740, 3781, 3812, 3861, 3867, 3888, 3910, 3926, 3958, 4050, 4077, 4125, 4147, 4195, 4248, 4275, 4840, 5314, 5360, 5524, 5538], 'yeast.': [143, 309], 'When': [144, 310, 4217, 5096, 5197], 'studying': [145, 311], 'cells,': [151, 317, 2826, 4040], 'furthermore': [153, 319], 'S.': [156, 322, 781, 1092, 1150, 1156, 1388, 4300, 4552, 5819], 'excreting': [159, 325], 'putrescine': [160, 326, 3258, 3778, 3794, 4083, 4115, 4903, 5116, 5138, 5184, 5279], 'during': [161, 327, 3676], 'fermentative': [163, 329, 5146], 'growth': [164, 330, 643, 3201, 3758, 3854, 3934, 5147, 5204, 5555], 'phase.': [165, 331], '4-morpholineethanesulfonic': [333], 'acid': [334, 1011, 2586, 5659, 5686, 5689], 'high': [335, 2523, 2597, 3269, 3291, 4855, 5004, 5209, 5594], 'pressure': [336], 'liquid': [337, 2046, 2341, 2525, 2599], 'chromatography': [338, 2526, 2600], 'Polyamines': [339, 3196], 'are': [340, 369, 409, 414, 517, 744, 3902, 3913, 4308, 4848, 4882, 4992, 4999, 5199, 5869], 'essential': [341], 'compounds': [342, 368, 413, 4491, 5629], 'occurring': [343], 'virtually': [345, 3325], 'prokaryotic': [347, 4916], 'and': [348, 383, 385, 407, 819, 840, 946, 986, 1078, 1125, 1135, 1226, 1252, 1266, 1308, 1431, 1453, 1457, 1461, 1471, 1479, 1536, 1542, 1640, 1675, 1717, 1742, 1793, 1823, 1872, 1889, 1918, 1942, 1983, 2000, 2063, 2095, 2100, 2106, 2116, 2149, 2196, 2218, 2249, 2258, 2284, 2309, 2343, 2407, 2448, 2472, 2489, 2517, 2594, 2742, 2928, 3109, 3177, 3192, 3259, 3261, 3322, 3356, 3399, 3587, 3722, 3739, 3760, 3772, 3900, 3908, 3951, 3969, 4038, 4108, 4162, 4203, 4306, 4349, 4369, 4417, 4426, 4482, 4588, 4755, 4875, 4893, 4937, 5122, 5164, 5260, 5331, 5632, 5687, 5783, 5841, 5851, 5862], 'eukaryotic': [349, 4938], '(1Tabor': [351], 'C.W.': [352], 'Tabor': [353], 'H.': [354, 462, 488, 596, 855, 2558, 2663, 2688, 2833, 3040, 3076, 3219, 3425, 3590, 3690, 4317, 4603, 4657, 4683, 4776, 4922, 5282, 5497], 'Annu.': [355], 'Rev.': [356], 'Biochem.': [357, 499, 607, 810, 2569, 2699, 3087, 3230, 3436, 3710, 4328, 4614, 4694, 4945, 5022, 5508, 5694, 5789], '1984;': [358, 2398, 3347], '53:': [359], '749-790Crossref': [360], 'PubMed': [361, 436, 482, 504, 574, 612, 814, 873, 904, 937, 975, 1060, 1105, 1396, 1417, 1576, 1613, 2078, 2374, 2404, 2427, 2574, 2683, 2704, 2853, 3060, 3092, 3235, 3353, 3370, 3441, 3610, 3700, 3715, 3836, 4333, 4532, 4619, 4677, 4699, 4723, 4796, 4932, 4950, 5029, 5054, 5302, 5451, 5513, 5653, 5679, 5701, 5741, 5778, 5796], 'Scopus': [362, 437, 483, 505, 575, 613, 815, 874, 905, 938, 976, 1106, 1397, 1418, 1577, 1614, 2375, 2428, 2543, 2575, 2684, 2705, 2854, 3061, 3093, 3236, 3371, 3442, 3611, 3701, 3716, 3837, 4334, 4533, 4620, 4678, 4700, 4724, 4797, 4933, 4951, 5030, 5055, 5303, 5452, 5514, 5654, 5680, 5702, 5742, 5779, 5797], '(3236)': [363], 'Google': [364, 439, 485, 507, 577, 615, 817, 876, 907, 940, 978, 1061, 1108, 1169, 1399, 1420, 1579, 1616, 2079, 2377, 2405, 2430, 2545, 2577, 2686, 2707, 2856, 3063, 3095, 3238, 3354, 3373, 3444, 3613, 3703, 3718, 3839, 4336, 4535, 4622, 4680, 4702, 4726, 4799, 4935, 4953, 4974, 5032, 5057, 5305, 5454, 5516, 5656, 5682, 5704, 5744, 5781, 5799], 'Scholar).': [365, 440, 508, 578, 616, 877, 941, 1062, 1109, 1421, 1580, 1617, 2080, 2378, 2431, 2546, 2578, 2708, 2857, 3096, 3239, 3374, 3614, 3719, 4337, 4536, 4623, 4727, 4975, 5033, 5517, 5745], 'these': [367, 514, 3973, 4367, 4407, 4580, 4628, 5251], 'toxic': [370, 3916, 5000, 5221, 5628], 'higher': [372, 5458], 'concentrations,': [373], 'intracellular': [375, 390, 2710, 3249, 3866, 3925, 4637, 5016, 5222, 5459, 5595], 'content': [376, 913, 3868, 3927], 'tightly': [378], 'regulated': [379], 'controlling': [381, 5014], 'biosynthesis': [382, 5038], 'degradation': [384], 'also': [386, 3842, 5372], 'storage': [391], 'compartments': [392], 'or': [393, 1018, 2011, 3117, 3627, 5684], 'out': [394, 775, 3628, 4434], 'cell.': [397, 778], 'yeast': [400, 458, 699, 889, 1362, 1558, 2724, 2915, 3133, 3819, 3858, 3929, 4080, 4401, 5111, 5256, 5838, 5847], 'putrescine,': [405, 3188], 'spermidine,': [406, 3191, 4007], 'spermine': [408, 2107, 2408, 3031, 3103, 3120, 3357, 3396, 3506, 3534, 4810, 5565, 5574], 'found.': [410], 'All': [411, 1292], 'three': [412, 1173, 2460, 4341, 4400], 'actively': [415], 'transported': [416], 'substrate/nH+antiport': [422], 'mechanism': [423, 5215], '(2Kakinuma': [424, 3358], 'Y.': [425, 468, 494, 602, 928, 2068, 2392, 2394, 2416, 2564, 2669, 2694, 2839, 3046, 3082, 3225, 3341, 3343, 3359, 3431, 3596, 3827, 4323, 4609, 4663, 4689, 4782, 5288, 5442, 5503], 'Masuda': [426, 925, 2417, 3360, 3824, 5439], 'N.': [427, 554, 926, 2418, 3361, 3825, 5440, 5721], 'Igarashi': [428, 469, 497, 605, 929, 2419, 2567, 2670, 2697, 2840, 3047, 3085, 3228, 3362, 3434, 3597, 3828, 4326, 4612, 4664, 4692, 4783, 5289, 5443, 5506], 'K.': [429, 464, 466, 470, 490, 498, 598, 606, 930, 1158, 2420, 2560, 2568, 2665, 2667, 2671, 2690, 2698, 2835, 2837, 2841, 3042, 3044, 3048, 3078, 3086, 3221, 3229, 3363, 3427, 3435, 3592, 3594, 3598, 3829, 4319, 4327, 4605, 4613, 4659, 4661, 4665, 4685, 4693, 4778, 4780, 4784, 5019, 5021, 5284, 5286, 5290, 5444, 5499, 5507], 'Biochim.': [430, 931, 2421, 3364, 3830, 5445], 'Biophys.': [431, 932, 2422, 3365, 3711, 3831, 4946, 5023, 5446, 5695, 5790], 'Acta.': [432, 933, 2423, 3366, 3832, 5447], '1992;': [433, 972, 2424, 2540, 3367], '1107:': [434, 2425, 3368], '126-130Crossref': [435, 2426, 3369], '(21)': [438, 2429, 3372, 4534], 'Four': [441], 'proteins,': [443, 4573], 'postulated': [447], 'responsible': [450], 'for': [451, 638, 657, 689, 707, 791, 947, 1116, 1212, 1268, 1506, 1677, 1736, 1779, 1833, 1866, 1951, 2142, 2183, 2255, 2306, 2345, 2514, 2590, 2919, 2971, 3159, 3264, 3280, 3453, 3482, 3494, 3510, 3578, 3682, 3860, 3917, 4020, 4212, 4236, 4732, 4914, 4958, 4994, 5013, 5115, 5193, 5250, 5375, 5471, 5714, 5755, 5835, 5846, 5858, 5865, 5874], 'capability': [455], 'vacuolar': [459, 661, 677, 700, 951, 2052, 2312, 2615, 2660, 2762, 3004, 3152, 3163, 3171, 3284, 3386, 3454, 3537, 3541, 4463, 4494, 4593, 4767], '(3Tomitori': [461, 2662, 2832, 3039, 4656, 4775, 5281], 'Kashiwagi': [463, 489, 597, 2559, 2664, 2689, 2834, 3041, 3077, 3220, 3426, 3591, 4318, 4604, 4658, 4684, 4777, 5020, 5283, 5498], 'Sakata': [465, 2666, 2836, 3043, 3593, 4660, 4779, 5285], 'Kakinuma': [467, 493, 601, 927, 2413, 2563, 2668, 2693, 2838, 3045, 3081, 3224, 3430, 3595, 3826, 4322, 4608, 4662, 4688, 4781, 5287, 5441, 5502], 'J.': [471, 500, 563, 608, 803, 809, 857, 862, 898, 1055, 1096, 1152, 1602, 2069, 2395, 2538, 2570, 2672, 2700, 2842, 3049, 3088, 3231, 3344, 3437, 3599, 3695, 4329, 4615, 4666, 4695, 4785, 4927, 4969, 5291, 5509, 5668, 5730], 'Biol.': [472, 564, 863, 900, 1603, 2070, 2396, 2673, 2843, 3050, 3345, 3600, 4667, 4786, 5292, 5669, 5731], 'Chem.': [473, 565, 864, 1604, 2071, 2397, 2674, 2844, 3051, 3346, 3601, 4668, 4787, 5293, 5670, 5732], '1999;': [474, 2675, 2845, 3052, 3602, 4529, 4669, 4788, 5294], '274:': [475, 2676, 2846, 3053, 3603, 4670, 4789, 5295], '3265-3267Abstract': [476, 2677, 2847, 3054, 3604, 4671, 4790, 5296], 'Full': [477, 479, 569, 571, 868, 870, 1608, 1610, 2075, 2401, 2678, 2680, 2848, 2850, 3055, 3057, 3350, 3605, 3607, 4672, 4674, 4791, 4793, 5297, 5299, 5674, 5676, 5736, 5738], 'Text': [478, 480, 570, 572, 869, 871, 1609, 1611, 2076, 2402, 2679, 2681, 2849, 2851, 3056, 3058, 3351, 3606, 3608, 4673, 4675, 4792, 4794, 5298, 5300, 5675, 5677, 5737, 5739], 'PDF': [481, 573, 872, 1612, 2077, 2403, 2682, 2852, 3059, 3352, 3609, 4676, 4795, 5301, 5678, 5740], '(87)': [484, 2685, 2855, 3062, 3612, 4679, 4798, 5304], 'Scholar,': [486, 3704, 4681, 4703], '4Tomitori': [487, 4682], 'Asakawa': [491, 599, 2561, 2691, 3079, 3222, 3428, 4320, 4606, 4686, 5500], 'T.': [492, 600, 924, 1094, 2390, 2562, 2692, 3080, 3223, 3339, 3429, 3823, 4321, 4607, 4687, 5438, 5501], 'Michael': [495, 603, 2565, 2695, 3083, 3226, 3432, 4324, 4610, 4690, 5504], 'A.J.': [496, 604, 2566, 2696, 3084, 3227, 3433, 4325, 4611, 4691, 5505], '2001;': [501, 609, 2571, 2701, 3089, 3232, 3438, 4330, 4616, 4696, 4720, 5051, 5510, 5650, 5775], '353:': [502, 610, 2572, 2702, 3090, 3233, 3439, 4331, 4617, 4697, 5511], '681-688Crossref': [503, 611, 2573, 2703, 3091, 3234, 3440, 4332, 4618, 4698, 5512], '(102)': [506, 614, 2576, 2706, 3094, 3237, 3443, 4335, 4621, 4701, 5515], 'According': [509], 'sequences,': [513], 'proteins': [516, 622, 721, 1586, 1883, 2626, 2796, 4431, 4629, 5717], 'family': [522, 4481], 'multidrug': [524, 542, 4479, 5715, 5805], 'transporters': [526, 581, 678, 743, 4298, 4403, 4581, 5180], 'within': [527], 'superfamily.': [531], 'identified': [534, 4385], 'sequence': [537, 591, 716, 1223, 1514], 'similarity': [538, 592, 717], 'theBacillus': [540], 'subtilis': [541], 'transporter': [543, 2661, 2871, 5615], 'Blt,': [544], 'which': [545, 910, 1171, 1401, 2890, 3266, 3286, 4185, 4383, 4743, 4845, 5316, 5370, 5412, 5541, 5562, 5711, 5803, 5827], 'excretion': [550, 5059, 5327], '(5Woolridge': [551, 5718], 'D.P.': [552, 5719], 'Vazquez-Laslop': [553, 5720], 'Markham': [555, 5722], 'P.N.': [556, 5723], 'Chevalier': [557, 5724], 'M.S.': [558, 5725], 'Gerner': [559, 5726], 'E.W.': [560, 5727], 'Neyfakh': [561, 5728], 'A.A.': [562, 5729], '1997;': [566, 1605, 5733], '272:': [567, 1606, 4721, 5651, 5734, 5776], '8864-8866Abstract': [568, 5735], '(83)': [576, 5743], 'other': [580, 3683, 4295, 5120, 5606], 'this': [583, 695, 1213, 1311, 1322, 2873, 3390, 3467, 3809, 3850, 3876, 4164, 4199, 4449, 4654, 4824, 4980, 5155], 'group': [584, 4655], 'were': [585, 687, 723, 830, 883, 993, 1123, 1297, 1469, 1555, 1620, 1649, 1685, 1730, 1777, 1808, 1826, 1842, 1860, 1884, 1929, 1955, 1995, 2016, 2026, 2083, 2114, 2140, 2170, 2191, 2216, 2324, 2354, 2382, 2434, 2458, 2491, 2503, 2581, 2601, 2738, 2917, 3197, 3324, 3329, 3381, 3490, 3725, 3745, 3880, 4042, 4201, 4229, 4582, 5133, 5542, 5549], 'basis': [589, 4019], '(4Tomitori': [595, 3075, 3218, 3424, 4316, 4602, 5496], 'Tpo': [621, 742], 'deduced': [624, 4641], 'from': [625, 1069, 1368, 1406, 1494, 1754, 1796, 2506, 2723, 3173, 3457, 3727, 3938, 4643, 4804], 'phenotype': [627, 2859, 5345], 'mutant': [629, 2825, 3773, 3971, 4039], 'strains.': [630, 3919], 'Their': [631], 'overexpression': [632], 'led': [633, 3244, 3287, 4085], 'increased': [636, 2820, 2950, 3248, 3572, 3864, 3936, 4809, 5399, 5488], 'tolerance': [637, 5280, 5378, 5400, 5423], 'added': [640, 1636, 3198, 3209], 'medium,': [644, 1962, 3955], 'whereas': [645, 3065], 'deletion': [648, 2897, 3028, 3460, 3529, 4056, 4110, 4239, 4502, 5189], 'rendered': [649], 'more': [652, 3903], 'sensitive': [653], 'Evidence': [656], 'participation': [659], 'uptake,': [663], 'however,': [664, 737, 3099, 4090, 5177], 'largely': [666], 'indirect.': [667], 'course': [670, 2608], 'project': [673], 'identify': [675, 2613], 'new': [676, 1359, 2614, 3564], 'belonging': [679], 'class': [682], 'secondary': [684, 1936], 'carriers,': [685], 'looking': [688], 'characterized': [692], 'use': [703, 2347], 'control': [706, 2909, 4158, 5044], 'localization': [708, 1582, 2621, 2711, 2990, 4444, 4625, 4638], 'assays.': [709], 'We': [710, 2877, 2939, 3097, 3276, 3523, 3767, 3961, 4338, 4728, 4859, 5173, 5253, 5831, 5868], 'chose': [711], 'because': [713, 2652, 3203, 3472, 5161, 5227], 'interested': [724], 'in,': [725], 'particular': [727, 3380], 'Ycr023p.': [729], 'analysis': [732, 5312, 5566], 'subcellular': [735, 2620, 4443, 4880], 'distribution,': [736], 'actually': [745], 'localized': [746, 4282], 'cytoplasmic': [749], 'membrane.': [750, 2800, 3635], 'This': [751, 796, 2858, 5234, 5518, 5598, 5614, 5807], 'observation': [752, 4770, 5535, 5599], 'encouraged': [753], 'us': [754], 'perform': [756], 'detailed': [758], 'study': [759, 1312, 4825], 'function.': [762], 'at': [768, 833, 1023, 1680, 1739, 1782, 1836, 1869, 1985, 1997, 2018, 2145, 2186, 2251, 2348, 2484, 2493, 2587], 'least': [769], 'participates': [771], 'export': [774, 944, 3661, 4148, 4196, 4227, 5086, 5139, 5171, 5185, 5361, 5472, 5539, 5575], 'haploid': [780], 'cerevisiaestrain': [782], '23344c': [783, 1265, 1450, 5840], '(MATα': [784], 'ura3)': [785], 'used': [787, 1115, 1211, 1307, 1320, 1930, 1950, 3330, 3389], 'genetic': [789], 'background': [790], 'experiments.': [795, 4254], 'strain': [797, 1264, 1449, 1495, 2888, 3029, 3108, 3461, 4057, 4111, 4200, 4831, 5168, 5190, 5358, 5403, 5495, 5839, 5848], 'isogenic': [799], 'Σ1278b': [801], '(6Béchet': [802], 'Greenson': [804], 'M.': [805, 897, 1160, 1382, 1914, 4512], 'Wiame': [806], 'J.M.': [807], 'Eur.': [808], '1970;': [811], '12:': [812], '31-39Crossref': [813], '(192)': [816], 'Scholar)': [818, 908, 979, 3355, 4800, 4936, 5782], 'kindly': [821], 'provided': [822, 1911, 1923], 'Bruno': [824, 1925, 5833], 'André': [825, 1324, 5834], '(Brussels,': [826, 1325], 'Belgium).': [827], 'grown': [831, 994, 1621, 1956, 2084, 2435, 2828, 3181, 3726], 'aerobically': [832], '30': [834, 1681, 1720, 1998, 2146, 2184, 2187, 2485], '°C.': [835, 1682, 2188, 2350], 'Preparation': [836], 'yeast-rich': [838], '(YPD)': [839], 'synthetic': [841, 1959, 3757], 'complete': [842, 1960], 'minimal': [843, 890, 1961], 'media': [844, 882], 'followed': [845, 1072, 1180, 1239, 5261], 'standard': [846], 'recipes': [847], '(7Dohmen': [848], 'R.J.': [849], 'Stappen': [850], 'R.': [851, 1601, 3692, 4924], 'McGrath': [852], 'J.P.': [853, 970], 'Forrova': [854], 'Kolarov': [856], 'Goffeau': [858, 4712, 5642, 5767], 'A.': [859, 861, 1154, 1411, 1597, 3694, 4514, 4713, 4926, 5643, 5768], 'Varshavsky': [860], '1995;': [865, 1393, 1573], '270:': [866], '18099-18109Abstract': [867], '(165)': [875], 'Growth': [878], 'assays': [879, 1994, 2353], 'solid': [881, 4018], 'performed': [884, 1143, 2383, 2552, 4633, 5543], 'using': [885, 1039, 1145, 1445, 1459, 1500, 1534, 1894, 2522, 3112, 4465], 'modified': [887, 954, 2059], 'citrate-buffered': [888], 'medium': [891, 956, 1004, 1627, 2087, 2440, 2463, 2508, 3202, 3675, 3744, 3759, 3892, 4853, 5556], '(8Jacobs': [892], 'P.': [893, 1052, 5048], 'Jauniaux': [894], 'J.C.': [895], 'Grenson': [896], 'Mol.': [899], '1980;': [901], '139:': [902], '691-704Crossref': [903], '(112)': [906], 'Mg2+': [912, 5545], 'limited': [915], '50': [917, 1019, 2090], 'μm': [918, 2337, 3114, 3119], 'enhance': [920, 3272], 'sensitivity': [922, 2822, 2921, 4180, 5525], '(9Maruyama': [923, 5437], '1994;': [934, 3833, 4971, 5448], '1194:': [935, 3834, 5449], '289-295Crossref': [936, 3835, 5450], '(30)': [939, 3717, 3838, 4952, 5453], 'For': [942, 1899], 'experiments': [945, 4070, 4095, 4645], 'preparation': [949, 2050, 3300], 'vesicles,': [952, 3285, 3387], 'CBS': [955, 1003, 2086, 2439, 3736, 3891], 'described': [957, 1084, 2604, 4262, 4296, 4550, 4600, 4913], 'Verduyn': [959], 'et': [960, 1087, 1562, 1594, 2359, 2387, 2414, 2530, 2556, 3422, 4773], 'al.': [961, 1088, 1563, 1595, 2360, 2388, 2531, 3423, 4774], '(10Verduyn': [962], 'C.': [963, 4518, 5661, 5665], 'Postma': [964], 'E.': [965, 1049, 1162, 1386, 4711, 5641, 5766], 'Scheffers': [966], 'W.A.': [967], 'Van': [968], 'Dijken': [969], 'Yeast.': [971, 1572, 4528], '8:': [973], '501-517Crossref': [974], '(1106)': [977], 'used,': [981], 'containing': [982, 1856, 1980, 2032, 2467, 4854], '20': [983, 999, 1241, 1695, 1974, 2010, 2336, 3118], 'g/liter': [984, 988, 2470], 'glucose': [985], '5': [987, 1820, 1857, 2163], 'NH4SO4.': [989], 'Uracil': [990], 'auxotrophic': [991], 'strains': [992, 1306, 1319, 3497, 3799, 4342, 4368, 4806], 'presence': [997, 2443, 3184, 3874, 3884, 5073, 5207, 5230], 'mg/liter': [1000], 'uracil.': [1001], 'buffered': [1006, 2088], 'either': [1008, 3621], '1%': [1009], 'succinic': [1010], 'adjusted': [1012, 2275], 'pH': [1014, 1024, 1673, 1699, 1764, 1815, 1978, 2093, 2122, 2166, 2206, 2297, 2331], '5.8': [1015], 'NaOH': [1017], 'mm': [1020, 1696, 1702, 1762, 1767, 1813, 1818, 1821, 1975, 2030, 2034, 2102, 2120, 2125, 2164, 2204, 2295, 2329, 2334, 2446, 3187, 3190, 3194, 3887], 'potassium': [1021], 'phthalate': [1022], '5.5': [1025], 'Replacement': [1026], 'gene': [1030, 1037, 1041, 1068, 1235, 1284, 1295, 1486, 2734, 2901, 3570, 4174, 4355, 4376], 'lacZ': [1032, 1067], 'done': [1034, 1996, 2055, 2355, 2602], 'via': [1035, 1443, 1489], 'PCR-based': [1036], 'targeting': [1038], 'disruption': [1042, 1121, 5167], 'cassette': [1043, 1122, 1195], 'encoded': [1044, 2882, 4173], 'plasmid': [1046, 1064, 1147, 1247, 1423, 2881, 2904, 4154, 4172, 4242], 'pUG6lacZ': [1047], '(11Boles': [1048], 'de': [1050], 'Jong-Gubbels': [1051], 'Pronk': [1053], 'J.T.': [1054], 'Bacteriol.': [1056, 3696, 4928], '1998;': [1057], '180:': [1058], '2875-2882Crossref': [1059], 'contains': [1065, 1424], 'Escherichia': [1070], 'coli,': [1071], 'dominant': [1075], 'kanMX': [1076, 1254, 1329, 1336, 1340, 1344, 1348, 1352], 'marker,': [1077], 'derivative': [1081, 1376], 'pUG6': [1083, 5860], 'Güldener': [1086], '(12Güldener': [1089], 'U.': [1090], 'Heck': [1091], 'Fielder': [1093], 'Beinhauer': [1095], 'Hegemann': [1097], 'J.H.': [1098], 'Nucleic': [1099], 'Acids': [1100], 'Res.': [1101, 1165, 5024, 5696, 5791], '1996;': [1102], '24:': [1103], '2519-2524Crossref': [1104], '(1372)': [1107], 'sequences': [1111, 1475], 'primers': [1114, 1210, 1467], 'amplification': [1118, 1508], '5′-TTTTTTTTAGTCAAAGAAGCAAGAGAAAACTAGACAGAGACAATGTTCGTACGCTGCAGGTCGAC': [1124], '5′-AAAAATGCAAATATAGAAAGAGCATGATTTCTGCTTTTCTTTTTCGCATAGGCCACTAGTGGATCTG.': [1126], 'Genomic': [1127], 'HA1': [1128], 'tagging': [1129, 2781], 'TPO': [1133, 4375], 'genes': [1134], 'open': [1138], 'reading': [1139], 'frame': [1140], 'YCR023c': [1141], 'pUG6-HA': [1148, 1246], '(13Buziol': [1149], 'Becker': [1151], 'Baumeister': [1153], 'Jung': [1155], 'Mauch': [1157], 'Reuss': [1159], 'Boles': [1161, 5857], 'FEMS': [1163], 'Yeast': [1164, 2579], '2002;': [1166, 5671, 5698, 5793], '2:': [1167], '283-291PubMed': [1168], 'Scholar),': [1170, 1400, 2406, 3064, 3445, 4954, 5058, 5455, 5657, 5683, 5705, 5800], 'encodes': [1172], 'tandem': [1174], 'repeats': [1175], 'HA': [1178, 2635, 2789, 2811, 2958], 'epitope': [1179, 1251, 2636], 'kanMX.': [1182], 'Via': [1183], 'PCR': [1184, 1209, 1261, 1444, 1466, 1490, 1527], 'DNA': [1186, 1447, 1493], 'molecule': [1187], 'generated,': [1189], 'consisting': [1190], '3xHA-kanMX': [1193], 'marker': [1194], 'flanked': [1196], 'short': [1198], 'regions': [1199], 'homologous': [1200, 1243, 1290], 'end': [1203], 'gene.': [1207, 1438, 5355], 'purpose': [1214], 'consisted': [1215], '45': [1217, 1678, 1867], 'nucleotides': [1218, 1242], 'corresponding': [1219], 'genomic': [1222, 1446, 1492], 'ultimately': [1224], 'upstream': [1225], 'downstream,': [1227], 'respectively,': [1228, 3180, 4041, 4351], 'stop': [1231, 1279], 'codon': [1232, 1280], 'tagged,': [1238], 'amplify': [1249], 'marker.': [1255], 'After': [1256, 2301, 3949], 'transformation': [1257], '1.7-kb': [1260], 'product': [1262], 'selection': [1267], 'G418': [1271], '(200': [1272], 'mg/l)': [1273], 'YPD': [1275, 1626], 'agar': [1276], 'plates,': [1277], 'usually': [1286], 'replaced': [1287, 2893], 'by3xHA-kanMX': [1288], 'through': [1289, 2022], 'recombination.': [1291], 'modifications': [1296], 'verified': [1298, 1550], 'diagnostic': [1300], 'PCR.': [1301], 'A': [1302, 1725, 2200, 2229, 2278, 2638, 3312, 3555], 'list': [1303], 'given': [1314], 'TableI.Table': [1316], 'IS.': [1317], 'studyStrainGenotypeSource23344cMATαura3Bruno': [1323], 'Belgium)WF': [1326], '7MATα': [1327], 'YCR023c-3xHA': [1328], 'ura3Wolf': [1330], 'Frommer': [1331, 1370, 1389, 5845], '(Tübingen,': [1332, 1371], 'Germany)RK': [1333], '25MATα': [1334], 'TPO1–3xHA': [1335, 1484, 2885], 'ura3This': [1337, 1341, 1345, 1349, 1353], 'workRK': [1338, 1342, 1346, 1350], '6MATαTPO2–3xHA': [1339], '13MATαTPO3–3xHA': [1343], '11MATαTPO4–3xHA': [1347], '26MATαtpo1::lacZ': [1351], 'work': [1354], 'Open': [1355, 3560], 'table': [1356, 3561], 'tab': [1360, 3565], 'expression': [1363, 2864, 3213, 3274, 4425, 5853], 'vector': [1364, 2936, 5854], 'pDR199': [1365, 1532], 'Wolf': [1369, 5844], 'Germany).': [1372], 'pDR195': [1378], '(14Rentsch': [1379], 'D.': [1380, 3686, 3688, 4516, 4918, 4920], 'Laloi': [1381], 'Rouhara': [1383], 'I.': [1384, 5693, 5788], 'Schmelzer': [1385], 'Delrot': [1387], 'W.B.': [1390], 'FEBS': [1391], 'Lett.': [1392], '370:': [1394], '264-268Crossref': [1395], '(279)': [1398], 'turn': [1403], 'YEplac195': [1407], '(15Gietz': [1408], 'R.D.': [1409, 1565], 'Sugino': [1410], 'Gene': [1412, 4718, 5648, 5773], '(Amst.).': [1413, 4719, 5649, 5774], '1988;': [1414], '74:': [1415], '527-534Crossref': [1416], '(2528)': [1419], 'copy': [1426, 5339], 'PMA1': [1429], 'promoter': [1430, 1456, 4161], 'terminator': [1433, 1458], 'region': [1434], 'ADH1': [1437, 1543], 'TPO1gene': [1440], 'amplified': [1442, 1488], 'template': [1452, 1499], 'cloned': [1454], 'between': [1455, 1540, 3106, 3966, 4104], 'anXmaI': [1460], 'XhoI': [1463, 1480, 1523, 1538], 'site.': [1464], 'forTPO1': [1468], '5′-GCGTCCCCGGGATGTCGGATCATTCTCCCATT': [1470], '5′-GCGTCCTCGAGTTAAGCGGCGTAAGCATACTT.': [1472], 'underlined': [1474], 'indicate': [1476, 4071], 'XmaI': [1478], 'sites,': [1481], 'respectively.': [1482], 'fusion': [1485, 2729, 2767, 2812, 2874, 2959], 'RK': [1496], '25': [1497, 3942], 'same': [1502, 1971, 1991, 2477, 2644, 3493, 4208, 4232, 4381, 4879], '5′': [1503], 'primer': [1504, 1518], 'unmodified': [1511], 'TPO1.': [1512], '3′': [1517], 'GCGTCCTCGAGTTAGGCGGCGTAGTCAGGAAC,': [1520], 'site': [1524, 1539], 'underlined.': [1525], 'fragment': [1528], 'inserted': [1530], 'theXmaI': [1535], 'PMA1promoter': [1541], 'terminator.': [1544], 'Accuracy': [1545], 'constructs': [1548], 'sequencing.': [1552], 'plasmids': [1554], 'transformed': [1556, 2879, 2932, 4163, 4221], 'according': [1559, 2356, 2384, 2527, 2553], 'Gietz': [1561], '(16Gietz': [1564], 'Schiestl': [1566], 'R.H.': [1567, 3706, 4941], 'Willems': [1568], 'A.R.': [1569], 'Woods': [1570], 'R.A.': [1571], '11:': [1574], '355-360Crossref': [1575], '(1712)': [1578], 'Subcellular': [1581], 'triple': [1584, 2634, 4455, 4538], 'determined': [1588, 2043, 2411, 2618, 2713, 3751, 4202], 'following': [1589, 2056], 'protocol': [1591, 2060, 3279], 'Sorin': [1593], '(17Sorin': [1596], 'Rosas': [1598], 'G.': [1599, 4510, 4523], 'Rajini': [1600], '9895-9901Abstract': [1607], '(219)': [1615], '600': [1623], 'ml': [1624, 1689, 1804, 2288], 'A600': [1629, 1986, 3728], '2–3.': [1631, 2111], 'NaN3': [1632], '(10': [1633, 1769], 'mm)': [1634], 'prior': [1637], 'harvesting,': [1639], 'culture': [1642], 'chilled': [1644], 'ice.': [1646], 'converted': [1650], 'spheroplasts': [1652, 1684, 2169, 2190], 'adding': [1654, 2003], 'lysing': [1655, 2175], 'enzymes': [1656, 2176, 3549], '(Sigma)': [1657, 2177], 'concentration': [1660, 2008, 2130, 4249], '1': [1662, 1701, 1766, 1803, 2033, 2101, 2256, 2307, 2469, 2591, 3189, 3193], 'mg/ml': [1663], 'S/K': [1665], 'buffer': [1666, 1692, 1853, 2199, 2247, 2277, 2290], '(1.2': [1667, 2160], 'm': [1668, 2161], 'sorbitol,': [1669, 2162], '100': [1670, 1812, 1876, 2012, 2029, 2119, 2208, 2299, 2328, 2333, 3113], 'mmpotassium': [1671, 2091], 'phosphate,': [1672], '7.5)': [1674], 'incubating': [1676], 'min': [1679, 1738, 1868, 2144, 2185], 'suspended': [1686, 2326], '4': [1688, 1740, 1837, 1870], 'lysis': [1691], '(0.3': [1693], 'msorbitol,': [1694], 'triethanolamine': [1697], 'acetate,': [1698], '7.2,': [1700, 1979], 'EDTA,': [1703, 1822], 'supplemented': [1704, 2096], 'commercially': [1707], 'available': [1708], 'protease': [1709, 2210], 'inhibitor': [1710, 3310], 'mixture': [1711], '(Complete,': [1712], 'EDTA-free;': [1713], 'Roche': [1714, 2213], 'Molecular': [1715, 1905, 2214], 'Biochemicals)': [1716, 2215], 'homogenized': [1718, 2222], 'strokes': [1721, 2225], 'Wheaton': [1724, 2228], 'Dounce': [1726, 2230], 'homogenizer.': [1727, 2231], 'Unlysed': [1728], 'removed': [1731], 'centrifugation': [1733, 2268, 2303, 2510, 2718, 4468], '(800': [1734], '×g': [1735, 2305], '3': [1737, 2515], '°C),': [1741], 'supernatant': [1744], 'layered': [1746], 'top': [1748, 1797, 2319], 'noncontinuous': [1751], 'ranging': [1753], '18': [1755], '54%': [1757], '(w/v)': [1758], '10': [1761, 1981, 2098, 2124, 2143, 2203, 2294, 2445, 3186, 3886], 'Hepes,': [1763], '7.1,': [1765], 'EDTA': [1768], 'steps': [1770], '4%': [1772], 'difference': [1773, 3101, 3965, 3993, 4023, 4103], 'each).': [1774, 1805], 'gradients': [1776], 'centrifuged': [1778, 1862, 2250], '2': [1780, 1834, 3586], 'h': [1781, 1835, 2257, 2308], '40,000': [1783], 'rpm': [1784], '(4': [1785], '°C)': [1786, 1871], 'Beckmann': [1789], 'SW41': [1790], 'Ti': [1791], 'rotor': [1792], 'fractionated': [1794, 4363], 'manually': [1795], 'bottom': [1799], '(12': [1800], 'fractions': [1801, 1807, 2737, 3552], 'Isolated': [1806], 'diluted': [1809], '(1:5)': [1810], 'Tris-Cl,': [1814], '7.5,': [1816], '150': [1817], 'NaCl,': [1819], 'membranes': [1825, 1893], 'pelleted': [1827], '(100,000': [1830], '×': [1831, 1864, 2180, 2253, 2512], 'g': [1832, 1865, 2133, 2153, 2254, 2513], '°C).': [1838], 'resulting': [1840, 2233, 2914, 4183], 'pellets': [1841, 2457], 'incubated': [1843, 2483, 2582], 'ice': [1845], '(30': [1846], 'min)': [1847], '400': [1849], 'μl': [1850, 1877], 'Tris': [1852], '(see': [1854, 2279], 'above)': [1855, 2280], 'murea.': [1858], 'They': [1859, 2323], 'again': [1861], '(17,000': [1863], 'finally': [1873, 2473], 'resuspended': [1874, 1984, 2117, 2150, 2197, 2474], 'SDS': [1879], 'sample': [1880], 'buffer.': [1881, 1992], 'separated': [1885, 2505, 2739], 'SDS-PAGE': [1887, 2741], '(12%)': [1888], 'electroblotted': [1890], 'onto': [1891], 'nitrocellulose': [1892, 2023], 'semidry': [1896], 'transfer': [1897, 5265], 'system.': [1898], 'immunodetection': [1900], 'monoclonal': [1902, 1908], 'anti-HA': [1903], '(Roche': [1904], 'Biochemicals),': [1906], 'anti-Vph1p': [1909, 5866], '(kindly': [1910, 1922], 'Patricia': [1913], 'Kane,': [1915], 'Syracuse,': [1916], 'NY),': [1917], 'polyclonal': [1920], 'anti-Pma1p': [1921], 'André,': [1926], 'Brussels,': [1927], 'Belgium)': [1928], 'first': [1932, 3009, 3667], 'antibody.': [1933], 'antibody': [1937], 'coupled': [1938], 'horseradish': [1940], 'peroxidase': [1941], 'enhanced': [1944, 5434], 'chemiluminescence': [1945], 'detection': [1946, 4428], 'system': [1947], '(Invitrogen)': [1948], 'visualization.': [1952], 'overnight': [1957, 2436], 'harvested': [1963, 2115, 2449], 'atA600': [1964, 2450], '=': [1965, 1987, 2451, 3729], '1.0,': [1966], 'washed': [1967, 2192, 2459], 'twice': [1968, 2193], 'volume': [1972, 2245], 'Na/Hepes': [1976], 'buffer,': [1977], 'mmglucose': [1982], '1.0': [1988], 'Transport': [1993], '°C': [1999, 2486, 2589], 'started': [2001], '[14C]spermine': [2004], 'final': [2007], 'μm.': [2013], '100-μl': [2014], 'aliquots': [2015, 2490], 'filtered': [2017], 'defined': [2019, 2494], 'time': [2020, 2495], 'points': [2021], 'filters': [2024, 2041], 'preincubated': [2027], 'LiCl': [2031], 'spermine.': [2035, 3195], 'radioactivity': [2037], 'trapped': [2038], 'scintillation': [2047], 'counter.': [2048], 'vesicles': [2053, 2313, 3172, 3328, 3455, 4802], 'slightly': [2058, 3449, 3481], 'Ohsumi': [2062, 2391, 3340], 'Anraku': [2064, 2067, 2393, 3342], '(18Ohsumi': [2065], 'Y': [2066], '1981;': [2072], '256:': [2073], '2079-2082Abstract': [2074], 'phthalate,': [2092], '5.5,': [2094], 'mmputrescine': [2099], 'each': [2104, 2931, 3483], 'anA600': [2109], 'Tris-sulfate,': [2121], '9.4,': [2123], 'dithiothreitol': [2126], 'yield': [2128], '0.5': [2132, 3730], 'cell': [2135, 2155, 2456, 2480, 3631, 3944], 'fresh': [2136, 2156], 'weight/ml.': [2137], 'shaken': [2141], '°C,': [2147], 'centrifuged,': [2148], '0.15': [2152], 'weight/ml': [2157], 'SOB': [2159, 2195], 'MES-Tris,': [2165, 2205, 2296, 2330], '6.9).': [2167], 'incubation': [2173, 3922, 4851], '(1': [2178], 'mg/5': [2179], '108': [2181], 'cells)': [2182], '(12%': [2201], 'Ficoll,': [2202, 2293], '6.9,': [2207, 2298, 2332], 'μmMgCl2),': [2209], 'inhibitors': [2211], '(Complete;': [2212], 'added,': [2217], 'suspension': [2220, 2234, 2481], 'seven': [2224], 'transferred': [2236, 2270], 'centrifuge': [2239], 'tube,': [2240, 2274], 'overlaid': [2241, 2285], 'half': [2243], 'A,': [2248], '60,000': [2252], '15': [2259, 2310, 4032], 'min.': [2260], 'white': [2262, 2316], 'floating': [2263], 'layer': [2264, 2317], 'appeared': [2266], 'after': [2267, 2412, 3166, 3790, 5264], 'ultracentrifuge': [2273], '6': [2282, 2287], 'ml,': [2283], 'B': [2291], '(8%': [2292], 'μmMgCl2).': [2300], 'further': [2302, 2346, 2803, 2969, 4895, 5808], '(60,000': [2304], 'min),': [2311, 2516], 'formed': [2314], 'solution.': [2322], 'aspirated,': [2325], 'KCl,': [2335], 'MgCl2,': [2338], 'frozen': [2339], 'under': [2340, 2829, 2907, 3852, 3893, 3972, 4157, 4842, 5201, 5426, 5544], 'nitrogen,': [2342], 'stored': [2344], '−80': [2349], 'enzyme': [2352], 'Roberts': [2358], '(19Roberts': [2361], 'C.J.': [2362], 'Raymond': [2363], 'C.K.': [2364], 'Yamashiro': [2365], 'C.T.': [2366], 'Stevens': [2367], 'T.H.': [2368], 'Methods': [2369], 'Enzymol.': [2370], '1991;': [2371], '194:': [2372], '644-661Crossref': [2373], '(287)': [2376], 'Phenylalanine': [2379], 'measurements': [2381, 3378], 'Sato': [2386], '(20Sato': [2389, 3338], '259:': [2399, 3348], '11505-11508Abstract': [2400, 3349], 'import': [2409, 3012, 3032, 3068, 3131, 3451, 3535, 4811], 'al.(2Kakinuma': [2415], 'succinate-buffered': [2438, 3735, 3890], '1.3–1.5': [2452], 'centrifugation.': [2454], 'times': [2461], 'without': [2464, 4240], 'but': [2466, 3779], 'only': [2468, 2733, 4354], 'NH4SO4': [2471], 'medium.': [2478, 3737, 5270], 'agitation,': [2488], 'taken': [2492], 'points.': [2496], 'To': [2497, 2801, 3856, 4015], 'analyze': [2498], 'efflux,': [2500], 'immediately': [2504], '(11,000': [2511], 'released': [2518, 3672], 'quantified': [2521], 'performance': [2524, 2598], 'Price': [2529], '(21Price': [2532], 'N.P.J.': [2533], 'Firmin': [2534], 'J.L.': [2535, 3708, 4709, 4943, 5639, 5764], 'Gray': [2536], 'D.O.': [2537], 'Chromatogr.': [2539], '598:': [2541], '51-57Crossref': [2542], '(36)': [2544], 'Extraction': [2547], 'total': [2549, 3924], 'Tomitori': [2555, 3421, 4772], 'al.(4Tomitori': [2557], '10%': [2584], 'trichloroacetic': [2585], '65': [2588], 'h.': [2592, 3792], 'Derivatization': [2593], 'quantification': [2595], 'above.': [2605], 'approach': [2611, 4450], 'various': [2623], 'putative': [2624, 3649], 'fused': [2630, 2900], 'C-terminally': [2631], 'tag.': [2637], 'version': [2639, 2752, 2868, 2883, 4457], 'tag': [2645, 2790], 'bona': [2649], 'fide': [2650], 'control,': [2651], 'considered': [2654], 'it': [2655, 2982, 5475], 'established': [2659], 'Scholar,4Tomitori': [2687], 'density': [2716, 4359], 'preparations': [2721, 3289, 3514, 4365], 'isolated': [2722, 3385], 'carrying': [2726], 'construct': [2730, 4165, 5388], 'copy.': [2735, 4356], 'Defined': [2736], 'subsequently': [2743], 'analyzed': [2744, 3647, 4420], 'immunoblotting': [2746], '(Fig.': [2747, 2937, 3115, 3498, 3585, 3788, 3947, 3989, 4067, 4391, 5368, 5389], '1).': [2748, 4395], 'Although': [2749, 3811, 5034, 5131], '3xHA-tagged': [2751, 4344], 'Ycr023p': [2754, 4459, 4473], 'co-localized': [2755, 2768, 4460, 4556], '100-kDa': [2758], 'subunit': [2759], 'ATPase': [2763, 2773, 3295], '(Vph1p),': [2764], 'Tpo1p-3xHA': [2766], '(Pma1p),': [2774], 'thus': [2775, 2878, 3400, 3524, 3914, 4589, 4860, 5307, 5456, 5576], 'raising': [2776], 'question': [2778, 4289], 'whether': [2780, 3010, 3668, 4303, 4579, 5110, 5123], 'leads': [2784, 2818, 2947, 5432, 5486], 'mislocalization,': [2786], 'although': [2787, 3476, 4990], 'not': [2792, 3127, 3414, 3749, 3780, 3806, 3846, 3915, 3998, 4098, 4590, 4631, 4760, 5088, 5152, 5274, 5550], 'known': [2793, 3658], 'direct': [2795, 5349], 'get': [2802, 2968], 'evidence': [2804, 2970, 4731], 'tested': [2806, 2918, 3008], 'functionality': [2808, 2955, 5385], 'Tpo1p.': [2814, 3143, 3654, 5613], 'Disruption': [2815], 'when': [2827, 3515, 5001, 5382, 5467], 'Mg2+-limiting': [2830], 'conditions': [2831, 4843, 5202, 5420], 'should': [2860, 2983, 3267, 4140], 'rescued': [2862, 5357], 'HA-modified': [2867], 'if': [2872], 'functional.': [2876], 'TPO1had': [2891], 'lacZ-kanMX': [2896], 'cassette.': [2898], 'expressed': [2906], 'thePMA1': [2911, 4160], 'promoter.': [2912], 'comparison': [2923], 'thetpo1::lacZ': [2929, 3107, 3978, 4167, 5402], 'strain,': [2930], 'empty': [2935, 4224], '2).': [2938, 5390], 'synthesis': [2942], 'markedly': [2949, 3247], 'tolerance.': [2952], 'could': [2962, 3748, 4045, 4827, 5235, 5332], 'demonstrated,': [2964], 'tried': [2966, 3156], 'Tpo1': [2973], 'being': [2975, 4648], 'located': [2976, 4309], 'membrane,': [2980, 4742], 'where': [2981, 3896], 'contribute': [2984, 5276], 'transport.': [2987], 'contradictory': [2998], 'proposed': [3001], 'transport,': [3006], 'influenced': [3016], 'deletion.': [3019, 5323], 'An': [3020, 4396], 'earlier': [3021], 'report': [3022, 3419], 'had': [3023, 3214, 3530, 4598, 4630, 4639, 4911, 5009, 5087, 5112, 5169], 'indicated': [3024], 'shows': [3030, 4835], 'rates': [3033, 3488, 3996, 4030, 4066, 4197, 4228, 5362], 'similar': [3034, 3509, 5118], 'decreased': [3067, 3450, 3982, 4190], 'rate': [3069, 3398, 4052], 'inTPO1': [3070], 'deletions': [3071], 'reported': [3073, 3216, 3447, 3681, 5618], 'later': [3074], 'found,': [3098], 'no': [3100, 3531], 'uptake': [3104, 3165, 3334, 3377, 3397, 3487, 4763, 5243, 5436], '3)': [3116], '(not': [3121, 3313, 4118, 4191, 4243], 'shown),': [3122, 3314], 'suggesting': [3123, 3802, 5706], 'and/or': [3135, 5245], 'Tpo2p-Tpo4': [3137], 'may': [3138, 5181, 5225], 'complement': [3139, 4260], 'view': [3145], 'several': [3147], 'reports': [3148], 'describing': [3149], 'importer,': [3154], 'account': [3158, 5066], 'impairment': [3161, 4123], 'TPO1deletion.': [3167], 'Consequently,': [3168], 'prepared': [3170, 3456, 4803], 'tpo1::lacZ': [3178, 3723], 'mutants,': [3179], 'stimulatory': [3205], 'impact': [3206], 'externally': [3208], 'recently': [3217, 5749], 'concentrations': [3242, 3911], 'employed': [3243, 3415], 'level': [3251], '(about': [3252], '4-fold': [3253, 5463], 'case': [3256], 'spermine,': [3260], 'about': [3262, 3659, 3939], '2-fold': [3263], 'spermidine),': [3265], 'enough': [3270], 'ofTPO1.': [3275], 'optimized': [3277], 'isolation': [3282], 'purity': [3292], '(TableII).': [3293], 'vesicle': [3299, 3408], 'completely': [3302, 5557], 'inhibited': [3303], 'addition': [3306], 'V-ATPase-specific': [3309], 'concanamycin': [3311], 'proving': [3315, 5342], 'significant': [3317, 3964, 4102, 4837, 5137, 5159, 5330], 'contaminations': [3318], 'mitochondria': [3323], 'absent.': [3326], 'determine': [3332], 'amino': [3336], 'acids': [3337], 'phenylalanine': [3376], 'highly': [3382, 4189], 'reproducible': [3383], 'normalize': [3394], 'eliminate': [3402], 'possible': [3403, 5078], 'variations': [3404], 'caused': [3405], 'preparation,': [3409, 3484], 'strategy': [3411], 'original': [3418], 'who': [3446], 'type.': [3465], 'But': [3466], 'correction': [3468], 'might': [3469, 3670, 4569, 5125, 5519], 'crucial,': [3471], 'absolute': [3478], 'values': [3479, 4205], 'varied': [3480], 'relative': [3486], 'measured': [3489], 'essentially': [3491], 'two': [3496, 3512, 3798], '4).': [3499], 'Furthermore,': [3500, 5474, 5746], 'maximal': [3502], 'amount': [3503], 'accumulated': [3505, 3521, 3957, 4247], 'very': [3508], 'vesicular': [3513], 'normalized': [3516], 'maximum': [3519], 'phenylalanine.': [3522], 'conclude': [3525, 4861], 'effect': [3532], 'vesicles.Table': [3538], 'IIPurity': [3539], 'vesiclesMarker': [3542], 'enzymeEnrichmentYield%Vacuolar': [3543], 'markers': [3544], 'Dipeptidyl': [3545, 3553], 'aminopeptidase': [3546, 3554], 'B47-fold10': [3547], 'α-Mannosidase45-fold10Marker': [3548], 'contaminating': [3551], '(Golgi)11-fold2.3': [3556], 'Cytochromec': [3557], 'oxidase': [3558], '(mitochondria)3-fold0.7': [3559], 'absence': [3567], 'theTPO1': [3569, 4109], 'causes': [3571], 'sensitivity,': [3574], 'indicating': [3575], 'Ref.': [3588], '3Tomitori': [3589], 'Detoxification': [3615], 'general': [3617, 4568], 'can': [3618, 4009, 5082], 'mediated': [3620, 3652], 'presented': [3638, 5583], 'so': [3639, 4554, 4634, 4883, 5006, 5584], 'far': [3640, 4555, 4884, 5585], 'favor': [3641, 5586], 'latter': [3643, 5393], 'possibility.': [3644], 'Thus,': [3645], 'efflux': [3651, 3976, 3995, 4029, 4051, 4116, 4126, 5263], 'little': [3656], 'budding': [3663], 'yeast,': [3664, 4184], 'investigated': [3666], 'growth,': [3677], 'has': [3679, 4432, 4497, 5216, 5476, 5616], 'microorganisms': [3684, 5121], '(22Schiller': [3685, 4917], 'Kruse': [3687, 4919], 'Kneifel': [3689, 4921], 'Kramer': [3691, 4923], 'Burkovski': [3693, 4925], '2000;': [3697, 4929, 5026], '182:': [3698, 4930], '6247-6249Crossref': [3699, 4931], '(42)': [3702, 4934], '23Davis': [3705], 'Ristow': [3707, 4942], 'Arch.': [3709, 4944], '1989;': [3712, 4947], '271:': [3713, 4948, 5027], '315-322Crossref': [3714, 4949], 'Wild': [3720], 'stationary': [3732], 'phase': [3733, 3935], 'Putrescine': [3738, 5085], 'excreted': [3741], 'quantified.': [3746], 'Spermine': [3747], 'contaminant': [3754], 'interfered': [3761, 5563], 'quantitative': [3764], 'HPLC': [3765, 5878], 'analysis.': [3766, 5879], 'fact': [3776, 4188, 4278, 4564, 4584, 4988, 5319], 'excrete': [3777], 'until': [3782], 'reach': [3784], 'diauxic': [3786], 'shift': [3787], '5)': [3789], '∼24': [3791], 'release': [3795, 3848], 'indistinguishable,': [3801], 'process.': [3810, 5130], 'most': [3815, 4483, 4814, 4983, 5414], 'abundant': [3816], '(Ref.': [3821], '9Maruyama': [3822], 'Scholar;': [3840], 'see': [3841], 'Fig.6B),': [3843], 'did': [3845, 4097], 'observe': [3847, 4099], 'solute': [3851], 'normal': [3853], 'conditions.': [3855, 3974], 'challenge': [3857], 'export,': [3862, 5106, 5315], 'growing': [3870], 'compound.': [3877], 'cultured': [3881, 4959], 'nonlimiting': [3894], 'Mg2+-conditions,': [3895], 'both': [3897, 3918, 4253, 5801], 'mutants': [3901], 'tolerant': [3904], 'stress,': [3907], 'applied': [3912], 'During': [3920], 'logarithmic': [3933], 'significantly': [3937, 3981, 5277], '8': [3940], 'nmol/mg': [3943], 'dry': [3945], 'mass': [3946], '6B).': [3948], 'washing': [3950], 'resuspending': [3952], 'polyamine-free': [3954, 5269], 'released.': [3960], 'tpo1deletion': [3970], 'Spermidine': [3975, 5422], '6A).': [3990], 'observed': [3992, 4022, 4122, 4211, 4235, 5346, 5397, 5466, 5526], 'due': [3999, 4816, 5416], 'different': [4002], 'preloading': [4003], 'seen': [4011], 'Fig.': [4013, 4394], '6B.': [4014], 'provide': [4016, 4729, 5553], 'excretion,': [4026], 'initial': [4028, 4194], 'independent': [4033], 'cultures': [4034], 'determined.': [4043], 'drops': [4058], '49': [4060], '±': [4061], '28%': [4062], '6C).': [4068], 'These': [4069], 'detoxification.': [4078], 'Preloading': [4079], 'unfortunately': [4084], 'widely': [4087], 'varying': [4088], 'results;': [4089], 'series': [4093], 'statistically': [4101], 'terms': [4113], 'shown).': [4119, 4192, 4244], 'If': [4120], 'indeed': [4128], 'consequence': [4130, 5350], 'deletion,': [4134], 'introduction': [4136], 'plasmid-borne': [4138], 'lead': [4141], 'increase': [4144, 5464], 'rate.': [4149], 'Therefore,': [4150], 'constructed': [4152], 'expressing': [4155], 'Expression': [4169], 'controlled': [4176], 'analyzing': [4178], 'gave': [4204], 'range': [4209, 4233], '(Fig.6C).': [4216], 'tpo1::lacZstrain': [4219], 'vector,': [4225], 'any': [4241], 'initially': [4246], 'unchanged': [4251], 'phenotype,': [4263], 'consider': [4265], 'exporter': [4272], 'export.': [4276], 'raises': [4287], 'location': [4292, 4881], 'cerevisiae,': [4301], 'i.e.': [4302], 'Tpo2p,': [4304, 4873], 'Tpo3p,': [4305, 4874], 'Tpo4p': [4307, 4876], 'therefore': [4339, 5108, 5254], 'bearing': [4343], 'versions': [4345, 4540], 'TPO2,': [4347], 'TPO3,': [4348], 'TPO4,': [4350], 'centrifugation,': [4361], 'products': [4377], 'localize': [4378], 'fraction,': [4382], 'fraction': [4389], 'before': [4390, 4601], '7;': [4392], 'compare': [4393], 'involvement': [4397], 'solutes': [4408], 'seems': [4413], 'likely': [4416], 'will': [4418], 'future.': [4423], 'subsequent': [4427], 'epitope-tagged': [4430], 'turned': [4433], 'powerful': [4438], 'method': [4439], 'unraveling': [4441], 'proteins.': [4446], 'By': [4447], 'applying': [4448], 'ATPase,': [4464], 'analytical': [4471], 'method.': [4472], 'member': [4476], 'probably': [4484, 4815, 4984, 5415], 'functions': [4485], 'hazardous': [4490, 5825], 'lumen.': [4495], 'confers': [4503], 'allylglycine': [4506], '(25Bianchi': [4507], 'M.M.': [4508], 'Sartori': [4509], 'Vandenbol': [4511], 'Kaniak': [4513], 'Ucceletti': [4515], 'Mazzoni': [4517], 'Di': [4519], 'Rago': [4520], 'J.-P.': [4521], 'Carignani': [4522], 'Slonimski': [4524], 'P.R.': [4525], 'Frontali': [4526], 'L.': [4527, 4966], '15:': [4530], '513-526Crossref': [4531], 'Unexpectedly,': [4537], 'Tpo1p-4p,': [4546], 'ATPase.': [4561], 'Despite': [4562], 'tags': [4566], 'cause': [4570], 'mislocalization': [4571, 4818], 'decided': [4575], 'carefully': [4577], 're-evaluate': [4578], 'bound': [4587], 'Direct': [4624], 'studies': [4626], 'far;': [4635], 'indirectly': [4642], 'physiological': [4644, 4996], 'best': [4650], 'studied': [4651, 5090], '24do': [4704], 'Valle': [4705, 5635, 5760], 'Matta': [4706, 5636, 5761], 'M.A.': [4707, 5637, 5762], 'Jonniaux': [4708, 5638, 5763], 'Balzi': [4710, 5640, 5765], 'van': [4714, 5644, 5769], 'den': [4715, 5645, 5770], 'Hazel': [4716, 5646, 5771], 'B.': [4717, 5647, 5663, 5667, 5772], '111-119Crossref': [4722, 5652, 5777], '(44)': [4725, 5655, 5780], 'experimental': [4730, 4896, 5419], 'role': [4734], 'based': [4745, 4886], 'observations': [4748], 'aTPO1': [4757], 'impaired': [4761], 'vesicles.': [4768], 'TPO1-overexpressing': [4805], 'show': [4807, 4828], 'overproduced': [4821], 'protein.': [4822, 4869], 'deleted': [4832], 'defect': [4838], 'secretion': [4841], 'challenged': [4849], 'levels': [4856, 5046, 5210, 5223, 5460], 'membrane-embedded': [4867], 'arguments': [4871], 'exclusively': [4885], 'fractionation': [4892], 'need': [4894], 'proof.': [4897], 'Export': [4898], 'polyamines,': [4900, 5212], 'especially': [4901], 'key': [4906], 'metabolite': [4907], 'biosynthesis,': [4910], 'some': [4915], 'organisms': [4939], '(23Davis': [4940], 'mammalian': [4960], '(26Tjandrawinata': [4962], 'R.R.': [4963], 'Hawel': [4964], 'III,': [4965], 'Byus': [4967], 'C.V.': [4968], 'Immunol.': [4970], '152:': [4972], '3039-3052PubMed': [4973], 'biological': [4977], 'significance': [4978], 'process': [4981, 5156], 'related': [4985], 'pivotal': [4993], 'many': [4995], 'processes,': [4997], 'present': [5002], 'levels,': [5005], 'develop': [5011], 'mechanisms': [5012, 5114], 'pools': [5017], '(27Igarashi': [5018], 'Commun.': [5025, 5697, 5792], '559-564Crossref': [5028], '(737)': [5031], 'regulation': [5036], 'certainly': [5040], 'possibility': [5042], 'nontoxic': [5045], '(28Coffino': [5047], 'Biochimie': [5049], '(Paris).': [5050], '83:': [5052], '319-323Crossref': [5053], '(69)': [5056], 'provides': [5060], 'additional': [5062], 'rationale.': [5063], 'Taking': [5064], 're-uptake': [5068], 'guaranteed': [5070], 'importer': [5075], 'systems,': [5076], 'loss': [5079], 'precursors': [5081], 'avoided.': [5084], 'detail': [5092], 'inS.': [5093], 'before.': [5095], 'trying': [5097], 'establish': [5099], 'asked': [5109], 'developed': [5113], 'homoeostasis': [5117], 'able': [5134, 5551], 'detect': [5136], 'which,': [5140], 'interestingly,': [5141], 'restricted': [5143], 'phase,': [5148], 'obviously': [5151], 'extent,': [5160], 'equal': [5170], 'activity.': [5172], 'cannot': [5174], 'rule': [5175], 'out,': [5176], 'redundant': [5179], 'adjust': [5182], 'activities': [5186], 'compensate': [5192], 'missing': [5195, 5353], 'TPO1function.': [5196], 'stressed': [5200], 'exist': [5218], 'overcome': [5220], 'arise': [5226], 'importers.': [5233], 'principle': [5237], 'achieved': [5239], 'regulating': [5241], 'exporters': [5249], 'solutes.': [5252], 'preloaded': [5255], 'Scholar);': [5306], 'concentrated': [5309], 'affected': [5320], 'decrease': [5325], 'reverted': [5334], 'introducing': [5336], 'plasmid-encoded': [5338], 'TPO1,': [5341], 'showed': [5359], 'comparable': [5363], '6C),': [5369], 'reason': [5374], 'testing': [5383], 'theTPO1–3xHA': [5387], 'experiment': [5394], 'even': [5396, 5492], 'containingTPO1–3xHA': [5404], 'plasmid,': [5407], 'type,': [5411], 'applied.': [5421], 'assayed': [5425], 'magnesium': [5427], 'limitation,': [5428], 'condition': [5430], 'generating': [5457], 'than': [5461], 'challenging': [5468], 'measurements.': [5473], 'stress': [5481], 'combination': [5483], 'Mg2+limitation': [5485], 'mRNA': [5490], 'abundance,': [5491], 'aTPO1-overexpressing': [5494], 'explain': [5520], 'overcompensation': [5522], 'plate': [5529], 'assay': [5530], 'contrast': [5532], 'our': [5534], 'measurements,': [5540], 'excess.': [5546], 'Unfortunately,': [5547], 'appropriate': [5554], 'devoid': [5558], 'contaminant,': [5561], 'HPLC.': [5568], 'contribution': [5570], 'remains': [5577], 'unsettled': [5579], 'question.': [5580], 'data': [5582], 'levels.': [5597], 'interesting': [5601], 'context': [5604], 'recent': [5607], 'publications': [5608], 'properties': [5611], 'variety': [5624], 'structurally': [5626], 'nonrelated': [5627], 'like': [5630], 'quinidine': [5631], 'cycloheximide': [5633], '(24do': [5634, 5759], 'mycophenolic': [5658], '(29Desmoucelles': [5660], 'Pinson': [5662], 'Saint-Marc': [5664], 'Daignan-Fornier': [5666], '277:': [5672], '27036-27044Abstract': [5673], '(79)': [5681], '2-methyl-4-chlorophenoxyacetic': [5685], '2,4-dichlorophenoxyacetic': [5688], '(30Teixeira': [5690, 5785], 'M.C.': [5691, 5786], 'Sa-Correia': [5692, 5787], '292:': [5699, 5794], '530-537Crossref': [5700, 5795], '(60)': [5703, 5798], 'broad': [5708], 'specificity,': [5710], 'characteristic': [5713], 'target': [5754], 'regulators': [5757], 'Pdr1p': [5758], 'Pdr3p': [5784], 'mediate': [5804], 'resistance.': [5806], 'emphasizes': [5809], 'concept': [5811], 'primary': [5814], 'compounds,': [5826], 'includes': [5828], 'spermidine.': [5830], 'thank': [5832], 'anti-Pma1p-antiserum,': [5843], 'WF': [5849], '7': [5850], 'pDR199,': [5855], 'Eckhard': [5856], 'derivatives,': [5861], 'Patty': [5863], 'Kane': [5864], 'antibodies.': [5867], 'indebted': [5870], 'Rolf': [5872], 'Hecker': [5873], 'help': [5875], 'establishing': [5876]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2047065718', 'counts_by_year': [{'year': 2024, 'cited_by_count': 4}, {'year': 2023, 'cited_by_count': 2}, {'year': 2022, 'cited_by_count': 1}, {'year': 2021, 'cited_by_count': 3}, {'year': 2020, 'cited_by_count': 3}, {'year': 2019, 'cited_by_count': 3}, {'year': 2018, 'cited_by_count': 1}, {'year': 2017, 'cited_by_count': 5}, {'year': 2015, 'cited_by_count': 5}, {'year': 2014, 'cited_by_count': 3}, {'year': 2013, 'cited_by_count': 2}, {'year': 2012, 'cited_by_count': 2}], 'updated_date': '2025-01-10T13:29:23.218131', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
